CN109880837B

CN109880837B - Method for degrading lignin in tobacco straw

Info

Publication number: CN109880837B
Application number: CN201910172209.9A
Authority: CN
Inventors: 王庆东; 党羽佳; 张佳媛; 李菲; 赵林萍; 杨艳坤
Original assignee: Zhengzhou University
Current assignee: Zhengzhou University
Priority date: 2019-03-07
Filing date: 2019-03-07
Publication date: 2022-02-11
Anticipated expiration: 2039-03-07
Also published as: CN109880837A

Abstract

The invention discloses a method for degrading tobacco straw lignin, which comprises the following steps: constructing a peroxidase gene expression vector containing a rice GRP signal peptide gene, a GFP gene and an SHP gene, and introducing the peroxidase gene expression vector into agrobacterium LBA4404 to construct a mature transgenic tobacco plant; finally, the hydrogen peroxide is utilized to degrade lignin in the mature transgenic tobacco plants. The constructed peroxidase gene expression vector can ensure that the endogenous SHP enzyme of crop straws is over-expressed when the crops grow normally and fully contacted with cell wall components such as straw lignin and the like along with the normal growth and development of the crops, the lignin content in the crop straws is not influenced, and after the crop straws are harvested and the straws in the mature period are harvested, the lignin content of the transgenic plant straws can be reduced by 3-5 percent by treating with hydrogen peroxide solution with the volume fraction of 5 percent.

Description

Method for degrading lignin in tobacco straw

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a method for degrading tobacco straw lignin.

Background

Lignocellulose resources are renewable energy substances rich in nature, serve as main carriers of biomass energy, and are widely concerned at home and abroad in research and application. The lignin is one of three main components of plant cell walls, is surrounded or bonded in a cellulose framework, can enhance the mechanical strength of plant bodies, is beneficial to moisture transportation of transportation tissues and resists against adverse attack of the external environment, but the structural complexity and the stable existing form in the body make the lignin difficult to degrade, industrially separate or convert, and become a primary barrier for the resource utilization of lignocellulose.

One of the key technologies for improving the quality of crop straws such as corn and the like as crude feed for ruminants is to break the constraint of straw cell walls, solve the problem of the blockage of the lignocellulose structure in the straw cell walls to the function of related enzyme molecules, promote the release of nutrient substances in the cell walls, and improve the digestibility, palatability, nutritive value and the like of the straw feed. On the premise of not influencing the normal growth and development and stress resistance of plants, the problem of a degradation resistance barrier of lignin in the utilization processes of plant stem (particularly crop straw) feed and energy is properly solved, and the method becomes one of the current international research hotspot fields.

The main industrial pretreatment methods for lignocellulose include physical, chemical and biological methods. The former two methods have good effect, but have environmental problems of high energy consumption, high cost, serious pollution and the like, and the research and development of environment-friendly biological pretreatment methods are increased at home and abroad in recent years, so that some important progresses are made. The field of lignin biodegradation achieves more prominent results based on the research of treating lignin by microorganisms such as white rot fungi. Although microorganisms such as white rot fungi and the like have the capacity of degrading lignin, the strain culture period is long, the enzyme yield and activity are low, and the white rot fungi can cause the loss of lignin in the growth process of crops in the process of degrading the lignin, so that the popularization and the application of the environment-friendly biological pretreatment method in production are greatly limited.

In conclusion, the prior art has the problem that a method which can not cause the loss of lignin in the growth process of crops and can effectively degrade the lignin of the harvested straws is lacked.

Disclosure of Invention

The invention aims to provide a method for degrading tobacco straw lignin, which solves the problems that in the prior art, white rot fungi can cause lignin loss in the crop growth process in the lignin degradation process, and the popularization and application of a biological treatment method in production are limited.

The invention provides a method for degrading tobacco straw lignin, which comprises the following steps:

s1, constructing a bean husk peroxidase gene expression vector pCAMBIA 3301-GRP-GFP-SHP;

the soybean hull peroxidase gene expression vector pCAMBIA3301-GRP-GFP-SHP is formed by connecting a signal peptide GRP gene, a GFP gene and a SHP gene on a pCAMBIA3301 vector;

wherein, the signal peptide GRP gene sequence is shown as SEQ ID NO. 3; the SHP gene is obtained by extracting total RNA of soybean hulls, performing reverse transcription to obtain cDNA, and then taking the cDNA as a template and SHP-F: AGCACCTTTCTTCAACCTCACTC, SHP-R: CTCCTTCATCCCCAGTCAGCAC is obtained by PCR amplification of primers; the GFP gene takes pBI221 plasmid as a template to

GF P-F: GAT C C C G C C A C C AT G GT GA G C AA G, S HP-R: AATTCCTTGTACAGCTCGTCCATG is obtained by PCR amplification of primers;

s2, cultivating mature transgenic tobacco plant

S21, introducing the soybean hull peroxidase gene expression vector pCAMBIA3301-GRP-GFP-SHP into agrobacterium to obtain a transforming strain, and then culturing the transforming strain to obtain a transforming strain liquid;

s22, soaking the tobacco leaves in the transformation bacterial liquid, then placing the tobacco leaves in a differentiation culture medium, and carrying out dark culture at 25-28 ℃ for 2-3d to obtain co-culture leaves;

s23, transferring the co-cultured leaves to a screening culture medium, performing photoperiod culture, transferring the seedlings to a rooting culture medium after the seedlings grow to 5-7cm, hardening the seedlings, and planting until mature transgenic tobacco plants are obtained;

s3, degrading lignin in mature transgenic tobacco plants

Mature transgenic tobacco plant straws are taken and placed in hydrogen peroxide solution with the volume concentration of 3-5%, and the solution is heated for 1-1.5h at the temperature of 45 ℃ to finish the degradation of lignin.

Preferably, in the method for degrading tobacco straw lignin, the soybean hull peroxidase gene expression vector pCAMBIA3301-GRP-GFP-SHP is constructed according to the following steps:

s11, constructing pMD19-SHP recombinant vector

Extracting total RNA of soybean hulls, carrying out reverse transcription to obtain cDNA, and carrying out PCR amplification by taking the cDNA as a template and SHP-F, SHP-R as a primer to obtain an SHP gene; connecting the SHP gene to pMD19-T subjected to double enzyme digestion by BstB I and BstE II to obtain a pMD19-SHP recombinant vector;

s12, constructing pMD19-GRP recombinant vector

Artificially synthesizing a signal peptide GRP gene shown as SEQ ID NO. 3; connecting a signal peptide GRP gene to a pMD19-T vector subjected to double enzyme digestion by NcoI and Spe I to obtain a pMD19-GRP recombinant vector;

s13, construction of PMD19-GFP recombinant vector

A pBI221 plasmid is used as a template, GFP-F, GFP-R is used as a primer, a GFP gene is amplified, and the GFP gene is connected to a PMD19-T vector subjected to double enzyme digestion by BamHI and SacI to obtain a PMD19-GFP recombinant vector;

s14, carrying out double enzyme digestion on the pBI221 plasmid through SacI and EcoRI to obtain an NOS fragment; carrying out double enzyme digestion on the pNMCS plasmid by SacI and EcoRI to obtain a pNMCS fragment; connecting the NOS fragment to the pNMCS fragment to obtain a pNMCS-NOS recombinant vector;

s15, carrying out double enzyme digestion on the pMD19-GFP recombinant vector by using endonuclease EcoR V and BamH I, and recovering to obtain a GFP fragment; carrying out single enzyme digestion on the PMD19-GRP recombinant vector by EcoT22I to obtain a vector fragment E, and carrying out single enzyme digestion on the vector fragment E by BamH I to obtain a GRP fragment containing a GRP sequence; connecting the GFP fragment to the GRP fragment to obtain a PMD19-GRP-GFP recombinant vector;

s16, carrying out double enzyme digestion on the pMD19-SHP recombinant vector by endonuclease BstB I and BstE II to obtain an SHP fragment; carrying out double enzyme digestion on the pNMCS-NOS recombinant vector by endonucleases BstB I and BstE II to obtain a pNMCS-NOS fragment; connecting the SHP fragment to the pNMCS-NOS fragment to obtain a pNMCS-SHP-NOS recombinant vector;

s17, carrying out double enzyme digestion on the PMD19-GRP-GFP recombinant vector by endonuclease Xba I and BamH I, and recovering to obtain a GRP-GFP fragment; carrying out double enzyme digestion on the pNMCS-SHP-NOS recombinant vector by using endonuclease Avr II/Bgl II to obtain an SHP fragment; connecting the GRP-GFP fragment to the SHP fragment to obtain a pNMCS-GRP-GFP-SHP-NOS recombinant vector;

s18, carrying out double enzyme digestion on the pNMCS-GRP-GFP-SHP-NOS recombinant vector by using endonuclease NcoI and BstEII, and recovering a GRP-GFP-SHP fragment with the size of 1799 bp; carrying out double enzyme digestion on the pCAMBIA3301 vector by endonuclease NcoI and BstEII, and recovering a long-sequence pCAMBIA3301 fragment; the GRP-GFP-SHP fragment was ligated to the pCAMBIA3301 fragment to obtain a peroxidase gene expression vector pCAMBIA 3301-GRP-GFP-SHP.

Preferably, in the method for degrading tobacco straw lignin, in S22, each liter of the differentiation medium is prepared by mixing the following components: 1L of MS culture medium, 200mg of 6-BA and 200mg of IAA;

in S23, each liter of the screening medium is prepared by mixing the following components: 1L of differentiation medium, 200mg of kanamycin; each liter of the rooting culture medium is prepared by mixing the following components: 1L of 1/2MS medium, 200mg kanamycin.

4. The method for degrading tobacco straw lignin according to claim 3, wherein in S21, OD of the transforming bacterial liquid₆₀₀Is 0.28-0.32.

Preferably, in the method for degrading tobacco straw lignin, in S21, the OD of the transformed bacterial liquid₆₀₀Is 0.28-0.32.

Preferably, in the method for degrading tobacco straw lignin, in step S22, the tobacco leaves are soaked in the transformed bacterial liquid for 5 min.

Preferably, in the method for degrading tobacco straw lignin, in S22, the dark culture temperature is 28 ℃ and the time is 3 d.

Preferably, in the method for degrading tobacco straw lignin, in S23, the light periodic culture conditions are 25 ℃, 3500lux illumination intensity and 16h light periodic culture.

Preferably, in the method for degrading tobacco straw lignin, in step 3, the volume concentration of the hydrogen peroxide solution is 5%, and the heating time is 1 h.

Compared with the prior art, the method for degrading the lignin in the tobacco straws has the following beneficial effects:

the Soybean Hull Peroxidase (SHP) is derived from Soybean seed coats, has the advantages of easy source, wide substrate action range, heat resistance, stability in a wide pH range and the like, and is an enzyme which is expected to replace manganese Peroxidase (Mnp) and lignin Peroxidase (Lip) and used for lignin degradation, phenolic wastewater treatment and the like. The invention skillfully utilizes the basic principle that a great amount of hydrogen peroxide is needed when peroxidase plays a role by taking lignin and the like as a substrate, utilizes a genetic engineering technology, takes a common tobacco plant expression vector as a basis, uses a GRP signal peptide sequence in a rice genome, fuses a coding sequence of an SHP gene from soybean with a coding sequence of a Green Fluorescent Protein (GFP) gene, constructs a directional fusion expression vector, promotes the peroxidase of soybean hulls to cross cell membranes and target cell walls, leads the endogenous SHP enzyme of crop straws to be over-expressed when the crops grow normally, and leads the endogenous SHP enzyme of the crop straws to be fully contacted with cell wall components such as straw lignin and the like along with the normal growth and development of the crops.

The method comprises the steps of constructing a plant expression vector of the bean hull peroxidase SHP gene, introducing the plant expression vector into tobacco NC89, and obtaining 21 positive plants of T0 generations through kanamycin resistance screening and PCR identification. Compared with the common plants, the peroxidase activity in the stalks of the transgenic plants in the mature period is obviously improved, but the change of the lignin content is small, the growth and development of the plants are basically normal, and the SHP is presumed to have small influence on the synthesis and accumulation of the lignin of the transgenic tobacco stalks. In addition, after the stalks in the mature period are harvested, the lignin content of the stalks of the transgenic plants can be reduced by 3-5 percent through treatment with 5 percent hydrogen peroxide, while the lignin content of the ordinary plants is not obviously reduced. Therefore, when hydrogen peroxide is present in a large amount, the overexpression of the endogenous SHP gene in tobacco contributes to the degradation of stalk lignin of plants. Therefore, after crop straws are harvested, if the straws are treated by hydrogen peroxide, lignin in the straws can be effectively degraded, the method solves the problems that in the prior art, lignin is lost in the crop growth process and the popularization and application of a biological treatment method in production are limited in the process of degrading the lignin by white rot fungi, and has a good application prospect in the degradation of the lignin in the crop straws.

Drawings

FIG. 1 is a schematic structural diagram of peroxidase gene expression vector pCAMBIA 3301-GRP-GFP-SHP;

FIG. 2 is an electrophoresis diagram of NcoI/BstEII enzyme digestion identification of pNMCS-GRP-GFP-SHP-NOS recombinant vector;

wherein, the lane M is DNA maker DL10000, and the lane 1 is the enzyme digestion product;

FIG. 3 is a fluorescence microscope observation of root cells of transgenic tobacco plants;

FIG. 4 shows the results of the measurement of the lignin content in plants;

FIG. 5 shows the results of the efficiency of lignin content degradation in plants;

FIG. 6 is a structural diagram of pNMCS plasmid.

Detailed Description

The following detailed description of specific embodiments of the invention is provided, but it should be understood that the scope of the invention is not limited to the specific embodiments. Test methods in which specific conditions are not specified in the following examples are generally carried out under conventional conditions or under conditions recommended by the respective manufacturers. In addition, various enzymes used in the present invention and the following examples are commercially available.

The invention utilizes genetic engineering technology, takes a commonly used tobacco plant expression vector as a base, uses a GRP signal peptide sequence in a rice genome to fuse a coding sequence of Soybean Hull Peroxidase (SHP) gene of Soybean source with a coding sequence of green fluorescent protein GFP gene, constructs a directional fusion expression vector to promote the Soybean hull peroxidase to cross cell membranes and target cell walls, so that the endogenous SHP enzyme of crop straws is over-expressed when crops grow normally and is in full contact with cell wall components such as straw lignin and the like along with the normal growth and development of the crops. The method specifically comprises the following steps:

s1, constructing an expression vector pCAMBIA3301-GRP-GFP-SHP of Soybean Hull Peroxidase gene (SHP).

S11, constructing pMD19-SHP recombinant vector

S111, designing primers SHP-F (AGCACCTTTCTTCAACCTCTCAGCAC) and SHP-R (CTCCTTCATCCCCAGTCAGCAC) according to a target gene sequence SHP mRNA (GenBank access number: NM-001251386), wherein the sequences of the SHP-F and the SHP-R are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2. An expression vector pCAMBIA3301-GRP-GFP-SHP of Soybean Hull Peroxidase gene (SHP) was constructed.

S112, extracting total RNA of soybean hulls, carrying out reverse transcription to obtain cDNA, and carrying out PCR amplification by using the cDNA as a template and SHP-F, SHP-R as a primer to obtain an SHP gene;

PCR amplification System: the total volume was 20. mu.L, including 2. mu.L of 10ng cDNA as template, 10. mu.L of 2 XEs Taq MasterMix, 2. mu.L of each 10mM primer and 4. mu.L ddH2O 4;

reaction procedure: pre-denaturation at 94 ℃ for 5 min; 94 ℃/30 s; 58 ℃/30 s; 72 ℃/40 s; 30 cycles; extension at 72 ℃ for 5 min.

S113, carrying out double enzyme digestion on a pMD19-T vector by using BstB I and BstE II, and collecting a long-sequence vector fragment BB; introducing BstB I enzyme cutting site at the 5 'end of the SHP gene, introducing BstE II site at the 3' end, connecting the obtained sequence into a vector fragment BB, and connecting the SHP gene to a pMD19-T vector to obtain a pMD19-SHP recombinant vector;

s12, constructing pMD19-GRP recombinant vector

S121, artificial synthesis of GRP signal peptide gene

The signal peptide GRP gene sequence is shown as SEQ ID NO.3 and is: a tggctactac taagcatttg gctcttgcca tccttgtcct ccttagcatt ggtatgacca ccagtgcaag aaccctccta (81bp), synthesized by Shanghai Bioengineering, Inc.

S122, carrying out double enzyme digestion on the pMD19-T vector by using NcoI and Spe I, and collecting a long-sequence vector fragment NS; introducing NcoI enzyme cutting site at the 5 'end of the GRP signal peptide gene, introducing Spe I site at the 3' end, connecting the obtained sequence into a vector fragment NS, and connecting the GRP signal peptide gene to a pMD-20T vector to obtain a pMD19-GRP recombinant vector;

s13, construction of PMD19-GFP recombinant vector

Carrying out double enzyme digestion on a PMD19-T vector by using restriction enzymes BamHI and SacI, and carrying out gel recovery on a large-fragment vector fragment BS;

using pBI221 plasmid as a template, using GFP-F (SEQ ID NO.4, GATCCCGCCACCATGGTGAGCAAG) and GFP-R (SEQ ID NO.5, AATTCCTTGTACAGCTCGTCCATG) as primers, amplifying GFP gene, introducing BamHI enzyme cutting sites at the 5 'end and SacI enzyme cutting sites at the 3' end of an amplification product, recovering a purified GFP fragment and connecting the GFP fragment with a vector fragment BS of PMD 19-T; transforming escherichia coli competent cells, and performing resistance screening, PCR (polymerase chain reaction) and plasmid enzyme digestion detection on the transformed single colony; the strains identified as positive were sent to the company for sequencing to verify the validity of their sequences, and the strain PMD19-GFP recombinant vector was cryopreserved.

S14, carrying out double digestion on the pBI221 plasmid containing the NOS reporter gene fragment by using endonucleases SacI and EcoRI to obtain an NOS fragment; carrying out double digestion on the pNMCS plasmid by using endonuclease SacI and EcoRI to obtain a pNMCS fragment, wherein the complete sequence of the pNMCS plasmid is shown as SEQ ID No.6, the structure of the pNMCS plasmid is shown as figure 6, and the sequence of the pNMCS fragment is shown as SEQ ID No. 7; connecting the NOS fragment to the pNMCS fragment to obtain a pNMCS-NOS recombinant vector;

s15, carrying out double enzyme digestion on the pMD19-GFP recombinant vector by using endonuclease EcoR V and BamH I, and recovering to obtain a GFP fragment; carrying out single enzyme digestion on the PMD19-GRP recombinant vector by EcoT22I to obtain a vector fragment E, and carrying out single enzyme digestion on the vector fragment E by BamH I to obtain a GRP fragment containing a GRP sequence; filling in the EcoT22I end of the GRP fragment, and then connecting the GFP fragment to the GRP fragment to obtain a PMD19-GRP-GFP recombinant vector;

s16, carrying out double enzyme digestion on the pMD19-SHP recombinant vector by endonuclease BstB I and BstE II to obtain an SHP fragment with the size of 1013 bp; carrying out double enzyme digestion on the pNMCS-NOS recombinant vector by endonucleases BstB I and BstE II to obtain a pNMCS-NOS fragment; connecting the SHP fragment to the pNMCS-NOS fragment to obtain a pNMCS-SHP-NOS recombinant vector;

s18, carrying out double enzyme digestion on the pNMCS-GRP-GFP-SHP-NOS recombinant vector by using endonuclease NcoI and BstEII, and recovering a GRP-GFP-SHP fragment with the size of 1799 bp; carrying out double enzyme digestion on the pCAMBIA3301 vector by endonuclease NcoI and BstEII, and recovering a long-sequence pCAMBIA3301 fragment; the GRP-GFP-SHP fragment is connected to the pCAMBIA3301 fragment to obtain a peroxidase gene expression vector pCAMBIA3301-GRP-GFP-SHP, and the clone which is proved to be positive by sequencing is collected for later use, and the structure of the clone is shown in figure 1 and is named as 3 GGS. NcoI/BstEII enzyme digestion identification is carried out on the obtained pNMCS-GRP-GFP-SHP-NOS recombinant vector to obtain a GRP-GFP-SHP fragment, the size of the target fragment is 1814bp through sequencing verification, and the result is shown in figure 2.

S2, cultivating mature transgenic tobacco plant

S21, introducing the pCAMBIA3301-GRP-GFP-SHP recombinant vector into Agrobacterium LBA4404 by a freeze-thaw method to obtain a transformed bacterium, and culturing the transformed bacterium to OD₆₀₀The number of the cells was 0.3, and a transformant solution was obtained.

Selecting colonies screened to be positive by kanamycin resistance from YEB plates, inoculating the colonies to YEB liquid culture medium containing 50mg/L kanamycin, and carrying out shake culture at 28 ℃ and 200r/min overnight (12-14 h); then inoculated in 20mL of YEB medium without antibiotics in an amount of 2% (w/v) and cultured with shaking to OD₆₀₀About 0.3, obtaining a transformed bacterium liquid for later use.

S22, cutting NC89 tobacco leaves into 0.5 multiplied by 0.5cm, soaking in the transformation bacterial liquid for 5min, sucking redundant transformation bacterial liquid by sterile filter paper, placing in a differentiation culture medium, wrapping a flat plate by tin foil paper, and carrying out dark culture at 28 ℃ for 3d to obtain co-culture leaves; the differentiation medium was prepared from the following components per liter: 1L of MS medium (MS minimal medium prepared according to the existing recipe), 200mg of 6-BA (6-benzylaminopurine), 200mg of IAA (indoleacetic acid).

S23, transferring the co-cultured leaves to a screening culture medium, culturing at 25 ℃, 3500lux illumination intensity and 16h photoperiod, transferring the seedlings to a rooting culture medium after the seedlings grow to 5-7cm, growing seedlings with developed root systems in 18-22d, hardening the seedlings, transferring the hardened seedlings to a test field for planting, carrying out normal fertilizer and water management and pest control, and carrying out bud picking without topping until mature transgenic tobacco plants are obtained.

Each liter of the screening culture medium is prepared from the following components: 1L of differentiation medium, 200mg of kanamycin; each liter of the rooting culture medium is prepared from the following components: 1L of 1/2MS medium (1/2 MS minimal medium prepared according to the existing recipe), 200mg kanamycin.

S3, degrading lignin in mature transgenic tobacco plants

Taking mature transgenic tobacco plant straws, grinding the straws into straw powder by using liquid nitrogen, putting the straw powder into hydrogen peroxide solution with the volume concentration of 3-5%, and heating for 1-1.5h at 45 ℃ to finish the degradation of lignin.

PCR identification of transgenic plants

1. Phenotypic trait survey results

The field character investigation is carried out on mature transgenic tobacco plants, and data analysis shows that the transgenic tobacco plants grow normally, the phenotype of the transgenic tobacco plants is not obviously different from that of NC89 tobacco plants in a control group, and the agronomic characters such as plant height, waist leaf length, leaf width, stem circumference, total leaf number, flowering phase and the like of the transgenic tobacco plants are almost the same as those of NC89 tobacco plants in the control group.

2. Fluorescence microscope observation of transgenic plant root tip cells

Under the excitation of blue light, the root cells of the transgenic tobacco plants detect obvious green fluorescence, and the expression system constructed by the transgenic tobacco plants can normally express the fusion protein GFP-SHP as shown in figure 3. Furthermore, fluorescence at the cell wall was particularly pronounced, indicating that GRP signal peptide has directed a large amount of GFP-SHP fusion protein to accumulate near the cell wall.

Secondly, measuring the activity of peroxidase in mature transgenic tobacco plants:

NC89 tobacco plants are used as a control group (the number is NC89), transgenic tobacco plants are used as an experimental group, 21 plants which are identified as positive by PCR are randomly selected from the experimental group, and the numbers are respectively K-1, K-2, K-3, K-4, K-5, K-6, K-7, K-8, K-9, K-10, K-11, K-12, K-13, K-14 and K-1415 to 15, K to 16, K to 17, K to 18, K to 19, K to 20 and K to 21, taking 1.0g of stems of the same part of the plants of the control group and the experimental group respectively, grinding the stems into powder by using a proper amount of liquid nitrogen, adding 20mmol/L KH₂PO₄30ml, and ground into a homogenate. Centrifuging at 4000r/min for 15min, and collecting supernatant. The residue was again washed with 20mmol/L KH₂PO₄Extracting once by 20mL, and combining two supernatants to obtain a crude enzyme extracting solution.

A large number of H₂O₂In the presence of peroxidase, guaiacol is oxidized to produce colored 4-o-methoxyphenol, and the amount of this chromogenic substrate produced is used to determine the enzyme activity. 50mL of 100mmol/L phosphate buffer (pH 6.0) was added with 28 μ L of guaiacol and 19 μ L of 30% hydrogen peroxide, and the mixture was mixed well to obtain a reaction mixture. Adding 3mL of reaction mixed solution and 1mL of crude enzyme extracting solution into a quartz cuvette, blowing, beating and uniformly mixing, measuring OD value under the wavelength of 470nm, reading once every 30s, and measuring A within every minute₄₇₀The change 0.01 is 1 peroxidase activity unit (U). Repeating for three times, and taking an average value to calculate the enzyme activity.

With A₄₇₀Plotting the reaction time on the ordinate and the reaction time on the abscissa, taking the initial linear part of the reaction, calculating A₄₇₀The nm/min was increased, and the results are shown in FIG. 4. As can be seen from FIG. 4, the peroxidase activity in the mature transgenic tobacco plants was increased compared with the control group, and the highest K-16 plant reached 8700U, which was 5300U higher than the control group.

Fourthly, measuring the lignin degradation efficiency:

after harvesting the crop stalks, the stalks were treated with 5% hydrogen peroxide and the lignin content was measured by the Klason method, which is a method for measuring the lignin content in the international classic manner, and the lignin content in the control NC89 (plants into which the expression vectors we constructed were not introduced) and the experimental groups (21 plants described above, corresponding to numbers K-1 to K-21) was shown in FIG. 5. As can be seen from fig. 5, the lignin content of both the control NC89 and the experimental group was reduced to some extent by the hydrogen oxide pretreatment, but the degree was different, wherein the lignin content of the control NC89 was not significantly reduced, which was about 0.3%; the lignin content of the transgenic plant is obviously reduced, and the maximum reduction amplitude is 5 percent.

The Soybean Hull Peroxidase (SHP) is derived from Soybean seed coats, has the advantages of easy source, wide substrate action range, heat resistance, stability in a wide pH range and the like, and is an enzyme which is expected to replace manganese Peroxidase (Mnp) and lignin Peroxidase (Lip) and used for lignin degradation, phenolic wastewater treatment and the like.

Characteristics of SHP: the SHP has wider substrate range, can oxidize biphenyltriol, p-toluidine, aniline, p-cresol, 2,4, 6-trimethylphenol, ferricyanide, NADH and the like, has the same property of general peroxidase as lignin peroxidase, and also has the capability of oxidizing various lignin models comprising veratryl alcohol, guaiacol, ferulic acid, caffeic acid, isoeugenol, syringaldehyde dinitrogen 2, 3-dimethoxyphenol, 2, 6-dimethoxyphenol, 3, 4-dimethoxyphenol, 3, 5-dimethoxyphenol, 1,2, 4-trimethoxybenzene and the like, and the SHP has extremely high catalytic capability, and the catalytic efficiency and the catalytic speed are higher than those of the HRP. The enzyme is suggested to have potential application value in the aspects of lignin degradation and phenolic substance treatment.

SHP can maintain high activity in a wide range of pH3-8, and can reach pH 2-11. The optimum pH for SHP is 5-6.

The existence of lignin hinders the cellulose hydrolysis by cellulase, influences the full hydrolysis of cellulose and reduces the utilization rate of energy plants. The industry needs to reduce the crystalline structure of lignin by adding additional pretreatment steps to achieve the goal of lignin removal. Therefore, the problem in the current research on lignocellulosic feedstocks is how to improve the resistance of the lignin in the feedstock to degradation, thereby reducing the cost of the bioethanol industry.

At present, genetic engineering improvement and control aiming at plant lignin mainly focus on a lignin synthesis way, and relevant enzymes in the lignin biosynthesis process are regulated and controlled by utilizing sense or antisense technology. However, as the synthetic pathway of the lignin monomer is more complex, multi-gene interaction and intersection of different metabolic pathways may exist, so that when relevant enzyme of the lignin synthetic pathway is subjected to molecular regulation, although the content or the composition of lignin is changed, the metabolism of other secondary substances is influenced, and finally, the plant cannot normally grow and develop.

The invention leads the bean hull peroxidase into the tobacco cell wall in a directional way, and reduces the content of lignin on the basis of not influencing the normal growth of plants. Different from the traditional extreme means that strong acid, strong base, steam explosion and the like are required to be added for industrial pretreatment, the SHP can degrade lignin under the environment-friendly condition, and the SHP degradation process can be started only by providing hydrogen peroxide from the outside. In the construction, the rice glycine-rich protein (GRP) peptide guide is used as a guide, the peptide guide can carry target protein to cross cell membranes to target cell walls, the problem that enzyme-producing molecules of microorganisms are too large and cannot penetrate through cell wall microporous structures to enter tissues is solved, the target protein can be in full contact with lignin, and the current situation that degradation only stays on the surface is changed. GFP is used as a reporter gene in construction, so that the target protein has a 'fluorescent label', and the positioning of the fusion protein in the cell can be conveniently known through fluorescent observation. Meanwhile, the invention takes plants as a bioreactor to produce the target enzyme, thereby omitting the purification and recovery steps in the process of producing the enzyme by microbial fermentation, reducing the cost and increasing the efficiency of the enzyme.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Zhengzhou university

<120> method for degrading lignin in tobacco straw

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence

<400> 1

agcacctttc ttcaacctca ctc 23

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

ctccttcatc cccagtcagc ac 22

<210> 3

<211> 81

<212> DNA

<213> Artificial sequence

<400> 3

atggctacta ctaagcattt ggctcttgcc atccttgtcc tccttagcat tggtatgacc 60

accagtgcaa gaaccctcct a 81

<210> 4

<211> 24

<212> DNA

<213> the sequence

<400> 4

gatcccgcca ccatggtgag caag 24

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

aattccttgt acagctcgtc catg 24

<210> 6

<211> 2858

<212> DNA

<213> Artificial sequence

<400> 6

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccccatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagttt gcacgcctgc cgttcgacga ttggcgcgcc aagcttgcgg 2280

ccgcgcatgc catggctgca gctcgaggtc gactctagaa gatctggatc tactagtcat 2340

atggatatcg gatccccggg taccggtgac cgagctctac gtagaattcc gtaactataa 2400

cggtcctaag gtagcgaatt aattaaaatc tctggaagat ccgcgcgtac cgagttctaa 2460

ttcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa 2520

tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg cccgcaccga 2580

tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg cgcctgatgc ggtattttct 2640

ccttacgcat ctgtgcggta tttcacaccg catatggtgc actctcagta caatctgctc 2700

tgatgccgca tagttaagcc agccccgaca cccgccaaca cccgctgacg cgccctgacg 2760

ggcttgtctg ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat 2820

gtgtcagagg ttttcaccgt catcaccgaa acgcgcga 2858

<210> 7

<211> 164

<212> DNA

<213> Artificial sequence

<400> 7

ggcgcgccaa gcttgcggcc gcgcatgcca tggctgcagc tcgaggtcga ctctagaaga 60

tctggatcta ctagtcatat ggatatcgga tccccgggta ccggtgaccg agctctacgt 120

agaattccgt aactataacg gtcctaaggt agcgaattaa ttaa 164

Claims

1. A method for degrading tobacco straw lignin is characterized by comprising the following steps:

wherein, the signal peptide GRP gene sequence is shown as SEQ ID NO. 3; the SHP gene is obtained by extracting total RNA of soybean hulls, performing reverse transcription to obtain cDNA, and then taking the cDNA as a template and SHP-F: AGCACCTTTCTTCAACCTCACTC, SHP-R: CTCCTTCATCCCCAGTCAGCAC is obtained by PCR amplification of primers; the GFP gene takes pBI221 plasmid as a template, and GF P-F: GAT C C C GC CAC CAT GGT GAGCAAG, GFP-R: AATTCCTTGTACAGCTCGTCCATG is obtained by PCR amplification of primers;

s2, cultivating mature transgenic tobacco plant

s3, degrading lignin in mature transgenic tobacco plants

2. The method for degrading tobacco straw lignin according to claim 1, wherein the soybean hull peroxidase gene expression vector pCAMBIA3301-GRP-GFP-SHP is constructed according to the following steps:

s11, constructing pMD19-SHP recombinant vector

s12, constructing pMD19-GRP recombinant vector

s13, construction of PMD19-GFP recombinant vector

s15, carrying out double enzyme digestion on the pMD19-GFP recombinant vector by using endonuclease EcoR V and BamH I, and recovering to obtain a GFP fragment; carrying out single enzyme digestion on the PMD19-GRP recombinant vector through EcoT22I to obtain a vector fragment E, and carrying out single enzyme digestion on the vector fragment E through BamH I to obtain a GRP fragment containing a GRP sequence; connecting the GFP fragment to the GRP fragment to obtain a PMD19-GRP-GFP recombinant vector;

3. The method for degrading tobacco straw lignin according to claim 1, wherein in S22, each liter of the differentiation medium is prepared by mixing the following components: 1L of MS culture medium, 200mg of 6-BA and 200mg of IAA;

5. The method for degrading tobacco straw lignin according to claim 3, wherein in S22, the tobacco leaves are soaked in the transforming bacterial solution for 5 min.

6. The method for degrading tobacco straw lignin according to claim 3, wherein the temperature of dark culture in S22 is 28 ℃ and the time is 3 d.

7. The method for degrading tobacco straw lignin according to claim 3, wherein in S23, the photoperiod culture conditions are 25 ℃, 3500lux illumination intensity and 16h photoperiod culture.

8. The method for degrading tobacco straw lignin according to claim 3, wherein in the step 3, the hydrogen peroxide solution has a volume concentration of 5% and the heating time is 1 h.