CN106978445A - The method of the goat EDAR gene knockouts of CRISPER Cas9 System-mediateds - Google Patents

Abstract

The method that the present invention completes goat EDAR gene knockouts using CRISPER Cas9 System-mediateds, it is according to goatEDARGene order, builds two gRNA expression vectors based on CRISPER Cas9 systems, is then transferred in the fetal fibroblast of goat the CRISPER Cas9 carriers after optimization and the gRNA expression vectors built jointly, obtains the cell of goat EDAR gene knockouts.The targeting vector for the CRISPER Cas9 mediations that the present invention is built is goatEDARThe knockout of gene provides a kind of approach of simple and fast safety.This method, without reference to any riddled basins, so as to substantially increase the security of transgenic animals, has important value during cell line selection to the genetic breeding and gene functional research of goat.

Description

The method of the goat EDAR gene knockouts of CRISPER-Cas9 System-mediateds

Technical field

The present invention relates to molecular biology and Animal Genetics field, specifically, it is related to CRISPER-Cas9 systems The method of the goat EDAR gene knockouts of mediation.

Background technology

Modern gene editing technology includes：Zinc finger nuclease（Znic finger nuclease, ZFNs）, transcriptional activation Factor sample effector nuclease（Transcriptionactivator-like effector nuclease, TALENs）With CRISPR-Cas9 systems.But CRISPR-Cas9 systems are sent out rapidly with its unique advantage after other two technologies occur Exhibition is got up.CRISPR-Cas9 systems be as combined by rule cluster interval palindrome repetitive sequence and CRISPR associated protein 9s and Into.CRISPR-Cas9 systems are needed by a sgRNA（Small guide RNA, sgRNA）As guide, target position sequence is recognized Row, guiding Cas9 albumen completes cutting to it so that double-strand chain rupture occurs at this, can thus trigger endogenic in cell repair The system of answering a pager's call.Endogenic repair mechanism includes two kinds of homologous recombination repair mechanism and non-homologous end joining in cell.Wherein Homologous recombination repair mechanism is with the presence of recovery template, according to recovery template, it is possible to achieve the base of the different length of fixed point Missing and insert, can thus be formed based on knock in and gene knockout.Non-homologous end joining repair mechanism is not accurate Ground, in breaking part often by random insertion or deletion number of base.

Down producing goat is occupied very importantly as one of domestic animal kind of suede meat dual-purpose type in the animal husbandry of China Position.What the improvement of down producing goat was completed by traditional breeding improvement and using modern both approach of biotechnology breeding, Wherein it is improved by modern biotechnology in being purposeful the improveing to it of researcher, so whole improved, process The features such as can reaching accurate, quick.

The suede matter and velour yield for improving down producing goat are the very important Breeding directions in down producing goat breeding.Hair follicle is animal One of accessory structure of skin, it completes the growth of hair with coming off by the continuous renewal and cyclical growth of oneself.Suede In the skin of goat, it is studied personnel with design feature sooner or later with the generation of hair follicle and is divided into primary follicle and hair follicle stimulating two Kind.Growing for primary follicle can form wool, but growing for Secondary follicle can form cashmere.So how to improve The change of growing of secondary lint can improve the yield of cashmere.Found at present in the research of mouse, Edar genes are controlled Growing for primary follicle, is essential in this process, but it is in the growth and development process of Secondary follicle Do not influence.So whether being also in this way, needing further research in the hair follicle growth growth course of down producing goat.If EDAR knockout have impact on growing but not influenceed on growing for Secondary follicle for primary follicle in down producing goat, this The ratio that sample just improves Secondary follicle further increases cashmere yield.

The research for knocking out goat EDAR genes using CRISPER-Cas9 systems has no report.

The content of the invention

It is an object of the invention to provide the method for the goat EDAR gene knockouts of CRISPER-Cas9 System-mediateds.

In order to realize the object of the invention, the goat EDAR gene knockouts for the CRISPER-Cas9 System-mediateds that the present invention is provided Method, it is according to goat EDAR gene orders（Gene ID： 102179206）, two are devised on its 6th exon Individual target sequence in opposite direction, and two gRNA expression vectors based on CRISPER-Cas9 systems are built, after then optimizing CRISPER-Cas9 carriers and the gRNA expression vectors of two above-mentioned structures be transferred to jointly in caprine fetal fibroblast cell, obtain Obtain goat EDAR Knockout cells system.

The goat addressed in the present invention including but not limited to Aerbasi Cashmere Goats '.

Foregoing method, two gRNA target sites points are respectively positioned on 6 exons of goat EDAR genes.SgRNA1 makees Be 5 '-GGAGAACTTCTCCGCGGGGC-3 ' with the DNA sequence dna in site, the DNA sequence dnas of sgRNA2 action sites for 5 '- CGGCGCCACAAGGACTGCGA -3′。

Foregoing method, described CRISPER-Cas9 carriers（That is hCas9 plasmids）Nucleotide sequence such as SEQ ID NO:Shown in 1（HCas9 plasmid maps are shown in Fig. 1）；The nucleotide sequence of the EDAR-gRNA1 expression vectors such as SEQ ID NO:2 It is shown；The nucleotide sequence of the EDAR-gRNA2 expression vectors such as SEQ ID NO:Shown in 3.

The present invention also provides the cell line of the goat EDAR gene knockouts obtained according to the above method.

The present invention further provides the above method the cloned goat for preparing EDAR gene knockouts application.The application refers to It is nuclear transfer donor cell by the cell of the goat EDAR gene knockouts, in vitro sheep egg mother cell is nuclear transfer recipient cell Born of the same parents, by somatic cell nuclear transfer technique obtain goat clone embryos, then by clone embryos by embryo transfer technology move into by Body goat intrauterine carries out gestation, obtains EDAR gene knockout goats.

The purpose of the present invention can also be further achieved by the following technical measures.

1）The optimization of CRISPER-Cas9 carriers；2）According to the EDAR gene orders of goat, build and be based on CRISPER- EDAR-gRNA1 the and EDAR-gRNA2 expression vectors of Cas9 systems；3）By CRISPER-Cas9 carriers, the EDAR- of above-mentioned optimization GRNA1 and EDAR-gRNA2 expression vectors are transfected into caprine fetal fibroblast cell jointly, pass through mouth pipette method, fluidic cell Instrument method and dilution method screening monoclonal cell system；4）By round pcr evaluation and screening monoclonal cell system, EDAR clpp genes are obtained The monoclonal cell system removed.

Wherein, step 3）Middle utilization dilution method picking monoclonal cell system refers to after cell transfecting is completed 24 hours, uses With 0.25% Trypsin Induced 2-3 minutes, then terminated and digested with the DMEM/F12 nutrient solutions containing 10% hyclone, and gently Attached cell is beaten in featheriness, disengages it from culture dish wall formation cell suspension and collection and 10mL centrifuge tubes, 1500rpm centrifugations 5 Minute.Above-mentioned cell is resuspended with PBS again, takes cell suspension to be placed on a small quantity in culture dish, under the microscope by preparing in advance Glass rim suction pipe choose individual cells be transferred in 96 porocyte culture plates with containing 10% hyclone DMEM/F12 train Nutrient solution is independently cultivated.

Step 3）Middle utilization flow cytometer screening monoclonal cell system refers to after cell transfecting is completed 24 hours, with use 0.25% Trypsin Induced 2-3 minutes, then digestion is terminated with the DMEM/F12 nutrient solutions containing 10% hyclone, and gently Attached cell is blown and beaten, is disengaged it from culture dish wall formation cell suspension and collection and 10mL centrifuge tubes, 1500rpm centrifuges 5 points Clock.Above-mentioned cell is resuspended with PBS again, then it is sorted in 96 porocyte culture plates with flow cytometer, then with containing The DMEM/F12 nutrient solutions of 10% hyclone are independently cultivated.

Step 3）Middle utilization dilution method screening monoclonal cell system refers to after cell transfecting is completed 24 hours, with use 0.25% Trypsin Induced 2-3 minutes, then digestion is terminated with the DMEM/F12 nutrient solutions containing 10% hyclone, and gently Attached cell is blown and beaten, is disengaged it from culture dish wall formation cell suspension and collection and 10mL centrifuge tubes, 1500rpm centrifuges 5 points Clock.Above-mentioned cell is resuspended with the DMEM/F12 nutrient solutions containing 10% hyclone again, it is diluted to the μ L of 1 cell/100 Cell concentration.Take the μ L of cell suspension 100 to be placed in 96 porocyte culture plates after mixing independently to cultivate.

Step 4）Middle identification EDAR knocks out the PCR that monoclonal cell system mainly includes two target site areas using design amplification The method of primer, the full sequence for expanding target sequence region by round pcr carries out sequencing analysis, purpose to the amplified fragments again It is to determine the catastrophe of EDAR genes.

The present invention successfully obtains 89 plants altogetherEDARGene targeting monoclonal cell system is by expanding the target practice of each strain cell line Region segments carry out sequencing analysis and find to have 62 plants of cell lineEDARGene is mutated, and mutation efficiency is 69.7%.It is right The mutation type of each mutant clone is further analyzed, and 9 kinds of different mutation types are found that altogether, and specific mutation type is shown in Fig. 6.

The present invention has advantages below.

（One）CRISPR-Cas9 gene editings technology and conventional homologous recombination technique, TALEN technologies and ZFNs technology phases Than gene knockout efficiency is significantly improved.

（Two）The opposite sgRNA of both direction is devised in CRISPR-Cas9 systems and completes gene knockout task, thus The large fragment deletion of EDAR gene target position is caused, the knockout efficiency of EDAR genes is improved.

（Three）By the mediation of CRISPR-Cas9 systems, realize and be not added with any selection markers and can filter out EDAR bases Because of the transgenic cell line of knockout, this is that traditional homologous recombination technique, TALEN technologies and ZFNs technologies can not be realized, very greatly Degree improves the security of transgenic animals.

（Four）EDAR gene knockout goats are prepared by somatic cell nuclear transfer technique, to build ripe genetically modified animal Research and production lay the foundation.

Brief description of the drawings

Fig. 1 is hCas9 plasmid maps in the embodiment of the present invention 1.

Fig. 2 is CRISPR-Cas9 System-mediated goat EDAR gene knockout ideographs in the embodiment of the present invention 2.

Fig. 3 is the electrophoresis result in the embodiment of the present invention 4 using Surveyor mutation detection kits detection target site；Its In, M:200bp Ladder marker;1:Positive control；2：GRNA1 mutagenic activity situations；3:GRNA2 catastrophes.

Fig. 4 is the bimodal figure of EDAR gene knockout total cells target area sequence in the embodiment of the present invention 5.

Fig. 5 is EDAR gene knockout monoclonal cell figures in the embodiment of the present invention 5.

Fig. 6 is each monoclonal cell EDAR gene knockout type maps in the embodiment of the present invention 6.Wherein strigula represents base Missing, square frame represents to insert base.

Embodiment

Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.Unless otherwise specified, embodiment According to conventional laboratory conditions, such as Sambrook equimoleculars Cloning: A Laboratory Manual（Sambrook J & Russell DW, Molecular cloning: a laboratory manual, 2001）, or according to the condition of manufacturer's specification suggestion.

Examining order is completed by Hua Da gene in following examples.

The optimization of the CRISPER-Cas9 carriers of embodiment 1.

CRISPR-Cas9 expression vectors purchased from Beijing Central Plains company are optimized, the CRISPER-Cas9 of optimization is carried Body（That is hCas9 plasmids）Nucleotide sequence such as SEQ ID NO:Shown in 1, hCas9 plasmid maps are shown in Fig. 1.

The structure of the gRNA expression vectors of embodiment 2.

According to the EDAR gene orders of goat（Gene ID: 102179206）, for EDAR the 6th exon sequence SgRNA sequences are designed, and build the gRNA expression vectors based on CRISPER-Cas9 systems.GRNA expression vectors include 4 parts： U6 promoters, target sequence, gRNA skeletons and termination signal.Based on CRISPR-Cas9 System-mediated goat EDAR gene knockout moulds Formula figure is shown in Fig. 2.Wherein, the DNA sequence dna of sgRNA action sites is as follows：sgRNA1：5 '-GGAGAACTTCTCCGCGGGGC-3 ', sgRNA2：5′-CGGCGCCACAAGGACTGCGA-3′.Using biological software according to sgRNA action sites（SgRNA1 target position Point and sgRNA2 target sites）SgRNA sequences are separately designed, are cloned on gRNA expression vectors, conversion Escherichia coli Trans- 110, picking single bacterium colony after coated plate carries out bacterium solution PCR, through electrophoresis and sequencing identification, and correct single bacterium colony is sequenced and is inoculated in containing Amp LB culture mediums in, 37 DEG C, 220rpm Guo Ye Oscillating bacterium, extract plasmid it is standby.EDAR-gRNA1 carriers and EDAR-gRNA2 carriers Nucleotide sequence such as SEQ ID NO:2 and SEQ ID NO:Shown in 3.

The electroporation of embodiment 3 transfects caprine fetal fibroblast cell.

Defrosting caprine fetal fibroblast cell is inoculated in 100mm culture dishes, be placed in 37 DEG C, 5%CO2,100% relative humidity Incubator in the DMEM/F12 nutrient solution cultures containing 10% hyclone.Treat that its growth reaches 90% cell confluency degree When use PBS cell, then with 0.25% Trypsin Induced 2-3 minutes, then with the DMEM/ containing 10% hyclone F12 nutrient solutions terminate digestion, and gently blow and beat attached cell, disengage it from culture dish wall formation cell suspension and collection and 10mL In centrifuge tube, 1500rpm is centrifuged 5 minutes.Centrifugation terminate after remove supernatant nutrient solution, add PBS be resuspended cell, then with 1500rpm centrifuges 5 minutes cleaning cell precipitations twice.Finally cleaned herein after cell precipitation with Opti-MEM nutrient solutions, with suitable Amount Opti-MEM nutrient solutions are resuspended cell and reach 1 × 10⁵Individual/μ L cell concentrations.Above-mentioned 90 μ L cell suspension is taken to add 10 μ g Plasmid（Cas9：gRNA=1:19）, totally 10 μ L.It is careful after well mixed to add above-mentioned mixed cell suspension in electric shock cup, Avoid producing bubble during this, in order to avoid influence transfection.Electric shock cup is put into the electric revolving cup chamber of NEPA21 electroporations, according to 225V/2.5ms electrotransfection condition completes electricity according to the operation instructions of electroporation and turns experiment.Containing with preheating after electricity turns The DMEM/F12 nutrient solutions of 10% hyclone are resuspended cell and are inoculated in the DMEM/F12 cultures containing 10% hyclone Cultivated in the culture dish of liquid.

SgRNA Activity determination in the CRISPER-Cas9 systems of embodiment 4.

Using the caprine fetal fibroblast cell of wild type as control, by EDAR-gRNA1+ Cas9 and EDAR-gRNA2+ Cas9 plasmids transfect caprine fetal fibroblast cell by electroporation.By cultivating after enrichment target practice cell, this is extracted respectively The genomic DNA of two groups of cells and wild-type cell.Then it is anti-by PCR using genomic DNA obtained above as template Should, expand the target position sequence of EDAR genes.Specific PCR reactions primer is as follows：edar-6exonF： GTGGTGGTCGTCGTGGTGATGC, edar-6exonR：CTGCTCAGCCTTCCTTATGGTC.PCR reaction total systems are 20 μ L μL：0.2 μ L, 10 × La PCR Buffer of La Taq, II 2 μ L, dNTP Mixture 3.2 μ L, the μ L of DNA 0.4, upper, Anti-sense primer（100 mmol•L-1）Each 0.8 μ L, the μ L of aqua sterilisa 12.6.Expand the PCR reaction conditions of EDAR gene target position sequences： 94 DEG C of min of pre-degeneration 10；94 DEG C of 30 sec of denaturation, 63 DEG C of annealing 45 sec, 72 DEG C of 1 min of extension, 35 circulations；72℃ 10 min, 16 DEG C of 1 h.After amplification terminates, by the size of 1.5% agarose gel electrophoresis testing goal band, and return Receive and purified after purpose band adhesive tape.The fragment wild-type fragment respectively with two experimental groups is carried out by the method progressively annealed again DNA hybridization.Specifically DNA hybridization reaction system is：DNA30µL（120ng/µL）, the μ L of 10 × La PCR Buffer II 3,.It is miscellaneous Friendship program is shown in Table 1.

The DNA hybridization program of table 1

Obtain after hybrid dna, mutagenic activity is detected by using Surveyor mutation detection kits.It is prominent according to Surveyor Become the operation instructions of detection kit to complete experiment, specific reaction system is shown in Table 2.

The Surveyor abrupt climatic change systems of table 2

After reaction system configuration is finished, it is placed in 42 DEG C and reacts 1 hour, finally by after the Stop Solution for entering 2.5 μ L, incite somebody to action Above-mentioned reaction solution detects the size of DNA fragmentation by 2% agarose gel electrophoresis.Testing result is shown in that Fig. 3, two kinds of sgRNA are respectively provided with Activity, can mediate Cas9 to cut target position sequence.

The screening of the monoclonal cell system of embodiment 5.

The present embodiment is intended to screeningEDARGene knockout monoclonal cell system.

EDAR-gRNA1+EDAR-gRNA2+Cas9 plasmids are transfected into caprine fetal fibroblast cell by electroporation.Carefully After dysuria with lower abdominal colic contaminates 24 hours, with 0.25% Trypsin Induced 2-3 minute, then with the DMEM/F12 trainings containing 10% hyclone Nutrient solution terminates digestion, and gently blows and beats attached cell, disengages it from culture dish wall formation cell suspension and collection is centrifuged with 10mL Guan Zhong, 1500rpm are centrifuged 5 minutes.Above-mentioned cell is resuspended with PBS again, EDAR gene knockout total cells are obtained, and take part cell Genomic DNA is extracted, PCR amplification target practice regional sequences carry out sequencing analysis.Pass through three kinds of method picking monoclonal cells again.Side Method one, using selected by flow cytometry apoptosis into unicellular, 96 holes containing cell culture fluid are inoculated in after pre-balance by unicellular In Tissue Culture Plate.Method two, using mouth suction pipe picking monoclonal cell system, be drawn into glass tube guarantee can make it is single thin The suitable diameter mouthful suction pipe that born of the same parents pass through, under the microscope sterile working is inoculated in after pre-balance containing thin respectively by unicellular In 96 porocyte culture plates of born of the same parents' nutrient solution, cell culture is carried out.Method three, with the DMEM/F12 containing 10% hyclone Above-mentioned cell is resuspended in nutrient solution, the cell concentration for making it be diluted to the μ L of 1 cell/100.The μ L of cell suspension 100 are taken after mixing It is placed in 96 porocyte culture plates and independently cultivates.At the 10th day, observe under the microscope, by the higher cell clone of degree of converging It is passaged in two holes of 24 orifice plates and cultivates, liquid is changed to cell progress in 24h after passage, when the cell clone degree of converging of passage reaches During to more than 90%, digested with 0.25% trypsase, the cell in a hole is added into 1ml frozen stock solutions（0.1mLDMSO+0.9mL Serum）Freeze, another hole cell extraction genome.

It is bimodal existing by occurring to the discovery of EDAR gene knockout total cell target practice regional sequences sequencing analysis behind target position As（See Fig. 4）, so assert the success of EDAR gene knockouts.Expand each EDAR gene targetings monoclonal cell by unicellular culture Strain（See Fig. 5）.

The identification of the monoclonal cell system of embodiment 6.

Using the genomic DNA of each monoclonal cell system as template, reacted by PCR, expand the target position sequence of EDAR genes Row.Specific PCR reacts primer：edar-6exonF：GTGGTGGTCGTCGTGGTGATGC, edar-6exonR： CTGCTCAGCCTTCCTTATGGTC.PCR reaction total systems are 20 μ L μ L：μ L, the 10 × La PCR Buffer II of La Taq 0.2 2 μ L, dNTP Mixture 3.2 μ L, the μ L of DNA 0.4, upstream and downstream primer（100 mmol•L-1）Each 0.8 μ L, aqua sterilisa 12.6µL.Expand the PCR reaction conditions of EDAR gene target position sequences：94 DEG C of min of pre-degeneration 10；94 DEG C of 30 sec of denaturation, 63 DEG C annealing 45 sec, 72 DEG C extension 1 min, 35 circulation；72 DEG C of 10 min, 16 DEG C of 1 h.After amplification terminates, by what is obtained PCR primer is sent in the analysis of Hua Da gene sequencing.Find that each EDAR gene targetings monoclonal cell strain has 9 kinds by sequencing analysis Mutation type, specific mutation type is shown in Fig. 6.

Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.

SEQUENCE LISTING

<110>University of the Inner Mongol

<120>The method of the goat EDAR gene knockouts of CRISPER-Cas9 System-mediateds

<130>The method of the goat EDAR gene knockouts of CRISPER-Cas9 System-mediateds

<160> 17

<170> PatentIn version 3.3

<210> 1

<211> 9553

<212> DNA

<213>HCas9 plasmids

<400> 1

atggtggtgt cgaagtactt gaaggctgca ggcgcgccca agttggtcag agtaaacaag 60

tggataatgt tttctgcctg ctccctgatg ggcttatccc tgtgcttatt gtaagcagaa 120

agcaccttat cgaggttagc gtcggcgagg atcactcttt tggagaattc gcttatttgc 180

tcgatgatct catcaaggta gtgtttgtgt tgttccacga acagctgctt ctgctcatta 240

tcttcgggag accctttgag cttttcatag tggctggcca gatacaagaa attaacgtat 300

ttagagggca gtgccagctc gttacctttc tgcagctcgc ccgcactagc gagcattcgt 360

ttccggccgt tttcaagctc aaagagagag tacttgggaa gcttaatgat gaggtctttt 420

ttgacctctt tatatccttt cgcctcgaga aagtcgatgg ggtttttttc gaagcttgat 480

cgctccatga ttgtgatgcc cagcagttcc ttgacgcttt tgagtttttt agacttccct 540

ttctccactt tggccacaac cagtacactg taagcgactg taggagaatc gaatccgccg 600

tatttcttgg ggtcccaatc ttttttgcgt gcgatcagct tgtcgctgtt ccttttcggg 660

aggatacttt ccttggagaa gcctccggtc tgtacttcgg tctttttaac gatgttcacc 720

tgcggcatgg acaggacctt ccggactgtc gcgaaatccc tacccttgtc ccacacgatt 780

tctcctgttt ctccgtttgt ttcgataagt ggtcgcttcc gaatctctcc attggccagt 840

gtaatctcgg tcttgaaaaa attcataata ttgctgtaaa agaagtactt agcggtggcc 900

ttgcctattt cctgctcaga ctttgcgatc attttcctaa catcgtacac tttatagtct 960

ccgtaaacaa attcagattc aagcttggga tattttttga taagtgcagt gcctaccact 1020

gcattcaggt aggcatcatg cgcatggtgg taattgttga tctctctcac cttataaaac 1080

tgaaagtcct ttctgaaatc tgagaccagc ttagacttca gagtaataac tttcacctct 1140

cgaatcagtt tgtcattttc atcgtacttg gtgttcatgc gtgaatcgag aatttgggcc 1200

acgtgcttgg tgatctggcg tgtctcaaca agctgccttt tgatgaagcc ggctttatcc 1260

aactcagaca ggccacctcg ttcagcctta gtcagattat cgaacttccg ttgtgtgatc 1320

agtttggcgt tcagcagctg ccgccaataa tttttcattt tcttgacaac ttcttctgag 1380

gggacgttat cactcttccc tctattttta tcggatcttg tcaacacttt attatcaata 1440

gaatcatctt tgagaaaaga ctggggcacg atatgatcca cgtcgtagtc ggagagccga 1500

ttgatgtcca gttcctgatc cacgtacatg tccctgccgt tctgcaggta gtacaggtag 1560

agcttctcat tctgaagctg ggtgttttca actgggtgtt ccttaaggat ttgggacccc 1620

agttctttta taccctcttc aatcctcttc atcctttccc tactgttctt ctgtcccttc 1680

tgggtagttt ggttctctcg ggccatctcg ataacgatat tctcgggctt atgccttccc 1740

attactttga cgagttcatc cacgacctta acggtctgca gtattccctt tttgatagct 1800

gggctacctg caagattagc gatgtgctcg tgaagactgt ccccctggcc agaaacttgt 1860

gctttctgga tgtcctcctt aaaggtgaga gagtcatcat ggatcaactg catgaagttc 1920

cggttggcaa atccatcgga cttaagaaaa tccaggattg tctttccact ctgcttgtct 1980

cggatcccat tgatcagttt tcttgacagc cgcccccatc ctgtatatcg gcgcctcttg 2040

agctgtttca tgactttgtc gtcgaagaga tgagcgtaag ttttcaagcg ttcttcaatc 2100

atctccctat cttcaaacaa cgtaagggtg aggacaatgt cctcaagaat gtcctcgttc 2160

tcctcattgt ccaggaagtc cttgtcttta atgattttca ggagatcgtg atacgttccc 2220

agggatgcgt tgaagcgatc ctccactccg ctgatttcaa cagagtcgaa acattcaatc 2280

tttttgaaat agtcttcttt gagctgtttc acggtaactt tccggttcgt cttgaagagg 2340

aggtccacga tagctttctt ctgctctcca gacaggaatg ctggctttct catcccttct 2400

gtgacgtatt tgaccttggt gagctcgtta taaactgtga agtactcgta cagcagagag 2460

tgtttaggaa gcaccttttc gttaggcaga tttttatcaa agttagtcat cctttcgatg 2520

aaggactggg cagaggcccc cttatccacg acttcctcga agttccaggg agtgatggtc 2580

tcttctgatt tgcgagtcat ccacgcgaat ctggaatttc cccgggcgag ggggcctaca 2640

tagtagggta tccgaaatgt gaggattttc tcaatctttt ccctgttatc tttcaaaaag 2700

gggtagaaat cctcttgccg cctgaggata gcgtgcagtt cgcccaggtg aatctggtgg 2760

gggatgcttc cattgtcgaa agtgcgctgt ttgcgcaaca gatcttctct gttaagcttt 2820

accagcagct cctcggtgcc gtccattttt tccaagatgg gcttaataaa tttgtaaaat 2880

tcctcctggc ttgctccgcc gtcaatgtat ccggcgtagc catttttaga ctgatcgaag 2940

aaaatttcct tgtacttctc aggcagttgc tgtctgacaa gggccttcag caaagtcaag 3000

tcttggtggt gctcatcata gcgcttgatc atactagcgc tcagcggagc tttggtgatc 3060

tccgtgttca ctcgcagaat atcactcagc agaatggcgt ctgacaggtt ctttgccgcc 3120

aaaaaaaggt ctgcgtactg gtcgccgatc tgggccagca gattgtcgag atcatcatcg 3180

taggtgtctt tgctcagttg aagcttggca tcttcggcca ggtcgaagtt agatttaaag 3240

ttgggggtca gcccgagtga cagggcgata agattaccaa acaggccgtt cttcttctcc 3300

ccagggagct gtgcgatgag gttttcgagc cgccgggatt tggacagcct agcgctcagg 3360

attgctttgg cgtcaactcc ggatgcgttg atcgggttct cttcgaaaag ctgattgtaa 3420

gtctgaacca gttggataaa gagtttgtcg acatcgctgt tgtctgggtt caggtccccc 3480

tcgatgagga agtgtccccg aaatttgatc atatgcgcca gcgcgagata gatcaaccgc 3540

aagtcagcct tatcagtact gtctacaagc ttcttcctca gatgatatat ggttgggtac 3600

ttttcatggt acgccacctc gtccacgata ttgccaaaga ttgggtggcg ctcgtgcttt 3660

ttatcctcct ccaccaaaaa ggactcctcc agcctatgga agaaagagtc atccacctta 3720

gccatctcat tactaaagat ctcctgcagg tagcagatcc gattctttct gcgggtatat 3780

ctgcgccgtg ctgttctttt gagccgcgtg gcttcggccg tctccccgga gtcgaacagg 3840

agggcgccaa tgaggttctt ctttatgctg tggcgatcgg tattgcccag aactttgaat 3900

tttttgctcg gcaccttgta ctcgtccgta atgacggccc agccgacgct gtttgtgccg 3960

atatcgagcc caatggagta cttcttgtcc atggtggcaa gggttcgatc ctctagagtc 4020

cggaggctgg atcggtcccg gtgtcttcta tggaggtcaa aacagcgtgg atggcgtctc 4080

caggcgatct gacggttcac taaacgagct ctgcttatat agacctccca ccgtacacgc 4140

ctaccgccca tttgcgtcaa tggggcggag ttgttacgac attttggaaa gtcccgttga 4200

ttttggtgcc aaaacaaact cccattgacg tcaatggggt ggagacttgg aaatccccgt 4260

gagtcaaacc gctatccacg cccattgatg tactgccaaa accgcatcac catggtaata 4320

gcgatgacta atacgtagat gtactgccaa gtaggaaagt cccataaggt catgtactgg 4380

gcataatgcc aggcgggcca tttaccgtca ttgacgtcaa tagggggcgt acttggcata 4440

tgatacactt gatgtactgc caagtgggca gtttaccgta aatactccac ccattgacgt 4500

caatggaaag tccctattgg cgttactatg ggaacatacg tcattattga cgtcaatggg 4560

cgggggtcgt tgggcggtca gccaggcggg ccatttaccg taagttatgt aacgcggaac 4620

tccatatatg ggctatgaac taatgacccc gtaattgatt actattaata actagtcaat 4680

aatcaatgtc aacgcgtata tctggcccgt acatcgcgaa gcagcgcaaa acgcctaacc 4740

ctaagcagat tcttcatgca attgtcggtc aagccttgcc ttgttgtagc ttaaattttg 4800

ctcgcgcact actcagcgac ctccaacaca caagcaggga gcagatactg gcttaactat 4860

gcggcatcag agcagattgt actgagagtg caccataggg gatcgggaga tctcccgatc 4920

cgtcgacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 4980

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 5040

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 5100

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 5160

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 5220

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 5280

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 5340

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 5400

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 5460

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 5520

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 5580

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 5640

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 5700

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 5760

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 5820

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 5880

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 5940

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 6000

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 6060

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 6120

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 6180

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 6240

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 6300

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 6360

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 6420

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 6480

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 6540

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 6600

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 6660

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 6720

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 6780

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 6840

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 6900

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 6960

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 7020

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 7080

accatgatta cgccaagctc tagctagagg tcgacggtat acagacatga taagatacat 7140

tgatgagttt ggacaaacca caactagaat gcagtgaaaa aaatgcttta tttgtgaaat 7200

ttgtgatgct attgctttat ttgtaaccat tataagctgc aataaacaag ttggggtggg 7260

cgaagaactc cagcatgaga tccccgcgct ggaggatcat ccagccggcg tcccggaaaa 7320

cgattccgaa gcccaacctt tcatagaagg cggcggtgga atcgaaatct cgtgatggca 7380

ggttgggcgt cgcttggtcg gtcatttcgc gaaccccaga gtcccgctca gaagaactcg 7440

tcaagaaggc gatagaaggc gatgcgctgc gaatcgggag cggcgatacc gtaaagcacg 7500

aggaagcggt cagcccattc gccgccaagc tcttcagcaa tatcacgggt agccaacgct 7560

atgtcctgat agcggtccgc cacacccagc cggccacagt cgatgaatcc agaaaagcgg 7620

ccattttcca ccatgatatt cggcaagcag gcatcgccat gggtcacgac gagatcctcg 7680

ccgtcgggca tgcgcgcctt gagcctggcg aacagttcgg ctggcgcgag cccctgatgc 7740

tcttcgtcca gatcatcctg atcgacaaga ccggcttcca tccgagtacg tgctcgctcg 7800

atgcgatgtt tcgcttggtg gtcgaatggg caggtagccg gatcaagcgt atgcagccgc 7860

cgcattgcat cagccatgat ggatactttc tcggcaggag caaggtgaga tgacaggaga 7920

tcctgccccg gcacttcgcc caatagcagc cagtcccttc ccgcttcagt gacaacgtcg 7980

agcacagctg cgcaaggaac gcccgtcgtg gccagccacg atagccgcgc tgcctcgtcc 8040

tgcagttcat tcagggcacc ggacaggtcg gtcttgacaa aaagaaccgg gcgcccctgc 8100

gctgacagcc ggaacacggc ggcatcagag cagccgattg tctgttgtgc ccagtcatag 8160

ccgaatagcc tctccaccca agcggccgga gaacctgcgt gcaatccatc ttgttcaatc 8220

atgcgaaacg atcctcatcc tgtctcttga tcagatccga aaatggatat acaagctccc 8280

gggagctttt tgcaaaagcc taggcctcca aaaaagcctc ctcactactt ctggaatagc 8340

tcagaggcag aggcggcctc ggcctctgca taaataaaaa aaattagtca gccatggggc 8400

ggagaatggg cggaactggg cggagttagg ggcgggatgg gcggagttag gggcgggact 8460

atggttgctg actaattgag atgcatgctt tgcatacttc tgcctgctgg ggagcctggg 8520

gactttccac acctggttgc tgactaattg agatgcatgc tttgcatact tctgcctgct 8580

ggggagcctg gggactttcc acaccctaac tgacacacat tccacagaat taattcgcgt 8640

taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc aaaatccctt 8700

ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg aacaagagtc 8760

cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat cagggcgatg 8820

gcccactacg tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac 8880

taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg 8940

tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag 9000

cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt 9060

ggggataccc cctagagccc cagctgcgca gatctgctat ggcagggcct gccgccccga 9120

cgttggctgc gagccctggg ccttcacccg aacttggggg gtggggtggg gaaaaggaag 9180

aaacgcgggc gtattggccc caatggggtc tcggtggggt atcgacagag tgccagccct 9240

gggaccgaac cccgcgttta tgaacaaacg acccaacacc cgtgcgtttt attctgtctt 9300

tttattgccg tcatagcgcg ggttccttcc ggtattgtct ccttccgtgt ttcagttagc 9360

ctcccccgtt taaactcatt actaaccggt agggatcgaa ccctttcaca ccttcctctt 9420

cttcttgggg tcagccctgc tgtctccacc gagctgagag aggtcgattc ttgtttcata 9480

gagccccgta attgactgat gaatcagtgt ggcgtccagg acctcctttg tagaggtgta 9540

ccgctttctg tct 9553

<210> 2

<211> 455

<212> DNA

<213>EDAR-gRNA1 plasmids

<400> 2

tgtacaaaaa agcaggcttt aaaggaacca attcagtcga ctggatccgg taccaaggtc 60

gggcaggaag agggcctatt tcccatgatt ccttcatatt tgcatatacg atacaaggct 120

gttagagaga taattagaat taatttgact gtaaacacaa agatattagt acaaaatacg 180

tgacgtagaa agtaataatt tcttgggtag tttgcagttt taaaattatg ttttaaaatg 240

gactatcata tgcttaccgt aacttgaaag tatttcgatt tcttggcttt atatatcttg 300

tggaaaggac gaaacaccgg agaacttctc cgcggggcgt tttagagcta gaaatagcaa 360

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 420

tctagaccca gctttcttgt acaaagttgg catta 455

<210> 3

<211> 455

<212> DNA

<213>EDAR-gRNA2 plasmids

<220>

<221> misc_feature

<222> (319)..(338)

<223> n is a, c, g, or t

<400> 3

tgtacaaaaa agcaggcttt aaaggaacca attcagtcga ctggatccgg taccaaggtc 60

gggcaggaag agggcctatt tcccatgatt ccttcatatt tgcatatacg atacaaggct 120

gttagagaga taattagaat taatttgact gtaaacacaa agatattagt acaaaatacg 180

tgacgtagaa agtaataatt tcttgggtag tttgcagttt taaaattatg ttttaaaatg 240

gactatcata tgcttaccgt aacttgaaag tatttcgatt tcttggcttt atatatcttg 300

tggaaaggac gaaacaccnn nnnnnnnnnn nnnnnnnngt tttagagcta gaaatagcaa 360

gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg gtgctttttt 420

tctagaccca gctttcttgt acaaagttgg catta 455

<210> 4

<211> 20

<212> DNA

<213>SgRNA1 target sites

<400> 4

ggagaacttc tccgcggggc 20

<210> 5

<211> 20

<212> DNA

<213>SgRNA2 target sites

<400> 5

cggcgccaca aggactgcga 20

<210> 6

<211> 22

<212> DNA

<213>Artificial sequence

<400> 6

gtggtggtcg tcgtggtgat gc 22

<210> 7

<211> 22

<212> DNA

<213>Artificial sequence

<400> 7

ctgctcagcc ttccttatgg tc 22

<210> 8

<211> 661

<212> DNA

<213>Wild type sequencing result

<400> 8

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggctgc gttccctgcc ccgcggagaa 120

gttctccaag ggcggctacc agatctgccg gcgccacaag gactgcgagg gcttcttccg 180

cgccacggtg ctgaccccgg gggacacaga gcgcgacgct gagtgtgggc cctgcttgcc 240

tgggtgagct ccgtgccgcc ctgcccacgt acccctcccg ggcatgggtc ctgctgggag 300

gagagtctca catctccagc tccgggagag gagggaagag gggcacaggt ctcctggtgg 360

gggtcccacc accttccacc cgcagggcag cccacctggg ctccatgtct gtgtccctaa 420

gtggacctca tcataatagc atctctgacc acccaaatca agcagatgtg ttgaatactt 480

aaaaggagac aacacatgtg gagtgaggaa agaaaaaaac aaggtatttt ttgtattttt 540

agtattctgg aaaaaaactg agggtgaaaa gctaccaata gaaatatttg taatcaaagc 600

tatggtgttt ccagtagtca tgtatggata tgagaggtgg accataagga aggctgagca 660

g 661

<210> 9

<211> 625

<212> DNA

<213>Type-1 sequencing results

<400> 9

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggctgc gttccctgcc ccgcggagaa 120

gttctccaag ggcggcttct tccgcgccac ggtgctgacc ccgggggaca cagagcgcga 180

cgctgagtgt gggccctgct tgcctgggtg agctccgtgc cgccctgccc acgtacccct 240

cccgggcatg ggtcctgctg ggaggagagt ctcacatctc cagctccggg agaggaggga 300

agaggggcac aggtctcctg gtgggggtcc caccaccttc cacccgcagg gcagcccacc 360

tgggctccat gtctgtgtcc ctaagtggac ctcatcataa tagcatctct gaccacccaa 420

atcaagcaga tgtgttgaat acttaaaagg agacaacaca tgtggagtga ggaaagaaaa 480

aaacaaggta ttttttgtat ttttagtatt ctggaaaaaa actgagggtg aaaagctacc 540

aatagaaata tttgtaatca aagctatggt gtttccagta gtcatgtatg gatatgagag 600

gtggaccata aggaaggctg agcag 625

<210> 10

<211> 606

<212> DNA

<213>Type-2 sequencing results

<400> 10

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggctgc gttccctgcc cgagggcttc 120

ttccgcgcca cggtgctgac cccgggggac acagagcgcg acgctgagtg tgggccctgc 180

ttgcctgggt gagctccgtg ccgccctgcc cacgtacccc tcccgggcat gggtcctgct 240

gggaggagag tctcacatct ccagctccgg gagaggaggg aagaggggca caggtctcct 300

ggtgggggtc ccaccacctt ccacccgcag ggcagcccac ctgggctcca tgtctgtgtc 360

cctaagtgga cctcatcata atagcatctc tgaccaccca aatcaagcag atgtgttgaa 420

tacttaaaag gagacaacac atgtggagtg aggaaagaaa aaaacaaggt attttttgta 480

tttttagtat tctggaaaaa aactgagggt gaaaagctac caatagaaat atttgtaatc 540

aaagctatgg tgtttccagt agtcatgtat ggatatgaga ggtggaccat aaggaaggct 600

gagcag 606

<210> 11

<211> 608

<212> DNA

<213>Type-3 sequencing results

<400> 11

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggctgc gttccctgcc tgcgagggct 120

tcttccgcgc cacggtgctg accccggggg acacagagcg cgacgctgag tgtgggccct 180

gcttgcctgg gtgagctccg tgccgccctg cccacgtacc cctcccgggc atgggtcctg 240

ctgggaggag agtctcacat ctccagctcc gggagaggag ggaagagggg cacaggtctc 300

ctggtggggg tcccaccacc ttccacccgc agggcagccc acctgggctc catgtctgtg 360

tccctaagtg gacctcatca taatagcatc tctgaccacc caaatcaagc agatgtgttg 420

aatacttaaa aggagacaac acatgtggag tgaggaaaga aaaaaacaag gtattttttg 480

tatttttagt attctggaaa aaaactgagg gtgaaaagct accaatagaa atatttgtaa 540

tcaaagctat ggtgtttcca gtagtcatgt atggatatga gaggtggacc ataaggaagg 600

ctgagcag 608

<210> 12

<211> 607

<212> DNA

<213>Type-4 sequencing results

<400> 12

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggctgc gtttttcttt gcgagggctt 120

cttccgcgcc acggtgctga ccccggggga cacagagcgc gacgctgagt gtgggccctg 180

cttgcctggg tgagctccgt gccgccctgc ccacgtaccc ctcccgggca tgggtcctgc 240

tgggaggaga gtctcacatc tccagctccg ggagaggagg gaagaggggc acaggtctcc 300

tggtgggggt cccaccacct tccacccgca gggcagccca cctgggctcc atgtctgtgt 360

ccctaagtgg acctcatcat aatagcatct ctgaccaccc aaatcaagca gatgtgttga 420

atacttaaaa ggagacaaca catgtggagt gaggaaagaa aaaaacaagg tattttttgt 480

atttttagta ttctggaaaa aaactgaggg tgaaaagcta ccaatagaaa tatttgtaat 540

caaagctatg gtgtttccag tagtcatgta tggatatgag aggtggacca taaggaaggc 600

tgagcag 607

<210> 13

<211> 605

<212> DNA

<213>Type-5 sequencing results

<400> 13

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggctgc gttccctgcc gagggcttct 120

tccgcgccac ggtgctgacc ccgggggaca cagagcgcga cgctgagtgt gggccctgct 180

tgcctgggtg agctccgtgc cgccctgccc acgtacccct cccgggcatg ggtcctgctg 240

ggaggagagt ctcacatctc cagctccggg agaggaggga agaggggcac aggtctcctg 300

gtgggggtcc caccaccttc cacccgcagg gcagcccacc tgggctccat gtctgtgtcc 360

ctaagtggac ctcatcataa tagcatctct gaccacccaa atcaagcaga tgtgttgaat 420

acttaaaagg agacaacaca tgtggagtga ggaaagaaaa aaacaaggta ttttttgtat 480

ttttagtatt ctggaaaaaa actgagggtg aaaagctacc aatagaaata tttgtaatca 540

aagctatggt gtttccagta gtcatgtatg gatatgagag gtggaccata aggaaggctg 600

agcag 605

<210> 14

<211> 598

<212> DNA

<213>Type-6 sequencing results

<400> 14

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggctgc gtcgagggct tcttccgcgc 120

cacggtgctg accccggggg acacagagcg cgacgctgag tgtgggccct gcttgcctgg 180

gtgagctccg tgccgccctg cccacgtacc cctcccgggc atgggtcctg ctgggaggag 240

agtctcacat ctccagctcc gggagaggag ggaagagggg cacaggtctc ctggtggggg 300

tcccaccacc ttccacccgc agggcagccc acctgggctc catgtctgtg tccctaagtg 360

gacctcatca taatagcatc tctgaccacc caaatcaagc agatgtgttg aatacttaaa 420

aggagacaac acatgtggag tgaggaaaga aaaaaacaag gtattttttg tatttttagt 480

attctggaaa aaaactgagg gtgaaaagct accaatagaa atatttgtaa tcaaagctat 540

ggtgtttcca gtagtcatgt atggatatga gaggtggacc ataaggaagg ctgagcag 598

<210> 15

<211> 611

<212> DNA

<213>Type-7 sequencing results

<400> 15

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggctgc gttccctgcc cggggtccca 120

gatctgccgg cgccacggtg ctgaccccgg gggacacaga gcgcgacgct gagtgtgggc 180

cctgcttgcc tgggtgagct ccgtgccgcc ctgcccacgt acccctcccg ggcatgggtc 240

ctgctgggag gagagtctca catctccagc tccgggagag gagggaagag gggcacaggt 300

ctcctggtgg gggtcccacc accttccacc cgcagggcag cccacctggg ctccatgtct 360

gtgtccctaa gtggacctca tcataatagc atctctgacc acccaaatca agcagatgtg 420

ttgaatactt aaaaggagac aacacatgtg gagtgaggaa agaaaaaaac aaggtatttt 480

ttgtattttt agtattctgg aaaaaaactg agggtgaaaa gctaccaata gaaatatttg 540

taatcaaagc tatggtgttt ccagtagtca tgtatggata tgagaggtgg accataagga 600

aggctgagca g 611

<210> 16

<211> 580

<212> DNA

<213>Type-8 sequencing results

<400> 16

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgaggg cttcttccgc gccacggtgc tgaccccggg 120

ggacacagag cgcgacgctg agtgtgggcc ctgcttgcct gggtgagctc cgtgccgccc 180

tgcccacgta cccctcccgg gcatgggtcc tgctgggagg agagtctcac atctccagct 240

ccgggagagg agggaagagg ggcacaggtc tcctggtggg ggtcccacca ccttccaccc 300

gcagggcagc ccacctgggc tccatgtctg tgtccctaag tggacctcat cataatagca 360

tctctgacca cccaaatcaa gcagatgtgt tgaatactta aaaggagaca acacatgtgg 420

agtgaggaaa gaaaaaaaca aggtattttt tgtattttta gtattctgga aaaaaactga 480

gggtgaaaag ctaccaatag aaatatttgt aatcaaagct atggtgtttc cagtagtcat 540

gtatggatat gagaggtgga ccataaggaa ggctgagcag 580

<210> 17

<211> 549

<212> DNA

<213>Type-9 sequencing results

<400> 17

gtggtggtcg tcgtggtgat gcagccgctg acccacctgt gtcccatcct tccctggcca 60

gtcctgcggt tatggcacca gggacgagga ctacggcgga gaagttctcc aagggcggcc 120

tgcttgcctg ggtgagctcc gtgccgccct gcccacgtac ccctcccggg catgggtcct 180

gctgggagga gagtctcaca tctccagctc cgggagagga gggaagaggg gcacaggtct 240

cctggtgggg gtcccaccac cttccacccg cagggcagcc cacctgggct ccatgtctgt 300

gtccctaagt ggacctcatc ataatagcat ctctgaccac ccaaatcaag cagatgtgtt 360

gaatacttaa aaggagacaa cacatgtgga gtgaggaaag aaaaaaacaa ggtatttttt 420

gtatttttag tattctggaa aaaaactgag ggtgaaaagc taccaataga aatatttgta 480

atcaaagcta tggtgtttcc agtagtcatg tatggatatg agaggtggac cataaggaag 540

gctgagcag 549

Claims (8)

1. The method of the goat EDAR gene knockouts of 1.CRISPER-Cas9 System-mediateds, it is characterised in that it is according to goat EDAR gene orders, build two gRNA expression vectors based on CRISPER-Cas9 systems, then by after optimization Two gRNA expression vectors of CRISPER-Cas9 carriers and above-mentioned structure are transferred in the fetal fibroblast of goat jointly, are obtained Obtain the cell line of goat EDAR gene knockouts.
2. 2. according to the method described in claim 1, it is characterised in that two gRNA expression vectors be respectively EDAR-gRNA1 and EDAR-gRNA2, and their action site is in opposite direction and is respectively positioned on 6 exons of sheep EDAR genes.
3. 3. method according to claim 2, it is characterised in that sgRNA1 target sequences are 5 '- GGAGAACTTCTCCGCGGGGC-3 ', sgRNA2 target sequence are 5 '-CGGCGCCACAAGGACTGCGA -3 '.
4. 4. the method according to claim any one of 1-3, it is characterised in that the goat includes Aerbasi Cashmere Goats '.
5. 5. the method according to claim any one of 1-4, it is characterised in that the nucleotides of the CRISPER-Cas9 carriers Sequence such as SEQ ID NO:Shown in 1；The nucleotide sequence of the EDAR-gRNA1 expression vectors such as SEQ ID NO:Shown in 2；Institute State the nucleotide sequence such as SEQ ID NO of EDAR-gRNA2 expression vectors:Shown in 3.
6. 6. the cell line of the goat EDAR gene knockouts obtained according to any one of claim 1-5 methods described.
7. 7. according to application of any one of the claim 1-6 methods described in the cloned goat of production EDAR gene knockouts.
8. 8. application according to claim 7, it is characterised in that with the thin of goat EDAR gene knockouts described in claim 6 Born of the same parents are nuclear transfer donor cell, and in vitro goat oocytes are nuclear transfer recipient cell, and sheep gram is obtained by nuclear transfer technology Then clone embryos are moved into goat entopic pregnancy by embryo transfer technology, obtain EDAR gene knockout goats by grand embryo.