CN106497966A - The purposes of insecticidal proteins - Google Patents

Abstract

The present invention relates to a kind of purposes of insecticidal proteins, the method for the control Lloyd's armyworm insect includes：Lloyd's armyworm insect is at least contacted with Cry1A albumen.The present invention controls Lloyd's armyworm insect by producing the Cry1A albumen that can kill Lloyd's armyworm in plant body；With prior art using cultural control method, compared with chemical prevention and control method and physical control method; the present invention carries out the protection of the time of infertility, whole plant preventing and treating the infringement of Lloyd's armyworm insect to plant; and pollution-free, noresidue, effect stability, thoroughly is simple, convenient, economical.

Description

The purposes of insecticidal proteins

Technical field

The present invention relates to a kind of purposes of insecticidal proteins, more particularly to a kind of Cry1A protein is by table in plant Reach.

Background technology

Lloyd's armyworm (Mythimna seperata) belongs to Lepidoptera Noctuidae, category omnivorousness, animal migration, interval fulminant Insect, mainly with corn, wheat, Chinese sorghum, millet, paddy rice, Soybean and Other Crops as food.China Henan, Shandong, Jiangsu, Anhui, The distribution of Hunan, Hubei and Guangdong and Guangxi Provinces area.There is 3-4 generations, winter generation adult April within 1 year in Henan, Shandong District Lloyd's armyworm Beginning the first tenday period of a month in the middle ten days to May sees, terminates to October early and middle ten dayses.Main harm spring maize.

Corn is the important cereal crops of China, and with the reinforcement of Global Greenhouse Effect, nearly 2 years temperature constantly rise, worm Evil species survey and quantity all increase, and as spring maize cultivated area is little, and seedling age is little, are therefore more collected by larva harm In, aggrieved serious.2nd generation larva main harm summer corn, harm Sheng phase, in July early and middle ten dayses, take food the heart first after larvae hatch Leaf, eats into skylight or hole, then takes food blade, blade is eaten into and is incised, and only remains vein when serious.The harm of 3rd generation larva is contained Phase, in mid or late August, is to endanger a most heavy generation to summer corn.4th generation larva occurs in September part, and now summer corn is successively Maturation is simultaneously gradually harvested, and larva main harm evening broadcasts field and the plant that reseeds.

Corn is the important cereal crops of China, and as weather is changeable in recent years, especially some areas dry areas are being just Expanding, result in Lloyd's armyworm and spread out of in the message of Henan and Shandong one with constantly there is outburst and (be different from east armyworm happiness Hot and humid environment).In order to prevent and treat Lloyd's armyworm, the main prevention and controls that people generally adopt have：Cultural control, chemical prevention And physical control.

Cultural control be multifactorial for whole farmland ecosystem comprehensive coordination manage, regulation and control crop, insect, environment because Element, creation one are conducive to plant growth and are unfavorable for the farmland ecological environment that Lloyd's armyworm occurs.Such as is contained in Adult worms producting eggs the phase The front straw 8-10 roots for selecting blade completely, not go rotten are bundled into tate, and every mu of 30-50 handle was changed once every 5-7 days (if grass Through with medicament immersion can reduce change a number of times), field insect density can be substantially reduced；Can also tend ducks between Larvae occurrence time and peck Food.Because cultural control must obey the requirement of crop allocation and volume increase, application has certain limitation, it is impossible to arrange as emergent Apply, just seem helpless when Lloyd's armyworm is broken out.

Chemical prevention is pesticide control, is to kill insect using chemical insecticide, is the weight of Lloyd's's armyworm comprehensive regulation Part is wanted, the characteristics of it has quick, convenient, easy and high economic benefit, the particularly situation of the big generation of Lloyd's armyworm Under, it is requisite emergency measure.Chemical prevention and control method is mainly medicine liquid spray at present, such as 4.5% effective cypermethrin, 2.5% decis, 48% Le Siben etc. respectively with 1000 times of liquid and the whole strain spraying of 1500 times of liquid, with can obtain preferably Prevention effect.But chemical prevention also has its limitation, such as improper use frequently can lead to crops occur poisoning, insect produce anti- The property of medicine, and natural enemy, pollution environment is killed, make farmland ecosystem suffer that destruction and residues of pesticides are constituted to the safety of people, animal The adverse consequences such as threat.

Physical control reaction mainly according to insect to various physical factors in environmental condition, using various physical factors such as The methods such as light, electricity, color, humiture etc. and plant equipment carry out trapping and killing, steriliation by irradiation carry out pest control.Most widely used at present Be frequency ventilating type insecticidal lamp trapping, it is closely used up using the phototaxis of adult pest, at a distance with ripple, lures insect to lean on Closely, the prevention effect to Lloyd's armyworm adult is very good；But frequency ventilating type insecticidal lamp is needed daily on cleaning high-voltage fence in time Dirt, can otherwise affect insecticidal effect；And can not turn on light in thundery sky, the danger that hurts sb.'s feelings of operationally also shocking by electricity；This The outer disposably input for installing lamp is larger.

In order to solve cultural control, chemical prevention and physical control limitation in actual applications, scientists are passed through Research finds to proceed to the anti insect gene of encoding insecticidal proteins in plant, can obtain some insect-resistant transgenic plants to prevent and treat plant Insect pest.Cry1A insecticidal proteins are the one kind in numerous insecticidal proteins, are by bacillus thuringiensis storehouse Stuckey subspecies It is insoluble with spore crystalline protein that (Bacillus thuringiensis subsp.kurstaki, B.t.k.) is produced.

Cry1A albumen is uptaked into middle intestines by insect, and toxalbumin parent toxin is dissolved in the alkaline pH environment of insect midgut Under.Parent toxin is transformed into active fragment by basic protein enzymic digestion by albumen N- and C- ends；On active fragment and insect midgut Receptor binding on chrotoplast film upper surface, inserts goldbeater's skin, causes cell membrane perforation focus, the infiltration destroyed inside and outside cell membrane occur Buckling and pH balances etc., upset the digestion process of insect, ultimately result in which dead.

The plant for being proved to turn Cry1A genes can resist the Lepidopteras such as bollworm, Spodopterafrugiperda (Lepidoptera) The infringement of insect, however, there is no with regard to controlling Lloyd's armyworm pair by producing the transfer-gen plant for expressing Cry1A albumen so far The report of plant hazard.

Content of the invention

It is an object of the invention to provide a kind of purposes of insecticidal proteins, is provided first by producing expression Cry1A albumen Transfer-gen plant controlling method of the Lloyd's armyworm to plant hazard, and effectively overcome prior art cultural control, chemistry anti- Control and the technological deficiencies such as physical control.

For achieving the above object, the invention provides a kind of method of control Lloyd's armyworm insect, including by Lloyd's armyworm Insect is at least contacted with Cry1A albumen.

Further, the Cry1A albumen is present in the host cell at least producing the Cry1A albumen, the labor Family name armyworm insect is at least contacted with the Cry1A albumen by the host cell of ingesting.

Further, the Cry1A albumen is present in the bacterium or genetically modified plants at least producing the Cry1A albumen In, the Lloyd's armyworm insect by the tissue of the ingest bacterium or the genetically modified plants at least with the Cry1A albumen Contact, the Lloyd's armyworm insect growth after contact are suppressed and/or cause death, to realize endangering plant to Lloyd's armyworm Control.

The genetically modified plants may be at any breeding time.

The genetically modified plants are organized as blade, stalk, fruit, tassel, female fringe, flower pesticide or filigree.

The control for endangering plant to Lloyd's armyworm does not change because planting the change in place and/or implantation time.

The plant is corn, wheat, Chinese sorghum, millet, paddy rice, soybean.

The step of before the contact procedure is the plant of polynucleotides of the plantation containing the coding Cry1A albumen.

On the basis of above-mentioned technical proposal, the Cry1A albumen be Cry1Ab albumen, Cry1A.105 albumen or Cry1Ac albumen.

Preferably, the Cry1A protein amino acid sequences have SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3 Or SEQ ID NO:Amino acid sequence shown in 4.

On the basis of above-mentioned technical proposal, the plant also includes at least one different from the coding Cry1A albumen Nucleotides second nucleotides.

Further, second nucleotide coding Cry class insect-killing proteins, Vip class insect-killing proteins, protease suppression Preparation, agglutinin, AMS or peroxidase.

Preferably, second nucleotide coding Vip3Aa albumen or Cry2Ab albumen.

Further, second nucleotides has SEQ ID NO:9 or SEQ ID NO:Nucleotides shown in 10 Sequence.

Selectively, second nucleotides is the dsRNA for suppressing important gene in target insect pests.

For achieving the above object, present invention also offers a kind of Cry1A protein controls the purposes of Lloyd's armyworm insect.

For achieving the above object, present invention also offers a kind of method of the plant for producing control Lloyd's armyworm insect, bag The polynucleotide sequence of coding Cry1A albumen is introduced in including to the genome of the plant.

For achieving the above object, present invention also offers a kind of side of the vegetable seeds for producing control Lloyd's armyworm insect Method, the first plant and the second plant including will be obtained by methods described hybridize, so as to produce containing many of coding Cry1A albumen The seed of nucleotide sequence

For achieving the above object, present invention also offers a kind of method of the plant of culture control Lloyd's armyworm insect, bag Include：

At least one vegetable seeds of plantation, the genome of the vegetable seeds include many nucleosides for encoding Cry1A albumen Acid sequence；

The vegetable seeds is made to grow up to plant；

Make the plant artificial infection Lloyd's armyworm insect and/or the naturally-occurring of Lloyd's armyworm insect harm under conditions of Growth, with the plant injury for weakening compared with the plant that results do not have the polynucleotide sequence for encoding Cry1A albumen with other And/or the plant with increased plant products.

Heretofore described " contact ", refers to insect and/or insect touching, stops and/or feeding plant, plant device Official, plant tissue or plant cell, the plant, plant organ, plant tissue or plant cell can both be which is expressed in vivo Insecticidal proteins, can also be the surface of the plant, plant organ, plant tissue or plant cell have insecticidal proteins and/or There is the microorganism for producing insecticidal proteins.

Term " control " of the present invention and/or " preventing and treating " refer to that Lloyd's armyworm insect is at least contacted with Cry1A albumen, after contact The growth of Lloyd's armyworm insect is suppressed and/or causes death.Further, Lloyd's armyworm insect by feeding plant organize to Contact with Cry1A albumen less, all or part of Lloyd's armyworm insect growth after contact is suppressed and/or causes death.Suppress Refer to sub- lethal, i.e., not yet lethal but can cause and grow, behavior, physiology, biochemistry and certain effect of aspect such as organize, such as Grow slow and/or stop.Meanwhile, plant should be morphologically normal, and can cultivate under conventional approaches for The consumption and/or generation of product.Additionally, the control Lloyd's armyworm insect of the polynucleotide sequence containing coding Cry1A albumen Plant and/or vegetable seeds, in the condition that artificial infection Lloyd's armyworm insect and/or the naturally-occurring of Lloyd's armyworm insect endanger Under, with the plant injury for weakening compared with not genetically modified WT lines, the stem of concrete manifestation including but not limited to improvement Kernel weight, and/or volume increase of stalk resistance, and/or raising etc..Cry1A albumen " control " and/or " preventing and treating " to Lloyd's armyworm Effect be can with self-existent, not because other " can control " and/or the presence of the material of " preventing and treating " Lloyd's armyworm insect and subtract Weak and/or disappearance.Specifically, genetically modified plants (containing coding Cry1A albumen polynucleotide sequence) any tissue simultaneously And/or asynchronously, exist and/or produce, another kind of material of Cry1A albumen and/or controllable Lloyd's armyworm insect, then institute The presence for stating another kind of material neither affects Cry1A albumen to act on " control " and/or " preventing and treating " of Lloyd's armyworm, can not lead " control " described in cause and/or " preventing and treating " effect completely and/or part is realized by another kind of material, and with Cry1A albumen without Close.Under normal circumstances, in land for growing field crops, Lloyd's armyworm insect feeding plant tissue process of short duration and be difficult observe with the naked eye, because This, under conditions of artificial infection Lloyd's armyworm insect and/or Lloyd's armyworm insect naturally-occurring harm, such as genetically modified plants There is dead Lloyd's armyworm insect, and/or thereon in any tissue of (polynucleotide sequence containing coding Cry1A albumen) Stop Lloyd's armyworm insect, and/or the plant with decrease compared with not genetically modified WT lines that growth is suppressed Damage, as achieve the method for the present invention and/or purposes, i.e., by Lloyd's armyworm insect at least contact with Cry1A albumen with Realize the method and/or purposes of control Lloyd's armyworm insect.

In the present invention, a kind of expression of the Cry1A albumen in genetically modified plants can be accompanied by one or more Cry classes Insect-killing protein and/or the expression of Vip class insect-killing proteins.This more than a kind of Pesticidal toxins in same strain genetically modified plants Middle co expression can make by genetic engineering that plant includes and gene needed for expressing is realizing.In addition, a kind of plant the (the 1st Parent) Cry1A protein can be expressed by genetic engineering procedure, second plant (the 2nd parent) can pass through genetic engineering Operation expression Cry classes insect-killing protein and/or Vip class insect-killing proteins.Expressed by the 1st parent and the 2nd parents Introduce the progeny plants of all genes of the 1st parent and the 2nd parent.

RNA interference (RNA interference, RNAi) refer to being highly conserved during evolution, by double-stranded RNA (double-stranded RNA, dsRNA) induce, the phenomenon of the efficient selective degradation of homologous mRNA.Therefore in the present invention RNAi technology specific depletion can be used or close the expression of specific gene in target insect pests.

Noctuidae belonging to Lloyd's armyworm is the most abundant section of species in Lepidoptera, and the whole world is had discovered that more than 20,000 kinds Noctuid, the wherein overwhelming majority are agricultural pests；China has reported that Noctuidae has 2110 kinds, adheres to 18 subfamilies 514 separately Category.Although Lloyd's armyworm belongs to Noctuidae with east armyworm, except there is similitude in criteria for classification, in other form knots Then there is huge difference on structure or habit, such as east armyworm body colour is in taupe or faint yellow and Lloyd's armyworm body colour is in reddish brown Color, the long 30-40mm of east armyworm larva body and the long 17-27mm of Lloyd's's armyworm larva body, east armyworm is in Henan and Shandong District Can not survive the winter, only there can be part worm with pupa or mature larva Diapause in Jiangsu and Zhejiang, and the pupa of Lloyd's armyworm or old Ripe larva can survive the winter in the soil on the ground such as Henan, Shandong.Similar, the strawberry in plant (belongs to rose as apple The common vetch mesh rose family), they have the features such as colored both sexes, radiation symmetric, 5, petal, but its fruit and plant forms are but Vary.But because of the less contact insect of people, especially less contact agricultural pests, for the difference on Morphology of entomology less Concern, and cause people to think that the form of insect is similar.And in fact, Lloyd's armyworm either from Larva Morpho. Logy still into From the point of view of in worm form, the feature that all has which unique.

The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any inhereditary material, and including nucleus and plastid and mitochondrial genomes.

Heretofore described polynucleotides and/or nucleotides form completely " gene ", encode in required host cell Protein or polypeptide.Those skilled in the art are it is readily appreciated that can be placed in the polynucleotides of the present invention and/or nucleotides Under regulating and controlling sequence control in purpose host.

Well-known to those skilled in the art, DNA is typically present with double chain form.In this arrangement, chain with Another chain complementation, vice versa.As DNA replicates other complementary strands for generating DNA in plant.So, present invention bag Include the use of polynucleotides and its complementary strand to example in sequence table." coding strand " that this area often uses refers to and antisense link The chain of conjunction.In order to one chain of DNA is transcribed into the complementary strand of a mRNA for marking protein in vivo, typical case, it is used as mould Plate translates protein.MRNA is actually transcribed from " antisense " chain of DNA." having justice " or " coding " chain has a series of passwords Son (codon is three nucleotides, once reads three and can produce specific amino acids), which can be read as ORFs (ORF) Read to form target protein or peptide.Present invention additionally comprises there is the RNA of suitable function with the DNA of example.

Nucleic acid molecule of the present invention or its fragment under strict conditions with Cry1A gene recombinations of the present invention.Any conventional Nucleic acid hybridization or amplification method may be used to the presence for identifying Cry1A genes of the present invention.Nucleic acid molecules or its fragment are certain In the case of can carry out specific hybrid with other nucleic acid molecules.In the present invention, if two nucleic acid molecules can form antiparallel Double-strandednucleic acid structure, it is possible to say that the two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid point Son shows completely complementarity, then it is another nucleic acid molecules " complement " to claim one of nucleic acid molecules.In the present invention, When each nucleotides of nucleic acid molecules is with the corresponding nucleotide complementary of another nucleic acid molecules, then claim the two cores Acid molecule shows " complete complementary ".If two nucleic acid molecules can with enough stability phase mutual crosses so that they Anneal under the conditions of at least conventional " low strict " and be bonded to each other, then the two nucleic acid molecules are called that " minimum level is mutual Mend ".Similarly, if two nucleic acid molecules can with enough stability phase mutual crosses so that they conventional " highly Anneal under the conditions of strictly " and be bonded to each other, then claim the two nucleic acid molecules that there is " complementarity ".Deviateing from complete complementary is Can allow, as long as this not exclusively two molecules of prevention that deviate form duplex structures.In order that nucleic acid molecules can As primer or probe, it is only necessary to ensure which has in sequence sufficiently complementary so that in the specific solvent for being adopted and Stable duplex structure can be formed under salinity.

In the present invention, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules can under high stringency There is specific hybrid with the complementary strand of another section of nucleic acid molecules for matching.Promote the suitable stringent condition of DNA hybridization, example Such as, with 6.0 × sodium chloride/sodium citrate (SSC) process about under the conditions of 45 DEG C, then with 2.0 × SSC under the conditions of 50 DEG C Washing, these conditions are known to those skilled in the art.For example, the salinity in washing step can be selected from low tight About 2.0 × the SSC of glazing bar part, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.Additionally, the temperature in washing step Condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of the room temperature of Low stringency conditions.Temperature conditionss and salt are dense Degree all can change, it is also possible to which one of holding is constant and another variable changes.Preferably, of the present invention Stringent condition can be in 6 × SSC, 0.5%SDS solution, at 65 DEG C occur specific hybrid, then with 2 × SSC, 0.1% SDS and 1 × SSC, 0.1%SDS respectively wash film 1 time.

Therefore, with anti-insect activity and under strict conditions with SEQ ID NO of the present invention:5、SEQ ID NO:6、SEQ ID NO:7 or SEQ ID NO:The sequence of 8 hybridization is included in the invention.These sequences and sequence of the present invention at least about 40%- 50% is homologous, and about 60%, 65% or 70% are homologous, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%th, 94%, 95%, 96%, 97%, 98%, 99% or bigger sequence homology.

Heretofore described gene and protein not only include specific exemplary sequence, also include saving described specific The part of the insecticidal activity feature of the protein of example and/fragment (lack including including compared with full length protein and/or end Lose), variant, mutant, the substituent protein of amino acid (have substitute), chimera and fusion protein." variant " or " become Different " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity." equivalent protein " is referred to There is the albumen of the biologically active of identical or essentially identical anti-Lloyd's armyworm insect with the albumen of claim.

Original DNA or egg that " fragment " or " truncation " of heretofore described DNA molecular or protein sequence is referred to A part of Bai Xulie (nucleotides or amino acid) or its artificial reconstructed form (being for example suitable for the sequence of plant expression), aforementioned sequence The length of row there may be change, but length is enough to ensure that (coding) protein is insect toxins.

Gene variant can be built with modifier and readily using standard technique.For example, it is well known that manufacture point The technology of mutation.Such as U.S. Patent number 5605793 is described to be reassemblied using DNA after random fracture and produces other molecules again Multifarious method.Commercialization endonuclease can be used to manufacture the fragment of full-length gene, and can be according to standardization program Using exonuclease.It is, for example possible to use enzyme such as Bal31 or direct mutagenesis cut off core from the end system of these genes Thuja acid.Multiple restriction enzymes can also be used to obtain the gene of encoding active fragment.Can be directly obtained using protease The active fragment of these toxin.

The present invention can derive equivalent protein from B.t. separators and/or DNA library and/or encode these equivalent proteins Gene.There are multiple methods to obtain the insecticidal proteins of the present invention.It is, for example possible to use the desinsection that the present invention is disclosed and claimed The antibody of albumen is identified and isolated from other albumen from protein mixture.Especially, antibody be probably by albumen most constant and with The most different protein part of other B.t. albumen causes.May then pass through immunoprecipitation, enzyme linked immunosorbent assay (ELISA) Or western immunoblot methods exclusively identify the equivalent protein of activity characteristic using these antibody (ELISA).Ability can be used Domain standardization program readily prepares the antibody of the fragment of albumen or equivalent protein or this albuminoid disclosed in the present invention.Then may be used To obtain the gene for encoding these albumen from microorganism.

Due to the Feng Yuxing of genetic codon, multiple different DNA sequence dnas can encode identical amino acid sequence.Produce The alternative DNA sequence dna of the identical or essentially identical albumen of these codings is just in the technical merit of those skilled in the art.This Different DNA sequence dnas is included within the scope of the invention a bit." substantially the same " sequence has referred to 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, has lacked Lose, add or insertion but the substantial sequence for not affecting insecticidal activity, also include the fragment for retaining insecticidal activity.

In the present invention, the replacement of amino acid sequence, disappearance or interpolation are the ordinary skill in the art, preferably this amino acid Change is turned to：Little characteristic changing, i.e., the conserved amino acid of the folding and/or activity that do not significantly affect albumen replace；Little disappearance, The disappearance of normally about 1-30 amino acid；Little amino or c-terminus extend, and for example aminoterminal extends methionine residues； Little connection peptide, e.g., from about 20-25 residue are long.

The example of conservative replacement is the replacement occurred in following amino acid group：Basic amino acid is (such as arginine, lysine And histidine), acidic amino acid (such as glutamic acid and aspartic acid), polar amino acid (such as glutamine, asparagine), hydrophobic Acidic amino acid (such as leucine, isoleucine and valine), ArAA (such as phenylalanine, tryptophan and tyrosine), with And small molecule amino acid (such as glycine, alanine, serine, threonine and methionine).Generally given activity is not changed Those 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors are it is well known that and by for example, N.Neurath and R.L.Hill is 1979 in the art Year new york academic publishing house (Academic Press) publishes《Protein》In be described.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/ Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art it should be evident that this replacement can play an important role to molecular function Region outside occur, and still produce active peptides.For the polypeptide by the present invention, its activity is required and therefore selects not Substituted amino acid residue, can be reflected according to methods known in the art, such as direct mutagenesis or alanine scanning mutagenesis Fixed (such as referring to, Cunningham and Wells, 1989, Science 244：1081-1085).Latter technique is every in the molecule Mutation is introduced at one positively charged residue, detects the anti-insect activity of gained mutating molecule, so that it is determined that to the molecular activity For important amino acid residue.Substrate-enzyme interacting site can also be determined by the analysis of its three-dimensional structure, this Three-dimensional structure can be determined by technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as de Vos etc., 1992, Science 255：306-312；Smith etc., 1992, J.Mol.Biol 224:899-904；Wlodaver etc., 1992, FEBS Letters 309：59-64).

In the present invention, Cry1A albumen includes but is not limited to SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3 or SEQ ID NO:4, with SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3 or SEQ ID NO:Amino acid sequence shown in 4 The amino acid sequence that row have certain homology is also included in the present invention.These sequences and sequence similarities of the present invention/identical Property be typically larger than 78%, preferably greater than 85%, more preferably greater than 90%, be even more preferably more than 95%, and can To be more than 99%.Can also be according to homogeny particularly and/or the preferred polynucleotides of the similarity scope definition present invention And protein.For example have 78% with the sequence of example of the present invention, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%th, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical Property and/or similarity.

In the present invention, the genetically modified plants for producing the Cry1A albumen include but is not limited to Mon810 transgenic corns Event and/or the vegetable material (as described by US6713259 B2) comprising Mon810 transgenic corn events, Bt11 turn Gene corn event and/or the vegetable material comprising Bt11 transgenic corn events are (such as in the non-control state Shens of USDA APHIS Please be described by 95-195-01p, the amino acid sequence such as SEQ ID NO of the present invention of the Cry1Ab albumen included by which:3 institutes Show), Bt176 transgenic corn events and/or the vegetable material comprising Bt176 transgenic corn events be (such as in USDA APHIS Described by non-control state application 94-319-01p, the amino acid sequence of the Cry1Ab albumen included by which is such as Described by US5625136B2), TT51 transgenic paddy rices event and/or the vegetable material comprising TT51 transgenic paddy rice events (as described by CN100582223C and CN101302520B), 223F-S21 transgenic rice lines and/or include 223F- The vegetable material (as described by CN103773759A) of S21 transgenic rice lines, Mon15985 transgenic cotton events And/or the vegetable material (as described by CN101413028B) comprising Mon15985 transgenic cotton events, MON531 turn Gene cotton event and/or the vegetable material comprising MON531 transgenic cotton events are (such as in the non-control states of USDA APHIS Described by application 00-342-01p), COT67B transgenic cotton events and/or the plant comprising COT67B transgenic cotton events Thing material (as described by the non-control state application 07-108-01p of USDA APHIS) or 3006-210-23 transgenic cottons Flower event and/or the vegetable material comprising 3006-210-23 transgenic cotton events are (such as in the non-control state Shens of USDA APHIS Please be described by 03-036-02p), which can realize the method for the present invention and/or purposes, i.e., by Lloyd's armyworm insect extremely Few method and/or purposes contacted with Cry1A albumen to realize control Lloyd's armyworm insect.Those skilled in the art are understood , the Cry1A albumen in above-mentioned transgenic event is expressed in different plants and can also realize the method for the present invention and/or use On the way.More specifically, the Cry1A albumen is present in the genetically modified plants at least producing the Cry1A albumen, the Lloyd's sticks Insect pest worm is at least contacted with the Cry1A albumen by the tissue of the genetically modified plants that ingest, the Lloyd's armyworm after contact Insect growth is suppressed and/or causes death, to realize the control for endangering plant to Lloyd's armyworm.

Heretofore described regulating and controlling sequence include but is not limited to promoter, transit peptides, terminator, enhancer, targeting sequencing, Introne and other be operably connected to the regulatory sequence of the Cry1A albumen.

The promoter is that effable promoter in plant, described " effable promoter in plant " are referred to and guaranteed The promoter expressed in plant cell by connected coded sequence.In plant, effable promoter can be composing type Promoter.The example of the promoter of constitutive expression in plant is instructed to include but is not limited to, from cauliflower mosaic virus 35S promoter, corn Ubi promoters, promoter of paddy rice GOS2 genes etc..Alternatively, in plant, effable promoter can For the table that tissue-specific promoter, the i.e. promoter such as instruct coded sequence in chlorenchyma in some tissues of plant It is higher than its hetero-organization (can be measured by routine RNA tests) of plant, such as PEP carboxylase promoters up to level.Alternatively, In plant, effable promoter can be wound-induced promoter.Wound-induced promoter instructs the expression pattern of wound-induced Promoter refer to when plant is stood machinery or gnaws the wound for causing by insect, the table of the coded sequence under promoter regulation Reach compared with being significantly increased under the conditions of normal growth.The example of wound-induced promoter is included but is not limited to, potato and tomato Protease suppressor (pin I and pin II) and zein enzyme level gene (MPI) promoter.

Transit peptides (also known as secretory signal sequence or the targeting sequencing) is to instruct transgene product to specific organelle Or cellular compartment, for receptor protein, the transit peptides can be heterologous, for example, using encoding chloroplast transit peptide Sequence targets chloroplaset, or utilizes ' KDEL ' to retain sequence targeting endoplasmic reticulum, or using barley plants agglutinin gene CTPP targets vacuole.

The targeting sequencing is including but not limited to picornavirus targeting sequencing, such as EMCV targeting sequencings (encephalomyo-carditis disease Malicious 5 ' noncoding regions)；Potyvirus leaders, such as MDMV (Maize Dwarf Mosaic Virus) targeting sequencing；Human immunity Globular protein heavy-chain binding protein matter (BiP)；The coat protein mRNA of alfalfa mosaic virus does not translate targeting sequencing (AMV RNA4)；Tobacco mosaic virus (TMV) (TMV) targeting sequencing.

The enhancer is including but not limited to cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) increase Hadron, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), duck plantar Straw colour mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application, the introne is including but not limited to corn hsp70 intrones, corn are general Plain introne, Adh introne 1s, crose synthase intron or paddy rice Act1 intrones.For dicotyledon application, institute Introne is stated including but not limited to CAT-1 intrones, pKANNIBAL intrones, PIV2 intrones and " super ubiquitin " are included Son.

The terminator can be the suitable polyadenylation signal sequence worked in plant, including but do not limit In from the Polyadenylation of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Burst, from protease-inhibitor Ⅱ (pin II) gene polyadenylation signal sequence, derive from pea The polyadenylation signal sequence of ssRUBISCO E9 genes and the poly from alpha-tubulin (α-tubulin) gene Polyadenylation signal sequence.

Heretofore described " effectively connection " represents the connection of nucleotide sequence, and it is right that the connection causes a sequence provide The function of needing for linked sequence.Described in the present invention " effectively connection " can be by promoter and sequence phase interested Even so that the transcription of the sequence interested is subject to the promoter control and regulates and controls.When sequential coding albumen interested and Go for the albumen expression when " effectively connection " represent：Promoter is connected with the sequence, and connected mode causes to obtain Transcript efficient translation.If promoter is that transcript merges and wants the albumen of realization coding with the connection of coded sequence Expression when, the such connection of manufacture so that the first translation initiation codon is the starting of coded sequence in the transcript for obtaining Codon.Alternatively, if promoter is to translate the table for merging and wanting the albumen that realization is encoded with the connection of coded sequence When reaching, the such connection of manufacture so that the first translation initiation codon and the promoter contained in 5 ' non-translated sequences is connected, And it is to meet reading that connected mode causes the translation product for obtaining with the relation of the translation opening code-reading frame for encoding the albumen that wants Code frame.Can be included but is not limited to the nucleotide sequence of " effectively connection "：Sequence (the i.e. gene expression of gene expression function is provided Element, such as promoter, 5 ' untranslated regions, introne, protein encoding regions, 3 ' untranslated regions, poly- putative adenylylation site and/ Or transcription terminator), sequence (i.e. T-DNA border sequences, the locus specificity recombinase of DNA transfers and/or integration function are provided Recognition site, integrate enzyme recognition site), sequence (i.e. antibiotic resistance markers, the biosynthesis base of selectivity function are provided Cause), the sequence of label function of can scoring, sequence that is external or assisting series of operations in vivo (i.e. polylinker sequence, site are provided Specific recombination sites) and sequence (the i.e. origin of replication of bacterium, autonomously replicating sequence, the centromere sequence of copy function are provided Row).

It is poisonous that heretofore described " desinsection " or " pest-resistant " is referred to crop pests, so as to realize " control " And/or " preventing and treating " crop pests.Preferably, described " desinsection " or " pest-resistant " refer to kill crop pests.More specifically, mesh Mark insect is Lloyd's armyworm insect.

In the present invention, Cry1A albumen has toxicity to Lloyd's armyworm insect.Plant in the present invention, particularly corn, Contain foreign DNA in its genome, nucleotide sequence of the foreign DNA comprising coding Cry1A albumen, Lloyd's armyworm insect lead to Cross feeding plant tissue to contact with the albumen, Lloyd's armyworm insect growth after contact is suppressed and/or causes death.Suppression is Refer to lethal or sub- lethal.Meanwhile, plant should be morphologically normal, and can cultivate disappearing for product under conventional approaches Consumption and/or generation.Additionally, the plant can substantially eliminate the needs to chemistry or biological insecticides (chemistry or Biocidal The insecticide of Lloyd's armyworm insect of the agent by targetting for Cry1A albumen).

In vegetable material, the expression of insecticidal crystal protein (ICP) can be entered by described multiple methods in the art Row detection, for example, carried out quantitatively, or directly to the mRNA of the coded insect-killing protein produced in tissue by applying special primer The amount of the insect-killing protein that specific detection is produced.

Different tests can be applied to determine the insecticidal effect of ICP in plant.In the present invention, targeted insect is mainly Lloyd's Armyworm.

In the present invention, the Cry1A albumen can have SEQ ID NO in sequence table:1、SEQ ID NO:2、SEQ ID NO:3 or SEQ ID NO:Amino acid sequence shown in 4.In addition to the code area comprising Cry1A albumen, can also include other yuan The protein of part, such as encoding selection markers.

Additionally, the expression cassette comprising the nucleotide sequence for encoding Cry1A albumen of the present invention in plant can with least A kind of protein of encoding herbicide resistance gene is expressed together, and the herbicide resistance gene is included but is not limited to, phosphine oxamate Resistant gene (such as bar genes, pat genes), phenmedipham resistant gene (such as pmph genes), Glyphosate resistance gene are (such as EPSPS Gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, the resistant gene to herbicide Dalapon, to ammonia The resistant gene of the resistant gene or glutamine synthetase inhibitor (such as PPT) of nitrile, so as to obtain both have high insecticidal activity, There are the genetically modified plants of Herbicid resistant again.

In the present invention, by Exogenous DNA transfered plant, the gene or expression cassette of Cry1A albumen or restructuring as described in by coding Vector introduction plant cell, conventional method for transformation are included but is not limited to, Agrobacterium-medialed transformation, micro transmitting bombardment, straight Connect and the DNA that DNA takes in the mediation of protoplast, electroporation or silicon whisker is imported.

The invention provides a kind of purposes of insecticidal proteins, with advantages below：

1st, internal cause preventing and treating.Prior art is external cause controlling the harm of Lloyd's armyworm insect mainly by external action, Such as cultural control, chemical prevention and physical control；And the present invention is can to kill Lloyd's armyworm by generation in plant body Cry1A albumen is prevented and treated by internal cause controlling Lloyd's armyworm insect.

2nd, pollution-free, noresidue.Although danger of the chemical prevention and control method that prior art is used to control Lloyd's armyworm insect Evil serves certain effect, but also brings pollution, destruction simultaneously to people, animal and farmland ecosystem and remain；Using this The method of bright control Lloyd's armyworm insect, can eliminate above-mentioned adverse consequences.

3rd, time of infertility preventing and treating.Prior art using control Lloyd's armyworm insect method be all interim, and this Invention is the protection for carrying out the time of infertility to plant, genetically modified plants (Cry1A albumen) from germination, growth, until blooming, tying Really, can avoid being encroached on by Lloyd's armyworm.

4th, whole plant preventing and treating.Prior art using the method for control Lloyd's armyworm insect be locality mostly, such as leaf Face sprays；And the present invention is that whole plant is protected, such as the blade of genetically modified plants (Cry1A albumen), stalk, fruit, The infringement of Lloyd's armyworm can all be resisted by tassel, female fringe, flower pesticide or filigree etc..

5th, effect stability.Prior art using either cultural control method or physical control method is required for utilizing Environmental condition is prevented and treated to insect, and variable factor is more；The present invention is to make the Cry1A albumen carry out table in plant body Reach, effectively overcome the unstable defect of environmental condition, and the prevention effect of genetically modified plants of the present invention (Cry1A albumen) exists Different location, different time, different genetic backgrounds are also all stable and consistents.

6th, simple, convenient, economical.The disposably input of the frequency ventilating type insecticidal lamp that prior art is used is larger, and operates not The danger that hurts sb.'s feelings when also shocking by electricity；The present invention only need to plant the genetically modified plants that can express Cry1A albumen, without Using other measures, so as to save a large amount of human and material resources and financial resources.

7th, effect is thorough.The method of the control Lloyd's armyworm insect that prior art is used, its effect is halfway, only rises Act on to mitigation；And genetically modified plants (Cry1A albumen) of the present invention can cause the mortality for just incubating Lloyd's armyworm larva, and Greatly suppression is caused to fraction survival larvae development progress, larva, substantially still in state is just incubated, is all obvious after 3 days Depauperation, and stop developing, cannot survive in the natural environment of field, and genetically modified plants are generally only slightly damaged Wound.

Below by drawings and Examples, technical scheme is described in further detail.

Description of the drawings

Fig. 1 is the recombinant cloning vector DBN01-T structures containing Cry1A nucleotide sequences of the purposes of insecticidal proteins of the present invention Build flow chart；

Fig. 2 is the recombinant expression carrier DBN100738 containing Cry1A nucleotide sequences of the purposes of insecticidal proteins of the present invention Build flow chart.

Specific embodiment

The technical scheme of the purposes of insecticidal proteins of the present invention is further illustrated below by specific embodiment.

First embodiment, the acquisition of gene and synthesis

1st, nucleotide sequence is obtained

SEQ ID NO in the amino acid sequence (818 amino acid) of Cry1Ab-01 insect-killing proteins, such as sequence table:1 institute Show；Cry1Ab-01 nucleotide sequence (2457 of the coding corresponding to the amino acid sequence of the Cry1Ab-01 insect-killing proteins Nucleotides), such as SEQ ID NO in sequence table:Shown in 5.

SEQ ID NO in the amino acid sequence (615 amino acid) of Cry1Ab-02 insect-killing proteins, such as sequence table:2 institutes Show；Cry1Ab-02 nucleotide sequence (1848 of the coding corresponding to the amino acid sequence of the Cry1Ab-02 insect-killing proteins Nucleotides), such as SEQ ID NO in sequence table:Shown in 6.

SEQ ID NO in the amino acid sequence (1177 amino acid) of Cry1A.105 insect-killing proteins, such as sequence table:3 institutes Show；Cry1A.105 nucleotide sequence (3534 of the coding corresponding to the amino acid sequence of the Cry1A.105 insect-killing proteins Nucleotides), such as SEQ ID NO in sequence table:Shown in 7.

The amino acid sequence (1178 amino acid) of Cry1Ac insect-killing proteins, such as sequence table SEQ ID NO:Shown in 4；Compile Cry1Ac nucleotide sequence (3537 nucleotides) of the code corresponding to the amino acid sequence of the Cry1Ac insect-killing proteins, such as sequence SEQ ID NO in list:Shown in 8.

The Vip3A nucleotide sequences (2370 of the amino acid sequence (789 amino acid) of coding Vip3A insect-killing proteins Nucleotides), such as SEQ ID NO in sequence table:Shown in 9.

The Cry2Ab nucleotide sequences (1905 of the amino acid sequence (634 amino acid) of coding Cry2Ab insect-killing proteins Individual nucleotides), such as SEQ ID NO in sequence table:Shown in 10.

2nd, synthesize above-mentioned nucleotide sequence

The Cry1Ab-01 nucleotide sequences are (such as SEQ ID NO in sequence table:Shown in 5), the Cry1Ab-02 nucleosides Acid sequence is (such as SEQ ID NO in sequence table:Shown in 6), the Cry1A.105 nucleotide sequences are (such as SEQ ID in sequence table NO:Shown in 7), the Cry1Ac nucleotide sequences are (such as sequence table SEQ ID NO:8), the Vip3A nucleotide sequences are (such as sequence SEQ ID NO in list:Shown in 9) and the Cry2Ab nucleotide sequences (such as SEQ ID NO in sequence table:Shown in 10) by south Jing Jinsirui bio tech ltd synthesizes.The Cry1Ab-01 nucleotide sequences (the SEQ ID NO of synthesis:5) 5 ' ends It is also associated with NcoI restriction enzyme sites, Cry1Ab-01 nucleotide sequences (the SEQ ID NO:5) 3 ' ends are also associated with SwaI enzymes Enzyme site；The Cry1Ab-02 nucleotide sequences (the SEQ ID NO of synthesis:6) 5 ' ends are also associated with NcoI restriction enzyme sites, Cry1Ab-02 nucleotide sequences (the SEQ ID NO:6) 3 ' ends are also associated with SwaI restriction enzyme sites；Synthesized is described Cry1A.105 nucleotide sequences (SEQ ID NO:7) 5 ' ends are also associated with NcoI restriction enzyme sites, the Cry1A.105 nucleosides Acid sequence (SEQ ID NO:7) 3 ' ends are also associated with SwaI restriction enzyme sites；Cry1Ac nucleotide sequences (the SEQ of synthesis ID NO:8) 5 ' ends are also associated with NcoI restriction enzyme sites, Cry1Ac nucleotide sequences (the SEQ ID NO:8) 3 ' ends are also It is connected with SwaI restriction enzyme sites；The Vip3A nucleotide sequences (the SEQ ID NO of synthesis:9) 5 ' ends are also associated with AscI enzymes Enzyme site, Vip3A nucleotide sequences (the SEQ ID NO:9) 3 ' ends are also associated with BamHI restriction enzyme sites；Synthesized is described Cry2Ab nucleotide sequences (SEQ ID NO:10) 5 ' ends are also associated with AscI restriction enzyme sites, the Cry2Ab nucleotide sequences (SEQ ID NO:10) 3 ' ends are also associated with BamHI restriction enzyme sites.

Second embodiment, the structure of recombinant expression carrier and recombinant expression carrier conversion Agrobacterium

1st, the recombinant cloning vector containing Cry1A genes is built

By the Cry1Ab-01 nucleotide sequences of synthesis be connected into cloning vector pGEM-T (Promega, Madison, USA, CAT：A3600, on), operating procedure is carried out by Promega Products pGEM-T carriers specifications, obtains recombinant cloning vector DBN01-T, which builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1；F1 represents answering for bacteriophage f1 Starting point processed；LacZ is LacZ initiation codons；SP6 is SP6 RNA polymerase promoters；T7 is T7 RNA polymerase promoters； Cry1Ab-01 is Cry1Ab-01 nucleotide sequences (SEQ ID NO:5)；MCS is MCS).

Then by recombinant cloning vector DBN01-T with heat shock method conversion Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT：CD501), its hot shock condition is：50 μ l Escherichia coli T1 competent cells, 10 μ l DNAs (weight Group cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds；37 DEG C of shaken cultivations 1 hour (shaking table shake under 100rpm rotating speeds), in table Face scribbles the ammonia of IPTG (isopropylthio-β-D-galactoside) and X-gal (the chloro- 3- indoles-β-D- galactosides of the bromo- 4- of 5-) Parasiticin (100mg/L) LB flat boards (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, PH is adjusted to grow overnight to 7.5) upper with NaOH.Picking white colony, in LB fluid nutrient mediums, (tryptone 10g/L, yeast are extracted Thing 5g/L, NaCl 10g/L, ampicillin 100mg/L, adjust pH to cultivate under the conditions of 37 DEG C of temperature in 7.5) with NaOH Night.Alkalinity extraction its plasmid：Bacterium solution is centrifuged 1min under 12000rpm rotating speeds, supernatant is removed, precipitation thalline is pre- with 100 μ l ice Cold solution I (25mM Tris-HCl, 10mM EDTA (ethylenediamine tetra-acetic acid), 50mM glucose, pH8.0) suspends；Add 150 The solution II (0.2M NaOH, 1%SDS (lauryl sodium sulfate)) that μ l are newly prepared, pipe is reverse 4 times, mixing, puts on ice 3-5min；The solution III (4M potassium acetates, 2M acetic acid) for adding 150 μ l ice-cold, is fully mixed immediately, places 5-10min on ice； 5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, and 2 times of volume absolute ethyl alcohols, room temperature after mixing is added in supernatant Place 5min；5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, supernatant is abandoned, precipitation concentration (V/V) is 70% Ethanol washing after dry；Add TEs (10mM Tris-HCl, 1mM EDTA, pH8.0) of the 30 μ l containing RNase (20 μ g/ml) molten Solution precipitation；Water-bath 30min at 37 DEG C of temperature, digests RNA；In temperature, -20 DEG C save backup.

After the plasmid of extraction is through KpnI and BglI digestions identification, sequence verification is carried out to positive colony, as a result shows to recombinate The Cry1Ab-01 nucleotides sequences inserted in cloning vector DBN01-T are classified as in sequence table (SEQ ID NO:5) core shown in Nucleotide sequence, i.e. Cry1Ab-01 nucleotide sequences are correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by the Cry1Ab-02 nucleotide sequences of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN02-T, wherein, Cry1Ab-02 is Cry1Ab-02 nucleotides Sequence (SEQ ID NO:6).Cry1Ab-02 nucleotide sequences described in digestion and sequence verification recombinant cloning vector DBN02-T It is correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by the Cry1A.105 nucleotide sequences of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN03-T, wherein, Cry1A.105 is Cry1A.105 nucleotides Sequence (SEQ ID NO:7).Cry1A.105 nucleotide sequences described in digestion and sequence verification recombinant cloning vector DBN03-T It is correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, the Cry1Ac nucleotide sequences of synthesis are connected Enter on cloning vector pGEM-T, obtain recombinant cloning vector DBN04-T, wherein, Cry1Ac is Cry1Ac nucleotide sequence (SEQ ID NO:8).Described in digestion and sequence verification recombinant cloning vector DBN04-T, Cry1Ac nucleotide sequences are correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, the Vip3A nucleotide sequences of synthesis are connected into On cloning vector pGEM-T, recombinant cloning vector DBN05-T is obtained, wherein, Vip3A is Vip3A nucleotide sequences (SEQ ID NO:9).Described in digestion and sequence verification recombinant cloning vector DBN05-T, Vip3A nucleotide sequences are correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, the Cry2Ab nucleotide sequences of synthesis are connected Enter on cloning vector pGEM-T, obtain recombinant cloning vector DBN06-T, wherein, Cry2Ab is Cry2Ab nucleotide sequence (SEQ ID NO:10).Described in digestion and sequence verification recombinant cloning vector DBN06-T, Cry2Ab nucleotide sequences are correctly inserted into.

2nd, the recombinant expression carrier containing Cry1A genes is built

Digestion recombinant cloning vector DBN01-T and expression vector DBNBC-01 is distinguished with restriction enzyme NcoI and SwaI (carrier framework：PCAMBIA2301 (CAMBIA mechanisms can provide)), the Cry1Ab-01 nucleotide sequence fragments for cutting are inserted To between NcoI the and SwaI sites of expression vector DBNBC-01, it is art technology using conventional enzymatic cleavage methods carrier construction Known to personnel, recombinant expression carrier DBN100738 is built into, which builds flow process (Kan as shown in Figure 2：Kanamycins base Cause；RB：Right margin；prUbi：Maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:11)；Cry1Ab-01： Cry1Ab-01 nucleotide sequences (SEQ ID NO:5)；tNos：Terminator (the SEQ ID NO of rouge alkali synthetase gene:12)； PMI：Phophomannose isomerase gene (SEQ ID NO:13)；LB：Left margin).

Recombinant expression carrier DBN100738 is converted Escherichia coli T1 competent cells, its hot shock condition with heat shock method For：50 μ l Escherichia coli T1 competent cells, 10 μ l DNAs (recombinant expression carrier DBN100738), 42 DEG C of water-baths 30 seconds； 37 DEG C of water-baths 1 hour (shaking table shake under 100rpm rotating speeds)；Then in the LB solids of kanamycins containing 50mg/L (Kanamycin) Flat board (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH adjust pH on 7.5) in temperature Cultivate 12 hours under the conditions of 37 DEG C of degree, picking white colony, in LB fluid nutrient mediums (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, kanamycins 50mg/L, with NaOH adjust pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation.Alkali Method extracts its plasmid.The plasmid for extracting is identified with after restriction enzyme NcoI and SwaI digestion, and positive colony is carried out Sequencing identification, as a result shows that nucleotides sequences of the recombinant expression carrier DBN100738 between NcoI and SwaI sites is classified as sequence table Middle SEQ ID NO:Nucleotide sequence shown in 5, i.e. Cry1Ab-01 nucleotide sequences.

According to the method for above-mentioned structure recombinant expression carrier DBN100738, NcoI and SwaI, AscI and BamHI are distinguished The Cry1Ab-01 nucleotide sequences and Vip3A nucleotides sequences that digestion recombinant cloning vector DBN01-T and DBN05-T cut Row insertion expression vector DBNBC-01, obtains recombinant expression carrier DBN100053.Digestion and sequence verification recombinant expression carrier Nucleotide sequence in DBN100053 contains for SEQ ID NO in sequence table:5 and SEQ ID NO:Nucleotide sequence shown in 9, That is Cry1Ab-01 nucleotide sequences and Vip3A nucleotide sequences.The Cry1Ab-01 nucleotide sequences and the Vip3A nucleosides Acid sequence can connect the Ubi promoters and Nos terminators respectively.

According to the method for above-mentioned structure recombinant expression carrier DBN100738, by NcoI and SwaI digestion recombinant cloning vectors The Cry1Ab-02 nucleotide sequences insertion expression vector DBNBC-01 that DBN02-T cuts, obtains recombinant expression carrier DBN100106.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100106 contains for SEQ in sequence table ID NO:Nucleotide sequence shown in 6, i.e. Cry1Ab-02 nucleotide sequences.The Cry1Ab-02 nucleotide sequences can connect institute State Ubi promoters and Nos terminators.

According to the method for above-mentioned structure recombinant expression carrier DBN100738, by NcoI and SwaI digestion recombinant cloning vectors The Cry1Ac nucleotide sequences insertion expression vector DBNBC-01 that DBN04-T cuts, obtains recombinant expression carrier DBN100734.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100734 contains for SEQ in sequence table ID NO:Nucleotide sequence shown in 8, i.e. Cry1Ac nucleotide sequences.The Cry1Ac nucleotide sequences can connect the Ubi Promoter and Nos terminators.

According to the method for above-mentioned structure recombinant expression carrier DBN100738, by NcoI and SwaI digestion recombinant cloning vectors The Cry1A.105 nucleotide sequences insertion expression vector DBNBC-01 that DBN03-T cuts, obtains recombinant expression carrier DBN100029.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100029 contains for SEQ in sequence table ID NO:Nucleotide sequence shown in 7, i.e. Cry1A.105 nucleotide sequences.The Cry1A.105 nucleotide sequences can connect institute State Ubi promoters and Nos terminators.

According to the method for above-mentioned structure recombinant expression carrier DBN100738, NcoI and SwaI, AscI and BamHI are distinguished The Cry1A.105 nucleotide sequences and Cry2Ab nucleotides sequences that digestion recombinant cloning vector DBN03-T and DBN06-T cut Row insertion expression vector DBNBC-01, obtains recombinant expression carrier DBN100076.Digestion and sequence verification recombinant expression carrier Nucleotide sequence in DBN100076 contains for SEQ ID NO in sequence table:7 and SEQ ID NO:Nucleotide sequence shown in 10, That is Cry1A.105 nucleotide sequences and Cry2Ab nucleotide sequences.The Cry1A.105 nucleotide sequences and the Cry2Ab cores Nucleotide sequence can connect the Ubi promoters and Nos terminators respectively.

3rd, recombinant expression carrier conversion Agrobacterium

To oneself constructed correct recombinant expression carrier DBN100738, DBN100053, DBN100106, DBN100029, DBN100076 and DBN100734 liquid nitrogen methods are transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT： In 18313-015), its conversion condition is：100 μ l Agrobacterium LBA4404s, 3 μ l DNAs (recombinant expression carrier)；It is placed in liquid 10 minutes in nitrogen, 37 DEG C of tepidarium 10 minutes；Agrobacterium LBA4404 after by conversion be inoculated in LB test tubes in 28 DEG C of temperature, Rotating speed is to cultivate 2 hours under the conditions of 200rpm, and being applied to the card of rifampin (Rifampicin) and 100mg/L containing 50mg/L, that is mould Until growing positive monoclonal on the LB flat boards of element, picking Colony Culture simultaneously extracts its plasmid, uses restriction enzyme counterweight After group expression vector DBN100738, DBN100053, DBN100106, DBN100029, DBN100076 and DBN100734 digestion Verified, as a result show recombinant expression carrier DBN100738, DBN100053, DBN100106, DBN100029, DBN100076 and DBN100734 structures are completely correct.

3rd embodiment, the acquisition of transgenic corn plant

According to the conventional Agrobacterium infestation method for adopting, by the rataria and second of comprehensive for the corn variety of sterile culture 31 (Z31) In embodiment described in 3 recombinant expression carrier conversion Agrobacterium co-culture, by second embodiment 2 build recombinant expressed T-DNA (bags in carrier DBN100738, DBN100053, DBN100106, DBN100029, DBN100076 and DBN100734 Include the promoter sequence of corn Ubiquitin genes, Cry1Ab-01 nucleotide sequences, Cry1Ab-02 nucleotide sequences, Cry1A.105 nucleotide sequences, Cry1Ac nucleotide sequences, Vip3A nucleotide sequences, Cry2Ab nucleotide sequences, PMI genes With Nos terminator sequences) be transferred in maize chromosome group, obtain proceed to Cry1Ab-01 nucleotide sequences milpa, The milpa for proceeding to Cry1Ab-02 nucleotide sequences, the milpa for proceeding to Cry1Ab-01-Vip3A nucleotide sequences, turn The milpa that enters Cry1A.105 nucleotide sequences and the milpa for proceeding to Cry1A.105-Cry2Ab nucleotide sequences and turn Enter the milpa of Cry1Ac nucleotide sequences；Simultaneously using wild-type corn plant as control.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from corn, suspended with Agrobacterium Liquid contact rataria, wherein Agrobacterium can be possible to by Cry1Ab-01 nucleotide sequences, Cry1Ab-02 nucleotide sequences, Cry1Ac nucleotide sequences, Cry1Ab-01-Vip3A nucleotide sequences, Cry1A.105 nucleotide sequences and/or Cry1A.105- Cry2Ab nucleotide sequences are transferred at least one cell (step 1 of one of rataria：Infect step), in this step, rataria Agrobacterium suspension (OD is preferably immersed₆₆₀=0.4-0.6, infects culture medium (MS salt 4.3g/L, MS vitamins, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in starting inoculation.Rataria co-cultures one section of period (3 days) (step 2 with Agrobacterium：Co-culture step). Preferably, rataria after step is infected in solid medium (MS salt 4.3g/L, MS vitamins, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 1mg/L, agar 8g/ L, pH5.8) upper culture.After the here co-cultivation stage, there can be selective " recovery " step.In " recovery " step, Recovery media (MS salt 4.3g/L, MS vitamins, casein 300mg/L, sucrose 30g/L, 2,4 dichlorophenoxyacetic acid (2,4- D) 1mg/L, agar 8g/L, pH5.8) at least exist a kind of oneself know suppress Agrobacterium growth antibiotic (cephalosporin), no Add the selective agent (step 3 of vegetable transformant：Recovering step).Preferably, rataria is having antibiotic but consolidating without selective agent Cultivate on body culture medium, to eliminate Agrobacterium and provide convalescence as infected cell.Then, the rataria of inoculation is containing selective agent Transformed calli (the step 4 that culture growth selection on the culture medium of (mannose)：Select step).Preferably, rataria In the screening solid medium (MS salt 4.3g/L, MS vitamins, casein 300mg/L, sucrose 5g/L, the mannose that have selective agent 12.5g/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, agar 8g/L, pH5.8) the upper cell selection that cultivates, cause conversion Property growth.Then, callus regeneration is into plant (step 5：Regeneration step), it is preferable that raw on the culture medium containing selective agent Long callus is in the upper culture of solid medium (MS differential mediums and MS root medias) with aftergrowth.

The resistant calli that screening is obtained is transferred to the MS differential mediums (MS salt 4.3g/L, MS vitamins, cheese Plain 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, agar 8g/L, pH5.8) on, cultivate at 25 DEG C Differentiation.Differentiation seedling out be transferred to the MS root medias (MS salt 2.15g/L, MS vitamins, casein 300mg/L, Sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, cultivate at 25 DEG C to about 10cm height, move to greenhouse training Support to solid.In greenhouse, cultivate 16 hours at 28 DEG C daily, cultivate 8 hours at 20 DEG C.

Fourth embodiment, with TaqMan verify transfer-gen plant

The milpa that proceed to Cry1Ab-01 nucleotide sequence, the corn that proceed to Cry1Ab-02 nucleotide sequence are taken respectively Plant, the milpa for proceeding to Cry1Ab-01-Vip3A nucleotide sequences, the corn plant for proceeding to Cry1A.105 nucleotide sequences Strain, the milpa for proceeding to Cry1A.105-Cry2Ab nucleotide sequences and the milpa for proceeding to Cry1Ac nucleotide sequences Blade about 100mg extracts its genomic DNA with the DNeasy Plant Maxi Kit of Qiagen, by Taqman as sample Fluorescence probe quantitative PCR method detection Cry1Ab-01 genes, Cry1Ab-02 genes, Cry1A.105 genes, Cry1Ac genes, Vip3A genes and the copy number of Cry2Ab genes.Simultaneously using wild-type corn plant as control, examined according to the method described above Survey analysis.Experiment sets 3 repetitions, averages.

Detection Cry1Ab-01 genes, Cry1Ab-02 genes, Cry1A.105 genes, Cry1Ac genes, Vip3A genes and The concrete grammar of Cry2Ab gene copy numbers is as follows：

Step 11, take respectively and proceed to the milpa of Cry1Ab-01 nucleotide sequences, proceed to Cry1Ab-02 nucleotides sequences The milpa of row, the milpa for proceeding to Cry1Ab-01-Vip3A nucleotide sequences, proceed to Cry1A.105 nucleotide sequences Milpa, proceed to the milpa of Cry1A.105-Cry2Ab nucleotide sequences, proceed to the jade of Cry1Ac nucleotide sequences The each 100mg of blade of rice plant and wild-type corn plant, is ground into homogenate with liquid nitrogen respectively in mortar, and each sample takes 3 Repeat；

Step 12, the genomic DNA of above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；

Step 13, the genomic DNA concentration for determining above-mentioned sample with NanoDrop 2000 (Thermo Scientific)；

, to same concentration value, the scope of the concentration value is 80- for step 14, the genomic DNA concentration of the above-mentioned sample of adjustment 100ng/μl；

Step 15, the copy number for being identified sample using Taqman fluorescence probe quantitative PCR methods, are copied known to identification with passing through Used as standard items, used as control, 3 repetitions of each sample take which average to the sample using wild-type corn plant to the sample of shellfish number Value；Fluorescence quantification PCR primer and probe sequence are respectively：

Following primer and probe are used for detecting Cry1Ab-01 nucleotide sequences：

Primer 1：SEQ ID NO in CGAACTACGACTCCCGCAC such as sequence table:Shown in 14；

Primer 2：SEQ ID NO in GTAGATTTCGCGGGTCAGTTG such as sequence table:Shown in 15；

Probe 1：SEQ ID NO in CTACCCGATCCGCACCGTGTCC such as sequence table:Shown in 16；

Following primer and probe are used for detecting Cry1Ab-02 nucleotide sequences：

Primer 3：SEQ ID NO in TGCGTATTCAATTCAACGACATG such as sequence table:Shown in 17；

Primer 4：SEQ ID NO in CTTGGTAGTTCTGGACTGCGAAC such as sequence table:Shown in 18；

Probe 2：SEQ ID NO in CAGCGCCTTGACCACAGCTATCCC such as sequence table:Shown in 19；

Following primer and probe are used for detecting Vip3A nucleotide sequences：

Primer 5：SEQ ID NO in ATTCTCGAAATCTCCCCTAGCG such as sequence table:Shown in 20；

Primer 6：SEQ ID NO in GCTGCCAGTGGATGTCCAG such as sequence table:Shown in 21；

Probe 3：SEQ ID NO in CTCCTGAGCCCCGAGCTGATTAACACC such as sequence table:Shown in 22；

Following primer and probe are used for detecting Cry1A.105 nucleotide sequences：

Primer 7：SEQ ID NO in ATCGTGAACAACCAGAACCAGTG such as sequence table:Shown in 23；

Primer 8：SEQ ID NO in CTCCAGGATCTCGATCTCCG such as sequence table:Shown in 24；

Probe 4：SEQ ID NO in CGTGCCGTACAACTGCCTGAACAACC such as sequence table:Shown in 25；

Following primer and probe are used for detecting Cry2Ab nucleotide sequences：

Primer 9：SEQ ID NO in TCATTTGGGGCTTCGTCG such as sequence table:Shown in 26；

Primer 10：SEQ ID NO in TGATTGATCAGCTGCTCAACCT such as sequence table:Shown in 27；

Probe 5：SEQ ID NO in CCAGTGGGATGCGTTCCTCGCTC such as sequence table:Shown in 28；

Following primer and probe are used for detecting Cry1Ac nucleotide sequences：

Primer 11：SEQ ID NO in CATTCAATTCAATGACATGAACAGC such as sequence table:Shown in 29；

Primer 12：SEQ ID NO in GACAAGTGCAGGTTGGCAGC such as sequence table:Shown in 30；

Probe 6：SEQ ID NO in TCCGCTCTTCGCCGTTCAGAATTACC such as sequence table:Shown in 31；

PCR reaction systems are：

Every kind of primer of the 50 × primer/probe mixture comprising 1mM concentration each 45 μ l, 50 μ of probe of 100 μM of concentration L and 860 μ l 1 × TE buffer solutions, and at 4 DEG C, be housed in amber tube.

PCR reaction conditions are：

Using SDS2.3 softwares (Applied Biosystems) analyze data.

Test result indicate that, Cry1Ab-01 nucleotide sequences, Cry1Ab-02 nucleotide sequences, Cry1Ab-01-Vp3A cores Nucleotide sequence, Cry1A.105 nucleotide sequences, Cry1A.105-Cry2Ab nucleotide sequences and Cry1Ac nucleotide sequences are It is incorporated in the genome of detected milpa, and proceeds to the milpa of Cry1Ab-01 nucleotide sequences, proceeds to The milpa of Cry1Ab-02 nucleotide sequences, the milpa for proceeding to Cry1Ab-01-Vip3A nucleotide sequences, proceed to The milpa of Cry1A.105 nucleotide sequences, the milpa for proceeding to Cry1A.105-Cry2Ab nucleotide sequences and proceed to The milpa of Cry1Ac nucleotide sequences obtains the transgenic corn plant of single copy.

5th embodiment, the insect resistant effect detection of transgenic corn plant

The milpa of Cry1Ab-01 nucleotide sequences will be proceeded to, proceed to the jade of Cry1Ab-01-Vip3A nucleotide sequences Rice plant；The milpa for proceeding to Cry1Ab-02 nucleotide sequences, the milpa for proceeding to Cry1A.105 nucleotide sequences, turn The milpa for entering Cry1A.105-Cry2Ab nucleotide sequences and the milpa for proceeding to Cry1Ac nucleotide sequences；Accordingly Wild-type corn plant, and be accredited as not genetically modified milpa through Taqman insect resistant effect inspection carried out to Lloyd's armyworm Survey.

Take respectively and proceed to the milpa of Cry1Ab-01 nucleotide sequences, proceed to Cry1Ab-01-Vip3A nucleotide sequences Milpa, proceed to Cry1Ab-02 nucleotide sequences milpa, proceed to Cry1A.105 nucleotide sequences corn plant Strain, proceed to Cry1A.105-Cry2Ab nucleotide sequences milpa, proceed to Cry1Ac nucleotide sequences milpa, Wild-type corn plant and the fresh blade (lobus cardiacus) of not genetically modified milpa (V3-V4 phases) is accredited as through Taqman, use Aseptic water washing is clean and blots the water on blade with gauze, and maize leaf is removed vein then, at the same be cut into about 1cm × The strip of 4cm, take 1 cut after strip blade be put on the moisturizing filter paper of round plastic culture dish bottom, each culture 10 Lloyd's armyworms (newly hatched larvae) are put in ware, after worm examination culture dish is added a cover, in temperature 25-28 DEG C, relative humidity 70%- 80%th, the photoperiod (light dark) 16:After placing 3 days under conditions of 8, fatal rate and the blade injury feelings of Lloyd's armyworm larva are counted Condition, fatal rate=death borer population/connect worm sum × 100%.Proceed to totally 3 strains (S1, S2 of Cry1Ab-01 nucleotide sequences And S3), totally 3 strains (S7, S8, S9) of Cry1Ab-02 nucleotide sequences are proceeded to, Cry1Ab-01-Vip3A nucleotides is proceeded to Totally 3 strains (S4, S5 and S6) of sequence, proceed to totally 3 strains (S10, S11 and S12) of Cry1A.105 nucleotide sequences, Totally 3 strains (S13, S14 and S15) of Cry1A.105-Cry2Ab nucleotide sequences are proceeded to, Cry1Ac nucleotide sequences are proceeded to Totally 3 strains (S16, S17 and S18), be accredited as not genetically modified (NGM) totally 1 strain, (CK) of wild type through Taqman Totally 1 strain；5 plants are selected to be tested from each strain, per plant is repeated 3 times.As a result as shown in table 1.

Table 1, transgenic corn plant is inoculated with the pest-resistant experimental result of Lloyd's armyworm

The result of table 1 shows：Proceed to the milpa of Cry1Ab-01 nucleotide sequences, proceed to Cry1Ab-02 nucleotides sequences The milpa of row, the milpa for proceeding to Cry1Ab-01-Vip3A nucleotide sequences, proceed to Cry1A.105 nucleotide sequences Milpa, proceed to the milpa of Cry1A.105-Cry2Ab nucleotide sequences and proceed to the jade of Cry1Ac nucleotide sequences Rice plant pair Lloyd's armyworm is respectively provided with preferable insecticidal effect, and the fatal rate of newly hatched larvae especially contains more than 85% The newly hatched larvae fatal rate of the milpa of Cry1Ab and Cry1A.105 compositions even up to more than 97%；And wild-type corn Plant and Taqman are accredited as the newly hatched larvae fatal rate of not genetically modified plant typically 15% or so.

Testing result is it is also shown that proceeding to the milpa of Cry1Ab-01 nucleotide sequences, proceeding to Cry1Ab-02 nucleotides The milpa of sequence, the milpa for proceeding to Cry1Ab-01-Vip3A nucleotide sequences, proceed to Cry1A.105 nucleotides sequences The milpa of row, the milpa for proceeding to Cry1A.105-Cry2Ab nucleotide sequences and proceed to Cry1Ac nucleotide sequences Milpa is generally only subject to slight damage, and visually cannot almost identify Lloyd's armyworm takes food vestige.

Thus prove proceed to the milpa of Cry1Ab-01 nucleotide sequences, proceed to the jade of Cry1Ab-02 nucleotide sequences Rice plant, proceed to the milpa of Cry1Ab-01-Vip3A nucleotide sequences, proceed to the corn of Cry1A.105 nucleotide sequences Plant, the milpa for proceeding to Cry1A.105-Cry2Ab nucleotide sequences and proceed to the milpa of Cry1Ac nucleotide sequences All show the activity of high anti-Lloyd's armyworm, this activity be enough to the growth to Lloyd's armyworm produce ill effect so that its Field is controlled.Caused harm by controlling Lloyd's armyworm simultaneously, it is also possible to reduce the generation of disease on corn, greatly improved The yield and quality of corn.

In sum, the purposes of insecticidal proteins of the present invention is by producing the Cry1A that can kill Lloyd's armyworm in plant body Albumen is controlling Lloyd's armyworm insect；Cultural control method, chemical prevention and control method and the physical control side used with prior art Method is compared, and the present invention carries out the protection of the time of infertility, whole plant to prevent and treat the infringement of Lloyd's armyworm insect to plant, and without dirt Dye, noresidue, effect stability, thoroughly are simple, convenient, economical.

It should be noted last that, above example is only unrestricted in order to technical scheme to be described, although ginseng The present invention is described in detail according to preferred embodiment, it will be understood by those within the art that, can be to the present invention Technical scheme modify or equivalent, without deviating from the spirit and scope of technical solution of the present invention.

Claims (20)

1. a kind of control Lloyd's armyworm insect method, it is characterised in that include by Lloyd's armyworm insect at least with Cry1A albumen Contact.

2. the method for control Lloyd's armyworm insect according to claim 1, it is characterised in that the Cry1A albumen is present In the host cell at least producing the Cry1A albumen, the Lloyd's armyworm insect is by ingesting the host cell at least Contact with the Cry1A albumen.

3. the method for control Lloyd's armyworm insect according to claim 2, it is characterised in that the Cry1A albumen is present In the bacterium or genetically modified plants at least producing the Cry1A albumen, the Lloyd's armyworm insect is by the bacterium that ingests Or the tissue of the genetically modified plants is at least contacted with the Cry1A albumen, the Lloyd's armyworm insect growth after contact is subject to Suppress and/or cause death, to realize the control that plant is endangered to Lloyd's armyworm.

4. the method for control Lloyd's armyworm insect according to claim 3, it is characterised in that the genetically modified plants can be with It is in any breeding time.

5. according to claim 3 control Lloyd's armyworm insect method, it is characterised in that the group of the genetically modified plants It is woven to blade, stalk, fruit, tassel, female fringe, flower pesticide or filigree.

6. according to claim 3 control Lloyd's armyworm insect method, it is characterised in that described to Lloyd's armyworm endanger The control of plant does not change because planting the change in place and/or implantation time.

7. according to any one of claim 3 to 6 control Lloyd's armyworm insect method, it is characterised in that the plant For corn, wheat, Chinese sorghum, millet, paddy rice or soybean.

8. according to any one of claim 2 to 7 control Lloyd's armyworm insect method, it is characterised in that the contact The step of before step is the plant of polynucleotides of the plantation containing the coding Cry1A albumen.

9. according to any one of claim 1 to 8 control Lloyd's armyworm insect method, it is characterised in that the Cry1A Albumen is Cry1Ab albumen, Cry1A.105 albumen or Cry1Ac albumen.

10. according to claim 9 control Lloyd's armyworm insect method, it is characterised in that the Cry1A histone aminos Acid sequence has SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3 or SEQ ID NO:Amino acid sequence shown in 4.

The method of 11. control Lloyd's armyworm insects according to claim 10, it is characterised in that the Cry1A albumen Nucleotide sequence has SEQ ID NO:5、SEQ ID NO:6、SEQ ID NO:7 or SEQ ID NO:Nucleotides sequence shown in 8 Row.

The method of the 12. control Lloyd's armyworm insects according to any one of claim 2 to 11, it is characterised in that the plant Thing also includes at least one second nucleotides different from encoding the nucleotides of the Cry1A albumen.

The method of 13. control Lloyd's armyworm insects according to claim 12, it is characterised in that second nucleotides Coding Cry class insect-killing proteins, Vip class insect-killing proteins, protease inhibitors, agglutinin, AMS or peroxidase.

The method of 14. control Lloyd's armyworm insects according to claim 13, it is characterised in that second nucleotides Coding Vip3A albumen or Cry2Ab albumen.

The method of 15. control Lloyd's armyworm insects according to claim 14, it is characterised in that second nucleotides There is SEQ ID NO:9 or SEQ ID NO:Nucleotide sequence shown in 10.

The method of 16. control Lloyd's armyworm insects according to claim 13, it is characterised in that second nucleotides For suppressing the dsRNA of important gene in target insect pests.

A kind of 17. Cry1A protein control the purposes of Lloyd's armyworm insect.

A kind of 18. methods of the plant for producing control Lloyd's armyworm insect, it is characterised in that include the genome to the plant The middle polynucleotide sequence for introducing coding Cry1A albumen.

A kind of 19. methods of the vegetable seeds for producing control Lloyd's armyworm insect, it is characterised in that include by claim 18 The first plant that methods described is obtained is hybridized with the second plant, so as to produce the polynucleotide sequence containing coding Cry1A albumen Seed.

A kind of 20. methods of the plant of culture control Lloyd's armyworm insect, it is characterised in that include：

At least one vegetable seeds of plantation, the genome of the vegetable seeds include the polynucleotides sequence for encoding Cry1A albumen Row；

The vegetable seeds is made to grow up to plant；

Make the plant raw under conditions of artificial infection Lloyd's armyworm insect and/or Lloyd's armyworm insect naturally-occurring harm Long, harvest the plant of the polynucleotide sequence that there is no coding Cry1A albumen with other compared with the plant injury for weakening and/ Or the plant with increased plant products.