CN108611312B - New antimycin biosynthesis pathway ketoreductase gene deletion strain, construction method and application - Google Patents

Abstract

The invention relates to the technical field of medical bioengineering, in particular to a ketoreductase gene deletion strain in a new antimycin biosynthesis pathway, a method for constructing the strain and application in preparing antitumor drugs. According to the invention, the strain is obtained by knocking out the natE gene in the new antimycin biosynthesis gene cluster. The strain can directionally accumulate two new components of NAT-H and NAT-I without generating new antimycin NAT-A and NAT-F components any more, the yield of the new components is equivalent to that of the original components, the strain has obvious inhibitory activity on eight tumor cells, and the inhibitory activity on most cell lines is superior to that of a control drug Cisplatin.

Description

New antimycin biosynthesis pathway ketoreductase gene deletion strain, construction method and application

Technical Field

The invention relates to the technical field of medical bioengineering, in particular to a ketoreductase gene deletion strain of a new antimycin biosynthesis pathway, a new antimycin derivative with a new structure generated by the strain, and a preparation method and application thereof.

Background

Neoantimycin (NAT) is a novel natural product of antineoplastic and antifungal depsipeptides, having a pentadecane-ring quadruple lactone as the molecular skeleton, and having a 3-N-formylaminosalicylic acid acyl (FSA), two alkyl groups and a benzyl side chain. The twelve new antimycin analogs are discovered from streptomyces fermentation products, and the structural differences mainly lie in the hydroxylation or ketonization modification at the C1 position of a parent molecule, the size of an alkyl side chain, and whether the salicylic acid acyl has nitrogen substitution or N-formylation modification.

Among them, the Novel antimycin compounds SW-163A and SW-163B were initially found to have immunosuppressive and antifungal activities (Takahashi, K.et al, SW-163A and B, Novel immunological derivatives produced by Streptomyces sp., J Antibiot (Tokyo) 2001,54, 867. sup. 873), and their structural analogs prunetin A, JBIR-04and JBIR-05 were subsequently found to have negative regulatory effects on the expression of the tumor cell target protein GRP78 (glucose regulatory protein) (Umeda, Y.et al, Absolute structure of study A, alpha Novel GRP78molecular chain down-regulator, Org Lett.2007,9, 4239. sup. 4242; Izukamii, M.640. WA. sup. GRP78molecular chain down-regulator, JBIR-05. sup. J.2007, New antimycin D-A, NAT, New antimycin A, J.12, J.83-D.E.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K.K. K., NAT-G and NAT-H have significant inhibitory effects on both the membrane localization of KRAS, a key target of canceration, and the multi-resistance of SW620 colon cancer cell line (Salim, A.A.et al, Rare Streptomyces N-formmyl amino-salicylic amides inhibitory oncogene K-Ras, Org Lett.2014,16, 5036-5039).

The biosynthesis of neomycin is carried out by a non-ribosomal polypeptide synthase (NRPS) and a polyketide synthase (PKS) large multifunctional protein through an assembly line model. We found a new antimycin biosynthetic gene cluster from soil-derived streptomyces s. The NRPS-PKS responsible for the synthesis of the novel antimycin lactone ring molecular backbone comprises five carbon chain extension steps, loading sequentially the FSA starter unit, threonine, 3-methyl-2-ketobutyric acid, 2-ketophenylpropionic acid, 2-methylmalonic acid, 3-methyl-2-ketovaleric acid (Li, X.et al, Chemical variation from the neo anti peptide depsipeptide assembly line, Bioorg Med Chem Lett.2013,23, 5123-. The biosynthetic pathway is deduced as shown in FIG. 1, taking the mutexamples of the novel antimycins NAT-A and NAT-F produced by Streptomyces synglobatus. Wherein, the ketoreductase gene natE (SEQ ID NO.6) of the new antimycin biosynthetic pathway is responsible for reducing a C1 ketonic group into hydroxyl, thereby leading NAT-H and NAT-I to be respectively converted into NAT-A and NAT-F. Although NAT-H has been reported in the literature, the structure of NAT-I is presumed and cannot be obtained in the prior art, and the structural characterization and whether the NAT-I has antitumor activity or other drug effects are unknown. And after knocking out the ketoreductase gene natE of the new antimycin biosynthetic pathway, whether the streptomyces S.globatus directly obtains NAT-H and NAT-I without producing NAT-A and NAT-F is not reported in documents.

Disclosure of Invention

The inventors speculated from the biosynthetic pathway of neomycin that in the case where the neomycin producing strain lacks the ketoreductase gene natE, the last reduction step of the biosynthetic pathway would not be completed, and thus would not produce a neomycin component containing the hydroxyl group at C1, and would only accumulate a neomycin derivative containing the keto group at C1. Accordingly, the gene deletion strain (mutant strain for short) is obtained by knocking out the natE gene in the new antimycin biosynthesis gene cluster, is named as RJ8, is preserved in China general microbiological culture Collection center (CGMCC) for short, is preserved for 3 and 28 months in 2018, and has the preservation number of CGMCC No: 15522. HPLC-MS detection of the fermentation product finds that the mutant RJ8 directionally accumulates two new components, new antimycin NAT-A and NAT-F components are not produced any more, and the yield of the new components is equivalent to that of the original components. Two new components are separated from the mutant RJ8 fermentation product and subjected to structural identification, and the new antimycin NAT-H and the new structural derivative NAT-I which are known compounds are respectively found. The new antimycin NAT-H and NAT-I produced by the mutant RJ8 have obvious inhibitory activity on eight tumor cells, and the inhibitory activity on most cell lines is better than that of a control drug Cisplatin.

The invention aims to provide a ketoreductase gene deletion strain of a neomycin biosynthesis pathway, which is named RJ8 and is preserved in CGMCC with the preservation date of 2018, 3 and 28 months and the preservation number of CGMCC No: 15522.

a second object of the present invention is to provide a method for constructing a mutant RJ8, comprising the steps of:

a) constructing a plasmid carrying a homologous recombination fragment for knocking out a ketoreductase gene natE of a new antimycin biosynthesis pathway;

b) b, transferring the plasmid constructed in the step a into transfer host bacteria carrying the combined transfer auxiliary plasmid;

c) c, mixed culture of the transfer host bacteria obtained in the step b and the target host bacteria streptomycete S.conglobatus, and screening out a new anti-mycin biosynthesis pathway natE gene deletion strain generated after homologous recombination.

In a preferred embodiment of the present invention, the method comprises the following steps:

streptomyces Soglobatus genome DNA is taken as a template, n7-L-F (SEQ ID NO.1) and n7-L-R (SEQ ID NO.2) are taken as primers to obtain a 1105bp homologous recombination left arm PCR fragment (SEQ ID NO.7) through PCR amplification, and n7-R-F (SEQ ID NO.3) and n7-R-R (SEQ ID NO.4) are taken as primers to obtain a 1089bp homologous recombination right arm PCR fragment (SEQ ID NO.8) through PCR amplification.

Plasmid pRJ2 with the functions of escherichia coli and streptomyces biparental conjugative transfer is used as a vector, and after being treated by restriction endonucleases XbaI and EcoRI, a 7758bp vector fragment is recovered by gel electrophoresis and is shown as SEQ ID NO. 5.

The two PCR fragments and the vector fragment were ligated by Gibson assembly, then transformed into e.coli DH10B or e.coli DH5a or e.coli JM109, and the target clone pRJ28 was obtained by screening.

Further, in step b, the transfer host bacterium is Escherichia coli E.coli ET12567 carrying the combined transfer helper plasmid pUZ8002 or other Escherichia coli lacking a DNA methylation modification system. Plasmid pRJ28 was extracted from E.coli DH10B or E.coli DH5a or E.coli JM109 and transformed into E.coli ET12567 containing plasmid pUZ8002 or other E.coli lacking a DNA methylation modification system.

Further, in step c, the mixed culture comprises the steps of:

(c1) c, selecting a single colony of escherichia coli E.coli ET12567 containing plasmids pRJ28 and pUZ8002 obtained in the step b, inoculating and culturing, and then collecting thalli for later use;

(c2) pre-culturing streptomyces S.conglobatus, and collecting germinated spores;

(c3) culturing Streptomyces synglobatus germinated spores and Escherichia coli E.coli ET12567 thallus containing plasmids pRJ28 and pUZ8002 in a mixed manner; and (3) selecting hygromycin-sensitive strains to perform PCR sequencing verification, and confirming the ketoreductase gene deletion strains in the new antimycin biosynthesis pathway.

Further, in step c1, LB medium (1% tryptone, 0.5% yeast extract and 1% NaCl) was used for the culture, and antibiotics were added to the final concentrations: 100 mu g/L of ampicillin, 25 mu g/L of chloramphenicol and 50 mu g/L of kanamycin.

Further, step c2 specifically includes: inoculating streptomyces S.conglobatus on an SFM solid plate culture medium (2% of soybean meal, 2% of D-mannitol and 2% of agar), culturing for 4-6 days at 27-32 ℃, collecting spores by using a cotton swab, suspending the spores in an antibiotic-free LB culture medium, thermally shocking for 8-12 min at 50 ℃, carrying out ice bath for 2-3 min, then carrying out shake cultivation at 37 ℃,220rpm for 2.5-3.5 h, then carrying out centrifugation at 12000rpm to collect pre-germinated spores, and then suspending the spores by using the antibiotic-free LB culture medium.

Further, step c3 specifically includes: mixing streptomyces S.conglobatus germinating spores and escherichia coli prepared in the step b in an LB culture medium, uniformly coating the mixture on an SFM flat plate, culturing at the temperature of 27-32 ℃ for 23h, and then covering the mixture with a covering liquid, wherein the covering liquid is an aqueous solution containing 18-22 mu g/L nalidixic acid and 45-55 mu g/L hygromycin; after the plate is dried and cultured at 27-32 ℃ for 4-6 days, a binding transfer factor can be seen, a single colony is selected to be subjected to recheck on an SFM plate, after the plate is cultured at 27-32 ℃ for 4-5 days, spores are selected to be subjected to relaxation culture on the SFM plate without antibiotics, and the plate is transferred to the SFM plate without antibiotics again after the plate is cultured at 27-32 ℃ for 4-6 days; then suspending the spores in sterile water, and preparing single colonies on an SFM (small form-factor pluggable) plate; and (3) selecting a single colony to carry out contrast SFM plate culture screening containing 45-55 mu g/L of hygromycin and no antibiotics, selecting hygromycin-sensitive strains to carry out PCR sequencing verification, and finally obtaining the mutant RJ8 with the deleted natE gene.

The third objective of the present invention is to provide a novel antimycin derivative produced by the mutant RJ8, which has the following structural formula:

the fourth object of the present invention is to provide a process for preparing the following two novel antimycin derivatives,

the novel antimycin derivative is obtained by fermenting the gene deletion strain.

The fifth purpose of the invention is to provide the application of the mutant RJ8 in preparing antitumor drugs.

The sixth purpose of the present invention is to provide the use of the above-mentioned novel antimycin derivative (NAT-I) having a novel structure in the preparation of antitumor drugs.

The anti-tumor drug can be used for preventing and/or treating one or more of melanoma, colon cancer, cervical cancer, liver cancer, ovarian cancer, gastric cancer, pancreatic cancer and glioma.

The invention has the advantages that:

according to the deduction of a biosynthesis pathway of the neomycin, a mutant RJ8 is obtained by knocking out a natE gene in a biosynthesis gene cluster of the neomycin through genes. HPLC-MS detection of the fermentation product finds that the mutant RJ8 directionally accumulates two new components, new antimycin NAT-A and NAT-F components are not produced any more, and the yield of the new components is equivalent to that of the original components. Two new components are separated from the mutant RJ8 fermentation product and are structurally identified, and known compounds NAT-H and new structural derivatives NAT-I are respectively found. The new antimycin NAT-H and NAT-I produced by the mutant RJ8 have obvious inhibitory activity on eight tumor cells, and the inhibitory activity on most cell lines is better than that of a control drug Cisplatin.

Preservation information of biological material sample:

the preservation unit: china general microbiological culture Collection center (CGMCC)

Address: microbial research institute of western road 1 institute No.3 of China academy of sciences, Beijing, Chaoyang

The preservation date is as follows: 3, 28 months in 2018

The preservation number is: CGMCC No: 15522

And (3) classification and naming: streptomyces conglobatus

Drawings

FIG. 1 is a schematic diagram of the principle process of construction of mutant RJ 8;

FIG. 2 is an HPLC-MS spectrum of the fermentation product of mutant RJ8 and wild strain WT.

FIG. 3 is a diagram of the biosynthetic machinery of neomycin resistant NAT-A.

Detailed Description

The following examples are provided to illustrate specific embodiments of the present invention.

EXAMPLE 1 construction of mutant RJ8

The principle and process of constructing the mutant RJ8 are shown in figure 1, and the mutant RJ8 with nat gene deletion is obtained after homologous recombination double exchange is carried out between a plasmid carrying a homologous recombination fragment and a target region of a chromosome of a host bacterium (WT).

The method is realized by the following steps:

a) construction of nat Gene knock-out plasmid

Using streptomyces S.conglobatus genome DNA as a template, and respectively obtaining a 1105bp homologous recombination left arm PCR fragment (SEQ ID NO.7) and a 1089bp homologous recombination right arm PCR fragment (SEQ ID NO.8) through PCR amplification, wherein the left arm fragment is overlapped with an XbaI shearing end of pRJ2 for 25 bases (ATCCCCGGGGACCTGCAGGTCGACT); the right arm fragment overlaps 26 bases with the EcoRI cleavage end of pRJ2 (TATCACGAGGCCCTTTCGTCTTCAAG). Wherein the primers of the left-arm PCR fragment are n7-L-F (SEQ ID NO.1) and n7-L-R (SEQ ID NO.2), and the primers of the right-arm PCR fragment are n7-R-F (SEQ ID NO.3) and n7-R-R (SEQ ID NO. 4).

The vector was plasmid pRJ2 treated with restriction enzymes XbaI and EcoRI, and a 7758bp vector fragment was recovered by gel electrophoresis.

The two PCR fragments and the vector fragment were ligated by the method of Gibson assembly (Gibson, D.G.et al, Enzymatic assembly up to recombinant cloned plasmids. Nat. methods.2009,6, 343-345), and then transferred into E.coli DH10B to obtain the desired cloning plasmid pRJ28, which was confirmed by sequencing.

b) Transfer of knockout plasmid pRJ28 into Escherichia coli (Trans-host bacterium)

The plasmid pRJ28 constructed in step a was transferred into E.coli ET12567 carrying the transfer helper plasmid pUZ8002 (Mazodier, P.et al, International conjugation between Escherichia coli and Streptomyces species, J bacteriol 1989,171,3583-3585) to give pRJ28+ pUZ8002/E.coli ET 12567.

c) And c, performing mixed culture on the strain obtained in the step b and a target host strain streptomycete S.conglobatus, and screening out a mutant strain RJ8 generated by homologous recombination. The method comprises the following specific steps:

(c1) picking a single colony of the strain obtained in the step b to inoculate LB culture medium (1% tryptone, 0.5% yeast extract and 1% NaCl) containing antibiotics with the final concentration: 100 mu g/L of ampicillin, 25 mu g/L of chloramphenicol and 50 mu g/L of kanamycin. The culture conditions are 37 ℃, the rotating speed of a shaking table is 220rpm for 4 hours, 3mL of bacterial liquid is taken to be centrifuged at 6000rpm for 30S until the measured value of the bacterial liquid concentration OD600 is about 1.0, then supernatant is removed, 1mL of LB culture medium is used for re-suspending the bacterial liquid, then the bacterial liquid is centrifuged again to collect the bacterial liquid, and the steps are repeated for 3 times for standby.

(c2) Streptomyces synglobatus is inoculated on an SFM solid plate culture medium (2% soybean meal, 2% D-mannitol and 2% agar), spores are collected by a cotton swab after 5 days of culture at 30 ℃, the spores are suspended in 5mL of LB culture medium, heat shock is carried out at 50 ℃ for 10min, ice bath is carried out for 2min, then shaking culture is carried out at 37 ℃ and 220rpm for 3h, pre-germination spores are collected by centrifugation at 12000rpm for 1min, then the spores are re-suspended by 1mL of LB culture medium, and the spores are collected by centrifugation.

(c3) The Streptomyces synglobatus germinated spores collected in step c2 and the Escherichia coli pRJ28+ pUZ8002/E. coli ET12567 collected in step c1 were mixed in 150. mu.L of LB medium and spread evenly on SFM plates. After incubation at 30 ℃ for 23h, the cells were covered with a 1mL aqueous solution containing 20. mu.g/L nalidixic acid and 50. mu.g/L hygromycin. After the plate is dried and cultured for 5 days at 30 ℃, the binding transfersomes can be seen, single colonies are picked to carry out the retest on an SFM plate (the final concentration of the antibiotics is 20 mu g/L of nalidixic acid and 50 mu g/L of hygromycin), spores are taken to carry out the loose culture on the SFM plate without the antibiotics after the culture is carried out for 4 days at 30 ℃, and the spores are transferred to the SFM plate without the antibiotics after the culture is carried out for 5 days at 30 ℃. Spores were then suspended in sterile water and single colonies were prepared on SFM plates. Selecting single colony to do contrast SFM plate culture screening containing hygromycin 50 mug/L and no antibiotics, and finally selecting hygromycin sensitive strain to do PCR verification.

The PCR verification primer is: nat7D-T-F (SEQ ID NO.9) and 1NL-R (SEQ ID NO.10), as well as comparison with wild-type strains. The sequencing result of the PCR product shows that the size of the PCR fragment of the wild strain is 488bp (SEQ ID NO.11), the size of the PCR fragment of the selected hygromycin-sensitive strain is 437bp (SEQ ID NO.12), and the obtained 51bp (SEQ ID NO.13) deletion mutation of the natE gene is the target mutant RJ 8.

Example 2

Coli DH5a or E.coli JM109 was selected as host bacteria, and plasmid pRJ28 containing a homologous recombination fragment was constructed (see example 1a for the construction process). Coli E.coli JTU007(A Non-Cloning and Non-methylation Escherichia coli Strain for DNA Cloning and High-Throughput Conjugation to microorganisms coelicolor, Curr Microbiol (2012)64, 185-190) without DNA methylation modification system was selected and plasmid pRJ28 was transformed into E.coli JTU007 containing plasmid pUZ8002 to obtain pRJ28+ pUZ8002/E.coli JTU 007. pRJ28+ pUZ8002/E.coli JTU007 was transformed into S.synglobatus and mutant RJ8 was selected (see example 1c for the selection procedure).

Example 3

By designing the positions of homologous recombination fragments in the gene nat, deletion mutation of different regions in the gene nat can be realized. For example, deletion of the 1074bp (SEQ ID NO.14) region within the nat of the mutated gene can be achieved by adjusting the position of the right arm of homologous recombination within the nat, while leaving the left arm of homologous recombination as described in "example 1 a" unchanged. The homologous recombination right arm is a PCR product of 1206bp (SEQ ID NO.15), and PCR primers are R-F (SEQ ID NO.16) and R-R (SEQ ID NO. 17). The remaining procedure was the same as in "example 1".

The sequences involved in the three examples above are shown in table 1:

TABLE 1DNA sequence Listing

Example 4 analysis and extraction of fermentation product of mutant RJ8

Analysis of fermentation product of mutant RJ8

Mutant RJ8 cells were picked from SFM plates after 4 days of culture and inoculated with 10mL of TSBY seed medium (3% Large Medium)Bean flour, 5% glucose, 0.5% CaCO₃，5mg/L CoCl₂·6H₂O, 0.2% (v/v) anti-foam), 50mL of a spring-loaded Erlenmeyer flask, shake-flask at 220rpm for 3 days at 30 ℃. The seed solution was inoculated with 1/10(v/v) into 50mL of SGCC secondary seed medium (3% soybean meal, 5% glucose, 0.5% CaCO)₃，5mg/L CoCl₂·6H₂O, 0.2% (v/v) anti-foam), 250mL of a spring-loaded Erlenmeyer flask, shake-flask at 220rpm for 5 days at 30 ℃. Adding equal volume of ethyl acetate into 20mL of fermentation liquor, performing ultrasonic extraction at 40 ℃ for 30min, taking the organic phase, performing reduced pressure evaporation to dryness, adding 1mL of methanol for dissolution, centrifuging to remove precipitates, and taking 20 mu L of sample for HPLC-MS detection. As shown in FIG. 2, HPLC-MS mut mutexamination of the fermentation product revealed that mutant RJ8 directionally accumulated two new fractions, no longer produced new antimycin NAT-A and NAT-F fractions, which were comparable to the yield of fermented neomycin NAT-A and NAT-F of wild-type strain WT.

(II) fermentation of mutant RJ8 and extraction of new antimycin product.

(1) Mutant RJ8 fermentation

Mutant RJ8 cells were picked from SFM plates after 4 days of culture and inoculated into 50mL of TSBY seed medium (3% soybean powder, 5% glucose, 0.5% CaCO)₃，5mg/L CoCl₂·6H₂O, 0.2% (v/v) anti-foam), 250mL of a spring-loaded Erlenmeyer flask, shaking at 220rpm at 30 ℃ for 3 days. The seed solution was inoculated with 1/10(v/v) into 100mL of SGCC secondary seed medium (3% soybean meal, 5% glucose, 0.5% CaCO)₃，5mg/L CoCl₂·6H₂O, 0.2% (v/v) anti-foam), 500mL spring-loaded Erlenmeyer flask, 30 ℃,220rpm shake flask culture for 3 days. Inoculating the secondary seed solution to 1/10(v/v) in 100mL SGC fermentation medium (3% soybean powder, 5% glucose, 0.5% CaCO)₃，5mg/L CoCl₂·6H₂O, 0.2% (v/v), 500mL of a spring-loaded Erlenmeyer flask, 30 ℃, and after shaking culture at 220rpm for 6 days, 10L of fermentation broth is obtained in total.

(2) Extraction and separation of neomycin

Adding 0.1% (v/v) formic acid into the fermentation liquor, extracting the fermentation liquor three times by using ethyl acetate with the same volume, and concentrating the ethyl acetate extract at 40 ℃ under reduced pressure to obtain 8.1g of extract. The extract was redissolved in 300ml of methanol, filtered through filter paper to remove the residue, and the oil was removed twice through a separatory funnel using 100ml of n-hexane. After the methanol solution was concentrated, the mixture was loaded on a forward silica gel column (Sillica gel, 200-mesh, 300-mesh) by sample-mixing, the column was passed under reduced pressure, the eluting solvent was methylene chloride-methanol, and the gradient of the eluting solvent ratio was 50/1 to 0/1(v/v), to obtain 6 fractions B1-B6, and when neomycin NAT-H and NAT-I were detected by HPLC-MS, fraction B1(2.5g dry weight) was found to contain the target molecule. The objective fraction was further loaded on the ODS column, and the gradient of elution solvent was 30% to 100% acetonitrile, to obtain 14 fractions (B1A-B1N). The target fraction B1J (dry weight: 1.2g) was again applied to the silica gel column, and petroleum ether-ethyl acetate-methanol (8/1/0 to 0/0/1, v/v/v) was used as an eluent to obtain 10 fractions B1J1-B1J10 in total, and the target fraction B1J7(1.0g dry weight) was subjected to preparative HPLC, reverse ODS column (YMC-Park C18, 20X 250mm,5 μm) for final separation. The separation conditions were: 8mL/min, 85% acetonitrile (containing 0.1% formic acid). 400mg of neoantimycin NAT-H (pale yellow amorphous) and three other fractions B1J7P1-B1J7P3 were finally obtained. The fraction B1J7P3 was separated using a semipreparative column (Waters Xbridge C18, 10X 250mm) with a flow rate of 3mL/min for the liquid phase and 70% acetonitrile in the mobile phase (containing 0.1% formic acid) to give 62mg of neoantimycin NAT-I (pale yellow amorphous).

Structural analysis of Compound

Weighing 5-10mg of neomycin-resistant NAT-H or NAT-I pure product, and adding 0.5mL of DMSO-d₆Dissolving, and collecting nuclear magnetic data by an Aglient DD 2600 MHz NMR spectrometer. Warp beam¹H-and¹³the structure of the compound was determined by analysis of C-NMR data and the molecular formula was determined by analysis using high resolution mass spectrometry (HR-ESI-MS).

By passing¹H and¹³comparative analysis of C NMR (Table 2) confirmed that the chemical structure of NAT-H is the same as reported in the literature, and that the structural differences between NAT-I and NAT-H are only one more methyl group at C-32 position in the latter (FIG. 3). Comparing NAT-I and NAT-H¹³C NMR data show that NAT-I does not contain the C-32 methylene signal delta possessed by NAT-H_C24.0. Furthermore, NAT-I does not have the H-35 (delta) that NAT-H has_H0.83) and C-35 (. delta.))_C10.4) displacement signal (tables 2, 3). High resolution mass spectrum detection of [ M + H ] of NAT-I and NAT-H]⁺Charge to mass ratio683.2829 (calculated 683.2816, error 1.90) and 697.2987 (calculated 697.2972, error 2.15), respectively, the molecular weight of NAT-I is one methylene less than that of NAT-H.

TABLE 2 of the Compound NAT-H¹H and¹³C NMR

^a Salim,A.A.et al.,Rare Streptomyces N-formyl amino-salicylamides inhibit oncogenic K-Ras.Org Lett.2014,16,5036-5039

^brepresenting overlapping values

^cNot shown in the literature indicating characteristic peaks, measured in the present invention

TABLE 3 of Compound NAT-I¹H and¹³C NMR

(3) detection of anti-tumor cell activity of mutant RJ8 fermentation product

Tumor cell viability was measured by the CCK8assay (Dojindo, Tokyo, Japan) kit. The cell culture process is as follows: the seed cells were cultured in a 96-well plate, penicillin at a concentration of 100U/mL and streptomycin at a concentration of 100. mu.g/mL were added to the medium, and the seeded cells were seeded at a cell concentration of 3X 10 per well³Single cell, 37 ℃, 5% CO₂Culturing for 24 hr, adding test compound (including new antimycin NAT-H and NAT-I produced by fermentation of mutant RJ8, and control drug Cisplatin) at concentration of 0.3-10000nM, and culturing for 72 hrAdd 10. mu.L of WST-CCK8 reagent to wells, incubate at 37 ℃ for 0.5-4h, and finally measure cell viability by a microplate reader (spectra MAX190, Molecular Devices, USA) at 450nm wavelength. The test results are shown in Table 4.

TABLE 4 inhibition of tumor cell IC₅₀Numerical values (nM)

As shown in Table 4, the new antimycin NAT-H and NAT-I produced by mutant RJ8 have significant inhibitory activity on eight tumor cells, and the inhibitory activity on most cell lines is better than that of the control drug Cisplatin.

While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full range of equivalents.

SEQUENCE LISTING

<110> Shanghai university of traffic medical college affiliated renji hospital

<120> a new strain with ketoreductase gene deletion in the biosynthesis pathway of antimycin, its construction method and application

<130> claims, specification

<160> 17

<170> PatentIn version 3.5

<210> 1

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atccccgggg acctgcaggt cgacttcgtc gggcatttca gcga 44

<210> 2

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttgaaggtgg tgacggtgtg cccgaggatc agcagcctca tgccgcct 48

<210> 3

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aggcggcatg aggctgctga tcctcgggca caccgtcacc accttcaac 49

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atcacgaggc cctttcgtct tcaagtcatg acactcggct tcctccggga 50

<210> 5

<211> 7758

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aattcttgaa gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata 60

ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt 120

tgtttatttt tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa 180

atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt 240

attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa 300

gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac 360

agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt 420

aaagttctgc tatgtggcgc ggtattatcc cgtgttgacg ccgggcaaga gcaactcggt 480

cgccgcatac actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat 540

cttacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac 600

actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg 660

cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc 720

ataccaaacg acgagcgtga caccacgatg cctgcagcaa tggcaacaac gttgcgcaaa 780

ctattaactg gcgaactact tactctagct tcccggcaac aattaataga ctggatggag 840

gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct 900

gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat 960

ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa 1020

cgaaatagac agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac 1080

caagtttact catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc 1140

taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc 1200

cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg 1260

cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg 1320

gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca 1380

aatactgtcc ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg 1440

cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg 1500

tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga 1560

acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac 1620

ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat 1680

ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc 1740

tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga 1800

tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc 1860

ctggcctttt gctggccttt tgctggcctt ttgctcacat gttctttcct gcgttatccc 1920

ctgattctgt ggataaccgt attaccgcct ttgagtgagc tgataccgct cgccgcagcc 1980

gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga agagcgctga cttccgcgtt 2040

tccagacttt acgaaacacg gaaaccgaag accattcatg ttgttgctca ggtcgcagac 2100

gttttgcagc agcagtcgct tcacgttcgc tcgcgtatcg gtgattcatt ctgctaacca 2160

gtaaggcaac cccgccagcc tagccgggtc ctcaacgaca ggagcacgat catgcgcacc 2220

cgtcagatcc agacatgata agatacattg atgagtttgg acaaaccaca actagaatgc 2280

agtgaaaaaa atgctttatt tgtgaaattt gtgatgctat tgctttattt gtaaccatta 2340

taagctgcaa taaacaagtt cccgcacgat cagcgtcccg ccgaccagga gcagtgcggc 2400

cagcactgcc gctaacgcct ggtcctggtc ccggtcctgg tggtgcatca gtcctccccg 2460

tgatcacttc ggcacccacc gtagtgatca cccccgacag cggatcaagg ggtttgcggg 2520

tcccggtcgg cgccgggcgg gggaggcagg agccgccgac gctgcctctg ggacgggccg 2580

gacggcaggg ggaccggcgg ccgggcgagc tgcagccggg ggtccggcag ggccggagcg 2640

ggcggaaccg tgctctgacc tgcggcccga gtttcgtcac gtgacggaat ggaaggctgc 2700

tgcatttcgt cacgtgacgt atctcggcga gcgactgccg acgccacggc ggacacgatc 2760

gcctcgcgct ggcgccgggc ctcgtacgcc cgctggcggc aggagcggcg gcagtagtcc 2820

cggctccggc cgacgccgga ttgcttgatc tccgagccgc accaggcgca gagcttcgcg 2880

ccgtcggcgt ccctgggggt ggtggtgctc atggccgacg accgtacgcg gcacgtctcg 2940

tagcgaggcg agtcgggcgc gaggtaccgc ctgcacgaag tgccggcggg gccgaccccg 3000

ggcgagtaat cccaggatta ctcccgcggc ttcgaccccg gccgccgtcg ccgcgtacgt 3060

caccgacccc cgccgtacgt caccgggatg acgtacggcg ggggggagcg agttagtgcg 3120

aagtgggccc acttgcgagc cgggcgatgt gccgggcggc ccgctcctgg cggtcgtcgg 3180

cgtcgtcgtc ctggtcgtcg tcctgctctc gccgtcggcg tgcagttgct tcctcgcggc 3240

gctgggcgag ggcggcgagc atgtcggcgt acgcctcggc cacctccccc gccgtgagca 3300

ccaccactgt gtcggccgcg tcggccagcg ccaggacctc ccgcacccgt tcgcccacgg 3360

ccgccgaatc ctcgttgccg tccttgcctt cggcggcccg ggtcgcctcg aggtcgaggg 3420

cgcggcgggt gaccgcgtgc catccgtcct cggtcacggc gaccccggcc cgcagctccc 3480

cgccgtcggc gtcggccgcc aggagcagat cgaggtcgtc ggcctcggtg tcgccgccgt 3540

cgagcccgag catctgccgc aggtagcggg tccattcgat ggcccggcgt ccccgggttg 3600

cccgctcgta ctcgtgccag cgcgagaggt tccactccag cgagccgacc ccggcggcgt 3660

cgtcctcggt catgccgccg gtcaggtccc cgatccgtcc gaggagttcg aacggggcga 3720

cgttcccgcc ggtcgccgtc ttgaggtcgg cgcgggcgag ttcgagggcg ggcgccttcc 3780

cgtcctgggt cttggcgatg tactcggcga ggtcgttggc gtcgcgctcg gtctccagcc 3840

gcttgaagtc gacgccgtgc cggtcgtcgg gcgtgaaggc ggggttgacc ttgcgcaggg 3900

cggcggtcca cacggaccgc cagtgcccct gccactcgtc gagcgcggcg ccggtcggct 3960

cgaaggtggc gacgatctgc ttcgcggacc gctccccctc ggtccggccg ccgaccagga 4020

cgatcgcgtg gatgtgcggg tgccagccgt tgatctgccc cacggtgact tcggtcgcgc 4080

ggatcatgcc gacgtacccg atccggtctc ggatgccctc gcggtcggcg gcccggtgcc 4140

cgtccttggc ccggcgtccg gcccacgtgc cgcccgtgat cagtcgctgg taggcgcccg 4200

gccgccgggg gctgtccggc gtcttccggg tgccctggag ggcgtccatg aggtccgcga 4260

gccggtccgt gtgcccatgg cgggccgtga aggtgaccag gtaggcggtc cccccgcgct 4320

tgatccactc gaccacggcg gcggtgatct cctcggcccg cttgtgccgg atcgtggcgg 4380

cgcagaccgg gcagagccag atccgcccgc accgcatcag gcccaggacc acggacgttc 4440

cggccgccgt ctgggcgacg atcacgccgg aggcagggtc catcagggcg cggccgcagc 4500

ccttgcacgc ggcgtccccg ctgatccgcc acagcgtccg gcggcggctg taccgggcgg 4560

ctttccgcag tcgggcagcg tcgctccgcg acgtgcttcc tacttccgag aggctgtcgc 4620

ctctcgggct ctccccatcc accccgtccg gagaaaccgc aggtcggagg ggtgcgggaa 4680

actctgttgt ttctttccca aggtgttcgc ttttgcctcg ggcggcatct cgcgtcacac 4740

gcgcgatcgc ccgcttcgct gccatccggc agcggtctga gcagtagata cgcggccgtt 4800

tgcccggtgt gtgggcaatt gcggtcccgc agtggcagcg gggcccggcg ggccgatctg 4860

gcaatgcctc ggcatcgctc cgtactctgg gcacgagcaa cgttcctgtc tcgcccggct 4920

aaggggcgcg agtctgggag cggacgggtc ggaggtgcga agtccggccc gttgctcttt 4980

ggtctggtgg gaatcctggc accaatcggg ccagaggttc cctccgccac tcccgacgcc 5040

ccttggggct ggtgtgactt ggagggccga agagagcccc gccggtgatc cggcggggct 5100

ttgacgtgcg gtcagtgcgt gtgtcggcga gcgatggcca cgaggccctg gaagccgagc 5160

ggtccggcga agtcggccca gtcgcaaccg ggctcagcgc agtgggcgga ccagccaccg 5220

ccgttgtggg tcctggacca ggttcacggt cccctcggtc aggcgtccgt cgaagtcggt 5280

catggtcggt ctcctggtgg gtgggggcgg ggcgccagca cgaagtgccg gcgccccgcg 5340

ggggttggtc gggtcaggcg ccgaaccggc gggcggcggc ggcgaccagg ccgtcggcgg 5400

cggccatggc gcggtcgcgg tcggtggtga gggcggtgcg gtcggcggcg gcccagtcct 5460

gctctcacgc aacgtctacg tggacgctca gggcgacacg atcgaggtcg gggagtccgt 5520

cgctccggcg ggccgctggc gcgtccaccg ggactgatca aggcgaatac ttcatatggc 5580

gtacaccgtc gcctcggtcg gcccgtagag attggcgatc ccgaccgcag caccaccgag 5640

aacgtccccg acgtggccga ccagcccgtc atcgtcaacg cctgatccgc ggtgcggaca 5700

ggccgtgtcg cgaccggccg tgcggaatta agccggcccg taccctgtga atagaggtcc 5760

gctgtgacac aagaatccct gttacttctc gaccgtattg attcggatga ttcctacgcg 5820

agcctgcgga acgaccagga gttctgggag ccgctggccc gccgagccct ggaggagctc 5880

gggctgccgg tgccgccggt gctgcgggtg cccggcgaga gcaccaaccc cgtactggtc 5940

ggcgagcccg gcccggtgat caagctgttc ggcgagcact ggtgcggtcc ggagagcctc 6000

gcgtcggagt cggaggcgta cgcggtcctg gcggacgccc cggtgccggt gccccgcctc 6060

ctcggccgcg gcgagctgcg gcccggcacc ggagcctggc cgtggcccta cctggtgatg 6120

agccggatga ccggcaccac ctggcggtcc gcgatggacg gcacgaccga ccggaacgcg 6180

ctgctcgccc tggcccgcga actcggccgg gtgctcggcc ggctgcacag ggtgccgctg 6240

accgggaaca ccgtgctcac cccccattcc gaggtcttcc cggaactgct gcgggaacgc 6300

cgcgcggcga ccgtcgagga ccaccgcggg tggggctacc tctcgccccg gctgctggac 6360

cgcctggagg actggctgcc ggacgtggac acgctgctgg ccggccgcga accccggttc 6420

gtccacggcg acctgcacgg gaccaacatc ttcgtggacc tggccgcgac cgaggtcacc 6480

gggatcgtcg acttcaccga cgtctatgcg ggagactccc gctacagcct ggtgcaactg 6540

catctcaacg ccttccgggg cgaccgcgag atcctggccg cgctgctcga cggggcgcag 6600

tggaagcgga ccgaggactt cgcccgcgaa ctgctcgcct tcaccttcct gcacgacttc 6660

gaggtgttcg aggagacccc gctggatctc tccggcttca ccgatccgga ggaactggcg 6720

cagttcctct gggggccgcc ggacaccgcc cccggcgcct gacgccccgg gtgaagagcc 6780

ccgtcgggcg gtgcctgacg gggcttctca gttctcatga gcggagaacg agatgacgtt 6840

ggaggggcaa ggtcgcgctg attgctgggg caacacgtgg agcggatcgg ggattgtctt 6900

tcttcagctc gctgatgata tgctgacgct caagcttgca tgcctgcagg tcgacggatc 6960

ttttccgctg cataaccctg cttcggggtc attatagcga ttttttcggt atatccatcc 7020

tttttcgcac gatatacagg attttgccaa agggttcgtg tagactttcc ttggtgtatc 7080

caacggcgtc agccgggcag gataggtgaa gtaggcccac ccgcgagcgg gtgttccttc 7140

ttcactgtcc cttattcgca cctggcggtg ctcaacggga atcctgctct gcgaggctgg 7200

ccggctaccg ccggcgtaac agatgagggc aagcggatgg ctgatgaaac caagccaacc 7260

aggaagggca gcccacctat caaggtgtac tgccttccag acgaacgaag agcgattgag 7320

gaaaaggcgg cggcggccgg catgagcctg tcggcctacc tgctggccgt cggccagggc 7380

tacaaaatca cgggcgtcgt ggactatgag cacgtccgcg agctggcccg catcaatggc 7440

gacctgggcc gcctgggcgg cctgctgaaa ctctggctca ccgacgaccc gcgcacggcg 7500

cggttcggtg atgccacgat cctcgccctg ctggcgaaga tcgaagagaa gcaggacgag 7560

cttggcaagg tcatgatggg cgtggtccgc ccgagggcag agccatgact tttttagccg 7620

ctaaaacggc cggggggtgc gcgtgattgc caagcacgtc cccatgcgct ccatcaagaa 7680

gagcgacttc gcggagctgg tgaagtacat caccgacgag caaggcaaga ccgatccccg 7740

gggacctgca ggtcgact 7758

<210> 6

<211> 1107

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgaggctgc tgatcctcgg cggcaccgcc ttcctcggcc gcgccttcgc cgccgaggcg 60

ctcgctgcgg ggcacaccgt caccaccttc aaccggggcc gcaccggggc ggacgtaccc 120

ggtgtcgagg ccgtgcgcgg cgaccgcacg gtggccgccg acctgtccgc gctggtggcg 180

ggccggcact gggacgcggt cgtcgacacc tgcggctacg tcccggaggt ggtgggcgcc 240

tcggcggcgg cgctgtccgg gcacgccggg gcgtatgtgt tcgtctccag cgtcgccgcc 300

taccggcgca gcggcccgtt cgagccgctg gacggtgacg agagcgctcc cctgcacgac 360

tgcccggacg acgcgggccc cggcggcggg ccgtacggcg tgctcaaggc gggctgcgaa 420

cgcgccgtcc ggcggcactt cgccggccgg acgcagatgc tgcgcccggg cgcggtggtc 480

ggcccgcacg aggacaccgg gctgagccgc tactggctgg gccggttcgc cggcggcggg 540

ccggtgctgg ccccgggcaa cccccgggcc ccgctgccac tggtcgacgc gcgggacgtg 600

gcacgcttcg gcctgctcct ggccggcggc ggcgccggga gcggagcgtg gaacgtggcc 660

gggccgcggg gcctggacta cggtgcctgg ctggccgcct gccgggaggc caccggcggc 720

ggcgaaccgg tgtgggtgcc cgacgacttc ctgctcgcgc agggtctgcg gccgtggctg 780

gacctgccgt tgtgggcgcc cggggccacc ccggagcggt ccgtgtgggg gttctccacc 840

gagcgggccc gggccgccgg gctcgtctgc cgcccggcgc cggagaccgc cgccgacacc 900

tggcgctggc tgcgcccgct ggccgccgta ccgcagcgcg cggaccagcc cgccccggcg 960

ctggaccggg cccgggagct ggccgtgctc gacgcgtggg cgacggcccg ccccgcggcc 1020

gtggcgacgg accccggcgg ccacggaggg accggcggcc ccgagcggac cccgcacccc 1080

cgtcccggag gaagccgagt gtcatga 1107

<210> 7

<211> 1105

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atccccgggg acctgcaggt cgacttcgtc gggcatttca gcgaagcgcc gggcacgtcg 60

gcgttcggga cggcggagcg cccggagttc gaacacccca cggtggcggg gctcgcggcg 120

cacctggagg ggcggtcggc gggctcgtcc ccgttcgccc cgcacctgcc gctgcggccc 180

ggggggagcg ccactcccct gttctgcttc caccccggcg gaggcatctg ctggcccttc 240

gccccgctcc tggcgcacct ggacgcgacg gtcccggtcc acggcgtgca gtcaccgggc 300

ctcaccgatc cgtcggcgct gccggcctcc atcgaggaga tggccgacga ctacacgcgg 360

cggatccggg agctgcgccc gtccgggccg tacgcgctgc tcggctggtc gctcggcggg 420

ttcgtcgccc acgccgtggc cggacggctc cagcgggcgg gcgagcacgt cgcgctcctc 480

gccgtgctgg acagcttccc gctgcaccag gacgacctcg cgtccctgcc cgccccggag 540

gagctggagg gcatcctgct gggcctgctg ctggacggcg cgggggtgcc tcccgcttcc 600

ggggcggcgc cgccggaccg ggccgccgcc gtggccgcgc tgcgcggcag cggcagcgcc 660

ctggccggca tcgacgaggc gcagctgggc cgcatggtgg acgtcatgcg gcacaacacc 720

gggctgatcg ccgggcacac gcccggcacg gtcgagggcg acctgctggt cttcaccgcg 780

cgccgcagcc acgcggcgga cgcgccgccg cccgccgcga gctggcggcc gcacgtgacc 840

ggcgaggtga ccgatctcct gctggactgt ctccaccagg agatgctgcg ccccgagcag 900

attccgttca tcgccgcgcc cctcaacgcc cggctcgcac cgggtgcccc gggtgacggc 960

gcacactccg gctgggaagg acgatcctcg tgaccccgaa cccctgtgac cgggaagacg 1020

cggcaggcgc cgcctaccgg ggcccggccg cccggggagg cggcatgagg ctgctgatcc 1080

tcgggcacac cgtcaccacc ttcaa 1105

<210> 8

<211> 1088

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aggcggcatg aggctgctga tcctcgggca caccgtcacc accttcaacc ggggccgcac 60

cggggcggac gtacccggtg tcgaggccgt gcgcggcgac cgcacggtgg ccgccgacct 120

gtccgcgctg gtggcgggcc ggcactggga cgcggtcgtc gacacctgcg gctacgtccc 180

ggaggtggtg ggcgcctcgg cggcggcgct gtccgggcac gccggggcgt atgtgttcgt 240

ctccagcgtc gccgcctacc ggcgcagcgg cccgttcgag ccgctggacg gtgacgagag 300

cgctcccctg cacgactgcc cggacgacgc gggccccggc ggcgggccgt acggcgtgct 360

caaggcgggc tgcgaacgcg ccgtccggcg gcacttcgcc ggccggacgc agatgctgcg 420

cccgggcgcg gtggtcggcc cgcacgagga caccgggctg agccgctact ggctgggccg 480

gttcgccggc ggcgggccgg tgctggcccc gggcaacccc cgggccccgc tgccactggt 540

cgacgcgcgg gacgtggcac gcttcggcct gctcctggcc ggcggcggcg ccgggagcgg 600

agcgtggaac gtggccgggc cgcggggcct ggactacggt gcctggctgg ccgcctgccg 660

ggaggccacc ggcggcggcg aaccggtgtg ggtgcccgac gacttcctgc tcgcgcaggg 720

tctgcggccg tggctggacc tgccgttgtg ggcgcccggg gccaccccgg agcggtccgt 780

gtgggggttc tccaccgagc gggcccgggc cgccgggctc gtctgccgcc cggcgccgga 840

gaccgccgcc gacacctggc gctggctgcg cccgctggcc gccgtaccgc agcgcgcgga 900

ccagcccgcc ccggcgctgg accgggcccg ggagctggcc gtgctcgacg cgtgggcgac 960

ggcccgcccc gcggccgtgg cgacggaccc cggcggccac ggagggaccg gcggccccga 1020

gcggaccccg cacccccgtc ccggaggaag ccgagtgtca tgacttgaag acgaaagggc 1080

ctcgtgat 1088

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tctccaccag gagatgctg 19

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

acgctggaga cgaacacata c 21

<210> 11

<211> 488

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tctccaccag gagatgctgc gccccgagca gattccgttc atcgccgcgc ccctcaacgc 60

ccggctcgca ccgggtgccc cgggtgacgg cgcacactcc ggctgggaag gacgatcctc 120

gtgaccccga acccctgtga ccgggaagac gcggcaggcg ccgcctaccg gggcccggcc 180

gcccggggag gcggcatgag gctgctgatc ctcggcggca ccgccttcct cggccgcgcc 240

ttcgccgccg aggcgctcgc tgcggggcac accgtcacca ccttcaaccg gggccgcacc 300

ggggcggacg tacccggtgt cgaggccgtg cgcggcgacc gcacggtggc cgccgacctg 360

tccgcgctgg tggcgggccg gcactgggac gcggtcgtcg acacctgcgg ctacgtcccg 420

gaggtggtgg gcgcctcggc ggcggcgctg tccgggcacg ccggggcgta tgtgttcgtc 480

tccagcgt 488

<210> 12

<211> 437

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tctccaccag gagatgctgc gccccgagca gattccgttc atcgccgcgc ccctcaacgc 60

ccggctcgca ccgggtgccc cgggtgacgg cgcacactcc ggctgggaag gacgatcctc 120

gtgaccccga acccctgtga ccgggaagac gcggcaggcg ccgcctaccg gggcccggcc 180

gcccggggag gcggcatgag gctgctgatc ctcgggcaca ccgtcaccac cttcaaccgg 240

ggccgcaccg gggcggacgt acccggtgtc gaggccgtgc gcggcgaccg cacggtggcc 300

gccgacctgt ccgcgctggt ggcgggccgg cactgggacg cggtcgtcga cacctgcggc 360

tacgtcccgg aggtggtggg cgcctcggcg gcggcgctgt ccgggcacgc cggggcgtat 420

gtgttcgtct ccagcgt 437

<210> 13

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggcggcaccg ccttcctcgg ccgcgccttc gccgccgagg cgctcgctgc g 51

<210> 14

<211> 1074

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggcggcaccg ccttcctcgg ccgcgccttc gccgccgagg cgctcgctgc ggggcacacc 60

gtcaccacct tcaaccgggg ccgcaccggg gcggacgtac ccggtgtcga ggccgtgcgc 120

ggcgaccgca cggtggccgc cgacctgtcc gcgctggtgg cgggccggca ctgggacgcg 180

gtcgtcgaca cctgcggcta cgtcccggag gtggtgggcg cctcggcggc ggcgctgtcc 240

gggcacgccg gggcgtatgt gttcgtctcc agcgtcgccg cctaccggcg cagcggcccg 300

ttcgagccgc tggacggtga cgagagcgct cccctgcacg actgcccgga cgacgcgggc 360

cccggcggcg ggccgtacgg cgtgctcaag gcgggctgcg aacgcgccgt ccggcggcac 420

ttcgccggcc ggacgcagat gctgcgcccg ggcgcggtgg tcggcccgca cgaggacacc 480

gggctgagcc gctactggct gggccggttc gccggcggcg ggccggtgct ggccccgggc 540

aacccccggg ccccgctgcc actggtcgac gcgcgggacg tggcacgctt cggcctgctc 600

ctggccggcg gcggcgccgg gagcggagcg tggaacgtgg ccgggccgcg gggcctggac 660

tacggtgcct ggctggccgc ctgccgggag gccaccggcg gcggcgaacc ggtgtgggtg 720

cccgacgact tcctgctcgc gcagggtctg cggccgtggc tggacctgcc gttgtgggcg 780

cccggggcca ccccggagcg gtccgtgtgg gggttctcca ccgagcgggc ccgggccgcc 840

gggctcgtct gccgcccggc gccggagacc gccgccgaca cctggcgctg gctgcgcccg 900

ctggccgccg taccgcagcg cgcggaccag cccgccccgg cgctggaccg ggcccgggag 960

ctggccgtgc tcgacgcgtg ggcgacggcc cgccccgcgg ccgtggcgac ggaccccggc 1020

ggccacggag ggaccggcgg ccccgagcgg accccgcacc cccgtcccgg agga 1074

<210> 15

<211> 1206

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gcatgaggct gctgatcctc agccgagtgt catgagccac ctgtccgtga tccgtccccg 60

gcccgtggac gcgccgtcgc tgcggctgtt cgtcctgcac cacgcgggcg cttcccacgt 120

cccctaccgt ccctgggccg cccacctgcc ggcggcctgg gagctgtgcc tggtccaggc 180

gccgggccgg ggcggccggc ccggcccgct ccgcgagacg gccgccggcc tggccggggc 240

gtatctggac gacatccggc cctggaccga ccggccgtac gcgctgttcg ggcacagcat 300

gggcgccgtc gccggctatg agctgaccct cgcgctgcgg gaccgcgggg tgccgctgcc 360

ccggtggctg ggcctgtcgg ccgtcagccc gcccgagcac cacccgcgtg cggagccccg 420

cttcgacctg ccccgggagg aactgcgcgc ggcggtggcc gccatgggcg gcacccagcg 480

cgaggtgctg gaggacccgg agatgtggga gctgatcgag cccgtcatgc gcgccgacct 540

gcgcgtggcg gagtgctggg agccccggcg cggcaccggc ccgctgccgg tgccgctgac 600

ggtcttcgcc ggggacgccg acgtgatcgc gcccgcgcac ctgatgcaca cctgggccgc 660

gcggagcgag cgcttctgcg gggcccaggt gctgagcggc ggtcacttct acttccagcc 720

cgacccggcg gagctggtcg gccggatcgt ctcggcgatc cgctcggtga ccccggccgt 780

ccaggcgaac acccccggtc ccgccgggag cacgccgatc cgcaacacct gaccgggccc 840

ctcccgccgc ccccgccggt gccgggcgag gaagccgccc ggcaccggtg tggccgagat 900

gcccagcagt gtggtgggtg cccggccggc gggcagcagg gcgccgtacg ccttgaacgc 960

cgcctccttg gccgagaaga gggcgaagag gcgggcctcg gccgccgccg caccgccggc 1020

ggcgcgcacc cagctctcct cgccggggtc cagcacgaga tgcgcggccg cgagcggcag 1080

gccgcgcagt tccaggtcgc agccgagcgc gcggcagcgg gacgccgggg cggccagggc 1140

cacggccagg ccgccggagt ggctgatgga gacggtggtc cttgaagacg aaagggcctc 1200

gtgata 1206

<210> 16

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gcatgaggct gctgatcctc agccgagtgt catgagccac ctgtccgtg 49

<210> 17

<211> 49

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tatcacgagg ccctttcgtc ttcaagacca ccgtctccat cagccactc 49

Claims (7)

1. A Streptomyces conglobatus strain with deletion of ketoreductase gene in biosynthesis pathway of new antimycin has preservation number of CGMCC No. 15522.

2. A method for constructing a Streptomyces strain in which ketoreductase gene of the biosynthetic pathway of neomycin is deleted, comprising the steps of:

a) PCR amplification is carried out on streptomyces S.conglobatus genome DNA to obtain two DNA homologous recombination fragments, and the two DNA homologous recombination fragments are cloned on a plasmid with the function of joint transfer of escherichia coli and streptomyces parents for deleting the ketoreductase gene of the novel antimycin biosynthesis pathway, and the method comprises the following steps:

by taking streptomyces S.conglobatus genome DNA as a template, taking n7-L-F with a sequence shown as SEQ ID NO.1 and n7-L-R with a sequence shown as SEQ ID NO.2 as primers, carrying out PCR amplification to obtain a 1105bp homologous recombination left arm PCR fragment, and taking n7-R-F with a sequence shown as SEQ ID NO.3 and n7-R-R with a sequence shown as SEQ ID NO.4 as primers, carrying out PCR amplification to obtain a 1089bp homologous recombination right arm PCR fragment;

taking a plasmid pRJ2 with the functions of escherichia coli and streptomyces parental conjugal transfer as a vector, treating the vector by restriction enzymes XbaI and EcoRI, and recovering a 7758bp vector fragment by gel electrophoresis as shown in SEQ ID NO. 5;

connecting two PCR fragments and a carrier fragment by Gibson assembly, then transferring a connecting reaction system into escherichia coli E.coli DH10B or E.coli DH5a or E.coli JM109, and obtaining a target clone pRJ28 by screening;

b) b, transferring the plasmid constructed in the step a into transfer host bacteria carrying the combined transfer auxiliary plasmid;

c) c, mixed culture of the transfer host bacteria obtained in the step b and the target host bacteria streptomycete S.conglobatus, and screening out the mutant strain with deletion of the ketoreductase gene in the biosynthesis pathway of the new antimycin after homologous recombination.

3. The method of claim 2, wherein in step b, the transfer host bacterium is E.coli ET12567 carrying the transfer helper plasmid pUZ8002 or other E.coli lacking a DNA methylation modification system, the plasmid pRJ28 is extracted from E.coli DH10B or E.coli DH5a or E.coli JM109, and is transferred into E.coli ET12567 carrying the plasmid pUZ8002 or other E.coli lacking a DNA methylation modification system.

4. The method of claim 3, wherein the mixed culture in step c comprises the steps of:

(c1) c, selecting a single colony of escherichia coli E.coli ET12567 containing plasmids pRJ28 and pUZ8002 obtained in the step b, inoculating and culturing, and then collecting thalli for later use;

(c2) pre-culturing streptomyces S.conglobatus, and collecting germinated spores;

(c3) culturing Streptomyces synglobatus germinated spores and Escherichia coli E.coli ET12567 containing plasmids pRJ28 and pUZ8002 in a mixed manner; and (3) selecting hygromycin-sensitive strains to perform PCR sequencing verification, and confirming the ketoreductase gene deletion strains in the new antimycin biosynthesis pathway.

5. The use of the strain of claim 1 for the preparation of an antitumor medicament.

6. The use according to claim 5, wherein the antineoplastic medicament is useful for the prevention and/or treatment of one or more of melanoma, colon cancer, cervical cancer, liver cancer, ovarian cancer, gastric cancer, pancreatic cancer and glioma.

7. The use according to claim 5, wherein the antineoplastic drug is a compound obtained by fermentation of the strain according to claim 1, the compound having a structural formula selected from any one of:

Images