CN103718895B - The method of Control pests - Google Patents

Abstract

The present invention relates to a kind of method of controlling prodenia litura insect, comprising: prodenia litura insect is contacted with Cry1A albumen. The present invention can kill the Cry1A albumen of prodenia litura and control prodenia litura insect by producing in plant; Compare with cultural control method, chemical prevention and control method and physical control method that prior art is used; the present invention carries out the protection of the time of infertility, whole plant with the infringement of control prodenia litura insect to plant; and pollution-free, noresidue, effect stability, thorough, simple, convenient, economical.

Description

The method of Control pests

Technical field

The present invention relates to a kind of method of Control pests, particularly relate to a kind of being used in and express in plantCry1A albumen is controlled the cause harm method of plant of prodenia litura.

Background technology

Prodenia litura (Spodopteralitura) belongs to Lepidoptera Noctuidae, is omnivorousness and gluttony insect,The host of causing harm is quite extensive, except corn and soybean, also can endanger comprise melon, eggplant, beans, green onion, leek,Spinach and brassicaceous vegetable, grain, industrial crops Deng Jin 100 sections, 300 various plants; Prodenia lituraBelong to worldwide distribution, there is generation domestic various places, mainly occur in the Yangtze river basin and the Huanghe valley. Twill nightThe moth blade back of trooping while mainly causing harm complete stool, low age with larva is gnawed; Blade, tender stem, old disperse after 3 ages to cause harmInstar larvae can be eaten into food fruit.

Corn and soybean are the important cereal crops of China, and the grain loss causing because of prodenia litura is every year huge,Have influence on what is more the survival state of local population. In order to prevent and treat prodenia litura, it is main that people adopt conventionallyThe method of control has: cultural control, chemical prevention and physical control.

Cultural control is multifactorial whole farmland ecosystem comprehensive coordination management, regulation and control crop, insect,Environmental factor, one of creation are conducive to plant growth and are unfavorable for the farmland ecological environment that prodenia litura occurs.As weed a garden, after results, turn over and shine soil or pour water, to destroy or to worsen its place of pupating, contribute to reduceWorm source; Or extract conveniently pieces of an egg and the newly hatched larvae of the harm of trooping in conjunction with management, to reduce worm source. Because of agricultureIndustry control is mostly preventive measure, and application has certain limitation, can not serve as emergency measure, at twillNoctuid just seems helpless when outburst.

Chemical prevention is pesticide control, is to utilize chemical insecticide to carry out kill pests, is the prodenia litura comprehensive regulationImportant component part, it has fast, the feature of convenient, easy and high economic benefit, particularly twill nightIn the situation of the large generation of moth, the emergency measure that is absolutely necessary, it can be by it before prodenia litura works the mischiefEliminate. Chemical prevention and control method is mainly that medicament sprays at present. But chemical prevention also has its limitation, as used notWhen tending to cause crops generation poisoning, insect to develop immunity to drugs, and killed natural enemies, contaminated environment, makeFarmland ecosystem suffers that destruction and residues of pesticides are to adverse consequences such as the safety of people, animal constitute a threat to.

The mainly reaction to various physical factors in environmental condition according to insect of physical control, utilize various physics because ofThe methods such as element as optical, electrical, look, humiture etc. and plant equipment is trapped and killed, steriliation by irradiation are carried out pest control.At present application more widely method mainly contain attract moths with lamps, syrupacetiacid bait trap and withy dip in and spill 500 times of metrifonate and lureKill moth; Although said method has prevention effect in various degree, in operation, there is certain difficulty.

In order to solve cultural control, chemical prevention and physical control limitation in actual applications, scientistThrough research find the anti insect gene of encoding insecticidal proteins is proceeded in plant, can obtain some pest-resistant bases that turnBecause plant is with control insect pest of the plant. Cry1A insecticidal proteins is the one in numerous insecticidal proteins, is by Su YunGold bacillus storehouse Stuckey subspecies (Bacillusthuringiensissubsp.kurstaki, B.t.k.) produce notDissolubility companion spore crystalline protein.

Cry1A albumen is taken in and is entered middle intestines by insect, and toxalbumin parent toxin is dissolved in the alkalescence of insect midgutUnder pH environment. Albumen N-and C-end, by basic protein enzymic digestion, are transformed into active fragment by parent toxin;Receptors bind on active fragment and insect midgut epithelial cell membrane upper surface, inserts goldbeater's skin, causes cell membrane to go outThe focus of now boring a hole, destroys that the inside and outside osmotic pressure of cell membrane changes and pH balance etc., upsets the digestion process of insect,Finally cause its death.

Prove that the plant that turns Cry1A gene can be resisted corn borer, bollworm, (autumn is sticky for the greedy noctuid in meadowWorm) etc. the infringement of Lepidoptera (Lepidoptera) insect, but, rare about expressing Cry1A by generationThe transfer-gen plant of albumen is controlled the report of prodenia litura to plant hazard.

Summary of the invention

A kind of method that the object of this invention is to provide Control pests, provides by generation and has expressed firstThe transfer-gen plant of Cry1A albumen is controlled the method for prodenia litura to plant hazard, and effectively overcomes existingThe technological deficiencies such as technology cultural control, chemical prevention and physical control.

For achieving the above object, the invention provides a kind of method of controlling prodenia litura insect, comprise tiltedlyAutographa spp insect contacts with Cry1A albumen.

Preferably, described Cry1A albumen is Cry1Ab albumen, Cry1Ab/Ac albumen or Cry1A.105 albumen.

Further, described Cry1Ab albumen is present in the plant cell that produces described Cry1Ab albumen,Described prodenia litura insect contacts with described Cry1Ab albumen by the described plant cell of ingesting.

Further, described Cry1Ab albumen is present in the genetically modified plants that produce described Cry1Ab albumenIn, described prodenia litura insect connects by tissue and the described Cry1Ab albumen of the described genetically modified plants that ingestTouch, after contact, the growth of described prodenia litura insect is suppressed and finally causes death, to realize twill nightThe control of moth harm plant.

Further, described Cry1Ab/Ac albumen is present in that to produce the plant of described Cry1Ab/Ac albumen thinIn born of the same parents, described prodenia litura insect contacts with described Cry1Ab/Ac albumen by the described plant cell of ingesting.

Further, described Cry1Ab/Ac albumen is present in the base that turns that produces described Cry1Ab/Ac albumenIn plant, described prodenia litura insect is by tissue and the described Cry1Ab/Ac of the described genetically modified plants that ingestAlbumen contact, after contact, described prodenia litura insect growth is suppressed and finally causes death, right to realizeThe control of prodenia litura harm plant.

Further, described Cry1A.105 albumen is present in that to produce the plant of described Cry1A.105 albumen thinIn born of the same parents, described prodenia litura insect contacts with described Cry1A.105 albumen by the described plant cell of ingesting.

Further, described Cry1A.105 albumen is present in the base that turns that produces described Cry1A.105 albumenIn plant, described prodenia litura insect is by tissue and the described Cry1A.105 of the described genetically modified plants that ingestAlbumen contact, after contact, described prodenia litura insect growth is suppressed and finally causes death, right to realizeThe control of prodenia litura harm plant.

Described genetically modified plants can be in any breeding time.

The tissue of described genetically modified plants can be blade, stem stalk, fruit, tassel, female fringe, flower pesticide or filigree.

The described control that prodenia litura is endangered to plant is not because the change in plantation place changes.

The described control that prodenia litura is endangered to plant is not because the change of implantation time changes.

Described plant can from corn, soybean, cotton, sweet potato, taro, lotus, sesbania, tobacco, beet,Chinese cabbage or eggplant.

Step before described contact procedure is to plant the plant of the polynucleotides that contain the described Cry1A albumen of encoding.

Preferably, the amino acid sequence of described Cry1A albumen have SEQIDNO:1, SEQIDNO:2,Amino acid sequence shown in SEQIDNO:3 or SEQIDNO:28. The nucleotides sequence of described Cry1A albumenRow have the core shown in SEQIDNO:4, SEQIDNO:5, SEQIDNO:6 or SEQIDNO:29Nucleotide sequence.

On the basis of technique scheme, described plant can also produce at least one and be different from described Cry1AThe second nucleotides of albumen.

Further, can encode Cry class insect-killing protein, Vip class insecticidal proteins of described the second nucleotidesMatter, protease inhibitors, agglutinin, AMS or peroxidase.

Preferably, can encode Vip3A albumen or Cry2Ab albumen of described the second nucleotides.

Further, described the second nucleotides comprises shown in SEQIDNO:7 or SEQIDNO:8Nucleotide sequence.

Selectively, described the second nucleotides is the dsRNA that suppresses important gene in targeted insect insect.

For achieving the above object, the present invention also provides the purposes of a kind of Cry1A protein control prodenia litura insect.

In the present invention, the expression of Cry1A albumen in a kind of genetically modified plants can be accompanied by one or manyThe expression of individual Cry class insect-killing protein and/or Vip class insect-killing protein. Thisly exceed a kind of Pesticidal toxinsIn same strain genetically modified plants, co expression can comprise plant and be expressed required base by genetic engineeringBecause realizing. In addition, a Plants (the 1st parent) can be expressed Cry1A egg by genetic engineering procedureWhite matter, the second plant (the 2nd parent) can be expressed Cry class insect-killing protein by genetic engineering procedureAnd/or Vip class insect-killing protein. Hybridize to obtain to express by the 1st parent and the 2nd parent and introduce the 1st parentProgeny plants with all genes of the 2nd parent.

RNA disturb (RNAinterference, RNAi) refer to high conservative during evolution, byDouble-stranded RNA (double-strandedRNA, dsRNA) brings out, the efficient specificity of homologous mRNA is fallenThe phenomenon of separating. Therefore can use in the present invention RNAi technology specific depletion or close targeted insect insectThe expression of middle specific gene.

Prodenia litura (Spodopteralitura) belongs to together with the greedy noctuid (Spodopterafrugiperda) in meadowLepidoptera Noctuidae, is polyphagous pest-insect, all cause harm corn, soybean, cotton, sweet potato etc. However,The greedy noctuid in prodenia litura and meadow be biologically clearly, distinct species, below at least existingThe main distinction:

1, feeding habits difference. Prodenia litura is a class omnivorousness and gluttony insect, and intermittent wildness causes harm, dangerEvil host is quite extensive, takes food sweet potato, cotton, taro, lotus, sesbania, soybean, tobacco, beet and crossNearly 300 Plants such as Hua Ke and solanaceous vegetable; The greedy noctuid in meadow is polyphagy, but obviously has a liking for grass family,The most often cause harm weeds, corn, paddy rice, Chinese sorghum, sugarcane, the cotton of also causing harm, Cruciferae, Curcurbitaceae,Peanut, clover, onion, Phaseolus, sweet potato, tomato and other plants of Solanaceae (auberigin, tobacco, pepperyGreen pepper belong to), the multiple phase thing (composite family, carnation, Pelargonium) of viewing and admiring.

2, distributed areas difference. The worldwide distribution of spodoptera, has generation all over China, mainly occursIn Henan of Jiangxi, Jiangsu, Hunan, Hubei, Zhejiang, Anhui and the Huanghe valley of the Yangtze river basin, Hebei,The provinces such as Shandong. And the greedy noctuid in meadow is mainly distributed in overseas, comprise America Canada, Mexico, the U.S.,Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, French Guiana, Guyana,Paraguay, Peru, Surinam, Uruguay, Venezuela and whole Centro-American and Caribbean area,The report that China exists there are no the greedy noctuid in meadow.

3, Damage habits difference. Prodenia litura is with the larva complete stool of causing harm, and the blade back of trooping when younger ones in an age group is gnawed lower epidermisAnd mesophyll, only stay epicuticle to be speculum; After 3 ages, disperse to cause harm blade, tender stem; Enter gluttony 4 ages later,Sting food blade, only stay master pulse; Mature larvae can be eaten into food fruit; Its feeding habits are not only assorted but also endanger each organ, when agedForming gluttony, is the insect that a kind of harmfulness is very large. And the greedy exigua larvae in meadow takes food blade and can cause fallen leaves,Shift cause harm thereafter; Sometimes a large amount of larvas are caused harm to cut root mode, cut off the stem of seedling and immature plant; GreatlyOn the crop of some, as corncob, larva can pierce causes harm; While taking food maize leaves, leave large metering-orifice; Low ageAfter larval feeding, vein becomes window screening shape; Mature larvae is the same with cutworm, can be by the seedling of 30 ages in days along basePortion cuts off; When population quantity is large, larva, as march shape, becomes group diffusion; When environment is favourable, often stay in weeds.

4, morphological feature difference.

1) avette state difference: the ovum of prodenia litura is flat hemispherical, primiparity yellow-white, after become dull grayLook, bulk is bonded together, and above covers yellowish-brown fine hair; And the ovum hemispherical of the greedy noctuid in meadow, pieces of an egg are poly-to be producedAt blade surface, every pieces of an egg, containing ovum 100-300 grain, become Z layer sometimes, and there is female worm belly grey on pieces of an egg surfaceThe banded protective layer that hair forms.

2) Larva Morpho. Logy difference: the long 33-50 millimeter of Spodoptera litura larvae body, head pitchy, chest is changeable,From khaki to blackish green, have, the scattered small particles of body surface, the Winter Solstice has subtriangular first quarter moon blackspot a pair of,Larva general 6 ages; And the greedy exigua larvae in meadow whole body green while just incubating, tool black line and spot; When growth,Still keep green or become light yellow, and tool black dorsal line and spiracle line; When intensive (population density is large,While being short of food), last instar larvae is almost black in the migration phase; The long 35-40mm of mature larva body, at headThe yellow inverted Y-shaped spot of portion's tool, black dorsal body setae sheet raw primary seta (there are 2 bristles every joint dorsal line both sides);Belly minor details have 4 blackspots that are square arrangement; Larva has 6 length of times, is occasionally 5.

3) pupa form difference: the long 15-20mm of pupa of prodenia litura, cylindrical shape, bronzing, afterbody has a pair ofShort thorn; And the greedy noctuid pupa in meadow is brown, glossy, long 18-20mm.

4) adult form difference: prodenia litura becomes the long 14-20mm of polypide left and right, wing expanse 35-46mm, bodyCrineous, chest back side adularescent feathering, fore wing taupe, decorative pattern is many, interior horizontal line and outer horizontal line white,Being wavy, centre has the oblique wealthy band line of obvious white, so claim prodenia litura; And the greedy noctuid adult in meadowSturdy, taupe brown, wing expanse 32-38mm; Female worm fore wing grey is to taupe brown, but male worm fore wing is more black, toolThe dark line of blackspot and light color; Hind wing white, hind wing vein is brown and transparent; Micro-worm external genital organs clasping lobe prosShape, clasping spine end ground clasping spine edge is carved and is lacked; Female worm bursa copulatrix amixia sheet.

5, habit is different with pests occurrence rule. Within 1 year, there is (North China)-9 generation in 4 generations (Guangdong) in prodenia litura,Generally survive the winter in the weeds of base limit, field with mature larva or pupa, In Guangzhou Area is without the phenomenon of really surviving the winter; In the Changjiang riverArea to the north of basin, this worm is easily freezed to death winter, and winter issue is not yet come to a conclusion, and infers that local worm source mayMigrate over from south; The Yangtze river basin is many to be occurred greatly in the 7-8 month, and the Huanghe valley is many to be occurred greatly in the 8-9 month.Adult goes out activity night, and the power of circling in the air is stronger, and tool phototaxis and chemotaxis are particularly responsive to fermentates such as sweet and sour wine.Every female moth 3-5 piece of laying eggs, every approximately has ovum position 100-200, and ovum fecund is in the vein crotch of blade back,Lay eggs with dense, dark green crop more, heap produces, and pieces of an egg are often covered with palea and are easily found the hatching of ovumThermophilic is 24 DEG C of left and right; Larva, in the time of 25 DEG C of temperature, is gone through 14-20 days, and newly hatched larvae has the harm of troopingHabit, starts after 3 ages to disperse, and mature larvae has volt property and seemingly-dead property in daytime, hide daytime at soil seam place more,Climb out of at dusk and take food, meet frightened will landing and roll up the death situation of playing tricks. When foodstuff is not enough or not at that time, larva can becomeNear field harm group migrates to, therefore there be being again commonly called as of " armyworm "; The applicable soil moisture of pupating is soilEarth water content is in 20% left and right, and be 11-18 days pupa time. Prodenia litura is a kind of thermophily and resistant to elevated temperaturesThe have a rest insect of rampant harm, the growth thermophilic of each worm state is 28-30 DEG C, but at high temperature (33-40 DEG C) is rawAlso normal alive; Cold hardiness is very weak, under the long-time low temperature of 0 DEG C of left and right, substantially can not survive in the winter time.Favourable its grown, bred general high temperature time and season, and low temperature easily causes the mortality of worm pupa. This worm foodThough property is assorted, foodstuff situation, comprises different hosts, even same host different developmental phases or organ,And the rich of foodstuff lack, its fertility breeding is had to obvious impact. Between plant, multiple crop index is high or excessively closeFavourable its generation of field of planting. Natural enemy has braconid and the polyhedrosis virus etc. of parasitic larva. And night is coveted on meadowMoth adult can migrate, and diffusion phase is worked as distance voluntarily, and it is important international that vegetables or fruit are carried larva secretlyCirculation way; The greedy noctuid in meadow migrates 1 time regularly in America for 1 year, diffuses to the whole U.S.; Lay eggsIn earlier stage (sexal maturity growth) extensive diffusive, in the U.S., adult can borrow low air flow in 30 hours from Mi XiState, Thebe is diffused into Canada; At the beginning of late summer or autumn, larva Chang Chengqun migration, thereby, successfully local diffusion,Be conducive to reduce larval mortality.

Comprehensively above-mentioned, can determine that the greedy noctuid in prodenia litura and meadow is different insect, and affiliation is far away,Cannot mating produce offspring each other.

The genome of the plant described in the present invention, plant tissue or plant cell, refers to plant, plant groupKnit or plant cell in any inhereditary material, and comprise nucleus and plastid and mitochondrial genomes.

" contact " described in the present invention, refer to insect and/or insect touching, stop and/or feeding plant,Plant organ, plant tissue or plant cell, described plant, plant organ, plant tissue or plant cellBoth can be its expression in vivo insecticidal proteins, and can also be described plant, plant organ, plant tissue or plantThe surface of thing cell has insecticidal proteins and/or has the microorganism that produces insecticidal proteins.

Polynucleotides described in the present invention and/or nucleotides form complete " gene ", at required host cellMiddle coded protein or polypeptide. Those skilled in the art are easy to recognize, can be by multinuclear glycosides of the present inventionAcid and/or nucleotides are placed under object host's regulating and controlling sequence control.

Well-known to those skilled in the art, DNA typically exists with double chain form. In this arrangement,, chain and another chain complementation, vice versa. Because DNA copies its that has produced DNA in plantIts complementary strand. Like this, the present invention includes polynucleotides to example in sequence table and the use of complementary strand thereof.Normal " coding strand " using in this area refers to the chain of being combined with antisense strand. For marking protein in vivo, allusion quotationType is transcribed into a chain of DNA the complementary strand of a mRNA, and it translates protein as template.MRNA is actually from " antisense " chain of DNA and transcribes. " there is justice " or " coding " chain has a series ofCodon (codon is three nucleotides, once reads three and can produce specific amino acids), it can be used asORFs (ORF) is read and is formed destination protein matter or peptide. The present invention also comprises the DNA with exampleThere are RNA and the PNA(peptide nucleic acid of suitable function).

Amplifying nucleic acid molecule of the present invention or its fragment under stringent condition with Cry1A gene recombination of the present invention. AnyConventional nucleic acid hybridization or amplification method may be used to identify the existence of Cry1A gene of the present invention. Nucleic acid dividesSon or its fragment can be carried out specific hybrid with other nucleic acid molecules under a stable condition. In the present invention, asTwo nucleic acid molecules of fruit can form antiparallel double-strandednucleic acid structure, just can say these two nucleic acid molecules each otherBetween can carry out specific hybrid. Complementary completely if two nucleic acid molecules demonstrate, claim wherein oneIndividual nucleic acid molecules is another nucleic acid molecules " complement ". In the present invention, every when a nucleic acid moleculesWhen nucleotides is all complementary with the corresponding nucleotides of another nucleic acid molecules, claim these two nucleic acid molecules aobvious" complete complementary " is shown. Thereby if two nucleic acid molecules can make with enough stability phase mutual crossesThey anneal and are bonded to each other under at least conventional " low strict " condition, claim this two nucleic acid moleculesFor " minimum level complementation ". Similarly, if two nucleic acid molecules can be mutually assorted with enough stabilityMake them under " highly strict " condition of routine, anneal and be bonded to each other thereby hand over, claim this two nucleic acidMolecule has " complementarity ". From complete complementary, depart from and can allow, as long as this cannot not departing from completelyTwo molecules of full prevention form duplex structures. In order to make a nucleic acid molecules can serve as primer or probe, onlyNeed to ensure that it has sufficient complementarity in sequence, to make under the specific solvent being adopted and salinityCan form stable duplex structure.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, and this nucleic acid molecules is at height stringent conditionDown can with the complementary strand generation specific hybrid of another section of nucleic acid molecules matching. Promote what DNA was hybridizedApplicable stringent condition for example, is located by 6.0 × sodium chloride/sodium citrate (SSC) greatly under 45 DEG C of conditionsReason is then washed with 2.0 × SSC under 50 DEG C of conditions, and these conditions are known to those skilled in the art.For example, the salinity in washing step can be selected from low stringent condition approximately 2.0 × SSC, 50 DEG C are to highApproximately 0.2 × the SSC, 50 DEG C of degree stringent condition. In addition, the temperature conditions in washing step can be tight from minuentApproximately 22 DEG C of the room temperatures of glazing bar part, are elevated to height approximately 65 DEG C of stringent condition. Temperature conditions and salinity canAll to change, also can one of them remain unchanged and another variable changes. Preferably, originallyInvent described stringent condition and can be in 6 × SSC, 0.5%SDS solution, at 65 DEG C with SEQIDNO:4,There is specific hybrid in SEQIDNO:5, SEQIDNO:6 or SEQIDNO:29, then use 2 × SSC,0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film 1 time.

Therefore, there is anti-insect activity and under stringent condition with SEQIDNO:4 of the present invention, SEQIDNO:5,The sequence of SEQIDNO:6 or SEQIDNO:29 hybridization comprises in the present invention. These sequences and the present inventionSequence is 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%,80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% orLarger sequence homology.

Gene described in the present invention and protein not only comprise specific exemplary sequence, also comprise and have preserved institutePart and the/fragment of stating the insecticidal activity feature of the protein of particular example (comprise compared with full length proteinIn and/or terminal deletion), variant, mutant, substituent (having the amino acid whose protein of substituting), chimericBody and fusion. Described " variant " or " variation " refer to that the same albumen of coding or coding have insecticidal activityThe nucleotide sequence of albumen of equal value. Described " albumen of equal value " refers to have identical with the albumen of claimOr the bioactive albumen of essentially identical anti-prodenia litura insect.

" fragment " or " brachymemma " of the DNA molecular described in the present invention or protein sequence refer to relate to formerA part for beginning DNA or protein sequence (nucleotides or amino acid) or its artificial reconstructed form (are for example applicable toThe sequence of expression of plants), can there is variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) eggWhite matter is insect toxins.

Use standard technique can modifier and the easy gene variant that builds. For example, well knownThe technology of manufacturing place sudden change. For example U.S. Patent number 5605793 has been described and after random fracture, has been used DNA againReassembly and produce the method for other molecular diversity. Can use commercialization endonuclease to manufacture full-length geneFragment, and can use exonuclease according to standardization program. For example, can use enzyme such as Bal31Or direct mutagenesis from the end system of these genes excise nucleotides. Can also use multiple restriction enzymeEnzyme obtains the gene of coding active fragment. Can use protease directly to obtain the active fragment of these toxin.

The present invention can derive albumen of equal value from B.t. separator and/or DNA library and/or encode these etc.The gene of valency albumen. There is several different methods to obtain insecticidal proteins of the present invention. For example, can use public affairs of the present inventionOpen with the antibody of claimed insecticidal proteins and identify and separate other albumen from protein mixture. Especially,Antibody may be that the most constant by albumen and the most different from other B.t. albumen protein parts causes. Then canUse these antibody by immunoprecipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or western trace methodIdentify the albumen of equal value of feature activity single-mindedly. Can use this area standardization program to be easy to preparation the present inventionIn the antibody of fragment of disclosed albumen or albumen of equal value or this albuminoid. Then can from microorganism, obtainThe encode gene of these albumen.

Due to the Feng Yuxing of genetic codon, the amino acid order that multiple different DNA sequence dna can be encoded identicalRow. Produce the alternative DNA sequence dna of these encode identical or essentially identical albumen just art technology peopleIn member's technical merit. These different DNA sequence dnas comprise within the scope of the invention. Described " substantiallyIdentical " sequence referred to 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, disappearance, interpolation or insertion but do not affected in fact insecticidal activitySequence, also comprise the fragment that retains insecticidal activity.

In the present invention, the replacement of amino acid sequence, disappearance or interpolation are the ordinary skill in the art, preferably thisAmino acid is changed to: little characteristic changing, does not significantly affect folding and/or active conservative amino of albumenAcid replaces; Little disappearance, common about 1-30 amino acid whose disappearance; Little amino or c-terminus extend, exampleAs aminoterminal extends a methionine residues; Little connection peptide, for example an about 20-25 residue is long.

The conservative example replacing is the replacement occurring in following amino acid group: basic amino acid (as arginine,Lysine and histidine), acidic amino acid (as glutamic acid and aspartic acid), polar amino acid be (as paddyGlutamine, asparagine), hydrophobic amino acid (as leucine, isoleucine and valine), fragranceAmino acid (as phenylalanine, tryptophan and tyrosine), and little molecule amino acid is (as glycine, thirdPropylhomoserin, serine, threonine and methionine). Conventionally do not change those 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors of given activityIn this area, be well-known, and by, for example, N.Neurath and R.L.Hill were in 1979In " Protein " that new york academic publishing house (AcademicPress) publishes, be described. ModalExchange has Ala/Ser, Val/Ile, and Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly,Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly,And their contrary exchanges.

For a person skilled in the art apparently, this replacement can be to molecular function liftingOutside the region acting on, occur, and still produce active peptides. For by polypeptide of the present invention, its activityEssential and therefore select not substituted amino acid residue, can be according to methods known in the art, as fixedPoint mutagenesis or alanine scanning mutagenesis identify (as referring to, Cunningham and Wells, 1989, Science244:1081-1085). A rear technology is that each positively charged residue place introduces sudden change in molecule, inspectionSurvey the anti-insect activity of gained mutating molecule, thereby determine this molecular activity and the amino acid residue of wanting of overstating.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, and this three-dimensional structure can be byThe technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling measure (referring to, as deVos etc., 1992,Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc.,1992，FEBSLetters309：59-64）。

In the present invention, Cry1A albumen include but not limited to Cry1Ab, Cry1A.105, Cry1Ah orCry1Ab/Ac albumen, or there is at least 70% homology with the amino acid sequence of above-mentioned albumen and to twillNoctuid has desinsection fragment or the functional area of insecticidal activity.

Therefore, there is the amino acid of certain homology with the amino acid sequence shown in sequence 1,2,3 and/or 28Sequence is also included within the present invention. These sequences and sequence similarity/homogeny of the present invention are typically greater than 60%,Preferably be greater than 75%, be preferredly greater than 80%, be even preferredly greater than 90%, and can be greater than95%. Also can be according to more specific homogeny and/or similarity scope definition preferred polynucleotides of the present inventionAnd protein. For example have 49%, 50%, 51%, 52%, 53%, 54%, 55% with the sequence of example of the present invention,56%、57%、58%、59%、60%、61%、62%、63%、64%、65%、66%、67%、68%、69%、70%、71%、72%、73%、74%、75%、76%、77%、78%、79%、80%、81%、82%、83%、84%、85%、86%、87%、88%、89%、90%、91%、92%、93%、94%、95%, 96%, 97%, 98% or 99% homogeny and/or similarity.

Regulating and controlling sequence described in the present invention includes but not limited to promoter, transit peptides, terminator, and enhancer is leadingSequence, introne and other are operably connected to the adjusting sequence of described Cry albuminoid and Vip albuminoid.

Described promoter is effable promoter in plant, described " effable promoter in plant "Refer to the promoter of guaranteeing that connected coded sequence is expressed in plant cell. In plant, can expressPromoter can be constitutive promoter. The example that instructs the promoter of constitutive expression in plant comprises but notBe limited to, derive from 35S promoter, corn Ubi promoter, the paddy rice GOS2 base of cauliflower mosaic virusThe promoter of cause etc. Alternatively, in plant, effable promoter can be tissue-specific promoter, shouldPromoter is in some tissues of plant as in chlorenchyma, instruct the expression of coded sequence higher than plantIts hetero-organization (can measure by conventional RNA test), as PEP carboxylase promoter. Alternatively,In plant, effable promoter can be wound-induced promoter. Wound-induced promoter or instruct wound-inducedThe promoter of expression pattern refer in the time that plant is stood machinery or gnaws by insect the wound causing, promoterUnder the expression compared with normal growth conditions of the coded sequence under regulation and control, be significantly increased. Showing of wound-induced promoterExample includes but not limited to, protease suppressor (pin I and pin II) and the corn egg of potato and tomatoThe promoter of white enzyme suppressor (MPI).

Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specificallyOrganelle or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, profitWith coding chloroplast transit peptide sequence target chloroplaset, or utilize ' KDEL ' reservation queue target endoplasmic reticulum,Or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described targeting sequencing including but not limited to, picornavirus targeting sequencing, as EMCV targeting sequencing(encephalomyocarditis virus 5 ' noncoding region); Potyvirus group targeting sequencing, as MDMV(cornMosaic virus stunts) targeting sequencing; Human immunoglobulin matter heavy chain conjugated protein (BiP); HoneysuckleThe coat protein mRNA of mosaic virus does not translate targeting sequencing (AMVRNA4); Tobacco mosaic virus (TMV)(TMV) targeting sequencing.

Described enhancer including but not limited to, cauliflower mosaic virus (CaMV) enhancer, radix scrophulariae mosaic diseasePoison (FMV) enhancer, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV)Enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV)Enhancer, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) andPeanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application, described introne including but not limited to, corn hsp70 introne,Corn ubiquitin introne, Adh introne 1, sucrose synthase introne or paddy rice Act1 introne. For twoCotyledon plant application, described introne including but not limited to, CAT-1 introne, pKANNIBALIntrone, PIV2 introne and " super ubiquitin " introne.

Described terminator can be the applicable polyadenylation signal sequence that works in plant, comprise butBe not limited to, derive from Agrobacterium (Agrobacteriumtumefaciens) rouge alkali synthetase (NOS) baseThe polyadenylation signal sequence of cause, derive from the poly adenosine of protease inhibitors II (pin II) geneAcidifying burst, derive from pea ssRUBISCOE9 gene polyadenylation signal sequence and comeCome from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

Described in the present invention, " effectively connect " connection that represents nucleotide sequence, described connection makes a sequenceThe function needing concerning the sequence that is connected can be provided. Described " effectively connecting " can be for opening in the present inventionMover is connected with interested sequence, makes transcribing of this interested sequence be subject to this promoter control and tuneControl. When interested sequential coding albumen and while going for the expression of this albumen " effectively connecting " represent:Promoter is connected with described sequence, and connected mode is efficiently translated the transcript obtaining. If promoterWhile being transcript fusion and the expression of albumen of wanting realization coding with being connected of coded sequence, manufacture like thisConnection, in the transcript that makes to obtain, the first translation initiation codon is the initiation codon of coded sequence.Alternatively, if being connected of promoter and coded sequence is the albumen that coding is merged and wants to realize in translationWhen expression, manufacture such connection, make the first translation initiation codon of containing in 5 ' non-translated sequence withPromoter is connected, and connected mode is opened the translation of the albumen that the translation product that obtains and coding wantThe relation of putting reading frame meets reading frame. The nucleotide sequence that can " effectively connect " includes but not limited to:Provide gene expression function sequence (be gene expression element, for example promoter, 5 ' untranslated region, inContaining son, encoding histone region, 3 ' untranslated region, gather putative adenylylation site and/or transcription terminator), provideDNA shifts and/or the sequence of integration function (is T-DNA border sequence, site-specific recombinase identificationSite, integrase recognition site), the sequence of selectivity function is provided (is antibiotic resistance markers, lifeThing synthetic gene), the order of assisting series of operations in the sequence of the label function of can scoring, external or body is providedRow (be polylinker sequence, locus specificity recombination sequence) and the sequence of copy function is provided (is bacteriumOrigin of replication, autonomously replicating sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests. More specifically, target elder brotherWorm is prodenia litura insect.

In the present invention, Cry1A albumen has toxicity to prodenia litura insect. Plant in the present invention, particularlyChinese sorghum and corn contain foreign DNA in its genome, and described foreign DNA comprises coding Cry1A eggWhite nucleotide sequence, prodenia litura insect is organized with this albumen and is contacted by feeding plant, twill after contactNoctuid insect growth is suppressed and finally causes death. Suppress to refer to lethal or sub-lethal. Meanwhile, plantIn form, should be normal, and can under conventional method, cultivate consumption and/or the generation for product. ThisOutward, this plant can substantially be eliminated needs to chemistry or biological insecticides (described chemistry or biological insecticides areFor the pesticide of the prodenia litura insect of Cry1A albumen institute target).

The expression of insecticidal crystal protein in vegetable material (ICP) can be by described multiple in this areaMethod detects, for example by application special primer to organizing the coded insect-killing protein of interior generationMRNA carries out quantitatively, or the amount of the insect-killing protein that directly specific detection produces.

Can apply the insecticidal effect of ICP in different test determination plants. In the present invention, targeted insect is mainFor prodenia litura.

In the present invention, described Cry1A albumen can have SEQ ID NO:1, SEQIDNO:2,Amino acid sequence shown in SEQIDNO:3 and/or SEQIDNO:28. Except comprising Cry1A albumenOutside code area, also can comprise other elements, for example the protein of codes selection mark.

The expression cassette of the nucleotide sequence that in addition, comprises code book invention Cry1A albumen is all right in plantWith at least one coding herbicide resistance gene protein together with express, described herbicide resistance gene comprisesBut be not limited to, phosphine oxamate resistant gene (as bar gene, pat gene), phenmedipham resistant gene are (as pmphGene), glyphosate resistance gene (as EPSPS gene), Brominal (bromoxynil) resistant gene,Sulfonylureas resistant gene, the resistant gene to herbicide Dalapon, resistant gene or the glutamine to cyanamideThe resistant gene of synthetase inhibitors (as PPT), had not only had high insecticidal activity, but also has and remove thereby obtainThe genetically modified plants of grass agent resistance.

In the present invention, foreign DNA is imported to plant, as gene or the expression of Cry1A albumen as described in by codingBox or recombinant vector import plant cell, and conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion,The DNA that protoplast, electroporation or silicon whisker mediation are bombarded, directly DNA taken in trace transmitting imports.

A kind of method that the invention provides Control pests, has the following advantages:

1, internal cause control. Prior art is mainly that external cause is controlled prodenia litura insect by external actionHarm, as cultural control, chemical prevention and physical control; And the present invention is can by producing in plantThe Cry1A albumen that kills prodenia litura is controlled prodenia litura insect, prevents and treats by internal cause.

2, pollution-free, noresidue. Although the chemical prevention and control method that prior art is used is to controlling prodenia litura evilCertain effect has been played in the harm of worm, but also people, animal and farmland ecosystem has been brought to pollution, broken simultaneouslyBad and residual; Use the method for control prodenia litura insect of the present invention, can eliminate above-mentioned adverse consequences.

3, control in the time of infertility. The method of the control prodenia litura insect that prior art is used is all interim,And the present invention is the protection of plant being carried out to the time of infertility, genetically modified plants (Cry1A albumen) from germinate,Growth, until bloom, result, can avoid suffering the infringement of prodenia litura.

4, whole plant control. The method of the control prodenia litura insect that prior art is used is locality mostly,As foliage-spray; And the present invention protects whole plant, as genetically modified plants (Cry1A albumen)Blade, stem stalk, tassel, female fringe, flower pesticide, filigree, fruit etc. all can be resisted prodenia litura infringement.

5, effect stability. What prior art was used is that cultural control method or physical control method all need profitBy environmental condition, insect is prevented and treated, variable factor is more; The present invention makes described Cry1A albumen at plantInside express, effectively avoided the unsettled defect of environmental condition, and genetically modified plants (Cry1A of the present inventionAlbumen) prevention effect in different location, different time, different genetic background be all also stable and consistent.

6, simple, convenient, economical. The physical control method that prior art is used is tool in agricultural production operationThere is certain difficulty; The present invention only need plant the genetically modified plants that can express Cry1A albumen, and notOther measure be need to adopt, thereby a large amount of human and material resources and financial resources saved.

7, effect is thorough. The method of the control prodenia litura insect that prior art is used, its effect is not thorough, only play and alleviate effect; And genetically modified plants of the present invention (Cry1A albumen) can be caused the first twill of incubatingThe mortality of exigua larvae, and fraction survival larvae development progress is caused to great inhibition, children after 3 daysWorm is substantially still in just incubating state or between just incubate-negative control state, being all obvious depauperation,And stopped growing, and genetically modified plants are only subject to slight damage substantially.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Brief description of the drawings

Fig. 1 is that the recombinant clone that contains Cry1Ab-01 nucleotide sequence of the method for Control pests of the present invention carriesBody DBN01-T builds flow chart;

Fig. 2 is contain Cry1Ab-01 nucleotide sequence recombinant expressed year of method of Control pests of the present inventionBody DBN100124 builds flow chart;

Fig. 3 is contain Cry1Ab-01 nucleotide sequence recombinant expressed year of method of Control pests of the present inventionBody DBN100093 builds flow chart;

Fig. 4 is the pest-resistant design sketch of the transgenic corn plant inoculation prodenia litura of the method for Control pests of the present invention;

Fig. 5 is the pest-resistant design sketch of the Transgenic soybean plants inoculation prodenia litura of the method for Control pests of the present invention.

Detailed description of the invention

Further illustrate the technical scheme of the method for Control pests of the present invention below by specific embodiment.

The acquisition of the first embodiment, Cry1A gene and synthetic

1, obtain Cry1A nucleotide sequence

The amino acid sequence (818 amino acid) of Cry1Ab-01 insect-killing protein, as SEQ IDShown in NO:1; Coding is corresponding to the amino acid sequence (818 amino acid) of described Cry1Ab-01 insect-killing proteinCry1Ab-01 nucleotide sequence (2457 nucleotides), as shown in SEQ ID NO:4.The amino acid sequence (615 amino acid) of Cry1Ab-02 insect-killing protein, as SEQ ID NO:2Shown in; Coding is corresponding to the amino acid sequence (615 amino acid) of described Cry1Ab-02 insect-killing proteinCry1Ab-02 nucleotide sequence (1848 nucleotides), as shown in SEQ ID NO:5.

The amino acid sequence (609 amino acid) of Cry1Ab/Ac insect-killing protein, as SEQ IDShown in NO:28; Coding is corresponding to the amino acid sequence (609 amino acid) of described Cry1Ab/Ac insect-killing proteinCry1Ab/Ac nucleotide sequence (1830 nucleotides), as shown in SEQ ID NO:29.

The amino acid sequence (1177 amino acid) of Cry1A.105 insect-killing protein, as SEQ IDShown in NO:3; Coding is corresponding to amino acid sequence (1177 amino of described Cry1A.105 insect-killing proteinAcid) Cry1A.105 nucleotide sequence (3534 nucleotides), as shown in SEQ ID NO:6.

2, obtain Vip class nucleotide sequence

The Vip3Aa nucleotides of the amino acid sequence (789 amino acid) of coding Vip3Aa insect-killing proteinSequence (2370 nucleotides), as shown in SEQ ID NO:7.

3, obtain other Cry class nucleotide sequence

The Cry2Ab nucleotides of the amino acid sequence (634 amino acid) of coding Cry2Ab insect-killing proteinSequence (1905 nucleotides), as shown in SEQ ID NO:8.

4, synthetic above-mentioned nucleotide sequence

Described Cry1Ab-01 nucleotide sequence (as shown in SEQ ID NO:4), as described inCry1Ab-02 nucleotide sequence (as shown in SEQ ID NO:5), as described in Cry1Ab/Ac coreNucleotide sequence (as shown in SEQ ID NO:29), as described in Cry1A.105 nucleotide sequence (asShown in SEQ ID NO:6), described Vip3Aa nucleotide sequence is (as SEQ IDShown in NO:7) and described Cry2Ab nucleotide sequence (as shown in SEQ ID NO:8) by southJing Jinsirui bio tech ltd is synthetic. Synthetic described Cry1Ab-01 nucleotide sequence (SEQIDNO:4) 5 ' end is also connected with NcoI restriction enzyme site, described Cry1Ab-01 nucleotide sequence (SEQIDNO:4) 3 ' end is also connected with SpeI restriction enzyme site; Synthetic described Cry1Ab-02 nucleotide sequence (SEQIDNO:5) 5 ' end is also connected with NcoI restriction enzyme site, described Cry1Ab-02 nucleotide sequence (SEQIDNO:5) 3 ' end is also connected with SpeI restriction enzyme site; Synthetic described Cry1Ab/Ac nucleotide sequence(SEQIDNO:29) 5 ' end is also connected with NcoI restriction enzyme site, described Cry1Ab/Ac nucleotides sequence3 ' end of row (SEQIDNO:29) is also connected with KpnI restriction enzyme site; Synthetic described Cry1A.1055 ' end of nucleotide sequence (SEQIDNO:6) is also connected with NcoI restriction enzyme site, described Cry1A.1053 ' end of nucleotide sequence (SEQIDNO:6) is also connected with HindIII restriction enzyme site; Described in synthetic5 ' end of Vip3Aa nucleotide sequence (SEQIDNO:7) is also connected with ScaI restriction enzyme site, described Vip3Aa3 ' end of nucleotide sequence (SEQIDNO:7) is also connected with SpeI restriction enzyme site; Synthetic described Cry2Ab5 ' end of nucleotide sequence (SEQIDNO:8) is also connected with NcoI restriction enzyme site, described Cry2Ab core3 ' end of nucleotide sequence (SEQIDNO:8) is also connected with SpeI restriction enzyme site.

The structure of the second embodiment, recombinant expression carrier and recombinant expression carrier transform Agrobacterium

1, build the recombinant cloning vector that contains Cry1A gene

Synthetic Cry1Ab-01 nucleotide sequence is connected into cloning vector pGEM-T(Promega, Madison,USA, CAT:A3600) upper, operating procedure is pressed the product pGEM-T of Promega company carrier descriptionCarry out, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents as shown in Figure 1Ampicillin resistance gene; F1 represents the origin of replication of bacteriophage f1; LacZ is LacZ initiation codon;SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promoter; Cry1Ab-01 isCry1Ab-01 nucleotide sequence (SEQIDNO:4); MCS is MCS).

Then recombinant cloning vector DBN01-T is transformed to Escherichia coli T1 competent cell by heat shock method(Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l Escherichia coli T1Competent cell, 10 μ l DNAs (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; 37 DEG CShaken cultivation 1 hour (shaking table shake under 100rpm rotating speed), scribbles IPTG(isopropylthio-β-D-on surfaceGalactoside) and the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) ampicillin (100 milligrams/Rise) LB flat board (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, agar 15g/L,With NaOH tune pH to 7.5) upper grow overnight. Picking white colony, at LB fluid nutrient medium (tryptosePeptone 10g/L, yeast extract 5g/L, NaCl10g/L, ampicillin 100mg/L, adjusts pH with NaOHTo 7.5) under 37 DEG C of conditions of temperature overnight incubation. Alkaline process extracts its plasmid: bacterium liquid is turned at 12000rpmThe lower centrifugal 1min of speed, removes supernatant, the solution I of 100 μ l ice precoolings for precipitation thalline (25mMTris-HCl,10mMEDTA(ethylenediamine tetra-acetic acid), 50mM glucose, pH8.0) suspend; Add 150 μ l newly to joinThe solution II (0.2MNaOH, 1%SDS(lauryl sodium sulfate) of system), pipe is put upside down 4 times, mixedClose, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M potassium acetate, 2M acetic acid), immediatelyFully mix, place 5-10min on ice; Centrifugal 5min under 4 DEG C of temperature, rotating speed 12000rpm condition,In supernatant, add 2 times of volume absolute ethyl alcohols, mix rear room temperature and place 5min; In 4 DEG C of temperature, rotating speedUnder 12000rpm condition, centrifugal 5min, abandons supernatant, the ethanol washing that precipitation is 70% by concentration (V/V)After dry; Add 30 μ l containing RNase(20 μ g/ml) TE(10mMTris-HCl, 1mMEDTA,PH8.0) dissolution precipitation; Water-bath 30min at 37 DEG C of temperature, digestion RNA; DEG C save backup in temperature-20.

The plasmid extracting is cut after qualification through AhdI and BglI enzyme, positive colony is carried out to sequence verification, result tableThe described Cry1Ab-01 nucleotides sequence inserting in bright recombinant cloning vector DBN01-T is classified SEQ in sequence table asNucleotide sequence shown in IDNO:4, Cry1Ab-01 nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by synthetic described Cry1Ab-02 coreIt is upper that nucleotide sequence is connected into cloning vector pGEM-T, obtains recombinant cloning vector DBN02-T, wherein,Cry1Ab-02 is Cry1Ab-02 nucleotide sequence (SEQIDNO:5). Enzyme is cut and sequence verification restructuring gramDescribed in grand carrier DBN02-T, Cry1Ab-02 nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by synthetic described Cry1A.105 coreIt is upper that nucleotide sequence is connected into cloning vector pGEM-T, obtains recombinant cloning vector DBN03-T, wherein,Cry1A.105 is Cry1A.105 nucleotide sequence (SEQIDNO:6). Enzyme is cut and sequence verification restructuring gramDescribed in grand carrier DBN03-T, Cry1A.105 nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by synthetic described Vip3Aa nucleosidesIt is upper that acid sequence is connected into cloning vector pGEM-T, obtains recombinant cloning vector DBN04-T, wherein, and Vip3AaFor Vip3Aa nucleotide sequence (SEQIDNO:7). Enzyme is cut and sequence verification recombinant cloning vector DBN04-TDescribed in Vip3Aa nucleotide sequence correctly insert.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by synthetic described Cry2Ab nucleosidesIt is upper that acid sequence is connected into cloning vector pGEM-T, obtains recombinant cloning vector DBN05-T, wherein, and Cry2AbFor Cry2Ab nucleotide sequence (SEQIDNO:8). Enzyme is cut and sequence verification recombinant cloning vector DBN05-TDescribed in Cry2Ab nucleotide sequence correctly insert.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by synthetic described Cry1Ab/Ac coreIt is upper that nucleotide sequence is connected into cloning vector pGEM-T, obtains recombinant cloning vector DBN06-T, wherein,Cry1Ab/Ac is Cry1Ab/Ac nucleotide sequence (SEQIDNO:29). Enzyme is cut with sequence verification and is recombinatedDescribed in cloning vector DBN06-T, Cry1Ab/Ac nucleotide sequence correctly inserts.

2, build the recombinant expression carrier that contains Cry1A gene

With restriction enzyme NcoI and SpeI respectively enzyme cut recombinant cloning vector DBN01-T and expression vectorDBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), will cutCry1Ab-01 nucleotide sequence fragment be inserted into the NcoI of expression vector DBNBC-01 and SpeI site itBetween, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, is built into restructuring tableReach carrier DBN100124, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: the rightBoundary; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQIDNO:9); Cry1Ab-01:Cry1Ab-01 nucleotide sequence (SEQIDNO:4); Nos: the terminator (SEQ of rouge alkali synthetase geneIDNO:10); PMI: Phophomannose isomerase gene (SEQIDNO:11); LB: left margin).

Recombinant expression carrier DBN100124 is transformed to Escherichia coli T1 competent cell by heat shock method, itsHot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l DNA (recombinant expression carriersDBN100124), 42 DEG C of water-baths 30 seconds; Within 1 hour, (under 100rpm rotating speed, shaking table shakes 37 DEG C of shaken cultivationMoving); Then containing the LB solid plate of 50mg/L kanamycins (Kanamycin) (tryptone 10g/L,Yeast extract 5g/L, NaCl10g/L, agar 15g/L, with NaOH tune pH to 7.5) upper in temperatureUnder 37 DEG C of conditions, cultivate 12 hours, picking white colony, LB fluid nutrient medium (tryptone 10g/L,Yeast extract 5g/L, NaCl10g/L, kanamycins 50mg/L, with NaOH adjust pH to 7.5) inOvernight incubation under 37 DEG C of conditions of temperature. Alkaline process extracts its plasmid. By the plasmid restriction enzyme NcoI extractingCut rear qualification with SpeI enzyme, and by the positive colony qualification of checking order, result shows recombinant expression carrierThe nucleotides sequence of DBN100124 between NcoI and SpeI site classified as shown in SEQ ID NO:4Nucleotide sequence, i.e. Cry1Ab-01 nucleotide sequence.

According to the method for above-mentioned structure recombinant expression carrier DBN100124, NcoI and SpeI enzyme are cut to restructuring gramThe described Cry1Ab-02 nucleotide sequence that grand carrier DBN02-T cuts inserts expression vector DBNBC-01,To recombinant expression carrier DBN100053. Enzyme cut with sequence verification recombinant expression carrier DBN100053 in coreNucleotide sequence is containing nucleotide sequence, i.e. Cry1Ab-02 nucleotides sequence shown in promising SEQ ID NO:5Row, described Cry1Ab-02 nucleotide sequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100124, NcoI and KpnI enzyme are cut to restructuring gramThe described Cry1Ab/Ac nucleotide sequence that grand carrier DBN06-T cuts inserts expression vector DBNBC-01,To recombinant expression carrier DBN100056. Enzyme cut with sequence verification recombinant expression carrier DBN100056 in coreNucleotide sequence is containing nucleotide sequence, i.e. Cry1Ab/Ac nucleotides sequence shown in promising SEQ ID NO:29Row, described Cry1Ab/Ac nucleotide sequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100124, by NcoI and SpeI, ScaI andSpeI respectively enzyme cuts the described Cry1Ab-01 nucleosides that recombinant cloning vector DBN01-T and DBN04-T cutAcid sequence and Vip3Aa nucleotide sequence insert expression vector DBNBC-01, obtain recombinant expression carrierDBN100003. Enzyme cut with sequence verification recombinant expression carrier DBN100003 in nucleotide sequence containing promisingNucleotide sequence shown in SEQ ID NO:4 and SEQIDNO:7, i.e. Cry1Ab-01 nucleotidesSequence and Vip3Aa nucleotide sequence, described Cry1Ab-01 nucleotide sequence and described Vip3Aa nucleotidesSequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100124, NcoI and HindIII enzyme are cut to restructuringThe described Cry1A.105 nucleotide sequence that cloning vector DBN03-T cuts inserts expression vector DBNBC-01,Obtain recombinant expression carrier DBN100029. Enzyme cut with sequence verification recombinant expression carrier DBN100029 inNucleotide sequence is containing nucleotide sequence, i.e. Cry1A.105 nucleotides shown in promising SEQ ID NO:6Sequence, described Cry1A.105 nucleotide sequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100124, by NcoI and HindIII, NcoIWith SpeI respectively enzyme cut the described Cry1A.105 core that recombinant cloning vector DBN03-T and DBN05-T cutNucleotide sequence and Cry2Ab nucleotide sequence insert expression vector DBNBC-01, obtain recombinant expression carrierDBN100076. Enzyme cut with sequence verification recombinant expression carrier DBN100076 in nucleotide sequence containing promisingNucleotide sequence shown in SEQ ID NO:6 and SEQIDNO:8, i.e. Cry1A.105 nucleotidesSequence and Cry2Ab nucleotide sequence, described Cry1A.105 nucleotide sequence and described Cry2Ab nucleotidesSequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100124, with restriction enzyme NcoI andSpeI respectively enzyme cuts recombinant cloning vector DBN01-T and expression vector DBNBC-02(carrier framework:PCAMBIA2301(CAMBIA mechanism can provide)), by the Cry1Ab-01 nucleotide sequence cuttingFragment is inserted between the NcoI and SpeI site of expression vector DBNBC-02, utilizes conventional enzyme blanking methodCarrier construction is well-known to those skilled in the art, is built into recombinant expression carrier DBN100093, its structureBuild flow process (Kan: kanamycin gene as shown in Figure 3; RB: right margin; Ubi: corn Ubiquitin(is generalElement) gene promoter (SEQIDNO:9); Cry1Ab-01:Cry1Ab-01 nucleotide sequence (SEQIDNO:4); Nos: the terminator (SEQIDNO:10) of rouge alkali synthetase gene; PAT: careless fourth phosphine secondAcyltransferase gene (SEQIDNO:27); LB: left margin).

According to the method for above-mentioned structure recombinant expression carrier DBN100093, NcoI and SpeI enzyme are cut to restructuring gramThe described Cry1Ab-02 nucleotide sequence that grand carrier DBN02-T cuts inserts expression vector DBNBC-02,To recombinant expression carrier DBN100104. Enzyme cut with sequence verification recombinant expression carrier DBN100104 in coreNucleotide sequence is containing nucleotide sequence, i.e. Cry1Ab-02 nucleotides sequence shown in promising SEQ ID NO:5Row, described Cry1Ab-02 nucleotide sequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100093, NcoI and KpnI enzyme are cut to restructuring gramThe described Cry1Ab/Ac nucleotide sequence that grand carrier DBN06-T cuts inserts expression vector DBNBC-02,To recombinant expression carrier DBN100058. Enzyme cut with sequence verification recombinant expression carrier DBN100058 in coreNucleotide sequence is containing nucleotide sequence, i.e. Cry1Ab/Ac nucleotides sequence shown in promising SEQ ID NO:29Row, described Cry1Ab/Ac nucleotide sequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100093, by NcoI and SpeI, ScaI andSpeI respectively enzyme cuts the described Cry1Ab-01 nucleosides that recombinant cloning vector DBN01-T and DBN04-T cutAcid sequence and Vip3Aa nucleotide sequence insert expression vector DBNBC-02, obtain recombinant expression carrierDBN100321. Enzyme cut with sequence verification recombinant expression carrier DBN100321 in nucleotide sequence containing promisingNucleotide sequence shown in SEQ ID NO:4 and SEQIDNO:7, i.e. Cry1Ab-01 nucleotidesSequence and Vip3Aa nucleotide sequence, described Cry1Ab-01 nucleotide sequence and described Vip3Aa nucleotidesSequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100093, NcoI and HindIII enzyme are cut to restructuringThe described Cry1A.105 nucleotide sequence that cloning vector DBN03-T cuts inserts expression vector DBNBC-02,Obtain recombinant expression carrier DBN100032. Enzyme cut with sequence verification recombinant expression carrier DBN100032 inNucleotide sequence is containing nucleotide sequence, i.e. Cry1A.105 nucleotides shown in promising SEQ ID NO:6Sequence, described Cry1A.105 nucleotide sequence can connect described Ubi promoter and Nos terminator.

According to the method for above-mentioned structure recombinant expression carrier DBN100093, by NcoI and HindIII, NcoIWith SpeI respectively enzyme cut the described Cry1A.105 core that recombinant cloning vector DBN03-T and DBN05-T cutNucleotide sequence and Cry2Ab nucleotide sequence insert expression vector DBNBC-02, obtain recombinant expression carrierDBN100033. Enzyme cut with sequence verification recombinant expression carrier DBN100033 in nucleotide sequence containing promisingNucleotide sequence shown in SEQ ID NO:6 and SEQIDNO:8, i.e. Cry1A.105 nucleotidesSequence and Cry2Ab nucleotide sequence, described Cry1A.105 nucleotide sequence and described Cry2Ab nucleotidesSequence can connect described Ubi promoter and Nos terminator.

3, recombinant expression carrier transforms Agrobacterium

To oneself through build correct recombinant expression carrier DBN100124, DBN100053, DBN100056,DBN100003、DBN100029、DBN100076、DBN100093、DBN100104、DBN100058、DBN100321, DBN100032 and DBN100033 are transformed into Agrobacterium LBA4404 by liquid nitrogen methodIn (Invitrgen, Chicago, USA, CAT:18313-015), its conversion condition is: 100 μ L agriculturesBacillus LBA4404,3 μ L DNAs (recombinant expression carrier); Be placed in liquid nitrogen 10 minutes, 37 DEG CTepidarium 10 minutes; By the Agrobacterium LBA4404 after transforming be inoculated in LB test tube in 28 DEG C of temperature,Rotating speed is under 200rpm condition, to cultivate 2 hours, be applied to rifampin (Rifampicin) containing 50mg/L andOn the LB flat board of the kanamycins (Kanamycin) of 100mg/L until grow positive monoclonal, picking listClone cultivates and extracts its plasmid, uses restriction enzyme A hdI and StyI to recombinant expression carrierDBN100124, with restriction enzyme A hdI and XhoI to recombinant expression carrier DBN100053 andDBN100003, with restriction enzyme StyI and XhoI to recombinant expression carrier DBN100029 andDBN100076, with Restriction enzyme Sma I and AatII to recombinant expression carrier DBN100093 andDBN100104, with restriction enzyme A hdI and AatII to recombinant expression carrier DBN100056 andDBN100058, uses restriction enzyme A atII to recombinant expression carrier DBN100321, DBN10032Carry out enzyme with DBN100033 and cut checking, result show recombinant expression carrier DBN100124, DBN100053,DBN100056、DBN100003、DBN100029、DBN100076、DBN100093、DBN100104、DBN100058, DBN100321, DBN100032 and DBN100033 structure are entirely true.

The 3rd embodiment, proceed to acquisition and the checking of the milpa of Cry1A gene

1, obtain the milpa that proceeds to Cry1A gene

According to routine adopt Agrobacterium infestation method, by the corn variety of sterile culture combine 31(Z31) rataria withAgrobacterium in the second embodiment described in 3 is cultivated altogether, with by the second embodiment 2 build recombinant expression carriersDBN100124, DBN100053, DBN100056, DBN100003, DBN100029 and DBN100076In T-DNA(comprise corn Ubiquitin gene promoter sequence, Cry1Ab-01 nucleotide sequence,Cry1Ab-02 nucleotide sequence, Cry1Ab/Ac nucleotide sequence, Cry1A.105 nucleotide sequence, Vip3AaNucleotide sequence, Cry2Ab nucleotide sequence, PMI gene and Nos terminator sequence) be transferred to corn dyeingIn body group, obtained proceed to Cry1Ab-01 nucleotide sequence milpa, proceed to Cry1Ab-02 nucleotidesThe milpa of sequence, proceed to Cry1Ab/Ac nucleotide sequence milpa, proceed to Cry1Ab-01-Vip3AaThe milpa of nucleotide sequence, proceed to the milpa of Cry1A.105 nucleotide sequence and proceed toThe milpa of Cry1A.105-Cry2Ab nucleotide sequence; In contrast with wild type milpa simultaneously.

Transform for agriculture bacillus mediated corn, briefly, from corn, separate immature rataria, use agriculture barBacterium suspension contact rataria, wherein Agrobacterium can be by Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleosidesAcid sequence, Cry1Ab/Ac nucleotide sequence, Cry1Ab-01-Vip3Aa nucleotide sequence, Cry1A.105 coreNucleotide sequence and/or Cry1A.105-Cry2Ab nucleotide sequence are passed at least one cell of one of rataria(step 1: infect step), in this step, rataria preferably immerse agrobacterium suspension (OD660=0.4-0.6,Infect culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, grapeSugar 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3))In with start inoculation. Rataria and Agrobacterium are cultivated one period (3 days) (step 2: incubation step altogether) altogether.Preferably, rataria is infecting after step at solid medium (MS salt 4.3g/L, MS vitamin, casein300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4-dichloro-benzenesFluoroacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation. After this common cultivation stage, canThere is optionally " recovery " step. In " recovery " step, recovery media (MS salt 4.3g/L,MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L,Agar 8g/L, pH5.8) at least exist a kind of oneself know the antibiotic (cephalosporin) that suppresses Agrobacterium growth,Do not add the selective agent (step 3: recovering step) of vegetable transformant. Preferably, rataria there being antibiotic butDo not have to cultivate on the solid medium of selective agent, to eliminate Agrobacterium and to provide convalescence as infected cell. Then,The transformed calli of growing is being cultivated and selected to the rataria of inoculation containing on the culture medium of selective agent (mannose)(step 4: select step). Preferably, rataria have the screening solid medium of selective agent (MS salt 4.3g/L,MS vitamin, casein 300mg/L, sucrose 5g/L, mannose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D)1mg/L, agar 8g/L, pH5.8) upper cultivation, cause the cell selective growth transforming. Then, callus groupKnit regeneration plant (step 5: regeneration step), preferably, containing healing of growing on the culture medium of selective agentInjured tissue is above cultivated with aftergrowth at solid medium (MS differential medium and MS root media).

The resistant calli that screening obtains is transferred to described MS differential medium (MS salt 4.3g/L, MSVitamin, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, fine jadeFat 8g/L, pH5.8) upper, cultivate differentiation at 25 DEG C. Seedling out of differentiation is transferred to the described MS training of taking rootSupport base (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid1mg/L, agar 8g/L, pH5.8) upper, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to knotReal. In greenhouse, cultivate 16 hours every day at 28 DEG C, then at 20 DEG C, cultivate 8 hours.

2, proceed to the milpa of Cry1A gene with TaqMan checking

Get respectively proceed to Cry1Ab-01 nucleotide sequence milpa, proceed to Cry1Ab-02 nucleotides sequenceRow milpa, proceed to Cry1Ab/Ac nucleotide sequence milpa, proceed to Cry1Ab-01-Vip3AaThe milpa of nucleotide sequence, proceed to the milpa of Cry1A.105 nucleotide sequence and proceed toThe about 100mg of blade of the milpa of Cry1A.105-Cry2Ab nucleotide sequence, as sample, uses QiagenDNeasyPlantMaxiKit extract its genomic DNA, by Taqman fluorescence probe quantitative PCRMethod detects the copy number of Cry1A gene, Vip3Aa gene and Cry2Ab gene. Simultaneously with wild type jadeRice plant in contrast, detects analysis according to the method described above. 3 repetitions are established in experiment, average.

The concrete grammar that detects Cry1A gene, Vip3Aa gene and Cry2Ab gene copy number is as follows:

Step 11, respectively get proceed to Cry1Ab-01 nucleotide sequence milpa, proceed to Cry1Ab-02The milpa of nucleotide sequence, proceed to Cry1Ab/Ac nucleotide sequence milpa, proceed toThe milpa of Cry1Ab-01-Vip3Aa nucleotide sequence, proceed to the corn of Cry1A.105 nucleotide sequenceThe blade of plant, the milpa that proceeds to Cry1A.105-Cry2Ab nucleotide sequence and wild type milpaEach 100mg is ground into homogenate with liquid nitrogen respectively in mortar, and each sample is got 3 repetitions;

The DNeasyPlantMiniKit of step 12, use Qiagen extracts the genomic DNA of above-mentioned sample,Concrete grammar is with reference to its product description;

Step 13, with NanoDrop2000(ThermoScientific) measure the genomic DNA of above-mentioned sampleConcentration;

Step 14, adjust above-mentioned sample genomic DNA concentration to same concentration value, the model of described concentration valueEnclose the l for 80-100ng/ μ;

The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, to pass throughThe sample of qualification known copy number is as standard items, with the sample of wild type milpa in contrast, each3 repetitions of sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Cry1Ab-01 nucleotide sequence:

Primer 1(CF1): CGAACTACGACTCCCGCAC is as SEQ ID NO:12Shown in;

Primer 2 (CR1): GTAGATTTCGCGGGTCAGTTG is as SEQ ID NO:13Shown in;

Probe 1(CP1): CTACCCGATCCGCACCGTGTCC is as SEQ ID NO:14Shown in;

Following primer and probe are used for detecting Cry1Ab-02 nucleotide sequence:

Primer 3(CF2): TGCGTATTCAATTCAACGACATG is as SEQ IDShown in NO:15;

Primer 4(CR2): CTTGGTAGTTCTGGACTGCGAAC is as SEQ IDShown in NO:16;

Probe 2(CP2): CAGCGCCTTGACCACAGCTATCCC is as SEQ IDShown in NO:17;

Following primer and probe are used for detecting Vip3Aa nucleotide sequence:

Primer 5(VF1): ATTCTCGAAATCTCCCCTAGCG is as SEQ ID NO:18Shown in;

Primer 6(VR1): GCTGCCAGTGGATGTCCAG is as SEQ ID NO:19Shown in;

Probe 3(VP1): CTCCTGAGCCCCGAGCTGATTAACACC is as SEQ in sequence tableShown in IDNO:20;

Following primer and probe are used for detecting Cry1A.105 nucleotide sequence:

Primer 7(CF3): GCGCATCCAGTTCAACGAC is as SEQ ID NO:21Shown in;

Primer 8(CR3): GTTCTGGACGGCGAAGAGTG is as SEQ ID NO:22Shown in;

Probe 4(CP3): TGAACAGCGCCCTGACCACCG is as SEQ ID NO:23Shown in;

Following primer and probe are used for detecting Cry2Ab nucleotide sequence:

Primer 9(CF4): CTGATACCCTTGCTCGCGTC is as SEQ ID NO:24Shown in;

Primer 10(CR4): CACTTGGCGGTTGAACTCCTC is as SEQ ID NO:25Shown in;

Probe 5(CP4): CGCTGAGCTGACGGGTCTGCAAG is as SEQ IDShown in NO:26;

Following primer and probe are used for detecting Cry1Ab/Ac nucleotide sequence:

Primer 11(CF5): TGCGTATTCAATTCAACGACATG is as SEQ IDShown in NO:30;

Primer 12(CR5): CTTGGTAGTTCTGGACTGCGAAC is as SEQ IDShown in NO:31;

Probe 6(CP5): CAGCGCCTTGACCACAGCTATCCC is as SEQ IDShown in NO:32;

PCR reaction system is:

The each 45 μ l of every kind of primer that described 50 × primer/probe mixture comprises 1mM concentration, 100 μ M concentrationProbe 50 μ l and 860 μ l1 × TE buffer solution, and at 4 DEG C, be housed in amber test tube.

PCR reaction condition is:

Utilize SDS2.3 software (AppliedBiosystems) to analyze data.

Experimental result shows, Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ab/AcNucleotide sequence, Cry1Ab-01-Vp3Aa nucleotide sequence, Cry1A.105 nucleotide sequence andAll oneself is incorporated in the genome of detected milpa Cry1A.105-Cry2Ab nucleotide sequence, andAnd proceed to Cry1Ab-01 nucleotide sequence milpa, proceed to the corn of Cry1Ab-02 nucleotide sequencePlant, proceed to Cry1Ab/Ac nucleotide sequence milpa, proceed to Cry1Ab-01-Vip3Aa nucleotidesThe milpa of sequence, proceed to the milpa of Cry1A.105 nucleotide sequence and proceed toThe milpa of Cry1A.105-Cry2Ab nucleotide sequence all obtained contain single copy Cry1A gene,The transgenic corn plant of Vip3Aa gene and/or Cry2Ab gene.

The pest-resistant effect detection of the 4th embodiment, transgenic corn plant

By proceed to Cry1Ab-01 nucleotide sequence milpa, proceed to Cry1Ab-02 nucleotide sequenceMilpa, proceed to Cry1Ab/Ac nucleotide sequence milpa, proceed to Cry1Ab-01-Vip3Aa coreThe milpa of nucleotide sequence, proceed to Cry1A.105 nucleotide sequence milpa, proceed toMilpa, the wild type milpa of Cry1A.105-Cry2Ab nucleotide sequence and identifying through TaqmanFor not genetically modified milpa carries out pest-resistant effect detection to prodenia litura.

Get respectively proceed to Cry1Ab-01 nucleotide sequence milpa, proceed to Cry1Ab-02 nucleotides sequenceRow milpa, proceed to Cry1Ab/Ac nucleotide sequence milpa, proceed to Cry1Ab-01-Vip3AaThe milpa of nucleotide sequence, proceed to Cry1A.105 nucleotide sequence milpa, proceed toMilpa, the wild type milpa of Cry1A.105-Cry2Ab nucleotide sequence and identifying through TaqmanFor the fresh blade (lobus cardiacus) of not genetically modified milpa (V3-V4 phase), clean with aseptic water washingAnd the water on blade is blotted with gauze, then maize leaf is removed to vein, be cut into about 1cm × 4cm simultaneouslyStrip, get 3 strip blades after cutting and put on the filter paper of round plastic culture dish bottom, described inFilter paper is wetting with distilled water, puts the prodenia litura (newly hatched larvae) of 10 artificial feedings in each culture dish,The square box of wet gauze put into bottom after adding a cover and is placed with by worm examination culture dish, temperature 26-28 DEG C, relative humidityUnder the condition of 70%-80%, photoperiod (light/dark) 16:8, place after 3 days, send out according to Spodoptera litura larvaeEducate progress, the death rate and three indexs of blade injury rate, obtain resistance total score: total score=100 × death rate+[100× the death rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+ 10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate). Proceed to Cry1Ab-01Totally 3 strains (S1, S2 and S3) of nucleotide sequence, proceed to totally 3 of Cry1Ab-02 nucleotide sequenceIndividual strain (S4, S5 and S6), proceed to Cry1Ab-01-Vip3Aa nucleotide sequence totally 3 strains (S7,S8 and S9), proceed to totally 3 strains (S10, S11 and S12) of Cry1A.105 nucleotide sequence, turnTotally 3 strains (S13, S14 and S15) that enter Cry1A.105-Cry2Ab nucleotide sequence, proceed toTotally 3 strains (S31, S32 and S33) of Cry1Ab/Ac nucleotide sequence, are accredited as non-through TaqmanGenetically modified (NGM1) be totally 1 strain, and (CK1) of wild type be totally 1 strain; From each strain choosing3 strains are tested, and every strain repeats 6 times. Result is as shown in table 1 and Fig. 4.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation prodenia litura

The result of table 1 shows: proceed to Cry1Ab-01 nucleotide sequence milpa, proceed toThe milpa of Cry1Ab-01-Vip3Aa nucleotide sequence, the corn that proceeds to Cry1A.105 nucleotide sequence are plantedStrain and milpa raw that proceeds to Cry1A.105-Cry2Ab nucleotide sequence are surveyed total score all more than 250 points,Part can reach 300 points of full marks; Proceed to the milpa of Cry1Ab-02 nucleotide sequence and proceed to Cry1Ab/AcThe milpa of nucleotide sequence raw surveyed total score more than 200 points or left and right; And be accredited as non-through TaqmanThe raw total score of surveying of genetically modified milpa and wild type milpa is generally 25 points of left and right.

The result of Fig. 4 shows: compared with wild type milpa, proceed to Cry1Ab-01 nucleotide sequenceMilpa, proceed to Cry1Ab-02 nucleotide sequence milpa, proceed to Cry1Ab/Ac nucleotides sequenceRow milpa, proceed to Cry1Ab-01-Vip3Aa nucleotide sequence milpa, proceed to Cry1A.105The milpa of nucleotide sequence can be made with the milpa that proceeds to Cry1A.105-Cry2Ab nucleotide sequenceBecome the mortality of just incubating Spodoptera litura larvae, and fraction survival larvae development progress is caused greatly and pressed downSystem, after 3 days, larva substantially still incubates state in just, and proceed to Cry1Ab-01 nucleotide sequence milpa,Proceed to Cry1Ab/Ac nucleotide sequence milpa, proceed to Cry1Ab-01-Vip3Aa nucleotide sequenceMilpa, proceed to the milpa of Cry1A.105 nucleotide sequence and proceed to Cry1A.105-Cry2Ab coreThe milpa of nucleotide sequence is only subject to slight damage substantially, is only the damage of minute quantity Pinhole-shaped on blade,Its blade injury rate, all in 10% left and right or following, only proceeds to the milpa of Cry1Ab-02 nucleotide sequenceBlade injury rate in 20% left and right or following.

Thus prove proceed to Cry1Ab-01 nucleotide sequence milpa, proceed to Cry1Ab-02 nucleotidesThe milpa of sequence, proceed to Cry1Ab/Ac nucleotide sequence milpa, proceed toThe milpa of Cry1Ab-01-Vip3Aa nucleotide sequence, proceed to the corn of Cry1A.105 nucleotide sequencePlant and the milpa that proceeds to Cry1A.105-Cry2Ab nucleotide sequence all demonstrate high resistance prodenia lituraActivity, is controlled it thereby this activity is enough to that the growth of prodenia litura is produced to ill effect.

The 5th embodiment, proceed to acquisition and the checking of the soybean plant strain of Cry1A gene

1, obtain the soybean plant strain that proceeds to Cry1A gene

The Agrobacterium infestation method adopting according to routine, by the cotyledonary node tissue of Huang 13 in the soybean varieties of sterile cultureCultivate altogether with the Agrobacterium described in 3 in the second embodiment, with by the second embodiment 2 build recombinant expressed yearsBody DBN100093, DBN100104, DBN100058, DBN100321, DBN100032 and DBN100033In T-DNA(comprise corn Ubiquitin gene promoter sequence, Cry1Ab-01 nucleotide sequence,Cry1Ab-02 nucleotide sequence, Cry1Ab/Ac nucleotide sequence, Cry1A.105 nucleotide sequence, Vip3AaNucleotide sequence, Cry2Ab nucleotide sequence, pat gene and Nos terminator sequence) be transferred to soybean dyeingIn body group, obtained proceed to Cry1Ab-01 nucleotide sequence soybean plant strain, proceed to Cry1Ab-02 nucleotidesThe soybean plant strain of sequence, proceed to Cry1Ab/Ac nucleotide sequence soybean plant strain, proceed to Cry1Ab-01-Vip3AaThe soybean plant strain of nucleotide sequence, proceed to the soybean plant strain of Cry1A.105 nucleotide sequence and proceed toThe soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence; In contrast with wild type soybean plant strain simultaneously.

For agriculture bacillus mediated transformation of soybean, briefly, soya seeds is seeded in to inducing culture (N6Salt, N6 vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L,Plant gel 3g/L, pH5.8) upper, induce callus (step 1: callus of induce from soybean mature embryoStep), afterwards, preferably callus, contacts callus, wherein Agrobacterium energy with agrobacterium suspensionEnough by Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ab/Ac nucleotide sequence,Cry1Ab-01-Vip3Aa nucleotide sequence, Cry1A.105 nucleotide sequence and/or Cry1A.105-Cry2AbNucleotide sequence is passed at least one cell (step 2: infect step) on callus. In this stepIn, callus preferably immerses agrobacterium suspension, and (OD660=0.3 infects culture medium (N6 salt, N6Vitamin, casein 300mg/L, sucrose 30g/L, glucose 10g/L, acetosyringone (AS) 40mg/L,2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, pH5.4)) in start infect. Callus and agriculture barBacterium is cultivated one period (3 days) (step 3: incubation step altogether) altogether. Preferably, callus is infectingAfter step at solid medium (N6 salt, N6 vitamin, casein 300mg/L, sucrose 30g/L, grapeSugar 10g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plantGel 3g/L, pH5.8) upper cultivation. After this common cultivation stage, there is " recovery " step. " extensiveMultiple " in step, recovery media (N6 salt, N6 vitamin, casein 300mg/L, sucrose 30g/L,2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) at least exist a kind of oneselfKnow the antibiotic (cephalosporin) that suppresses Agrobacterium growth, do not add vegetable transformant selective agent (step 4:Recovering step). Preferably, callus is cultivated on the solid medium of selective agent having antibiotic but do not have,To eliminate Agrobacterium and to provide convalescence as infected cell. Then, the callus of inoculation is (sweet containing selective agentReveal sugar) culture medium on the transformed calli (step 5: selection step) cultivating and select to grow. ExcellentSelection of land, callus is having the screening solid medium of selective agent (N6 salt, N6 vitamin, casein300mg/L, sucrose 10g/L, mannose 10g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plantGel 3g/L, pH5.8) upper cultivation, cause the cell selective growth transforming. Then, callus regenerationBecome plant (step 6: regeneration step), preferably, at the callus containing growing on the culture medium of selective agentAbove cultivate with aftergrowth at solid medium (N6 differential medium and MS root media).

The resistant calli that screening obtains is transferred to described N6 differential medium (N6 salt, N6 vitamin, dryCasein 300mg/L, sucrose 20g/L, 6-benzyl aminoadenine 2mg/L, naa 1mg/L, plant gel 3g/L,PH5.8) upper, cultivate differentiation at 25 DEG C. Differentiation seedling is out transferred to described MS root media (MSSalt, MS vitamin, casein 300mg/L, sucrose 15g/L, plant gel 3g/L, pH5.8) upper, 25 DEG CUnder to be cultured to about 10cm high, move to hot-house culture to solid. In greenhouse, cultivate every day at 30 DEG C.

2, proceed to the soybean plant strain of Cry1A gene with TaqMan checking

Get respectively proceed to Cry1Ab-01 nucleotide sequence soybean plant strain, proceed to Cry1Ab-02 nucleotides sequenceRow soybean plant strain, proceed to Cry1Ab/Ac nucleotide sequence soybean plant strain, proceed to Cry1Ab-01-Vip3AaThe soybean plant strain of nucleotide sequence, proceed to the soybean plant strain of Cry1A.105 nucleotide sequence and proceed toThe about 100mg of blade of the soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence, as sample, uses QiagenDNeasyPlantMaxiKit extract its genomic DNA, by Taqman fluorescence probe quantitative PCRMethod detects the copy number of Cry1A gene, Vip3Aa gene and Cry2Ab gene. Simultaneously large with wild typeBeans plant in contrast, proceeds to Cry1A gene according to 2 use TaqMan checkings in above-mentioned the 3rd embodimentThe method of milpa detects analysis. 3 repetitions are established in experiment, average.

Experimental result shows, Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ab/AcNucleotide sequence Cry1Ab-01-Vp3Aa nucleotide sequence, Cry1A.105 nucleotide sequence andAll oneself is incorporated in the genome of detected soybean plant strain Cry1A.105-Cry2Ab nucleotide sequence, andAnd proceed to Cry1Ab-01 nucleotide sequence soybean plant strain, proceed to the soybean of Cry1Ab-02 nucleotide sequencePlant, proceed to Cry1Ab/Ac nucleotide sequence soybean plant strain, proceed to Cry1Ab-01-Vip3Aa nucleotidesThe soybean plant strain of sequence, proceed to the soybean plant strain of Cry1A.105 nucleotide sequence and proceed toThe soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence all obtained contain single copy Cry1A gene,The Transgenic soybean plants of Vip3Aa gene and/or Cry2Ab gene.

The pest-resistant effect detection of the 6th embodiment, Transgenic soybean plants

By proceed to Cry1Ab-01 nucleotide sequence soybean plant strain, proceed to Cry1Ab-02 nucleotide sequenceSoybean plant strain, proceed to Cry1Ab/Ac nucleotide sequence soybean plant strain, proceed to Cry1Ab-01-Vip3Aa coreThe soybean plant strain of nucleotide sequence, proceed to Cry1A.105 nucleotide sequence soybean plant strain, proceed toSoybean plant strain, the wild type soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence and identifying through TaqmanFor not genetically modified soybean plant strain carries out pest-resistant effect detection to prodenia litura.

Get respectively proceed to Cry1Ab-01 nucleotide sequence soybean plant strain, proceed to Cry1Ab-02 nucleotides sequenceRow soybean plant strain, proceed to Cry1Ab/Ac nucleotide sequence soybean plant strain, proceed to Cry1Ab-01-Vip3AaThe soybean plant strain of nucleotide sequence, proceed to Cry1A.105 nucleotide sequence soybean plant strain, proceed toSoybean plant strain, the wild type soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence and identifying through TaqmanFor the fresh blade of not genetically modified soybean plant strain (Seedling Stage), with aseptic water washing clean and with gauze willWater on blade blots, and is cut into the shape of about 2cm × 2cm or 1cm × 4cm simultaneously, gets 1 leaf after cuttingSheet is put on the filter paper of round plastic culture dish bottom, and described filter paper is wetting with distilled water, in each culture dishPut the prodenia litura (newly hatched larvae) of 10 artificial feedings, after worm examination culture dish is added a cover, temperature 26-28 DEG C,Under the condition of relative humidity 70%-80%, photoperiod (light/dark) 16:8, place after 3 days, according to twill nightMoth larvae development progress, the death rate and three indexs of blade injury rate, obtain resistance total score: total score=100 ×The death rate+[100 × death rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/Connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate). Proceed toTotally 3 strains (S16, S17 and S18) of Cry1Ab-01 nucleotide sequence, proceed to Cry1Ab-02 coreTotally 3 strains (S19, S20 and S21) of nucleotide sequence, proceed to Cry1Ab-01-Vip3Aa nucleotides sequenceTotally 3 strains (S22, S23 and S24) of row, proceed to totally 3 strains of Cry1A.105 nucleotide sequenceSystem (S25, S26 and S27), proceed to Cry1A.105-Cry2Ab nucleotide sequence totally 3 strains (S28,S29 and S30), proceed to totally 3 strains (S34, S35 and S36) of Cry1Ab/Ac nucleotide sequence,Be accredited as not genetically modified (NGM2) totally 1 strain, totally 1 of (CK2) of wild type through TaqmanStrain; Select 3 strains to test from each strain, every strain repeats 6 times. Result is as shown in table 2 and Fig. 5.

The pest-resistant experimental result of table 2, Transgenic soybean plants inoculation prodenia litura

The result of table 2 shows: proceed to Cry1Ab-01 nucleotide sequence soybean plant strain, proceed to Cry1Ab-02The soybean plant strain of nucleotide sequence, proceed to Cry1Ab-01-Vip3Aa nucleotide sequence soybean plant strain, proceed toThe soybean plant strain of Cry1A.105 nucleotide sequence and the soybean that proceeds to Cry1A.105-Cry2Ab nucleotide sequencePlant raw surveyed total score all 250 points or more or left and right, partly can reach 300 points of full marks; Only proceed to Cry1Ab/AcThe soybean plant strain of nucleotide sequence raw surveyed total score more than 200 points or left and right; And be accredited as non-through TaqmanThe raw total score of surveying of genetically modified soybean plant strain and wild type soybean plant strain is generally 15 points of left and right.

The result of Fig. 5 shows: compared with wild type soybean plant strain, proceed to Cry1Ab-01 nucleotide sequenceSoybean plant strain, proceed to Cry1Ab-02 nucleotide sequence soybean plant strain, proceed to Cry1Ab/Ac nucleotides sequenceRow soybean plant strain, proceed to Cry1Ab-01-Vip3Aa nucleotide sequence soybean plant strain, proceed to Cry1A.105The soybean plant strain of nucleotide sequence can be made with the soybean plant strain that proceeds to Cry1A.105-Cry2Ab nucleotide sequenceBecome the mortality of just incubating Spodoptera litura larvae, and fraction survival larvae development progress is caused greatly and pressed downSystem, after 3 days, larva, substantially still in just incubating state or between just incubate-negative control state, and proceeds toThe soybean plant strain of Cry1Ab-01 nucleotide sequence, proceed to Cry1Ab-02 nucleotide sequence soybean plant strain, turnEnter Cry1Ab/Ac nucleotide sequence soybean plant strain, proceed to the large of Cry1Ab-01-Vip3Aa nucleotide sequenceBeans plant, proceed to the soybean plant strain of Cry1A.105 nucleotide sequence and proceed to Cry1A.105-Cry2Ab nucleosidesThe soybean plant strain of acid sequence is only subject to slight damage substantially, is only the damage of minute quantity Pinhole-shaped on blade, itsBlade injury rate is all in 15% left and right or following.

Thus prove proceed to Cry1Ab-01 nucleotide sequence soybean plant strain, proceed to Cry1Ab-02 nucleotidesThe soybean plant strain of sequence, proceed to Cry1Ab/Ac nucleotide sequence soybean plant strain, proceed toThe soybean plant strain of Cry1Ab-01-Vip3Aa nucleotide sequence, proceed to the soybean of Cry1A.105 nucleotide sequencePlant and the soybean plant strain that proceeds to Cry1A.105-Cry2Ab nucleotide sequence all demonstrate high resistance prodenia lituraActivity, is controlled it thereby this activity is enough to that the growth of prodenia litura is produced to ill effect.

Above-mentioned experimental result also show to proceed to Cry1Ab-01 nucleotide sequence milpa, proceed toThe milpa of Cry1Ab-02 nucleotide sequence, proceed to Cry1Ab/Ac nucleotide sequence milpa,Proceed to Cry1Ab-01-Vip3Aa nucleotide sequence milpa, proceed to Cry1A.105 nucleotide sequenceMilpa, proceed to Cry1A.105-Cry2Ab nucleotide sequence milpa, proceed to Cry1Ab-01 coreThe soybean plant strain of nucleotide sequence, proceed to Cry1Ab-02 nucleotide sequence soybean plant strain, proceed to Cry1Ab/AcThe soybean plant strain of nucleotide sequence, proceed to Cry1Ab-01-Vip3Aa nucleotide sequence soybean plant strain, proceed toThe soybean plant strain of Cry1A.105 nucleotide sequence and the soybean that proceeds to Cry1A.105-Cry2Ab nucleotide sequencePlant is obviously because plant itself can produce Cry1A albumen to the control of prodenia litura, so, this areaKnown by the technical staff, the identical toxic action according to Cry1A albumen to prodenia litura, can produce similarlyThe transfer-gen plant that can express Cry1A albumen can be used in the harm of control prodenia litura. Cry1A in the present inventionAlbumen includes but not limited to the Cry1A albumen of given amino acid sequence in detailed description of the invention, turns base simultaneouslyBecause plant can also produce the second insect-killing protein that at least one is different from Cry1A albumen, as Vip3AAlbumen or Cry2Ab albumen etc.

In sum, the method for Control pests of the present invention is by producing and can kill prodenia litura in plantCry1A albumen is controlled prodenia litura insect; Cultural control method, chemical prevention with prior art useMethod is compared with physical control method, and the present invention carries out the protection of the time of infertility, whole plant with control to plantThe infringement of prodenia litura insect, and pollution-free, noresidue, effect stability, thorough, simple, convenient, warpJi.

It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described,Although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art should manageSeparate, can modify or be equal to replacement technical scheme of the present invention, and not depart from the technology of the present invention sideThe spirit and scope of case.

Claims (40)

1. a method of controlling prodenia litura insect, is characterized in that, comprise by prodenia litura insect withThe contact of Cry1A albumen, described Cry1A albumen is Cry1Ab/Ac albumen or Cry1A.105 albumen, described inThe amino acid sequence of Cry1A albumen has the amino acid order shown in SEQIDNO:3 or SEQIDNO:28Row.

2. the method for control prodenia litura insect according to claim 1, is characterized in that, described inCry1Ab/Ac albumen is present in the plant cell that produces described Cry1Ab/Ac albumen, described prodenia lituraInsect contacts with described Cry1Ab/Ac albumen by the described plant cell of ingesting.

3. the method for control prodenia litura insect according to claim 2, is characterized in that, described inCry1Ab/Ac albumen is present in the genetically modified plants that produce described Cry1Ab/Ac albumen, described twill nightMoth insect contacts with described Cry1Ab/Ac albumen by the tissue of the described genetically modified plants that ingest, institute after contactState the growth of prodenia litura insect and be suppressed and/or cause death, to realize the control to prodenia litura harm plantSystem.

4. the method for control according to claim 3 prodenia litura insect, is characterized in that, described in turnGene plant is in any breeding time.

5. the method for control according to claim 3 prodenia litura insect, is characterized in that, described in turnGene plant be organized as blade, stem stalk, fruit, tassel, female fringe, flower pesticide or filigree.

6. the method for control prodenia litura insect according to claim 3, is characterized in that, described rightThe control of prodenia litura harm plant is not because the change in plantation place changes.

7. the method for control prodenia litura insect according to claim 3, is characterized in that, described rightThe control of prodenia litura harm plant is not because the change of implantation time changes.

8. the method for control prodenia litura insect according to claim 1, is characterized in that, described inCry1A.105 albumen is present in the plant cell that produces described Cry1A.105 albumen, described prodenia litura evilWorm contacts with described Cry1A.105 albumen by the described plant cell of ingesting.

9. the method for control prodenia litura insect according to claim 8, is characterized in that, described inCry1A.105 albumen is present in the genetically modified plants that produce described Cry1A.105 albumen, described prodenia lituraInsect contacts with described Cry1A.105 albumen by the tissue of the described genetically modified plants that ingest, described in contact is rearThe growth of prodenia litura insect is suppressed and/or causes death, to realize the control to prodenia litura harm plant.

10. the method for control prodenia litura insect according to claim 9, is characterized in that, described inGenetically modified plants are in any breeding time.

The method of 11. control prodenia litura insects according to claim 9, is characterized in that, described inGenetically modified plants be organized as blade, stem stalk, fruit, tassel, female fringe, flower pesticide or filigree.

The method of 12. control prodenia litura insects according to claim 9, is characterized in that, described inThe control that prodenia litura is endangered to plant is not because the change in plantation place changes.

The method of 13. control prodenia litura insects according to claim 9, is characterized in that, described inThe control that prodenia litura is endangered to plant is not because the change of implantation time changes.

14. according to the method for the control prodenia litura insect described in claim 2 to 13 any one, its featureBe, described plant from corn, soybean, cotton, sweet potato, taro, lotus, sesbania, tobacco, beet,Chinese cabbage or eggplant.

The method of 15. control prodenia litura insects according to claim 14, is characterized in that, described inStep before contact procedure is to plant the plant of the polynucleotides that contain the described Cry1A albumen of encoding.

The method of 16. control prodenia litura insects according to claim 15, is characterized in that, described inThe nucleotide sequence of Cry1A albumen has the nucleotides sequence shown in SEQIDNO:6 or SEQIDNO:29Row.

The method of 17. control prodenia litura insects according to claim 16, is characterized in that, described inPlant also produces at least one the second nucleotides that is different from described Cry1A albumen.

The method of 18. control prodenia litura insects according to claim 17, is characterized in that, described inThe second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, aggegationElement, AMS or peroxidase.

The method of 19. control prodenia litura insects according to claim 18, is characterized in that, described inThe second nucleotide coding Vip3A albumen or Cry2Ab albumen.

The method of 20. control prodenia litura insects according to claim 19, is characterized in that, described inThe second nucleotides comprises the nucleotide sequence shown in SEQIDNO:7 or SEQIDNO:8.

The method of 21. control prodenia litura insects according to claim 17, is characterized in that, described inThe second nucleotides is the dsRNA that suppresses important gene in targeted insect insect.

The method of 22. control prodenia litura insects according to claim 15, is characterized in that, described inPlant also produces at least one the second nucleotides that is different from described Cry1A albumen.

The method of 23. control prodenia litura insects according to claim 22, is characterized in that, described inThe second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, aggegationElement, AMS or peroxidase.

The method of 24. control prodenia litura insects according to claim 23, is characterized in that, described inThe second nucleotide coding Vip3A albumen or Cry2Ab albumen.

The method of 25. control prodenia litura insects according to claim 24, is characterized in that, described inThe second nucleotides comprises the nucleotide sequence shown in SEQIDNO:7 or SEQIDNO:8.

The method of 26. control prodenia litura insects according to claim 22, is characterized in that, described inThe second nucleotides is the dsRNA that suppresses important gene in targeted insect insect.

The method of 27. control prodenia litura insects according to claim 14, is characterized in that, described inPlant also produces at least one the second nucleotides that is different from described Cry1A albumen.

The method of 28. control prodenia litura insects according to claim 27, is characterized in that, described inThe second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, aggegationElement, AMS or peroxidase.

The method of 29. control prodenia litura insects according to claim 28, is characterized in that, described inThe second nucleotide coding Vip3A albumen or Cry2Ab albumen.

The method of 30. control prodenia litura insects according to claim 29, is characterized in that, described inThe second nucleotides comprises the nucleotide sequence shown in SEQIDNO:7 or SEQIDNO:8.

The method of 31. control prodenia litura insects according to claim 27, is characterized in that, described inThe second nucleotides is the dsRNA that suppresses important gene in targeted insect insect.

The method of 32. control prodenia litura insects according to claim 14, is characterized in that, described inThe nucleotide sequence of Cry1A albumen has the nucleotides sequence shown in SEQIDNO:6 or SEQIDNO:29Row.

33. according to the method for the control prodenia litura insect described in claim 2 to 13 any one, its featureBe, described plant also produces at least one the second nucleotides that is different from described Cry1A albumen.

The method of 34. control prodenia litura insects according to claim 33, is characterized in that, described inThe second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, aggegationElement, AMS or peroxidase.

The method of 35. control prodenia litura insects according to claim 34, is characterized in that, described inThe second nucleotide coding Vip3A albumen or Cry2Ab albumen.

The method of 36. control prodenia litura insects according to claim 35, is characterized in that, described inThe second nucleotides comprises the nucleotide sequence shown in SEQIDNO:7 or SEQIDNO:8.

The method of 37. control prodenia litura insects according to claim 33, is characterized in that, described inThe second nucleotides is the dsRNA that suppresses important gene in targeted insect insect.

38. according to the method for the control prodenia litura insect described in claim 1 to 13 any one, its featureBe, the nucleotide sequence of described Cry1A albumen has shown in SEQIDNO:6 or SEQIDNO:29Nucleotide sequence.

39. according to the method for the control prodenia litura insect described in claim 1 to 13 any one, its featureBe, the step before described contact procedure is the plantation polynucleotides that contain the described Cry1A albumen of encodingPlant.

The purposes of 40. 1 kinds of Cry1A protein control prodenia litura insects, is characterized in that described Cry1AAlbumen is Cry1Ab/Ac albumen or Cry1A.105 albumen, and the amino acid sequence of described Cry1A albumen hasAmino acid sequence shown in SEQIDNO:3 or SEQIDNO:28.