CN103719137B - Pest control method - Google Patents

Abstract

The invention relates to a method for controlling prodenia litura pests. The method comprises the step that the prodenia litura pests are contacted with Cry1F protein. According to the invention, the prodenia litura pests are controlled by Cry1F protein which is generated in plants and can kill prodenia litura; and compared with an agricultural control method, a chemical control method and a physical control method used in the prior art, the pest control method can be used for protecting whole plants at the whole growth periods so as to prevent and control attack of the prodenia litura pests, and is further free of pollution and residue, stable and thorough in effect, simple, convenient and economical.

Description

The method of Control pests

Technical field

The present invention relates to a kind of method of Control pests, particularly relate to a kind of Cry1F albumen of expressing in plant of being used in and to cause harm the method for plant to control prodenia litura.

Background technology

Prodenia litura (Prodenia litura) belongs to lepidopteran Noctuidae, for omnivory and binge insect, host of causing harm is quite extensive, except corn and soybean, also can endanger and comprise melon, eggplant, beans, green onion, leek, spinach and brassicaceous vegetable, grain, cash crop Deng Jin 100 section, 300 various plants; The worldwide distribution of spodoptera, there is generation domestic various places, mainly occur in the Yangtze valley and the Huanghe valley.Prodenia litura mainly with larva cause harm complete stool, younger ones in an age group time blade back of trooping gnaw; After 3 ages, cause harm blade, tender stem, mature larvae of dispersion can eat into food fruit.

Corn and soybean are Chinese important food crop, every year because the grain loss that prodenia litura is caused is huge, have influence on the survival state of local population what is more.In order to prevent and treat prodenia litura, the main prevention and controls that people adopt usually has: cultural control, chemical prevention and physical control.

Cultural control is that regulation and control crop, insect, environmental factors, creation one are conducive to plant growth and are unfavorable for the farmland ecological environment that prodenia litura occurs multifactorial for whole farmland ecosystem comprehensive coordination management.As weeded a garden, turning over after results and shine soil or pour water, to destroy or to worsen its place of pupating, contribute to reducing worm source; Or extract the newly hatched larvae of pieces of an egg and harm of trooping conveniently in conjunction with management, to reduce worm source.Because cultural control is mostly preventive measure, application has certain limitation, as emergency schedule, just can not seem helpless when prodenia litura is broken out.

Chemical prevention and pesticide control, utilize chemical insecticide to carry out kill pests, it is the important component part of the prodenia litura comprehensive regulation, it has fast, the feature of convenient, easy and high economic benefit, particularly when the large generation of prodenia litura, be absolutely necessary emergency schedule, and it can be eliminated before prodenia litura works the mischief.Current chemical prevention and control method mainly medicament sprays.But chemical prevention also has its limitation, as improper use often cause farm crop generation poisoning, insect develops immunity to drugs, and killed natural enemies, contaminate environment, make farmland ecosystem suffer the adverse consequencess such as destruction and the safety of pesticide residue to people, animal constitute a threat to.

Physical control mainly according to the reaction of insect to physical factor various in envrionment conditions, utilize various physical factor as optical, electrical, look, humiture etc. and mechanical means carry out trapping and killing, the method such as steriliation by irradiation carrys out pest control.Current Application comparison widely method mainly contain attract moths with lamps, syrupacetiacid bait trap and withy dip in and spill 500 times of Trichlorphon trapping moths; Although aforesaid method has prevention effect in various degree, operationally there is certain difficulty.

In order to solve cultural control, chemical prevention and physical control limitation in actual applications, scientists finds the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some insect-resistant transgenic plants to prevent and treat insect pest of the plant.Cry1F insecticidal proteins is the one in numerous insecticidal proteins, is the insoluble sexual partner's spore crystalline protein produced by bacillus thuringiensis.

Cry1F albumen is taken in by insect and is entered middle intestines, under toxalbumin parent toxin is dissolved in the alkaline pH environment of insect midgut.Parent toxin, by basic protein enzymic digestion, is transformed into active fragments by albumen N-and C-end; Receptors bind on active fragments and insect midgut epithelial cell membrane upper surface, inserts goldbeater's skin, causes cytolemma to occur perforation focus, destroys osmotic pressure change inside and outside cytolemma and pH balance etc., upsets the digestive process of insect, finally cause it dead.

The plant having proved to turn Cry1F gene can resist the infringement of the lepidopterans such as black cutworm (Lepidoptera) insect, but, there is no so far and control about by producing the transfer-gen plant of expressing Cry1F albumen the report that prodenia litura causes harm to plant.

Summary of the invention

The object of this invention is to provide a kind of method of Control pests, the transfer-gen plant provided first by producing expression Cry1F albumen controls the method that prodenia litura is caused harm to plant, and effectively overcomes the technological deficiencies such as prior art cultural control, chemical prevention and physical control.

For achieving the above object, the invention provides a kind of method controlling prodenia litura insect, comprise prodenia litura insect and Cry1F protein contact.

Preferably, described Cry1F albumen is Cry1Fa albumen.

Further, described Cry1Fa albumen is present in the vegetable cell producing described Cry1Fa albumen, and described prodenia litura insect is by described vegetable cell and the described Cry1Fa protein contact of ingesting.

Further, described Cry1Fa albumen is present in the transgenic plant producing described Cry1Fa albumen, described prodenia litura insect is by the tissue of the described transgenic plant that ingest and described Cry1Fa protein contact, after contact, the growth of described prodenia litura insect is suppressed and finally causes death, with the control of the plant that realizes causing harm to prodenia litura.

Described transgenic plant can be in any breeding time.

The tissue of described transgenic plant can be blade, stem stalk, tassel, female fringe, flower pesticide, filigree or fruit.

Described to prodenia litura cause harm plant control not because of plant place change and change.

Described the cause harm control of plant of prodenia litura not to be changed because of the change of implantation time.

Described plant can from corn, soybean, cotton, sweet potato, taro, lotus, sesbania, tobacco, beet, Chinese cabbage or eggplant.

Step before described contact procedure is the plant of the polynucleotide of plantation containing the described Cry1Fa albumen of coding.

Preferably, the aminoacid sequence of described Cry1Fa albumen has SEQ ID NO:1 or the aminoacid sequence shown in SEQ ID NO:2.The nucleotide sequence of described Cry1Fa albumen has SEQ ID NO:3 or the nucleotide sequence shown in SEQ IDNO:4.

On the basis of technique scheme, described plant can also produce the second Nucleotide that at least one is different from described Cry1Fa albumen.

Further, described the second Nucleotide can be encoded Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.

Preferably, described the second Nucleotide can be encoded Cry1Ab albumen, Cry1Ac albumen, Cry1Ba albumen or Vip3A albumen.

Further, described the second Nucleotide comprises SEQ ID NO:5 or the nucleotide sequence shown in SEQ ID NO:6.

Selectively, described the second Nucleotide is the dsRNA suppressing important gene in target insect pests.

For achieving the above object, present invention also offers the purposes that a kind of Cry1F protein controls prodenia litura insect.

In the present invention, the expression of Cry1F albumen in a kind of transgenic plant can along with the expression of one or more Cry class insect-killing protein and/or Vip class insect-killing protein.This kind of Pesticidal toxins co expression in same strain transgenic plant that exceedes can make plant comprise by genetic engineering and gene needed for expressing realizes.In addition, a kind of plant (the 1st parent) can express Cry1F protein by genetic engineering procedure, and the second plant (the 2nd parent) can express Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.The progeny plants of all genes of expressing introducing the 1st parent and the 2nd parent is obtained by the 1st parent and the 2nd parents.

RNA interference (RNA interference, RNAi) refer to high conservative during evolution, brought out by double-stranded RNA (double-stranded RNA, dsRNA), the phenomenon of the efficient selective degradation of homologous mRNA.Therefore the expression of specific gene in RNAi technology specific depletion or closedown target insect pests can be used in the present invention.

Prodenia litura (Prodenia litura) and black cutworm (Agrotis ypsilon Rottemberg) belong to lepidopteran Noctuidae together, are polyphagous pest-insect, all cause harm corn, soybean, cotton, sweet potato etc.However, prodenia litura and black cutworm be biologically clearly, distinct two species, at least there is the following key distinction:

1, distributed areas are different.The worldwide distribution of spodoptera, has generation all over China, mainly occurs in the province such as Henan, Hebei, Shandong of the Jiangxi of the Yangtze valley, Jiangsu, Hunan, Hubei, Zhejiang, Anhui and the Huanghe valley.And meadow is coveted noctuid and is mainly distributed in overseas, comprise the Canada in America, Mexico, the U.S., Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, French Guiana, Guyana, Paraguay, Peru, Suriname, Uruguay, Venezuela and whole Centro-American and Caribbean area.And black cutworm is global insect, also all have distribution in China various places, especially enrich with rainfall, the Yangtze valley that weather is moistening and southeastern coast generating capacity large, mostly occur at east and southern humid region in the Northeast.

2, Damage habits is different.Prodenia litura to be caused harm complete stool with larva, and blade back of trooping during younger ones in an age group gnaws lower epidermis and mesophyll, only stays the transparent spot of upper epidermis; Disperse to cause harm blade, tender stem after 3 ages; 4 ages entered gluttony later, stung food blade, only stayed master pulse; Mature larvae can eat into food fruit; Its feeding habits are not only assorted but also endanger each organ, and forming gluttony time aged, is the insect that a kind of hazardness is very large.And black cutworm belongs to subterranean pest-insect, 1-2 instar larvae all can be clustered in heart tender leaf place, seedling top round the clock and take food and cause harm; Disperse after 3 ages, larva Quick off the mark, have seemingly-dead habit, very responsive to light, be subject to agitation and namely crispatura agglomerating, hide daytime between the dry wet layer of table soil, be unearthed night from ground, seedling plants to be bitten broken and pull soil pit into or sting the seed that food is not unearthed, food tender leaf and blade and vegetative point is changed after the sclerosis of seedling stem, when inanition or searching hibernaculum, there is transport phenomena; It is high that high instar larvae cuts seedling rate, and food ingestion is large.

3, morphological specificity is different.

1) avette state is different: the ovum of prodenia litura is flat hemispherical, primiparity yellow-white, after become lead, bulk is bonded together, and above covers tawny fine hair; And the ovum of black cutworm becomes steamed bun shape, tool is carina in length and breadth, primiparity oyster white, and gradual change is yellow, ovum one top tool stain before hatching.

2) Larva Morpho. Logy is different: the long 33-50 millimeter of Spodoptera litura larvae body, head chocolate, and chest is changeable, has from khaki color to blackish green, the scattered small particles of body surface, and the Winter Solstice has subtriangular first quarter moon blackspot a pair, larva general 6 ages; And black cutworm larvae round shape, the long 37-50mm of mature larva body, head brown, the irregular reticulate pattern of tool chocolate, body ash is brown to dun, the particle that body surface is coarse, cloth is not of uniform size and separated from one another, lineback, sub-lineback and the equal chocolate of spiracle line, pronotum dun, tool two obvious Vandyke brown longitudinal bands, pereiopoda and abdominal foot tawny on tawny podical plate.

3) pupa form is different: the long 15-20mm of pupa of prodenia litura, round shape, sorrel, and afterbody has short a pair thorn; And the long 18-24mm of the pupa of black cutworm, russet have light, mouthpart is mutually neat with wing bud end, all stretch and reach the 4th uromere trailing edge, belly 4-7 saves back side leading edge central authorities Vandyke brown, and has thick punctum, and the tiny punctum of both sides extends near valve, 5-7 ventrite leading edge also has tiny punctum, and abdomen end tool short cremaster 1 is right.

4) adult form is different: prodenia litura becomes long about the 14-20mm of polypide, wing expanse 35-46mm, body dun, chest back side adularescent feathering, fore wing beige, decorative pattern is many, interior horizontal line and outer horizontal line white, there is the significantly oblique wealthy band line of white in wavy, centre, so claim prodenia litura, and the long 17-23mm of Agrotis Ypsilon body, wing expanse 40-54mm, head, chest back side dun, foot brown, front foot shin, digitus outer rim beige, middle metapedes respectively saves end beige ring grain, fore wing brown, frontal region chocolate, many dun within outer rim, baseline is light brown, horizontal line two-wire in black waviness, a circle greyness is had in black ring grain, kidney shape line black tool black surround, its outer middle part has the black line of a wedge shape to extend outer horizontal line, middle horizontal line dun waviness, the outer horizontal line brown of two-wire waviness, the sub-border line grey of irregular zig-zag, its inner rim has three pointed tooths between middle arteries and veins, on each arteries and veins, pore is had between sub-border line and outer horizontal line, border line black, filbert between outer horizontal line and sub-border line, chocolate beyond sub-border line, hind wing canescence, longitudinal vein and edge line brown, belly back side grey.

4, habit is different with pests occurrence rule.There is 4 generations (North China)-9 generation (Guangdong) in 1 year in prodenia litura, generally survive the winter in the weeds of base limit, field with mature larva or pupa, In Guangzhou Area is without phenomenon of really surviving the winter; Area to the north of the Yangtze valley, this worm is easily freezed to death winter, and winter issue is not yet come to a conclusion, and infers may migrate over from south in local worm source; The Yangtze valley is many to be occurred greatly in the 7-8 month, and the Huanghe valley is then many to be occurred greatly in the 8-9 month.Adult goes out activity night, and power of circling in the air is comparatively strong, and tool phototaxis and chemotaxis are particularly responsive to fermented products such as sweet and sour wine.Every only female moth can lay eggs 3-5 block, and every block about has ovum position 100-200, and ovum fecund, in the vein crotch of blade back, is laid eggs more with dense, dark green crop, and heap produces, and pieces of an egg are often covered with palea and are easily found, and the hatching thermophilic of ovum is about 24 DEG C; Larva is when temperature 25 DEG C, and go through 14-20 days, newly hatched larvae has harmness characteristics of trooping, and then starts dispersion after 3 ages, and mature larvae has volt property and seemingly-dead property in daytime, hides daytime at soil seam place more, climbs out of at dusk and takes food, and meets frightened will landing and rolls up death situation of playing tricks.When foodstuff is not enough or not at that time, larva can migrate to the harm of neighbouring field in groups, therefore has again being commonly called as of " armyworm "; The applicable soil humidity of pupating be soil moisture content about 20%, pupa time is 11-18 days.Prodenia litura is the insect of a kind of thermophily and resistant to elevated temperatures interval Rampant damage, and the growth thermophilic of each worm state is 28-30 DEG C, but at high temperature (33-40 DEG C), lives also normal; Cold hardiness is very weak, in the winter time under the long-time low temperature of about 0 DEG C, substantially can not survive.The general high temperature time and season favourable its grow, breeding, low temperature then easily causes the mortality of worm pupa.Though these worm feeding habits are mixed, foodstuff situation, comprises different hosts, even same host different developmental phases or organ, and the rich of foodstuff lacks, and has obvious impact to its fertility breeding.Between plant, multiple crop index field that is high or excessive close planting favourable its occur.Natural enemy has the braconid and polyhedrosis virus etc. of parasitic larva.And 3-4 generation occurs black cutworm for 1 year, mature larva or pupa are survived the winter in soil; Early spring, early March adult started to occur, generally mid or late March and April early and middle ten days there will be two moth appearances and contain the phases; Adult outage on daytime, contains most to the activity first half of the night at dusk, likes eating acid, the fermented product of sweet, vinosity and various nectar, and having phototaxis, larva was divided into for 6 ages, and 1,2 instar larvaes first hide volt in the lobus cardiacus of assorted leather or plant, take food round the clock, at this moment appetite is very little, causes harm also very not remarkable; After 3 ages, daytime hides under table soil, and night out causes harm; 5,6 instar larvae appetite increase, and every bar larva one can bite dish seedling 4-5 strain broken night, and many reaches more than l0 strain; Larva 3 significantly increases the resistibility of medicament after age; It is the serious period that 1st generation larva is caused harm to mid-April by the end of March; Occur all to see from October in April, the 2nd from generation to generation and occur and cause harm; The Northwest two is to three generations, and to the north of Great Wall, general year two arrives three generations, year three generations to the north of the Yellow River on the south Great Wall, the Yellow River to reach Nian Sidai along the Yangtze River in the south, generation in year four to five on the south the Changjiang river, generation in South Subtropical Area of China year six to seven; No matter generation is how many year, and production causes the first brood of larvae that is of seriously causing harm; South the winter generation adult February occur, the national most area emergence Sheng phase late March on April, the middle ten days, Ningxia, the Inner Mongol are late April; Agrotis Ypsilon is many 3 to sprout wings in the afternoon up to evening 10 time, hides daytime in the place such as foreign material and gap, starts to circle in the air, look for food after dusk, mating after 3-4 days, to lay eggs; Ovum fall apart originate on the close weeds of short leaf and seedling, minority originates in dead leaf, in soil seam, the place near the ground ovum that falls is maximum, often female 800-1000 grain of laying eggs, nearly 2000; About about 5 days ovum phase, larva 6 age, indivedual 7-8 age, larval stage, differs greatly in various places, but the first-generation is about 30-40 days; Pupate in dark about 5cm soil room after larva is aging, pupa time is about 9-19 days; To the growth of black cutworm and disadvantage of reproduction, thus there is comparatively small amt in high temperature summer, suitable survival temperature is 15 DEG C-25 DEG C; Winter temperature is too low, and the mortality ratio of black cutworm larvae increases; All physical features low humidities, the place that rainfall is abundant, occurs more; The first year autumn rain many, soil humidity is large, weedy to be conducive to Adult worms producting eggs and larval feeding movable, is the omen of the large generation of Second Year; But precipitation is too much, and humidity is excessive, is unfavorable for larvae development, very easily dead after first instar larvae waterflooding; Adult worms producting eggs Sheng phase soil moisture content causes harm heavier in the area of 15-20%; Silty loam, easily permeable, draining is rapid, is suitable for black cutworm breeding, and heavy clay and sandy soil then occur lighter.

Comprehensively above-mentioned, can determine that prodenia litura and black cutworm are two kinds of insects, and sibship is comparatively far away, mating cannot produces offspring.

The genome of the plant described in the present invention, plant tissue or vegetable cell, refers to any genetic material in plant, plant tissue or vegetable cell, and comprises nucleus and plastid and Mitochondrial Genome Overview.

" contact " described in the present invention, refer to insect and/or insect touching, stop and/or feeding plant, plant organ, plant tissue or vegetable cell, described plant, plant organ, plant tissue or vegetable cell both can be its expression in vivo insecticidal proteins, can also be described plant, the surface of plant organ, plant tissue or vegetable cell has insecticidal proteins and/or have and produce the microorganism of insecticidal proteins.

Polynucleotide described in the present invention and/or Nucleotide are formed complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, under polynucleotide of the present invention and/or Nucleotide can being placed in the regulating and controlling sequence control of object host.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand creating DNA in plant.Like this, the present invention includes the use of polynucleotide to example in sequence table and complementary strand thereof." coding strand " that this area often uses refers to the chain be combined with antisense strand.In order to marking protein in vivo, DNA chain is transcribed into the complementary strand of a mRNA by typical case, and it translates protein as template.MRNA is actually and transcribes from " antisense " chain of DNA." have justice " or " coding " chain has a series of codon (codon is three Nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form target protein matter or peptide.The present invention also comprises RNA and the PNA(peptide nucleic acid(PNA) having suitable function with the DNA of example).

Nucleic acid molecule of the present invention or its fragment under strict conditions with Cry1Fa gene recombination of the present invention.The nucleic acid hybridization of any routine or amplification method may be used to the existence identifying Cry1Fa gene of the present invention.Nucleic acid molecule or its fragment can carry out specific hybrid with other nucleic acid molecule in any case.In the present invention, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementary completely, then one of them nucleic acid molecule is claimed to be another nucleic acid molecule " complement ".In the present invention, when corresponding nucleotide complementary with another nucleic acid molecule of each Nucleotide of a nucleic acid molecule, then these two nucleic acid molecule are claimed to demonstrate " complete complementary ".If two nucleic acid molecule can make their annealing and being bonded to each other under at least conventional " low strict " condition with enough stability phase mutual crosses, then claim these two nucleic acid molecule for " minimum level is complementary ".Similarly, if two nucleic acid molecule can make them anneal under " highly strict " condition of routine and be bonded to each other with enough stability phase mutual crosses, then these two nucleic acid molecule are claimed to have " complementarity ".Depart from from complete complementary and can allow, depart from as long as this and not exclusively stop two molecules to form duplex structure.In order to enable a nucleic acid molecule as primer or probe, only need to ensure that it has sufficient complementarity in sequence, to make form stable duplex structure under adopted specific solvent and salt concn.

In the present invention, the sequence of basic homology is one section of nucleic acid molecule, this nucleic acid molecule under high stringency can with the complementary strand generation specific hybrid of another section of nucleic acid molecule matched.Promote the stringent condition be applicable to of DNA hybridization, such as, process greatly under 45 DEG C of conditions by 6.0 × sodium chloride/sodium citrate (SSC), then wash with 2.0 × SSC under 50 DEG C of conditions, these conditions are known to those skilled in the art.Such as, the salt concn in washing step can be selected from Low stringency conditions about 2.0 × SSC, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature condition in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be elevated to about 65 DEG C of high stringency.Temperature condition and salt concn can all change, and also can one of them to remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 × SSC, 0.5%SDS solution, with SEQ ID NO:3 or SEQ ID NO:4, specific hybrid occurs, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time at 65 DEG C.

Therefore, there is anti-insect activity and the sequence of hybridizing with SEQ ID NO:3 of the present invention and/or SEQ IDNO:4 under strict conditions comprises in the present invention.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about sequence homology of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger.

Gene described in the present invention and protein not only comprise specific exemplary sequence, the part also comprising the insecticidal activity feature of the protein saving described particular example with/fragment (comprising compared with full length protein and/or terminal deletion), variant, mutant, substituent (having alternative amino acid whose protein), mosaic and fusion rotein.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity.Described " equivalent protein " refers to the bioactive albumen with the albumen of claim with identical or substantially identical anti-prodenia litura insect.

" fragment " or " brachymemma " of the DNA molecular described in the present invention or protein sequence refers to a part or its artificial reconstructed form (being such as applicable to the sequence of expression of plants) of original DNA or the protein sequence (Nucleotide or amino acid) related to, can there is change in the length of foregoing sequences, but length is enough to guarantee that (coding) protein is insect toxins.

Use standard technique can build gene variant with being easy to by modifying factor.Such as, the technology of well known manufacturing place sudden change.Such as U.S. Patent number 5605793 describes and after random fracture, to use DNA to reassembly produce the method for other molecular diversity again.Commercialization endonuclease can be used to manufacture the fragment of full-length gene, and exonuclease can be used according to standard program.Such as, enzyme such as Bal31 or site-directed mutagenesis can be used to excise Nucleotide from the end system of these genes.Multiple restriction enzyme can also be used to obtain the gene of encode active fragments.Proteolytic enzyme can be used directly to obtain the active fragments of these toxin.

The present invention can derive equivalent protein and/or the gene of these equivalent protein of encoding from B.t. isolate and/or DNA library.Multiple method is had to obtain insecticidal proteins of the present invention.Such as, the present invention's antibody that is open and claimed insecticidal proteins can be used to identify from protein mixture and be separated other albumen.Especially, antibody may be that the most constant by albumen and the most different from other B.t. albumen protein parts causes.Then these antibody can be used exclusively to identify the equivalent protein of activity characteristic by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western immunoblot method.This area standard program can be used to be easy to the antibody of the fragment preparing albumen or equivalent protein or this proteinoid disclosed in the present invention.Then the gene of these albumen of coding can be obtained from microorganism.

Due to the Feng Yuxing of genetic codon, multiple different DNA sequence dna can be encoded identical aminoacid sequence.Produce the alternative DNA sequence dna of the identical or substantially identical albumen of these codings just in the state of the art of those skilled in the art.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to aminoacid replacement, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment retaining insecticidal activity.

The replacement of aminoacid sequence in the present invention, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, and namely folding the and/or active conserved amino acid of not remarkably influenced albumen replaces; Little disappearance, usually about 1-30 amino acid whose disappearance; Little amino or carboxyl terminal extend, and such as aminoterminal extends a methionine residues; Little connection peptides, such as an about 20-25 residue is long.

The conservative example replaced is the replacement occurred in following amino acid group: basic aminoacids (as arginine, Methionin and Histidine), acidic amino acid (as L-glutamic acid and aspartic acid), polare Aminosaeren (as glutamine, l-asparagine), hydrophobic amino acid (as leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid (as phenylalanine, tryptophane and tyrosine), and small molecules amino acid (as glycine, L-Ala, Serine, Threonine and methionine(Met)).Usually those aminoacid replacement not changing given activity are well-known in this area, and by, such as, N.Neurath and R.L.Hill was described in new york academic press (Academic Press) " Protein " that publish in 1979.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art apparently, this replacement can occur outside the region played an important role to molecular function, and still produces active polypeptide.For by polypeptide of the present invention, it is active required and therefore select amino-acid residue of not being substituted, can according to methods known in the art, as site-directed mutagenesis or alanine scanning mutagenesis carry out identifying (as see, Cunningham and Wells, 1989, Science244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in the molecule, detects the anti-insect activity of gained mutating molecule, thus determines the amino-acid residue wanted of overstating to this molecular activity.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (see, as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBS Letters309:59-64).

In the present invention, Cry1F albumen includes but not limited to Cry1Fa2, Cry1Fa3, Cry1Fb3, Cry1Fb6 or Cry1Fb7 albumen, or has at least 70% homology with the aminoacid sequence of above-mentioned albumen and prodenia litura had to desinsection fragment or the functional area of insecticidal activity.

Therefore, the aminoacid sequence having certain homology with the aminoacid sequence shown in sequence 1 and/or 2 is also included within the present invention.These sequences and sequence similarities/homogeny of the present invention are typically greater than 60%, are preferably greater than 75%, are preferredly greater than 80%, are even preferredly greater than 90%, and can be greater than 95%.Also can according to homogeny particularly and/or similarity scope definition preferred polynucleotide of the present invention and protein.Homogeny and/or the similarity of 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% is such as had with the sequence of example of the present invention.

Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhanser, leader sequence, intron and other be operably connected to the adjustment sequence of described Vip proteinoid and Cry proteinoid.

Described promotor is effable promotor in plant, and described " in plant effable promotor " refers to and guarantee that connected encoding sequence carries out the promotor expressed in vegetable cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from the promotor etc. of the 35S promoter of cauliflower mosaic virus, ubi promoter of maize, paddy rice GOS2 gene.Alternatively, in plant, effable promotor can be tissue-specific promotor, namely this promotor in some tissues of plant as instructed the expression level of encoding sequence higher than its hetero-organization (test by conventional RNA and measure) of plant in chlorenchyma, as PEP carboxylase promoter.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound caused, is significantly increased under the expression compared with normal growth conditions of the encoding sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the proteolytic enzyme suppressor gene (pin I and pin II) of potato and tomato and the promotor of zein enzyme level gene (MPI).

Described transit peptides (also known as secretory signal sequence or targeting sequencing) instructs transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, such as, utilize encoding chloroplast transit peptide sequence target chloroplast(id), or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described leader sequence including but not limited to, picornavirus leader sequence, as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); Potyvirus leaders, as MDMV(Maize Dwarf Mosaic Virus) leader sequence; Human immunoglobulin matter heavy-chain binding protein matter (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.

Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.

For monocotyledons application for, described intron including but not limited to, corn hsp70 intron, maize ubiquitin intron, Adh introne 1, crose synthase intron or paddy rice Act1 intron.For dicotyledons application for, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can for the applicable polyadenylation signal sequence worked in plant, include but not limited to, derive from the polyadenylation signal sequence of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene, derive from protease-inhibitor Ⅱ (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

" effectively connect " described in the present invention represents the connection of nucleotide sequence, and described connection makes a sequence can provide function concerning needing linked sequence." effectively connect " in the present invention and can, for promotor to be connected with interested sequence, make transcribing of this interested sequence be subject to the control of this promotor and regulation and control." effectively connect " when interested sequence encoding albumen and when going for the expression of this albumen and represent: promotor is connected with described sequence, and the mode be connected makes the transcript efficient translation obtained.If the connection of promotor and encoding sequence is transcript when merging and want the expression realizing the albumen of encoding, manufactures such connection, make the first translation initiation codon in the transcript obtained be the initiator codon of encoding sequence.Alternatively, if the connection of promotor and encoding sequence is translated when merging and want the expression realizing the albumen of encoding, manufacture such connection, the first translation initiation codon of containing in 5 ' non-translated sequence and promotor are connected, and mode of connection make the translation product obtained meet reading frame with the relation of the translation opening code-reading frame of the albumen wanted of encoding.The nucleotide sequence that can " effectively connect " includes but not limited to: sequence (the i.e. gene expression element providing genetic expression function, such as promotor, 5 ' untranslated region, intron, protein encoding regions, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA border sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), sequence (the i.e. antibiotic resistance markers of selectivity function is provided, biosynthesis gene), the sequence of marker function of can scoring is provided, interior sequence (the i.e. polylinker sequence of assisting series of operations of external or body, Site-specific recombinase sequence) and sequence (the i.e. replication orgin of bacterium of copy function is provided, autonomously replicating sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is prodenia litura insect.

In the present invention, Cry1F albumen has toxicity to prodenia litura insect.Plant in the present invention, particularly soybean and corn, containing foreign DNA in its genome, described foreign DNA comprises the nucleotide sequence of coding Cry1F albumen, prodenia litura insect is by feeding plant tissue and this protein contact, and after contact, the growth of prodenia litura insect is suppressed and finally causes death.Suppression refers to lethal or sub-lethal.Meanwhile, plant should be morphologically normal, and the consumption can cultivated under conventional approaches for product and/or generation.In addition, this plant can basically eliminate to chemistry or the needs (sterilant that described chemistry or biotic pesticide are the prodenia litura insect for Cry1F albumen institute target) of biotic pesticide.

In vegetable material, the expression level of insecticidal crystal protein (ICP) detects by multiple method described in this area, such as undertaken quantitatively by applying the mRNA of special primer to the coded insect-killing protein produced in tissue, or the amount of the insect-killing protein of directly specific detection generation.

The insecticidal effect of ICP in different test determination plants can be applied.In the present invention, targeted insect is mainly prodenia litura.

In the present invention, described Cry1F albumen can have SEQ ID NO:1 and/or the aminoacid sequence shown in SEQ IDNO:2 in sequence table.Except comprising the coding region of Cry1F albumen, also can comprise other elements, the protein of such as encoding selection markers.

In addition, the expression cassette comprising the nucleotide sequence of code book invention Cry1F albumen can also be expressed in plant together with the protein of at least one encoding herbicide resistance gene, described herbicide resistance gene includes but not limited to, glufosinates resistant gene is (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), Glyphosate resistance gene (as EPSPS gene), bromoxynil (bromoxynil) resistant gene, sulfonylurea resistance gene, to the resistant gene of weedicide dalapon, to the resistant gene of cyanamide or the resistant gene of glutamine synthetase inhibitor (as PPT), thus acquisition had both had high insecticidal activity, there are again the transgenic plant of Herbicid resistant.

In the present invention, by Exogenous DNA transfered plant, as by the gene of described for coding Cry1F albumen or expression cassette or recombinant vectors importing vegetable cell, conventional method for transformation includes but not limited to, Agrobacterium-medialed transformation, trace launch bombardment, direct DNA DNA being taken in the mediation of protoplastis, electroporation or silicon whisker imports.

The invention provides a kind of method of Control pests, have the following advantages:

1, internal cause control.Prior art mainly controls causing harm of prodenia litura insect by external action and external cause, as cultural control, chemical prevention and physical control; And the present invention controls prodenia litura insect by producing the Cry1F albumen that can kill prodenia litura in plant materials, namely prevented and treated by internal cause.

2, pollution-free, noresidue.Although the chemical prevention and control method that prior art uses serving certain effect to controlling causing harm of prodenia litura insect, also pollution being brought to people, animal and farmland ecosystem simultaneously, destroying and remain; Use the present invention to control the method for prodenia litura insect, above-mentioned adverse consequences can be eliminated.

3, control in the time of infertility.The method of the control prodenia litura insect that prior art uses is all interim; and the present invention is protection plant being carried out to the time of infertility; transgenic plant (Cry1F albumen) from germination, growth, until bloom, result, the infringement suffering prodenia litura can be avoided.

4, whole plant control.The method of the control prodenia litura insect that prior art uses is locality mostly, as foliage-spray; And the present invention protects whole plant, blade, stem stalk, tassel, female fringe, flower pesticide, filigree, fruit etc. as transgenic plant (Cry1F albumen) all can resist prodenia litura infringement.

5, effect stability.What prior art used is that cultural control method or physical control method all need to utilize envrionment conditions to prevent and treat insect, and variable factor is more; The present invention makes described Cry1F albumen express in plant materials, efficiently avoid the defect of envrionment conditions instability, and the prevention effect of transgenic plant of the present invention (Cry1F albumen) in different location, different time, different genetic background is also all stable and consistent.

6, simple, convenient, economical.The physical control method that prior art uses has certain difficulty in agriculture production operation; The present invention only need plant the transgenic plant can expressing Cry1F albumen, and does not need to adopt other measure, thus saves a large amount of human and material resources and financial resources.

7, effect is thorough.The method of the control prodenia litura insect that prior art uses, its effect is halfway, only plays and alleviates effect; And transgenic plant of the present invention (Cry1F albumen) can cause the mortality of just incubating Spodoptera litura larvae, and great suppression is caused to small portion survival larvae development progress, after 3 days larva be substantially still in state of just incubating or between just incubating-negative control state between, it is all obvious dysplasia, and stasi, transgenic plant are only subject to slight damage substantially.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN01-T containing Cry1Fa-01 nucleotide sequence of the method for Control pests of the present invention builds schema;

Fig. 2 is that the recombinant expression vector DBN100014 containing Cry1Fa-01 nucleotide sequence of the method for Control pests of the present invention builds schema;

Fig. 3 is that the recombinant expression vector DBN100015 containing Cry1Fa-01 nucleotide sequence of the method for Control pests of the present invention builds schema;

Fig. 4 is the insect resistant effect figure of the transgenic corn plant inoculation prodenia litura of the method for Control pests of the present invention;

Fig. 5 is the insect resistant effect figure of the Transgenic soybean plants inoculation prodenia litura of the method for Control pests of the present invention.

Embodiment

The technical scheme of the method for Control pests of the present invention is further illustrated below by specific embodiment.

The acquisition of the first embodiment, Cry1Fa gene and synthesis

1, Cry1Fa nucleotide sequence is obtained

The aminoacid sequence (605 amino acid) of Cry1Fa-01 insect-killing protein, as shown in SEQ IDNO:1 in sequence table; Encode corresponding to the Cry1Fa-01 nucleotide sequence (1818 Nucleotide) of the aminoacid sequence (605 amino acid) of described Cry1Fa-01 insect-killing protein, as shown in SEQ ID NO:3 in sequence table; The aminoacid sequence (1148 amino acid) of Cry1Fa-02 insect-killing protein, as shown in SEQ ID NO:2 in sequence table; Encode corresponding to the Cry1Fa-02 nucleotide sequence (3447 Nucleotide) of the aminoacid sequence (1148 amino acid) of described Cry1Fa-02 insect-killing protein, as shown in SEQ ID NO:4 in sequence table.

2, Cry1Ab and Vip3A nucleotide sequence is obtained

The Cry1Ab nucleotide sequence (2457 Nucleotide) of the aminoacid sequence (818 amino acid) of coding Cry1Ab insect-killing protein, as shown in SEQ ID NO:5 in sequence table; The Vip3A nucleotide sequence (2370 Nucleotide) of the aminoacid sequence (789 amino acid) of coding Vip3A insect-killing protein, as shown in SEQ ID NO:6 in sequence table.

3, above-mentioned nucleotide sequence is synthesized

Described Cry1Fa-01 nucleotide sequence (as shown in SEQ ID NO:3 in sequence table), as described in Cry1Fa-02 nucleotide sequence (as shown in SEQ ID NO:4 in sequence table), as described in Cry1Ab nucleotide sequence (as shown in SEQ ID NO:5 in sequence table) and as described in Vip3A nucleotide sequence (as shown in SEQ ID NO:6 in sequence table) synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' end of the described Cry1Fa-01 nucleotide sequence (SEQ ID NO:3) of synthesis is also connected with AscI restriction enzyme site, and 3 ' end of described Cry1Fa-01 nucleotide sequence (SEQ ID NO:3) is also connected with BamHI restriction enzyme site; 5 ' end of the described Cry1Fa-02 nucleotide sequence (SEQ ID NO:4) of synthesis is also connected with AscI restriction enzyme site, and 3 ' end of described Cry1Fa-02 nucleotide sequence (SEQ ID NO:4) is also connected with BamHI restriction enzyme site; 5 ' end of the described Cry1Ab nucleotide sequence (SEQ ID NO:5) of synthesis is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry1Ab nucleotide sequence (SEQ ID NO:5) is also connected with SpeI restriction enzyme site; 5 ' end of the described Vip3A nucleotide sequence (SEQ ID NO:6) of synthesis is also connected with ScaI restriction enzyme site, and 3 ' end of described Vip3A nucleotide sequence (SEQ ID NO:6) is also connected with SpeI restriction enzyme site.

The structure of the second embodiment, recombinant expression vector and recombinant expression vector transformation Agrobacterium

1, the recombinant cloning vector containing Cry1F gene is built

The Cry1Fa-01 nucleotide sequence of synthesis is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by Promega Products pGEM-T carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; Cry1Fa-01 is Cry1Fa-01 nucleotide sequence (SEQ ID NO:3); MCS is multiple clone site).

Then by recombinant cloning vector DBN01-T heat shock method transformation of E. coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 100rpm rotating speed shaking table shake), scribble IPTG(isopropylthio-β-D-galactoside on surface) and the chloro-3-indoles of the bromo-4-of X-gal(5--β-D-galactoside) LB flat board (the Tryptones 10g/L of penbritin (100 mg/litre), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, penbritin 100mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, the precipitation thalline solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings, 50mM glucose, pH8.0) suspend; Add the solution II (0.2M NaOH, 1%SDS(sodium lauryl sulphate) that 150 μ l newly prepare), pipe is put upside down 4 times, mixing, puts 3-5min on ice; Add the ice-cold solution III of 150 μ l (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, adds 2 times of volume dehydrated alcohols in supernatant liquor, and after mixing, room temperature places 5min; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, abandons supernatant liquor, and precipitation concentration (V/V) is dry after the washing with alcohol of 70%; Add 30 μ l containing RNase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, pH8.0) dissolution precipitation; Water-bath 30min at temperature 37 DEG C, digestion RNA; Save backup in temperature-20 DEG C.

The plasmid extracted is after AscI and BamHI enzyme cuts qualification, sequence verification is carried out to positive colony, result shows that the described Cry1Fa-01 nucleotides sequence inserted in recombinant cloning vector DBN01-T is classified as the nucleotide sequence shown in SEQ ID NO:3 in sequence table, and namely Cry1Fa-01 nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, the described Cry1Fa-02 nucleotide sequence of synthesis is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein, Cry1Fa-02 is Cry1Fa-02 nucleotide sequence (SEQ ID NO:4).Enzyme is cut and is correctly inserted with Cry1Fa-02 nucleotide sequence described in sequence verification recombinant cloning vector DBN02-T.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, be connected on cloning vector pGEM-T by the described Cry1Ab nucleotide sequence of synthesis, obtain recombinant cloning vector DBN03-T, wherein, Cry1Ab is Cry1Ab nucleotide sequence (SEQ ID NO:5).Enzyme is cut and is correctly inserted with Cry1Ab nucleotide sequence described in sequence verification recombinant cloning vector DBN03-T.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, be connected on cloning vector pGEM-T by the described Vip3A nucleotide sequence of synthesis, obtain recombinant cloning vector DBN04-T, wherein, Vip3A is Vip3A nucleotide sequence (SEQ ID NO:6).Enzyme is cut and is correctly inserted with Vip3A nucleotide sequence described in sequence verification recombinant cloning vector DBN04-T.

2, the recombinant expression vector containing Cry1F gene is built

With restriction enzyme A scI and BamHI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), between AscI and the BamHI site Cry1Fa-01 nucleotide sequence fragment cut being inserted into expression vector DBNBC-01, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression vector DBN100014, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:7); Cry1Fa-01:Cry1Fa-01 nucleotide sequence (SEQ ID NO:3); Nos: the terminator (SEQID NO:8) of rouge alkali synthetase gene; PMI: Phophomannose isomerase gene (SEQ ID NO:9); LB: left margin).

By recombinant expression vector DBN100014 heat shock method transformation of E. coli T1 competent cell, its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100014), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 100rpm rotating speed shaking table shake); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under temperature 37 DEG C of conditions, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, kantlex 50mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction.The plasmid restriction enzyme A scI of extraction and BamHI enzyme are cut rear qualification, and positive colony is carried out order-checking qualification, result shows that the nucleotides sequence of recombinant expression vector DBN100014 between AscI and BamHI site is classified as nucleotide sequence, i.e. Cry1Fa-01 nucleotide sequence shown in SEQ ID NO:3 in sequence table.

According to the method for above-mentioned structure recombinant expression vector DBN100014, AscI and BamHI enzyme is cut the described Cry1Fa-02 nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN02-T cuts, obtain recombinant expression vector DBN100013.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression vector DBN100013 containing nucleotide sequence shown in SEQ ID NO:4 in promising sequence table, i.e. Cry1Fa-02 nucleotide sequence, described Cry1Fa-02 nucleotide sequence can connect described Ubi promotor and Nos terminator.

According to the method for above-mentioned structure recombinant expression vector DBN100014, by AscI and BamHI, NcoI and SpeI respectively enzyme cut described Cry1Fa-01 nucleotide sequence that recombinant cloning vector DBN01-T and DBN03-T cut and Cry1Ab nucleotide sequence inserts expression vector DBNBC-01, obtain recombinant expression vector DBN100075.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression vector DBN100075 containing nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:5 in promising sequence table, i.e. Cry1Fa-01 nucleotide sequence and Cry1Ab nucleotide sequence, described Cry1Fa-01 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Cry1Ab nucleotide sequence.

According to the method for above-mentioned structure recombinant expression vector DBN100014, by AscI and BamHI, ScaI and SpeI respectively enzyme cut described Cry1Fa-01 nucleotide sequence that recombinant cloning vector DBN01-T and DBN04-T cut and Vip3A nucleotide sequence inserts expression vector DBNBC-01, obtain recombinant expression vector DBN100276.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression vector DBN100276 containing nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:6 in promising sequence table, i.e. Cry1Fa-01 nucleotide sequence and Vip3A nucleotide sequence, described Cry1Fa-01 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Vip3A nucleotide sequence.

According to the method for above-mentioned structure recombinant expression vector DBN100014, with restriction enzyme A scI and BamHI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-02(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), between AscI and the BamHI site Cry1Fa-01 nucleotide sequence fragment cut being inserted into expression vector DBNBC-02, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression vector DBN100015, it builds flow process (Kan: kanamycin gene as shown in Figure 3, RB: right margin, Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:7), Cry1Fa-01:Cry1Fa-01 nucleotide sequence (SEQID NO:3), Nos: the terminator (SEQ ID NO:8) of rouge alkali synthetase gene, PAT: careless fourth phosphinothricin acetyl transferase gene (SEQ ID NO:22), LB: left margin).

According to the method for above-mentioned structure recombinant expression vector DBN100015, AscI and BamHI enzyme is cut the described Cry1Fa-02 nucleotide sequence insertion expression vector DBNBC-02 that recombinant cloning vector DBN02-T cuts, obtain recombinant expression vector DBN100030.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression vector DBN100030 containing nucleotide sequence shown in SEQ ID NO:4 in promising sequence table, i.e. Cry1Fa-02 nucleotide sequence, described Cry1Fa-02 nucleotide sequence can connect described Ubi promotor and Nos terminator.

According to the method for above-mentioned structure recombinant expression vector DBN100015, by AscI and BamHI, NcoI and SpeI respectively enzyme cut described Cry1Fa-01 nucleotide sequence that recombinant cloning vector DBN01-T and DBN03-T cut and Cry1Ab nucleotide sequence inserts expression vector DBNBC-02, obtain recombinant expression vector DBN100012.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression vector DBN100012 containing nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:5 in promising sequence table, i.e. Cry1Fa-01 nucleotide sequence and Cry1Ab nucleotide sequence, described Cry1Fa-01 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Cry1Ab nucleotide sequence.

According to the method for above-mentioned structure recombinant expression vector DBN100015, by AscI and BamHI, ScaI and SpeI respectively enzyme cut described Cry1Fa-01 nucleotide sequence that recombinant cloning vector DBN01-T and DBN04-T cut and Vip3A nucleotide sequence inserts expression vector DBNBC-01, obtain recombinant expression vector DBN100031.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression vector DBN100031 containing nucleotide sequence shown in SEQ ID NO:3 and SEQ ID NO:6 in promising sequence table, i.e. Cry1Fa-01 nucleotide sequence and Vip3A nucleotide sequence, described Cry1Fa-01 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Vip3A nucleotide sequence.

3, recombinant expression vector transformation Agrobacterium

Agrobacterium LBA4404 (Invitrgen is transformed into building correct recombinant expression vector DBN100014, DBN100013, DBN100075, DBN100276, DBN100015, DBN100030, DBN100012 and DBN100031 liquid nitrogen method, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector), be placed in liquid nitrogen 10 minutes, 37 DEG C of warm water bath 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in LB test tube in temperature 28 DEG C, rotating speed is cultivate 2 hours under 200rpm condition, be applied on the LB flat board containing the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, with restriction enzyme A hdI and XhoI to recombinant expression vector DBN100014, DBN100013, DBN100012, DBN100075, DBN100015 and DBN100030 carries out digestion verification, with restriction enzyme A hdI and EcoRV, digestion verification is carried out to recombinant expression vector DBN100031 and DBN100276, result shows recombinant expression vector DBN100014, DBN100013, DBN100075, DBN100276, DBN100015, DBN100030, DBN100012 and DBN100031 structure is entirely true.

3rd embodiment, the acquisition proceeding to the milpa of Cry1F gene and checking

1, the milpa proceeding to Cry1F gene is obtained

The Agrobacterium infestation method conveniently adopted, the corn variety of sterile culture is combined 31(Z31) rataria and the second embodiment in Agrobacterium Dual culture described in 3, with the recombinant expression vector DBN100014 by 2 structures in the second embodiment, DBN100013, T-DNA(in DBN100075 and DBN100276 comprises the promoter sequence of corn Ubiquitin gene, Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Ab nucleotide sequence, Vip3A nucleotide sequence, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtain the milpa proceeding to Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, proceed to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to the milpa of Cry1Fa-01-Vip3A nucleotide sequence, in contrast with wild-type corn plant simultaneously.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from corn, rataria is contacted with agrobacterium suspension, wherein Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Fa-01-Cry1Ab nucleotide sequence and/or Cry1Fa-01-Vip3A nucleotide sequence can be passed at least one cell (step 1: infect step) of one of rataria by Agrobacterium, in this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.Rataria and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) at least there is the microbiotic (cephamycin) of a kind of known suppression Agrobacterium growth in, do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the rataria of inoculation cultivates the transformed calli (step 4: select step) that also growth selection on the substratum containing selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, is above cultivating with aftergrowth at solid medium (MS division culture medium and MS root media) containing the callus that the substratum of selective agent grows.

Screen the resistant calli obtained and transfer to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, then cultivates 8 hours at 20 DEG C.

2, the milpa of Cry1F gene is proceeded to TaqMan checking

The blade getting the milpa proceeding to Cry1Fa-01 nucleotide sequence, the milpa proceeding to Cry1Fa-02 nucleotide sequence, the milpa proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and the milpa that proceeds to Cry1Fa-01-Vip3A nucleotide sequence is respectively about 100mg as sample, extract its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, detected the copy number of Cry1F gene, Cry1Ab gene and Vip3A gene by Taqman fluorescence probe quantitative PCR method.In contrast with wild-type corn plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.

The concrete grammar detecting Cry1F gene, Cry1Ab gene and Vip3A gene copy number is as follows:

Step 11, get each 100mg of blade of the milpa proceeding to Cry1Fa-01 nucleotide sequence, the milpa proceeding to Cry1Fa-02 nucleotide sequence, the milpa proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence, the milpa proceeding to Cry1Fa-01-Vip3A nucleotide sequence and wild-type corn plant respectively, in mortar, be ground into homogenate with liquid nitrogen respectively, 3 repetitions got by each sample;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, use NanoDrop2000(Thermo Scientific) measure the genomic dna concentration of above-mentioned sample;

Step 14, adjust the genomic dna concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard substance, with the sample of wild-type corn plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Cry1Fa-01 nucleotide sequence:

Primer 1(CF1): CAGTCAGGAACTACAGTTGTAAGAGGG is as shown in SEQ ID NO:10;

Primer 2 (CR1): ACGCGAATGGTCCTCCACTAG is as shown in SEQ ID NO:11 in sequence table;

Probe 1(CP1): CGTCGAAGAATGTCTCCTCCCGTGAAC is as shown in SEQ ID NO:12;

Following primer and probe are used for detecting Cry1Fa-02 nucleotide sequence:

Primer 3(CF2): CAGTCAGGAACTACAGTTGTAAGAGGG is as shown in SEQ ID NO:13;

Primer 4(CR2): ACGCGAATGGTCCTCCACTAG is as shown in SEQ ID NO:14 in sequence table;

Probe 2(CP2): CGTCGAAGAATGTCTCCTCCCGTGAAC is as shown in SEQ ID NO:15;

Following primer and probe are used for detecting Cry1Ab nucleotide sequence:

Primer 5(CF3): CGAACTACGACTCCCGCAC is as shown in SEQ ID NO:16 in sequence table;

Primer 6(CR3): GTAGATTTCGCGGGTCAGTTG is as shown in SEQ ID NO:17 in sequence table;

Probe 3(CP3): CTACCCGATCCGCACCGTGTCC is as shown in SEQ ID NO:18 in sequence table;

Following primer and probe are used for detecting Vip3A nucleotide sequence:

Primer 7(VF1): ATTCTCGAAATCTCCCCTAGCG is as shown in SEQ ID NO:19 in sequence table;

Primer 8(VR1): GCTGCCAGTGGATGTCCAG is as shown in SEQ ID NO:20 in sequence table;

Probe 4(VP1): CTCCTGAGCCCCGAGCTGATTAACACC is as shown in SEQ ID NO:21;

PCR reaction system is:

Described 50 × primer/probe mixture comprises each 45 μ l of often kind of primer of 1mM concentration, the probe 50 μ l of 100 μMs of concentration and 860 μ l1 × TE damping fluids, and at 4 DEG C, is housed in amber tube.

PCR reaction conditions is:

Utilize SDS2.3 software (Applied Biosystems) analytical data.

Experimental result shows, Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Fa-01-Cry1Ab nucleotide sequence and Cry1Fa-01-Vip3A nucleotide sequence have been incorporated in the genome of detected milpa all, and proceed to the milpa of Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, the milpa proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and the milpa proceeding to Cry1Fa-01-Vip3A nucleotide sequence all obtain containing single copy Cry1F gene, the transgenic corn plant of Cry1Ab gene and/or Vip3A gene.

The insect resistant effect of the 4th embodiment, transgenic corn plant detects

By proceeding to the milpa of Cry1Fa-01 nucleotide sequence, the milpa proceeding to Cry1Fa-02 nucleotide sequence, the milpa proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence, the milpa proceeding to Cry1Fa-01-Vip3A nucleotide sequence, wild-type corn plant and being accredited as not genetically modified milpa through Taqman, insect resistant effect detection is carried out to prodenia litura.

Get the milpa proceeding to Cry1Fa-01 nucleotide sequence respectively, proceed to the milpa of Cry1Fa-02 nucleotide sequence, proceed to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to the milpa of Cry1Fa-01-Vip3A nucleotide sequence, wild-type corn plant and be accredited as the fresh blade (lobus cardiacus) of not genetically modified milpa (V3-V4 phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed vein, be cut into the strip of about 1cm × 4cm simultaneously, get 2 cut after strip blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water soaks, the prodenia litura (newly hatched larvae) of 10 artificial breedings is put in each culture dish, worm examination culture dish puts into the square box that bottom is placed with wet gauze after adding a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to Spodoptera litura larvae development progress, mortality ratio and blade injury rate three indexs, obtain resistance total score: total score=100 × mortality ratio+[100 × mortality ratio+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of Cry1Fa-01 nucleotide sequence, proceed to totally 3 strains (S4, S5 and S6) of Cry1Fa-02 nucleotide sequence, proceed to totally 3 strains (S7, S8 and S9) of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to totally 3 strains (S10, S11 and S12) of Cry1Fa-01-Vip3A nucleotide sequence, not genetically modified (NGM1) totally 1 strain is accredited as, (CK1) totally 1 strain of wild-type through Taqman; Select 3 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 1 and Fig. 4.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation prodenia litura

The result of table 1 shows: milpa raw proceed to the milpa of Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, proceeding to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence surveys total score all more than 250 points or left and right, partly can reach full marks 300 points; And be accredited as the raw total score of surveying of not genetically modified milpa and wild-type corn plant generally at about 15 points through Taqman.

The result of Fig. 4 shows: compared with wild-type corn plant, proceed to the milpa of Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, the milpa proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and the milpa proceeding to Cry1Fa-01-Vip3A nucleotide sequence can cause the mortality of just incubating Spodoptera litura larvae in 3 days, and great suppression is caused to small portion survival larvae development progress, after 3 days, larva is substantially still in and just incubates state, and proceed to the milpa of Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, the milpa proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and the milpa proceeding to Cry1Fa-01-Vip3A nucleotide sequence are only subject to slight damage substantially, its blade injury rate all about 10% or below.In addition, when the raw survey time length arrives 5 days, larva is all dead.

Prove that the milpa proceeding to the milpa of Cry1Fa-01 nucleotide sequence, the milpa proceeding to Cry1Fa-02 nucleotide sequence, the milpa proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence all demonstrates the activity of high resistance prodenia litura thus, this activity is enough to the growth of prodenia litura is produced to ill effect thus makes it be controlled.

5th embodiment, the acquisition proceeding to the soybean plant strain of Cry1F gene and checking

1, the soybean plant strain proceeding to Cry1F gene is obtained

The Agrobacterium infestation method conveniently adopted, by the Agrobacterium Dual culture in the cotyledonary node tissue of Huang 13 in the soybean varieties of sterile culture and the second embodiment described in 3, with the recombinant expression vector DBN100015 by 2 structures in the second embodiment, DBN100030, T-DNA(in DBN100012 and DBN100031 comprises the promoter sequence of corn Ubiquitin gene, Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Ab nucleotide sequence, Vip3A nucleotide sequence, pat gene and Nos terminator sequence) be transferred in soybean genome, obtain the soybean plant strain proceeding to Cry1Fa-01 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to the soybean plant strain of Cry1Fa-01-Vip3A nucleotide sequence, in contrast with Wild-type soy plant simultaneously.

For agriculture bacillus mediated transformation of soybean, briefly, by the soybean seeds of maturation at soybean germination substratum (B5 salt 3.1g/L, B5 vitamin b6 usp, sucrose 20g/L, agar 8g/L, pH5.6) sprout in, seed is inoculated on germination medium, by following CMC model: temperature 25 ± 1 DEG C; Photoperiod (light/dark) is 16/8h.Sprout and get the soybean aseptic seedling of expanding at bud green cotyledonary node place after 4-6 days, under cotyledonary node, 3-4 millimeter place cuts hypocotyl, longitudinally cuts cotyledon, removes terminal bud, lateral bud and seminal root.Wound is carried out at cotyledonary node place with the knife back of scalper, with the cotyledonary node tissue that agrobacterium suspension contact wound is crossed, wherein the construct of described mediated plant fertility can be passed to cotyledonary node tissue (step 1: infect step) that wound crosses in this step by Agrobacterium, and cotyledonary node is organized and preferably immersed agrobacterium suspension (OD ₆₆₀=0.5-0.8, infects in substratum (MS salt 2.15g/L, B5 vitamin b6 usp, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 40mg/L, MES (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) to start inoculation.Cotyledonary node tissue and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, cotyledonary node is above cultivated at solid medium (MS salt 4.3g/L, B5 vitamin b6 usp, sucrose 20g/L, glucose 10g/L, MES (MES) 4g/L, zeatin 2mg/L, agar 8g/L, pH5.6) after being organized in and infecting step.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (B5 salt 3.1g/L, B5 vitamin b6 usp, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 2mg/L, agar 8g/L, cephamycin 150mg/L, L-glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) at least there is the microbiotic (cephamycin) of a kind of known suppression Agrobacterium growth in, do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, the tissue block of cotyledon node regeneration is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the tissue block of cotyledon node regeneration cultivates the transformed calli (step 4: select step) that also growth selection on the substratum containing selective agent (careless fourth phosphine).Preferably, the tissue block of cotyledon node regeneration is having screening solid medium (B5 salt 3.1g/L, B5 vitamin b6 usp, MES (MES) 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP) 1mg/L, the agar 8g/L of selective agent, cephamycin 150mg/L, L-glutamic acid 100mg/L, aspartic acid 100mg/L, grass fourth phosphine 6mg/L, pH5.6) upper cultivation, cause the cell selective growth transformed.Then, the cell regeneration of conversion becomes plant (step 5: regeneration step), preferably, above cultivates with aftergrowth at solid medium (B5 division culture medium and B5 root media) in the tissue block containing the cotyledon node regeneration that the substratum of selective agent grows.

Screen the resistant tissues block obtained and transfer to described B5 division culture medium (B5 salt 3.1g/L, B5 vitamin b6 usp, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 1mg/L, agar 8g/L, cephamycin 150mg/L, L-glutamic acid 50mg/L, aspartic acid 50mg/L, Plant hormones regulators,gibberellins 1mg/L, growth hormone 1mg/L, careless fourth phosphine 6mg/L, pH5.6), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described B5 root media (B5 salt 3.1g/L, B5 vitamin b6 usp, MES (MES) 1g/L, sucrose 30g/L, agar 8g/L, cephamycin 150mg/L, indole-3-butyric acid (IBA) 1mg/L), in root culture, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 26 DEG C, then cultivates 8 hours at 20 DEG C.

2, the soybean plant strain of Cry1F gene is proceeded to TaqMan checking

The blade getting the soybean plant strain proceeding to Cry1Fa-01 nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-02 nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and the soybean plant strain that proceeds to Cry1Fa-01-Vip3A nucleotide sequence is respectively about 100mg as sample, extract its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, detected the copy number of Cry1F gene, Cry1Ab gene and Vip3A gene by Taqman fluorescence probe quantitative PCR method.Simultaneously with Wild-type soy plant in contrast, according to 2 carrying out detections analysis by the method that TaqMan checking proceeds to the milpa of Cry1F gene in above-mentioned 3rd embodiment.3 repetitions are established in experiment, average.

Experimental result shows, Cry1Fa-01 nucleotide sequence, Cry1Fa-02 nucleotide sequence, Cry1Fa-01-Cry1Ab nucleotide sequence and Cry1Fa-01-Vip3A nucleotide sequence have been incorporated in the genome of detected soybean plant strain all, and proceed to the soybean plant strain of Cry1Fa-01 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and the soybean plant strain proceeding to Cry1Fa-01-Vip3A nucleotide sequence all obtain containing single copy Cry1F gene, the Transgenic soybean plants of Cry1Ab gene and/or Vip3A gene.

The insect resistant effect of the 6th embodiment, Transgenic soybean plants detects

By proceeding to the soybean plant strain of Cry1Fa-01 nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-02 nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-01-Vip3A nucleotide sequence, Wild-type soy plant and being accredited as not genetically modified soybean plant strain through Taqman, insect resistant effect detection is carried out to prodenia litura.

Get the soybean plant strain proceeding to Cry1Fa-01 nucleotide sequence respectively, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-01-Vip3A nucleotide sequence, Wild-type soy plant and be accredited as the fresh blade of not genetically modified soybean plant strain (tri-leaf period) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, be cut into the square of about 2cm × 2cm simultaneously, get 1 cut after square blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water soaks, the prodenia litura (newly hatched larvae) of 10 artificial breedings is put in each culture dish, worm examination culture dish puts into the square box that bottom is placed with wet gauze after adding a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to Spodoptera litura larvae development progress, mortality ratio and blade injury rate three indexs, obtain resistance total score: total score=100 × mortality ratio+[100 × mortality ratio+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 strains (S13, S14 and S15) of Cry1Fa-01 nucleotide sequence, proceed to totally 3 strains (S16, S17 and S18) of Cry1Fa-02 nucleotide sequence, proceed to totally 3 strains (S19, S20 and S21) of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to totally 3 strains (S22, S23 and S24) of Cry1Fa-01-Vip3A nucleotide sequence, not genetically modified (NGM2) totally 1 strain is accredited as, (CK2) totally 1 strain of wild-type through Taqman; Select 3 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 2 and Fig. 5.

The pest-resistant experimental result of table 2, Transgenic soybean plants inoculation prodenia litura

The result of table 2 shows: soybean plant strain raw proceed to the soybean plant strain of Cry1Fa-01 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, proceeding to the soybean plant strain of Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence surveys total score all more than 220 points or left and right, partly can reach full marks 300 points; And be accredited as the raw total score of surveying of not genetically modified soybean plant strain and Wild-type soy plant generally at about 40 points through Taqman.

The result of Fig. 5 shows: compared with Wild-type soy plant, the soybean plant strain proceeding to Cry1Fa-01 nucleotide sequence and the soybean plant strain proceeding to Cry1Fa-02 nucleotide sequence can cause the mortality of just incubating Spodoptera litura larvae, and great suppression is caused to small portion survival larvae development progress, after 3 days, larva is substantially still in and just incubates-negative control state, and its blade injury rate is about 20%; The soybean plant strain proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and the prevention effect of soybean plant strain to newly hatched larvae proceeding to Cry1Fa-01-Vip3A nucleotide sequence are almost absolutely, survival larva also stasi substantially extremely individually, its blade is only minute quantity Pinhole-shaped slight damage.

Prove that the soybean plant strain proceeding to the soybean plant strain of Cry1Fa-01 nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-02 nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and proceed to Cry1Fa-01-Vip3A nucleotide sequence all demonstrates the activity of anti-prodenia litura thus, this activity is enough to the growth of prodenia litura is produced to ill effect thus makes it be controlled.

Above-mentioned experimental result also shows the milpa proceeding to Cry1Fa-01 nucleotide sequence, proceed to the milpa of Cry1Fa-02 nucleotide sequence, proceed to the milpa of Cry1Fa-01-Cry1Ab nucleotide sequence, proceed to the milpa of Cry1Fa-01-Vip3A nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-01 nucleotide sequence, proceed to the soybean plant strain of Cry1Fa-02 nucleotide sequence, the soybean plant strain proceeding to Cry1Fa-01-Cry1Ab nucleotide sequence and the soybean plant strain proceeding to Cry1Fa-01-Vip3A nucleotide sequence are obviously because plant itself can produce Cry1F albumen to the control of prodenia litura, so, well known to those skilled in the art, according to the identical toxic action of Cry1F albumen to prodenia litura, the transfer-gen plant that can produce similar expressed Cry1F albumen can be used in preventing and treating causing harm of prodenia litura.In the present invention, Cry1F albumen includes but not limited to the Cry1F albumen of given aminoacid sequence in embodiment, transfer-gen plant can also produce the second insect-killing protein that at least one is different from Cry1F albumen, as Cry1Ab albumen, Cry1Ac albumen, Cry1Ba albumen or Vip3A albumen etc. simultaneously.

In sum, the method for Control pests of the present invention controls prodenia litura insect by producing the Cry1F albumen that can kill prodenia litura in plant materials; The cultural control method used with prior art, chemical prevention and control method are compared with physical control method; the present invention to plant carry out the time of infertility, whole plant protection to prevent and treat the infringement of prodenia litura insect; and pollution-free, noresidue, effect stability, thoroughly, simple, convenient, economical.

It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.

Claims (23)

1. one kind controls the method for prodenia litura insect, it is characterized in that, comprise by prodenia litura insect at least with Cry1Fa protein contact, described Cry1Fa albumen is present in the transgenic plant cells at least producing described Cry1Fa albumen, described prodenia litura insect by ingest described transgenic plant cells at least with described Cry1Fa protein contact.

2. the method for control prodenia litura insect according to claim 1, it is characterized in that, described Cry1Fa albumen is present in the transgenic plant at least producing described Cry1Fa albumen, described prodenia litura insect by the described transgenic plant that ingest organize at least with described Cry1Fa protein contact, after contact, the growth of described prodenia litura insect is suppressed and/or causes death, with the control of the plant that realizes causing harm to prodenia litura.

3. the method for control prodenia litura insect according to claim 1 and 2, it is characterized in that, described plant is from corn, soybean, cotton, sweet potato, taro, lotus, sesbania, tobacco, beet, Chinese cabbage or eggplant.

4. the method for control prodenia litura insect according to claim 3, it is characterized in that, described transgenic plant are in any breeding time.

5. the method for control prodenia litura insect according to claim 3, is characterized in that, described transgenic plant be organized as blade, stem stalk, tassel, female fringe, flower pesticide, filigree or fruit.

6. the method for control prodenia litura insect according to claim 3, is characterized in that, does not describedly change because planting the change in place the cause harm control of plant of prodenia litura.

7. the method for control prodenia litura insect according to claim 3, is characterized in that, does not describedly change because of the change of implantation time the cause harm control of plant of prodenia litura.

8. the method for control prodenia litura insect according to claim 3, is characterized in that, the step before described contact procedure is the plant of the polynucleotide of plantation containing the described Cry1Fa albumen of coding.

9. the method for control prodenia litura insect according to claim 8, it is characterized in that, the aminoacid sequence of described Cry1Fa albumen has SEQ ID NO:1 or the aminoacid sequence shown in SEQ ID NO:2.

10. the method for control prodenia litura insect according to claim 9, it is characterized in that, the nucleotide sequence of described Cry1Fa albumen has SEQ ID NO:3 or the nucleotide sequence shown in SEQ ID NO:4.

The method of 11. control prodenia litura insects according to claim 9, it is characterized in that, described plant can also produce the second Nucleotide that at least one is different from described Cry1Fa albumen.

The method of 12. control prodenia litura insects according to claim 11, is characterized in that, described the second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.

The method of 13. control prodenia litura insects according to claim 12, is characterized in that, described the second nucleotide coding Cry1Ab albumen, Cry1Ac albumen, Cry1Ba albumen or Vip3A albumen.

The method of 14. control prodenia litura insects according to claim 13, it is characterized in that, described the second Nucleotide comprises SEQ ID NO:5 or the nucleotide sequence shown in SEQ ID NO:6.

The method of 15. control prodenia litura insects according to claim 11, it is characterized in that, described the second Nucleotide is the dsRNA suppressing important gene in target insect pests.

The method of 16. control prodenia litura insects according to claim 1 and 2, it is characterized in that, the aminoacid sequence of described Cry1Fa albumen has SEQ ID NO:1 or the aminoacid sequence shown in SEQ ID NO:2.

The method of 17. control prodenia litura insects according to claim 16, it is characterized in that, the nucleotide sequence of described Cry1Fa albumen has SEQ ID NO:3 or the nucleotide sequence shown in SEQ ID NO:4.

The method of 18. control prodenia litura insects according to claim 16, it is characterized in that, described plant can also produce the second Nucleotide that at least one is different from described Cry1Fa albumen.

The method of 19. control prodenia litura insects according to claim 18, is characterized in that, described the second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.

The method of 20. control prodenia litura insects according to claim 19, is characterized in that, described the second nucleotide coding Cry1Ab albumen, Cry1Ac albumen, Cry1Ba albumen or Vip3A albumen.

The method of 21. control prodenia litura insects according to claim 20, it is characterized in that, described the second Nucleotide comprises SEQ ID NO:5 or the nucleotide sequence shown in SEQ ID NO:6.

The method of 22. control prodenia litura insects according to claim 18, it is characterized in that, described the second Nucleotide is the dsRNA suppressing important gene in target insect pests.

23. 1 kinds of Cry1Fa protein control the purposes of prodenia litura insect, and it is characterized in that, described Cry1Fa albumen is present in the transgenic plant cells and/or transgenic plant at least producing described Cry1Fa albumen.