KR20210063127A - Microorganism for producing shikimic acid and method for producing shikimic acid using the microorganism - Google Patents

Abstract

The present specification discloses gene recombinant E. coli in which tyrR, ptsG, pykA, aroK, and aroL genes; tyrR, ptsG, pykA, aroK, aroL, and shiA genes; tyrR, ptsG, pykA, aroK, aroL, and ydiN genes; or tyrR, ptsG, pykA, aroK, aroL, shiA, and ydiN genes are inactivated and one or more of galP, ppsA, aroG, aroF, aroB, aroD, aroE, and tktA genes are overexpressed. Specifically, the gene recombinant E. coli according to one aspect of the present invention can exhibit high shikimic acid production ability by selectively removing or overexpressing specific genes involved in shikimic acid production.

Description

Microorganisms for producing shikimic acid and a method for producing shikimic acid using the same {MICROORGANISM FOR PRODUCING SHIKIMIC ACID AND METHOD FOR PRODUCING SHIKIMIC ACID USING THE MICROORGANISM}

Disclosed herein are microorganisms having a high shikimic acid-producing ability, and a method for producing shikimic acid using the same.

[Description of state-funded R&D]

This study was made with the support of the Rural Development Administration's research project (detailed project number: PJ01318702).

Tamiflu (ingredient: oseltamivir) owned by Roche® as the only treatment for the swine influenza A (H1N1) virus, which started in North America in 2009 and spread worldwide, is in demand worldwide. and the price of shikimic acid, its raw material, temporarily surged.

Oseltamivir, a component of Tamiflu, undergoes more than 10 chemical reactions based on shikimic acid to complete its structure. It was first discovered and is now known to be extracted from the star anise of Illicium verum in China. However, 1 kg of shikimic acid can be extracted from 30 kg of octagonal fruit, and the supply is not smooth due to limitations such as harvesting in spring after several years of growth, which is the biggest factor in price fluctuation and price increase. In addition, since a large amount of shikimic acid is used in the chemical synthesis process for Tamiflu, the required amount of shikimic acid is further increased, and there is a justification to find and develop an alternative sustainable source.

Recently, the production of shikimic acid using microbial fermentation has attracted attention. Most microorganisms, including Escherichia coli and Corynebacteria, have a shikimic acid biosynthesis pathway, and a pathway for synthesizing essential aromatic amino acids such as tryptophan and tyrosine from glucose through shikimic acid (see FIG. 1 ).

It was found that one of the reasons for the lack of supply of Tamiflu, the only treatment for the swine influenza A virus that was prevalent worldwide, was the supply and demand of shikimic acid, a raw material. Since shikimic acid, which has been extracted and supplied from plants (octagonal), is instability in yield depending on crop conditions and has a limitation that it takes a long time to harvest, research on microbial production has recently been in the spotlight.

Pharmaceuticals made through chemical synthesis emit pollutants and become the main culprit of environmental pollution. Oseltamivir antiviral agent is one of the most representative and marketable natural medicines synthesized from natural products through simple steps. For the production of antiviral agents against new viruses that have occurred through natural mutation, stable and smooth supply of raw materials (shikimic acid) produced in limited quantities from plant resources, and biomass-derived substances that are not chemically synthesized By producing shikimic acid, which is a raw material, from sugar using microorganisms, it is possible to produce substances that are raw materials for natural medicines using an environmentally friendly and stable method.

In addition, a study was published that tested the function of skin whitening effect using shikimic acid and its derivatives and showed the potential of shikimic acid as a cosmetic raw material that plays an excellent role in skin whitening effect, and (-)-, one of the substances synthesized from shikimic acid, Studies have shown that Zylenone has excellent anticancer effects on several cancer cell lines (acute lymphocytic leukemia, breast cancer, hepatocellular carcinoma, prostate cancer, and cervical cancer). Such shikimic acid not only serves as a raw material for Tamiflu, but also has the potential to be developed into a much broader and more diverse natural product drug.

International Patent Publication No. 2002-029078 International Patent Publication No. 2013-033652 International Patent Publication No. 2016-027870 Chinese Patent Publication No. 102304539 Chinese Patent Publication No. 104911137

In one aspect, the present invention provides an E. coli having a high shikimic acid production ability, in which shikimic acid can be effectively accumulated through selective removal and expression enhancement of specific genes on an aromatic amino acid biosynthetic pathway, and a method for producing shikimic acid using the same The purpose.

In order to achieve the above object, the present invention, in one aspect, tyrR, ptsG, pykA, aroK, and aroL genes; tyrR, ptsG, pykA, aroK, aroL, and shiA genes; tyrR, ptsG, pykA, aroK, aroL, and ydiN genes; Or tyrR, ptsG, pykA, aroK, aroL, shiA, and ydiN genes are inactivated, it provides a recombinant E. coli.

In one aspect, the recombinant E. coli according to the present invention can exhibit high shikimic acid production ability by selectively removing or overexpressing specific genes involved in shikimic acid production.

1 schematically shows a pathway through which aromatic amino acids are biosynthesized in E. coli via shikimic acid (SA).
Figure 2 shows the aromatic amino acid and shikimic acid biosynthesis pathway and regulatory pathway in E. coli.
3 shows the shikimic acid production ability according to the deletion of aroK and aroL genes.
Figure 4, shows a PoppA- aroE plasmid mapping a promoter (promoter), and part of the aroE gene oppA gene was cloned (cloning) in order to overexpress aroE.
Figure 5 shows the production of shikimic acid in E. coli (RGAKL-PoppA aroE_1, RGAKL-PoppA aroE_2 (reproducible)) in which the tyrR, ptsG, pykA, aroK and aroL genes are deleted and the aroE gene is overexpressed (SHK: shikimic acid) .
Figure 6 shows the production of shikimate in Escherichia coli by deletion of tyrR, ptsG, pykA, aroK, and aroL genes, overexpression of aroE gene, and overexpression of galP, ppsA aroG, aroF, aroB and aroD genes ( SHK1 is E. coli K12△aroK△aroL, SHK2 is E. coli AB2834 △tyrR △ptsG △pykA △aroK △aroL/PoppA-aroE, SHK3 is E. coli AB2834 △tyrR △ptsG △pykA △aroK △aroL △lacI E. coli having the gene combination of ::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD /PoppA-aroE).
7A shows E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroK in which tyrR, ptsG, pykA, aroK, and aroL genes are deleted and galP, ppsA, aroG, aroF, aroB, aroD, and aroE genes are overexpressed. Additional deletion of the shiA gene in aroLΔlacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE ( △ RGAKL_PAGFBD_aroE) ( △ RGAKL_PAGFBD_ △ shiA1_aroE, △ RGAKL_PAGFBD_ △ shiA) ) shows the production of shikimic acid (SHK).
7b shows E. coli in which the tyrR, ptsG, pykA, aroK, and aroL genes are deleted and the aroE gene is overexpressed ( E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroKΔaroL/PoppA-aroE ) (RGA_KL_aroE) versus galP, ppsA , illustrating aroG, aroF, aroB, aroD, and aroE gene overexpression (△ RGAKL_PAGFBD_aroE), and added defects (△ △ RGAKL_PAGFBD_ ydiN_aroE) Sikkim acid (SHK) produced according to the ydiN.
8 is PoppA- aroE produced by cloning the tktA gene, including the ribosome binding site (RBS) in the back of the HindIII site, aroE gene expressed under the oppA promoter (see Fig. 3) so as to over-expression by introducing tktK - tktA plasmid map is shown approximately.
9A shows E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroKΔaroL in which the tyrR, ptsG, pykA, aroK, and aroL genes are deleted and the galP, ppsA, aroG, aroF, aroB, aroD and aroE genes are overexpressed. △lacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD /PoppA-aroE ) ( △ RGAKL_PAGFBD_aroE_1-1, △ RGAKL_PAGFBD_aroE_2-1 (reproducibility)), in addition to this, the ydiN gene is deleted E. coli overexpressed with the tktA gene (E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroKΔaroLΔydiNΔlacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE-tktA ) ( △ RGAKL_PAGFBD_ △ ydiN_aroE_tkt_1-1, △ RGAKL_PAGFBD_ △ ydiN_aroE_tkt_1-3 (reproducibility)), and E. coli AB2834 △ tyrR △ ptsG △ L △ ydi △aroK △ L △ ydi △aroK △ shiAΔlacI::Plac-galP-ppsAP-lac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE-tktA ) ( △ RGAKL_PAGFBD_ △ ydiN_ △ shiA_aroE_tkt_1-1, △ RGAKL_PAGFBD_ △ ydiN_ △ shiA) ) shows the production of shikimic acid (SHK).
9B shows E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroK in which tyrR, ptsG, pykA, aroK, and aroL genes are deleted and galP, ppsA, aroG, aroF, aroB, aroD, and aroE genes are overexpressed. aroL △ lacI :: Plac-galP- ppsA-Plac-aroG-aroF-Plac-aroB-aroD / PoppA-aroE) (△ RGAKL_PAGFBD_aroE), shiA gene further herein, ydiN gene or ydiN gene is deficient and shiA The shikimic acid (SHK) production of E. coli overexpressed with the tktA gene ( △ RGAKL_PAGFBD_ △ shiA_tkt, △ RGAKL_PAGFBD_ △ ydiN_tkt, △ RGAKL_PAGFBD_ △ ydiN_ △ shiA_tkt) is shown.
10 shows E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroK in which the tyrR, ptsG, pykA, aroK, and aroL genes are deleted and the galP, ppsA, aroG, aroF, aroB, aroD, and aroE genes are overexpressed. aroLΔlacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE ) shows the shikimic acid productivity (bottom graph; total metabolite) in culture in a 5L incubator.
11 shows E. coli in which the tyrR, ptsG, pykA, aroK, aroL, and shiA genes are deleted and the galP, ppsA, aroG, aroF, aroB , aroD, aroE, and tktA genes are overexpressed ( E. coli AB2834 ΔtyrRΔptsG) Shikimic acid productivity (bottom graph; Total) of pykAΔaroKΔaroLΔshiAΔlacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE-tktA in 5L incubator culture metabolite) is shown.

Hereinafter, the present invention will be described in detail.

E. coli used in the present invention ( Eschericia coli; E. coli ) is a Gram-negative aerobic bacterium, has no toxicity, is very fast in growth, and has the advantage of being easily and inexpensively grown in laboratories and industrial sites. In the Republic of Korea Patent Publication Nos. 10-2015-0120236 and No. 10-2018-0088145, the present inventors describe 3 in E. coli for the synthesis of cis,cis-muconic acid and a precursor of muconic acid (DHS; 3-dehydroshikimate) It has been confirmed that DHS biosynthesis and cis,cis-muconic acid productivity, which are intermediates of the aromatic amino acid biosynthetic pathway, are increased by introducing a foreign gene and inactivating specific genes, the patent document is hereby incorporated by reference in its entirety. is integrated as

In order to prepare a microorganism capable of producing shikimic acid in a high yield in the aromatic amino acid biosynthetic pathway, the present inventors have developed the present invention to increase the productivity of shikimic acid through optimization of the aromatic amino acid biosynthetic pathway.

The biosynthesis pathway of shikimic acid in E. coli is as follows: DAHP (3-Deoxy) by the condensation reaction of PEP (phosphoenolpyruvate) and E4P (Erythrose 4-phosphate) generated through glycolysis from a carbon source -D-arabino-heptulosonate 7-phosphate), the final product, shikimic acid, is produced through the shikimic acid biosynthesis pathway.

It is known that shikimic acid is converted into shikimate 3-phosphate by shikimate kinase, and genes encoding shikimate kinase are aroK and aroL. Therefore, in order to preferentially construct a high-productivity strain of shikimic acid, as shown in FIG. 2, the pathway was adjusted to block the degradation process so that shikimic acid, an intermediate product on the aromatic amino acid biosynthesis pathway, could be accumulated, and from shikimic acid to shikimic acid By deleting the aroK and aroL genes, which are genes encoding shikimate kinase that converts to 3-phosphate, shikimate can be accumulated in the culture medium. In this case, in one embodiment, the polynucleotide encoding aroK and aroL may include the nucleotide sequences shown in SEQ ID NOs: 1 and 2, respectively.

Accordingly, the present invention, in one aspect, tyrR, ptsG, pykA, aroK, and aroL genes; tyrR, ptsG, pykA, aroK, aroL, and shiA genes; tyrR, ptsG, pykA, aroK, aroL, and ydiN genes; or tyrR, ptsG, pykA, aroK, aroL, shiA, and ydiN genes are inactivated, to a recombinant E. coli.

E. coli used in the present invention may be E. coli AB2834 (purchasing agency: E. coli Genetic Stock Center, accession number: AB2834), and in the present invention by inactivating or overexpressing specific genes for the E. coli AB2834. Recombinant E. coli with increased shikimic acid production ability can be produced.

That is, in one embodiment, the source strain that is the starting material of the recombinant E. coli may be the E. coli AB2834.

As used herein, the term "inactivation" includes all or part of a specific gene deletion (deletion), addition of another sequence in a specific gene, or substitution of a specific gene with another gene. In one embodiment, the inactivation of the gene may be a deletion (deletion) of the gene in the E. coli.

In one embodiment, the method for deletion of the gene from E. coli specifically comprises a plasmid preparation step for the deletion, a transformation step, a single recombination induction step and a double recombination induction step. have.

Specifically, in the step of preparing the plasmid for the deletion, the up region and the down region of the gene to be deleted are cloned into an Escherichia coli suicide vector, and pure DNA dissolved in distilled water is prepared. may include the step of The transformation step may include inserting the deletion plasmid into the strain using electroporation to introduce the prepared deletion plasmid, ie, the deletion plasmid, into a desired strain. In the single recombination induction step, the temperature was raised to 30-45° C. to induce a single recombination in the transformant into which the defective plasmid was inserted, and then cultured in LB medium (broth) supplemented with chloramphenicol, followed by chloramphenicol. It may include the step of removing a single non-recombinant strain in the chromosome by plating on an LB plate and culturing at 30-45°C. The double recombination induction step induces double recombination, i.e., gene deletion, by culturing the single recombined strain in LB medium to which antibiotics are not added at a temperature of 30-45° C. It may include the step of removing the plasmid by plating on the entered LB plate and selecting a strain in which the gene is deleted.

As another embodiment, the deletion of the gene from E. coli may be performed using a CRISPR/cas system. The CRISPR/cas system is a gene editing system based on gene scissors. It consists of RNA (gRNA) that specifically binds to a specific nucleotide sequence and Cas9 nuclease, which cuts a specific nucleotide sequence. Knock-out that can completely inhibit the function of a specific gene by introducing plasmid DNA into a cell or animal because it has the ability to cut out specific gene sequences more precisely and selectively by improving the existing restriction enzymes This is possible. Using this CRISPR/cas system, a specific gene can be deleted in E. coli, and a tool for operating the CRISPR/cas system can be performed by receiving the plasmid of Sheng Yang group registered in addgene (addgene.org) and (Yu Jiang et al ., 2015, Multigene editing in the E. coli genome via the CRISPR-cas9 system, Appl. Environ. Microbiol., 81(7): 2506-2514), plasmid for sgRNA and homologous arm (pTarget) and After inserting each plasmid (pCas) for cas protein expression and inducing recombination in the cell so that editing can occur, antibiotic-resistant strains are selected, and a clone whose recombination has been completed through PCR is found. Specifically, after removing the pTarget plasmid by using IPTG, all the pCas plasmids are lost through incubation at 37° C., thereby obtaining a transformant with a deletion in the gene.

In one embodiment, the tyrR gene regulates an aroG gene encoding a DHAP synthase (2-dehydro-3-deooxy-phosphoheptonate-aldolase) in an amino acid biosynthetic pathway. The final product produced via the aromatic amino acid biosynthetic pathway of E. coli tyrosine (tyrosine) is a protein that inhibits transcription of the aroG and aroF genes, and there is controlled the biosynthetic pathway by inhibiting the function of the protein, TyrR that the tyrR gene encoding It is as for the ability to inhibit expression of the gene, whereby the function of the aroG and aroF gene is controlled by. Therefore, to inactivate the tyrR gene, aroG and aroF gene may continue to keep the biosynthesis because it will be expressed, Sikkim acid (shikimic acid). In one embodiment, the polynucleotide encoding the tyrR may include the nucleotide sequence represented by SEQ ID NO: 3.

In one embodiment, the ptsG gene is involved in moving glucose existing outside the cell into the cell. glucose phosphotransferase IIBC (Glc) encoded by this gene; Glucose permease converts PEP into pyruvate while moving glucose existing outside the cell into the cell. Inactivation of the ptsG gene prevents consumption of PEP, a precursor of shikimic acid. In one embodiment, the ptsG- encoding polynucleotide may include the nucleotide sequence represented by SEQ ID NO: 4.

The pykA gene according to one embodiment is concerned to convert the PEP to pyruvate Like the ptsG gene. The pykA gene is The coding pyruvate kinase± converts PEP to pyruvate, and the carbon source enters the trichloroacetic acid (TCA) cycle to generate energy. Therefore, when the gene is inactivated, it is advantageous in that PEP is not consumed. In one embodiment, the polynucleotide encoding the pykA may include a nucleotide sequence represented by SEQ ID NO: 5.

In one embodiment, the shiA and ydiN genes are known to function as a transporter so that shikimic acid produced in E. coli can pass through a cell membrane. By deleting each of these genes, it is possible to prevent shikimic acid produced and discharged from the cell from being brought back into the cell. In one embodiment, the polynucleotides encoding shiA and ydiN may include the nucleotide sequences represented by SEQ ID NOs: 6 and 7, respectively.

In one embodiment, the E. coli, galactose permease (galactose permease), PEP synthetase converting oxaloacetate to PEP, DAHP synthase A converting E4P to DAHP, converting PEP to DAHP DAHP synthetase B, DHQ synthetase that converts DAHP to DHQ, and DHQ dehydratase are overexpressed, and the lacI gene encoding a lactose degradation inhibitory protein (lac repressor) may be deleted.

In one embodiment, the E. coli is introduced from foreign, galP gene coding for the galactose transmission enzyme, ppsA gene encoding the PEP synthase, aroG gene coding for the DAHP synthase A, the DAHP synthase aroF gene encoding a B, aroB gene encoding the DHQ synthase, and may include the aroD gene encoding the DHQ dehydratase.

That is, in Escherichia coli, at least one gene among galP, ppsA, aroG, aroF, aroB and aroD genes is introduced from a foreign source, so that the enzymes involved in the synthesis of DHS, a precursor of shikimic acid, are overexpressed and finally biosynthesis of shikimic acid can be increased.

In one embodiment, the gene introduction method for enzyme overexpression in E. coli specifically includes a plasmid preparation step for overexpression, a transformation step, a single recombination induction step, and a double recombination induction step. can do.

Specifically, the upper portion of the plasmid the production stage for the over-expression is set to the upper (upstream) and bottom (downstream) zone of the lacI gene to be removed with a traditional lac promoter on the right next to the lacI gene, and then, the lacI gene ( upstream) and bottom (downstream) to leave a Xba I restriction enzyme site between the upper (upstream) fragment and a lower (downstream) was cloned (cloning) in the fragment of E. coli suicide vector (suicide vector) lacI gene defect of the lacI gene After constructing the vector, it may include a step of further cloning the gene encoding the enzyme to be overexpressed and the lac promoter between the upstream fragment and the downstream fragment. The transformation step may include inserting the overexpression integration vector into the strain using electroporation to introduce the prepared plasmid for overexpression, ie, the overexpression integration vector, into a desired strain. In the single recombination induction step, the temperature was raised to 30-45° C. to induce single recombination in the transformant into which the overexpression integrative vector was inserted, and then cultured in LB medium (broth) supplemented with chloramphenicol, followed by addition of chloramphenicol. It may include the step of removing a single non-recombinant strain in the chromosome by plating on the old LB plate and culturing at 30-45°C. The double recombination induction step induces the introduction of a gene for double recombination, that is, overexpression of an enzyme, by culturing the single recombined strain in LB medium without antibiotics added at a temperature of 30-45° C. It may include the step of selecting a strain in which the plasmid is removed and a gene for enzyme overexpression is introduced by plating on an LB plate containing 10% sucrose.

In one embodiment of the present invention, the lacI gene is a gene encoding a lactose degradation suppressor protein (lac repressor) that binds to the lac operator of the lac operon, and serves to suppress transcription of the lac promoter. Therefore, in order to overexpress the enzymes encoded by each gene using the lac promoter, it is necessary to remove the lacI gene, a gene that inhibits transcription. As an embodiment, the polynucleotide encoding lacI may include the nucleotide sequence represented by SEQ ID NO: 8.

In one embodiment of the present invention, the galactose permease (galactose permease) is encoded in the galP gene, and serves to transfer extracellular glucose into the cell. Therefore, by overexpressing galactose permease, biosynthesis of DHS, a precursor of shikimic acid, can be increased through smooth glucose supply. As an embodiment, the polynucleotide encoding galP may include the nucleotide sequence shown in SEQ ID NO: 9.

In one embodiment of the present invention, the conversion of oxaloacetate in the TCA cycle to phosphoenolpyruvate (PEP), which is a precursor of DHS, PEP synthetase (phosphoenolpyruvate synthetase) is encoded in the ppsA gene, and by overexpressing this PEP synthetase, biosynthesis of DHS, a precursor of shikimic acid, can be increased. As an embodiment, the polynucleotide encoding ppsA may include the nucleotide sequence represented by SEQ ID NO: 10.

In one embodiment of the present invention, the DHQ synthase (3-dehydroquinate synthase) and DHQ dehydratase (3-dehydroquinate dehydratase) are encoded in the aroB and aroD genes, respectively, and are directly involved in the production of DHS, a precursor of shikimic acid. As an enzyme involved, it is an enzyme that synthesizes DHS through DHAP (3-deoxy-D-arabino-heptulosonic acid 7-phosphate) and DHQ (3-Dehydroquinic acid). By overexpressing the DHQ synthetase and DHQ dehydratase, the biosynthesis of DHS, a precursor of shikimic acid, can be increased by enhancing the DHS synthesis pathway. As an embodiment, the polynucleotides encoding aroB and aroD may include nucleotide sequences represented by SEQ ID NOs: 11 and 12, respectively.

In one embodiment of the present invention, the DAHP synthase A and DAHP synthase B are coded in respectively aroG and aroF gene, DAHP synthase A and DAHP synthase B, PEP and each E4P (erythorse 4-phosphate) As an enzyme that synthesizes DAHP (3-deoxy-D-arabino-heptulosonic acid 7-phosphate) from (phosphoenolpyruvate), it plays a role in sending DHS precursors PEP and E4P to the aromatic amino acid biosynthesis pathway. Therefore, by overexpressing the DAHP synthetase A and B, the biosynthesis of DHS, a precursor of shikimic acid, can be increased. In one embodiment the polynucleotide encoding the aroG and aroF may comprise the nucleotide sequence shown in SEQ ID NO: 13 and 14, respectively.

In one embodiment of the present invention, the E. coli, aroE ; or aroE and tktA ; it contains a polynucleotide encoding each, and each upstream of the polynucleotide includes a ribosome binding site (rbs) derived from E. coli, and a polynucleotide encoding the aroE or tktA Among the nucleotides, it may be further transformed with a recombinant vector including a promoter of the oppA gene upstream of the ribosome binding site of the first transcribed polynucleotide.

In one embodiment, the oppA gene is a gene showing a particularly high expression rate in E. coli, and by using the promoter of the oppA gene, it is possible to effectively increase the expression levels of target genes aroE and tktA.

In one embodiment, E. coli K12 (Genetic Resources at YaleCGSC, The Coli Genetic Stock Center) in the NdeI site of the vector from which the lac promoter, lac operator and cap binding site are removed. cloning the aroE gene of origin, and comprising the E. coli ribosome binding site (rbs) of the origin inserted in the upstream direction of the aroE gene, producing a PoppA-aroE plasmid upstream of the ribosome binding site cloned into the promoter of the oppA gene can do. In one embodiment, the polynucleotide encoding the oppA may include the nucleotide sequence represented by SEQ ID NO: 15.

In another embodiment, in the PoppA-aroE plasmid, a Poppa-aroE-tktA plasmid can be prepared by PCR and cloning the tktA gene including a ribosome binding site (rbs) in the HindIII site behind the aroE gene.

In one embodiment, the aroE gene is a gene encoding a DHS dehydrogenase that converts DHS to shikimic acid. By overexpressing the gene, the conversion from DHS to shikimic acid can be increased to further increase the shikimic acid production capacity. have. In one embodiment, the polynucleotide encoding the aroE may include the nucleotide sequence represented by SEQ ID NO: 16.

In one embodiment, the tktA gene is involved in the synthesis of E4P, a major precursor of shikimic acid biosynthesis. Therefore, by overexpressing the tktA gene, the synthesis of the precursor E4P can be increased, and finally, the ability to produce shikimic acid can be further increased. In one embodiment, the polynucleotide encoding tktA may include the nucleotide sequence represented by SEQ ID NO: 17.

In one aspect, the recombinant E. coli may be for production of shikimic acid.

In another aspect, the present invention may relate to a method for producing shikimic acid, comprising culturing the recombinant E. coli.

The shikimic acid production method, specifically, the primary growth and culture step of the E. coli producing strain comprising inoculating a single colony of E. coli in LB medium and culturing for one day; A secondary growth culture step comprising inoculating the LB medium with the primary growth culture medium and culturing with shaking for 4-8 hours; and inoculating and culturing the secondary growth medium in a production medium to produce shikimic acid. More specifically, inoculate a single colony of E. coli in 1.3 ml of LB medium (tryptone 10 g/L, Yeast extract 5 g/L, NaCl 5 g/), and overnight at 37° C., 220 rpm on a rotary shaker. The primary growth and culture step of the E. coli producing strain comprising culturing; A secondary growth culture step comprising adding 1.3 ml of LB medium to a 24-well cell culture plate, inoculating 1% of the primary growth culture medium, and culturing with shaking at 220 rpm and 30° C. for 6 hours; and adding 1.3 ml of the production medium to a 24-well cell culture plate, inoculating 1% of the secondary growth medium, and culturing with shaking at 220 rpm and 30° C. to produce shikimic acid.

Hereinafter, the content of the present invention will be described in more detail through preparation examples and test examples. However, these Examples and Test Examples are only presented to understand the content of the present invention, and the scope of the present invention is not limited to these Examples and Test Examples, and modifications and substitutions commonly known in the art and insertion may be performed, and this is also included in the scope of the present invention.

[Production Example]

Recombinant E. coli according to an embodiment of the present invention was prepared according to the following method.

Medium and culture conditions

For cell proliferation, inoculation preparation and deletion plasmid preparation, all E. coli strains were grown at 37°C in LB (Luria-Bertani) medium or agar plate. The LB medium contains 10 g of tryptone in 1L, 5 g of NaCl, and 5 g of yeast extract. The plasmid was removed from the LB medium further containing various concentrations of appropriate antibiotics or sucrose, specifically 100 μg/ml ampicillin, 25 μg/ml chloramphenicol and 10% sucrose. Colonies were selected.

-D-1-thiogalactopyranoside)를 포함시켰으며, 구체적으로는 25 μg/ml의 카나마이신 (kanamycin), 50 μg/ml의 스펙티노마이신 (spectinomycin), 10 mM의 아라비노오즈, 0.5 mM의 IPTG를 첨가하였다. 아라비노오즈를 포함하는 LB 배지에서 유전자 재조합을 유도하였고, 재조합이 완료되어 유전자가 결손된 대장균주는 플라스미드를 제거하기 위하여 IPTG를 첨가하고 LB 배지에서 하루 동안 배양하였다.As the medium and culture conditions for the production of the gene-defective E. coli strain using the CRISPR system, appropriate antibiotics or arabinose (L-arabinose), IPTG (Isopropyl) at various concentrations in LB medium

-D-1-thiogalactopyranoside), specifically 25 μg/ml of kanamycin, 50 μg/ml of spectinomycin, 10 mM of arabinose, and 0.5 mM of IPTG were added did. Gene recombination was induced in LB medium containing arabinose, and when the recombination was completed, the E. coli strain in which the gene was deleted was added with IPTG to remove the plasmid and cultured in LB medium for one day.

Bacterial strains and plasmids

E. coli AB2834 strain was obtained from the E. coli gene stock. E. coli DH5α (purchased from: TaKaRa) was used as a host in the preparation of the recombinant plasmid. E. coli K12 was purchased from (Genetic Resources at YaleCGSC, The Coli Genetic Stock Center). Plasmid pUC19 (purchased from Addgene) was used as an intermediate vector for gene deletion. Plasmid pKOV (purchased from Addgene) was used as a deletion vector by the use of restriction enzymes (upstrip fragment: BamHI & XbaI , downstream fragment: XbaI & SalI). The prepared plasmid was confirmed by sequencing and restriction enzyme analysis. All strains and plasmids used or prepared in this experiment are listed in Tables 1 and 2 below. In Table 2 below, the term "UP &DOWN" refers to an up region (up steam, left region, forward region), which is an upstream gene fragment of a gene that is deleted during the preparation of a plasmid for deletion of target genes, and down, a fragment below the gene. It means region (down steam, right region).

In this experiment, standard protocols were used for polymerase chain reactions (PCR) amplification, DNA purification, plasmid extraction, enzyme restriction and ligation reactions. The primers used in this experiment are listed in Table 3 below.

microbe( E. coli ) Related characteristics E. coli DH5α lacZ ￠ M15 hsdR recA E. coli AB2834 - E. coli K12 - E. coli K12 △K E. coli K12 △aroK E. coli K12 △L E. coli K12 △aroL E. coli K12 △KL E. coli K12 △aroK △aroL △RGA AB2834 △tyrR △ptsG △pykA △RGAKL AB2834 △tyrR △ptsG △pykA △aroK △aroL △RGAKL/PoppA-aroE AB2834 △tyrR △ptsG △pykA △aroK △aroL / PoppA-aroE △RGAKL △lacI::BDGFPA/Poppa-aroE AB2834 △tyrR △ptsG △pykA △aroK △aroL △lacI :: Plac-aroG-aroF-Plac_aroB-aroD-Plac-galP-ppsA / PoppA-aroE △RGAKL△shiA△lacI::BDGFPA/Poppa-aroE AB2834 △tyrR △ptsG △pykA △aroK △aroL △shiA △lacI :: Plac-aroG-aroF-Plac_aroB-aroD-Plac-galP-ppsA / PoppA-aroE △RGAKL △ydiN △lacI::BDGFPA/Poppa-aroE AB2834 △tyrR △ptsG △pykA △aroK △aroL △ydiN △lacI :: Plac-aroG-aroF-Plac_aroB-aroD-Plac-galP-ppsA / PoppA-aroE △RGAKL △shiA △ydiN △lacI::BDGFPA/Poppa-aroE AB2834 △tyrR △ptsG △pykA △aroK △aroL △shiA △ydiN △lacI :: Plac-aroG-aroF-Plac_aroB-aroD-Plac-galP-ppsA / PoppA-aroE △RGAKL △lacI::BDGFPA/Poppa-aroE-tktA AB2834 △tyrR △ptsG △pykA △aroK △aroL △lacI :: Plac-aroG-aroF-Plac_aroB-aroD-Plac-galP-ppsA / PoppA-aroE-tktA △RGAKL △shiA △lacI::BDGFPA/Poppa-aroE-tktA AB2834 △tyrR △ptsG △pykA △aroK △aroL △shiA△lacI :: Plac-aroG-aroF-Plac_aroB-aroD-Plac-galP-ppsA / PoppA-aroE-tktA ΔRGAKLΔydiNΔlacI::BDGFPA/Poppa-aroE-tktA AB2834 △tyrR △ptsG △pykA △aroK △aroL △ydiN △lacI :: Plac-aroG-aroF-Plac_aroB-aroD-Plac-galP-ppsA / PoppA-aroE-tktA △RGAKL △shiA △ydiN △lacI::BDGFPA/Poppa-aroE-tktA AB2834 △tyrR △ptsG △pykA △aroK △aroL △shiA △ydiN △lacI :: Plac-aroG-aroF-Plac_aroB-aroD-Plac-galP-ppsA / PoppA-aroE-tktA

Plasmi (vector) Related characteristics pUC19 Amp ^R , lacZ α, f1 ori, lac promoter (multiple cloning site) pKOV Cm ^R , sacB , Rep101, f1 ori pKOV- △ lacI pKOV containing lacI UP & DOWN pKOV- △ lacI :: Plac-aroGFBD, galP, ppsA lac promoter, galP, ppsA, aroG, aroF , aroB and aroD containing pKOV- △ lacI pMESK Contains Amp ^R , lacZ α, f1 ori, lac promoter (multiple cloning site), RBS PopA Insert the oppA gene promoter pMESK PoppA-aroE PoppA with aroE PoppA-aroE-tktA aroE and tktA containing PoppA

primer Sequence number Sequence (5'→3') Target lacI _UP_F 19 ATTCGGATCCTGCTCATCCATGACCTGACC AB2834 lacI _UP_R 20 GAACTCTAGATAATGCAGCTGGCACGACAG AB2834 lacI _DOWN_F 21 ATGGTCTAGAGAATGTAATTCAGCTCCGCC AB2834 lacI _DOWN_R 22 ATGCGTCGACTTGTGCGCTCAGTATAGGAAG AB2834 aroK_ UP_F 23 TTTCGCACCTGGGATCCAATACGCCTGCGCGGACATTT AB2834 aroK_ UP_R 24 CGACTCTAGAGGATCCGTTGGCCAATGAACGCAATCC AB2834 aroK_ DOWN_F 25 TCCTCTAGAGTCGACTTGAGTTGTTGAGCTAACTGG AB2834 aroK_ DOWN_R 26 CCATTCTCCGGTCGATCTGCTGGCCTCACATCTTC AB2834 aroL_ UP_F 27 TTCGCACCTGGGATCGACGCGTGTCCCAATGTAAT AB2834 aroL_ UP_R 28 CACCTGGCTGGGTTCACGGTTAAGCGAATCGGCAA AB2834 aroL_ DOWN_F 29 GAACCCAGCCAGGTGATTTC AB2834 aroL_ DOWN_R 30 CGACTCTAGAGGATCTGAAGCACCACTGCTGACAC AB2834 sgRNA-shiA-F 31 GTCCTAGGTATAATACTAGTATTCAGGGATTTGCAGTCGGGTTTTAGAGCTAGAAATAGC AB2834 sgRNA-HindIII-R 32 TAATAGATCTAAGCTTCTGCAGGTCGACTCT AB2834 shiA_ UP_F 33 GACCTGCAGAAGCTAATATGGATGACAACAAAGT AB2834 shiA_ UP_R 34 GTCGACGACGGCACCAGCGAAGCTGC AB2834 shiA_ DOWN_F 35 GGTGCCGTCGTCGACAAAGACAGTCAACGCGCTT AB2834 shiA_ DOWN_R 36 AATAGATCTAAGCTTCCAGTTCTGTTGTCGGGAAG AB2834 sgRNA-ydiN-F 37 GTCCTAGGTATAATACTAGTGTGGATGCCCAAATATGCGAGTTTTAGAGCTAGAAATAGC AB2834 ydiN_ UP_F 38 TTCTCTAGAGTCGACGCAATATTCTTTTCAGGTCA AB2834 ydiN_ UP_R 39 CGCACACTGCCAGACCGTAGGCGAGA AB2834 ydiN_ DOWN_F 40 GTCTGGCAGTGTGCGTTTGTTATTCCACTGATTAC AB2834 ydiN_ DOWN_R 41 CTTCTGCAGGTCGACGCCATCATCATTAACGATGG AB2834 ptsG _UP_F 42 TTACATATGCGGGATCCGGTAGGCGAACGT AB2834 ptsG _UP_R 43 CATGGTTTTAACCATCTAGACATAGGCAACAACTCGAGCCAGCGCGGATA AB2834 ptsG _DOWN_F 44 TCCACGCGATTCTAGAAGGCCTGGCATTCCCAAGCTTTATTCTTCTGGGG AB2834 ptsG _DOWN_R 45 GTCGACCTACGCCAGCTATA AB2834 tyrR _UP_F 46 CAGGTGATGGATGTCGACAAACCACTACCG AB2834 tyrR _UP_R 47 TCGACAGAGAGCAAAGCTTCAGGCAACGCC AB2834 tyrR _DOWN_F 48 ACTGACACAACTCGAGGGTTCTGAGCTGCG AB2834 tyrR _DOWN_R 49 GCATCGCAACGCCTGGATCCGCCAATAGCT AB2834 pykA _UP_F 50 CGTTTCTAGACACCGTCTCGAGGTTCAGTTCGAC AB2834 pykA _UP_R 51 CCGCCAAGGATCCGTGATCCCATTCT AB2834 pykA _DOWN_F 52 CAACCGCGCCGTCGACTTGCTC AB2834 pykA _DOWN_R 53 CAAACGGCTTCTAGACGTTCAAGCTTGGCAACAA AB2834 aroE _OVER_F 54 GGAGATATACATATGGAAACCTATGCTGTTTT AB2834 aroE _OVER_R 55 TCGGGGCAAGCTTAATCACGCGGACAATTCCTCC AB2834 tktA _OVER_F 56 GTCCGCGTGAAGCTTAAGGGCGTGCCCTTCATCAT AB2834 tktA _OVER_R 57 TGTCGGGGCAAGCTTTAATTACAGCAGTTCTTTTG AB2834 aroG _OVER_F 58 AGGAGATATACTCGAATGAATTATCAGAACGACGA AB2834 aroG _OVER_R 59 GAATTCGATTCTCGATTACCCGCGACGCGCTTTTA AB2834 aroF _OVER_F 60 CTCCCGGCCGCCATGATAAACCTCTTAAGCCACGC AB2834 aroF _OVER_R 61 CCCGCGGCCGCCATGTACGTCATCCTCGCTGAGGA AB2834 aroB _OVER_F 62 GAGGGAGTCCAAAAAACAATGGAGAGGATTGTCGTTACTCTCG AB2834 aroB _OVER_R 63 TTTACAGTTACGGTTTTCATTACGCTGATTGACAATCGG AB2834 aroD _OVER_F 64 TTGTCAATCAGCGTAATGAAAACCGTAACTGTAAAAGA AB2834 aroD _OVER_R 65 GGCGGGTGTCGGGGCAAGCTTTTATGCCTGGTGTAAAATAGTT AB2834 galP _OVER_F 66 AGGAGATATACTCGAATGCCTGACGCTAAAAAACA AB2834 galP _OVER_R 67 GAATTCGATTCTCGAGGAGATTAATCGTGAGCGCC AB2834 ppsA _OVER_F 68 CTCCCGGCCGCCATGCACATAACCCCGGCGACTAA AB2834 ppsA _OVER_R 69 CCCGCGGCCGCCATGCACAAAAGGATTGTTCGATG AB2834

genetic recombination

Gene removal and gene introduction for enzyme overexpression were used in the homologous recombination system. First, the deletion vector and the overexpression vector were inserted into the recipient strain by electroporation (deletion of tyrR, ptsG, pykA gene) or CRISPR/Cas system ( deletion of aroK, aroL, shiA, ydiN gene), and a single recombination was performed for PCR amplification. was confirmed by Double recombinant strains were selected on LB plates containing 25 mg/L of chloramphenicol and 10% sucrose, and confirmed by PCR amplification. All prepared plasmids were confirmed by sequencing and restriction enzyme analysis.

Flask culture conditions

Mutant strains were isolated from the stock and inoculated into LB solid medium containing appropriate antibiotics by streaking, and incubated at 37° C. for 16 hours or more. The primary growth culture (1 ^st seed culture) was performed by inoculating a single colony using 1.3ml of LB medium in a 24-well plate and culturing at 220rpm, 30℃ for 15 hours. The secondary growth culture (2 ^nd seed culture) was done by inoculating 13 μl of the primary growth culture solution using 1.3 ml of LB medium in a 24-well plate and culturing at 220 rpm, 30° C. for 6 hours. After that, the main culture was inoculated with 1.3 μl of the secondary growth medium using 1.3 ml of E. coli production media (EPM) medium, which is an E. coli production medium, in a 24-well plate, and inoculated at 220 rpm, 30° C. for 96 hours. This was done by culturing.

Preparation of gene overexpression E. coli

A method for overexpressing an enzyme encoded by a target gene by inserting an overexpression vector into the recipient strain in the above experiment is as follows.

galP, ppsA, aroG, aroF, aroB And aroD gene overexpression

- over-expression vector (plasmid) Preparation step: in order to remove the lacI gene of lacI gene cloned region up and down region in E. coli, a suicide vector, pKOV vector by building the lacI pKOV- βlacI gene-deficient vector, and this time, lacI gene position Xba I restriction enzyme sites between the up and down regions were left in order to insert the gene encoding the enzyme to be overexpressed in addition. Then, the gene encoding the enzyme to be overexpressed ( galP, ppsA, aroG, aroF, aroB, and aroD ) and the lac promoter were cloned into the pKOV- βlacI to construct an overexpression integration vector (see FIG. 2 ). ).

-Transformation step: To introduce the prepared overexpression vector into the desired strain, take a strain between 0.8 and 1 at an _{OD 600 and remove the medium using 10% glycerol.} Electroporation is performed by mixing 2 μl of the prepared overexpression vector DNA with 50 μl of cells suspended in 10% glycerol and using a BioRad Micro Pulsar machine and a cuvette with a spacing of 2 mm. After 1 ml of LB medium was added to the cells, the cells were cultured at 30° C. for one hour, spread on an LB plate to which chloramphenicol was added, and then cultured at 30° C., and then transformants were selected.

-Single recombination induction step: In order to induce single recombination in the transformant, the temperature was raised to 37°C, cultured in LB medium supplemented with chloramphenicol, plated on an LB plate supplemented with chloramphenicol, and then plated at 37°C Remove the single non-recombinant strains grown in the chromosome.

-Double recombination induction step: A single recombined strain is cultured at 37°C in LB medium without antibiotics to induce double recombination, that is, the introduction of genes. The cultured strains are spread on an LB plate containing 10% sucrose, the plate is removed, and strains overexpressing the coding enzyme of the introduced gene are selected.

Preparation of gene-defective E. coli

The method of inserting the deletion vector into the recipient strain in the above experiment to delete the target gene is as follows.

tyrR, ptsG, pykA, aroL, aroK gene deletion

-Deletion vector (plasmid) production step: clone the up region and down region of the gene to be deleted ( tyrR, ptsG, pykA ) into pKOV vector, an Escherichia coli suicide vector, and prepare the gene with a plasmid prep kit Prepare pure DNA dissolved in tertiary distilled water using

-Transformation step: To introduce the prepared defect vector into the desired strain, take a strain between 0.8 and 1 at an _{OD 600 and remove the medium using 10% glycerol.} 2 μl of the prepared deletion vector DNA is mixed with 50 μl of cells suspended in 10% glycerol, and electroporation is performed using a BioRad Micro Pulsar machine and a cuvette with a spacing of 2 mm. After 1 ml of LB medium was added to the cells, the cells were cultured at 30° C. for one hour, spread on an LB plate to which chloramphenicol was added, and then cultured at 30° C., and then transformants were selected.

-Single recombination induction step: In order to induce single recombination in the transformant, the temperature was raised to 37°C, cultured in LB medium supplemented with chloramphenicol, plated on an LB plate supplemented with chloramphenicol, and then plated at 37°C to remove single non-recombinant strains in the chromosome.

-Double recombination induction step: A single recombined strain is cultured at 37° C. in LB medium without antibiotics to induce double recombination, that is, gene deletion. The cultured strains are spread on an LB plate containing 10% sucrose, the plate is removed, and the gene-defective strain is selected.

shiA, ydiN gene deletion

-Deletion vector (plasmid) production step: Include sgRNA capable of binding specifically to the gene to be deleted ( shiA, ydiN ) and clone the up and down regions into the pTarget vector. Pure DNA is prepared by dissolving the gene in tertiary distilled water using a plasmid prep kit.

-Transformation step: Before introducing the prepared deletion vector into the desired strain, prepare the E. coli strain into which the pCas vector is introduced so that the Cas protein is expressed in the E. coli strain for the deletion of the gene. The strain is inoculated into kanamycin-added LB medium and incubated at 30° C. for one day at 220 rpm.

1% of the above culture medium is inoculated into 50 ml of fresh LB medium, and kanamycin and arabinose are added together and incubated at 30° C. so that _{the OD 600 is between 0.8 and 1.} Take the strain and remove the medium using 10% glycerol. 2 μl of the prepared deletion vector DNA is mixed with 50 μl of cells suspended in 10% glycerol, and electroporation is performed using a BioRad Micro Pulsar machine and a cuvette with a spacing of 2 mm. After adding 1 ml of LB medium to the cells, incubated at 30° C. for one hour, plated on an LB plate to which kanamycin and spectinomycin were added, and then cultured at 30° C., transformants are selected.

- Double recombination confirmation step: Selected transformants are newly cultured on an LB plate to which kanamycin and spectinomycin are added, and then, strains whose deletion is completed are selected by PCR.

-Plasmid erasure (curing) step: In order to eliminate the deletion vector, strains for which the deletion has been completed are inoculated into LB medium containing IPTG and incubated at 30°C for one day. A single colony is secured by spreading the cultured cell culture solution on an LB plate containing kanamycin, and a single colony is taken on an LB plate containing spectinomycin and kanamycin, respectively, and a recombinant strain with no spectinomycin resistance is selected. The strain with no spectinomycin resistance is cultured at 37° C. to abolish the pCas plasmid having a temperature-sensitive origin, and finally, a strain with no resistance to both kanamycin and spectinomycin is selected.

aroE And tktA Preparation of gene overexpression vectors

Cloning the aroE gene derived from E. coli K12 into the NdeI site of the pMESK plasmid , including a ribosome binding site (rbs) derived from the pET21b vector upstream of the aroE gene, and cloning the promoter of the oppA gene upstream of the ribosome binding site to prepare a PoppA-aroE plasmid (FIG. 4).

Further, in the above-PoppA aroE plasmid, by PCR, by cloning the tktA gene, including the ribosome binding site (rbs) to the HindIII site in the back of the aroE gene was prepared PoppA-aroE-tktA plasmid (Fig. 9).

The prepared PoppA-aroE plasmid includes the nucleotide sequence of SEQ ID NO: 70 of Table 4, and the PoppA-aroE-tktA plasmid includes the nucleotide sequence of SEQ ID NO: 71 of Table 5 below.

Preparation of E. coli for shikimic acid production

The various gene deletion and enzyme overexpression strains prepared above were transformed with the above-prepared aroE and tktA overexpression vectors, PoppA-aroE or PoppA-aroE-tktA, to prepare Escherichia coli for shikimic acid production.

[Test Example 1] Comparative test of shikimic acid production ability according to deletion of aroK and aroL genes

The aroK and/or aroL gene-deficient strain prepared in Preparation Example was treated with LB medium (containing 10.0 g of bactotrypton, 5.0 g of bacto yeast extract, and 10.0 g of NaCl) and EPM (glucose (5 g/L), glycerol ( 10 g/L), yeast extract (2.5 g/L), tryptone (2.5 g/L), KH ₂ PO ₄ (7.5 g/L), MgSO ₄ (0.5 g/L), (NH ₄ ) ₂ SO ₄ (3.5 g/L), NH ₄ Cl (2.7 g/L), Na ₂ SO ₄ (0.7 g/L), Na ₂ HPO ₄ 12H ₂ O (9 g/L), and metal solution (1 mL) /L) In this case, the metal solution is FeSO ₄ ·7H ₂ O (10 g/L), CaCl ₂ ·2H ₂ O (2 g/L), ZnSO ₄ ·7H ₂ O (2.2 g/L), MnSO ₄ .4H ₂ O (0.5 g/L), CuSO _{4 .5H 2} O (1 g/L), (NH ₄ )6Mo ₇ O ₂₄ .4H ₂ O (0.1 g/L), and Na ₂ B ₄ The _{flask was cultured in O 7} ·10H ₂ O (containing 0.02 g/L) medium, and it was confirmed whether shikimic acid was accumulated in the culture solution through HPLC analysis.

Specifically, 1 ml of the collected culture solution was centrifuged at 13000 rpm for 10 minutes to separate cells, and the supernatant was filtered through a 0.25 μm membrane filter and used for analysis. The biosynthesized precursors were separated-analyzed by HPLC (high-speed liquid chromatography), the column used was Aminex HPX-87H, the mobile phase was 5 mM H ₂ SO ₄ , the flow rate was 0.6 mL/L, and the analysis temperature was 30° C. (FRC) -10A, SHIMADZU). UV detection was performed in 3-DHS (237 nm), shikimic acid (263 nm). A standard (3-DHS, Shikimic acid: Sigma Co.) used for quantitative analysis was dissolved in distilled water, respectively, and filtered through a 0.25 μm membrane.

The results are shown in FIG. 3 , and as shown in FIG. 3 , in the aroK or aroL gene-deficient strain ( E. coli K12ΔaroK , E. coli K12ΔaroL ), shikimate standard (Sigma) G), a similar peak was confirmed at the same retention time, but as a result of confirming the absorbance, it was confirmed that shikimic acid was not produced. On the other hand, in the strain lacking both aroK and aroL genes ( E. coli K12ΔaroKΔaroL ), a very trace amount of shikimic acid was produced when cultured in LB medium, and it was confirmed that shikimic acid was produced in the culture medium using EPM medium. As a result, it was found that shikimic acid was produced only when the pathway was blocked by deleting both genes.

[Test Example 2] tyrR, ptsG, pykA, aroK and aroL, gene deletion, evaluation of shikimic acid production in Escherichia coli overexpressing aroE gene

The tyrR, ptsG, pykA, aroK, and aroL genes prepared in Preparation Example are deleted, and the aroE gene is overexpressed in Escherichia coli (GRAKL-PoppA aroE_1, GRAKL-PoppA aroE_2 (reproducibility)) from the first culture for 12 hours, After culturing under the same conditions as the culture conditions described in Preparation Example, except for the secondary culture for 12 hours, the culture solution was analyzed by HPLC. HPLC analysis conditions and methods were performed in the same manner as in Test Example 1. As a control group, E. coli K12ΔaroKΔaroL was used.

The results are shown in FIG. 5, and as shown in FIG. 5, the control group E. coli K12 ΔaroKΔaroL showed a productivity of 0.61 g/L, whereas the E. coli AB2834 βtyrRβptsGβpykAβaroKβaroL / It was confirmed that PoppA-aroE strain showed productivity of 2.45 g/L and 2.53 g/L (reproducibility test). This shows that the recombinant E. coli according to the present invention exhibits 4 times higher shikimic acid productivity than the control strain in which the gene on the biosynthetic pathway is not redesigned.

[Test Example 3] Evaluation of shikimic acid production in E. coli by overexpression of galP, ppsA, aroG, aroF, aroB, and aroD genes

In addition to the E. coli AB2834 βtyrRβptsGβpykAβaroKβaroL / PoppA-aroE strain in Test Example 2, E. coli in which the galP, ppsA, aroG, aroF, aroB, and aroD genes were further overexpressed was subjected to the same method as in Test Example 2 above. Acid production was evaluated.

The results are shown in FIG. 6 , and as shown in FIG. 6 , E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroKΔaroLΔ in which galP, ppsA, aroG, aroF, aroB, and aroD genes are additionally overexpressed In the case of the lacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE strain, it was confirmed that the production of shikimic acid was the highest at 2.95 g/L and 3.18 g/L (reproducibility test). could

[Test Example 4] Evaluation of shikimic acid production in E. coli by additional deletion of shiA or ydiN gene

In addition to the E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroKΔaroLΔlacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD /PoppA-aroE strain in Test Example 3, shiA Alternatively, shikimic acid production was evaluated in the same manner as in Test Example 2 for E. coli in which the ydiN gene was further deleted. The results are shown in FIGS. 8A and 8B.

As shown in Figure 7a, shiA gene is added to the defect E. coli AB2834 △ tyrR △ ptsG △ pykA △ aroK △ aroL △ shiA △ lacI :: Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB -aroD/PoppA-aroE strain ( △ RGAKL_PAGFBD_ △ shiA1_aroE,

In the case of △ RGAKL_PAGFBD_ △ shiA2_aroE (reproducibility)), the production of shikimic acid was 3.15 g/L and 3/13 g/L (reproducibility), which was confirmed to increase compared to the case where the shiA gene was not deleted.

As it is shown in Figure 7b, the ydiN gene deletion by adding E. coli AB2834 △ tyrR △ ptsG △ pykA △ aroK △ aroL △ ydiN △ lacI :: Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB In the case of -aroD-/PoppA-aroE strain (( △ RGAKL_PAGFBD_ △ ydiN_aroE), the production of shikimic acid was 4.11 g/L, which significantly increased compared to the case in which the ydiN gene was not deleted.

[Test Example 5] Evaluation of shikimic acid production in E. coli by additional deletion of shiA and ydiN genes and overexpression of tktA gene

In addition to the E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroKΔaroLΔlacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE strain in Test Example 3, shiA And ydiN gene was further deleted and the shikimic acid production was evaluated in the same manner as in Test Example 2 for E. coli in which the tktA gene was further overexpressed. The results are shown in FIGS. 10A and 10B.

As it is shown in Figures 9a and 9b, and the defect shiA to add all the ydiN gene and the tktA gene is added to the over-expression E. coli AB2834 tyrR △ △ △ ptsG pykA aroK △ △ △ aroL ydiN :: △ lacI Plac- In the case of the galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE-tktA strain, the production of shikimic acid was 4.24 g/L and 4.56 g/L (reproducibility) (FIG. 9a), 4.34 g/L As (FIG. 9b), it was confirmed that the production of shikimic acid was significantly increased compared to the strain in which the tktA gene was overexpressed and only one of the shiA and ydiN genes was deleted.

[Test Example 6] Evaluation of shikimic acid productivity in Escherichia coli by shiA gene deletion and tktA gene overexpression in 5L culture medium

E. coli AB2834 ΔtyrRΔptsGΔpykAΔaroKΔaroLΔlacI::Plac-galP-ppsA-Plac-aroG-aroF-Plac-aroB-aroD/PoppA-aroE strain was used and cultured at 37°C. Feeding (glucose 600g/L) was started from 14 hours, when all of the initial sugar was consumed, and the initial feeding rate was 0.1701ml/min, and then at 41 and 85 hours, 0.2268ml/min and 0.2646ml/min, respectively. changed the speed to The total incubation time was 121 hours.

In a specific test method, after solid culture was performed in LBG agar medium for 24 hours, a single colony was inoculated into 5 ml of LBG medium and cultured for 15 hours. Then, the secondary growth culture at 1% of the inoculum was incubated for 6 hours in 20 ml of LBG medium in the same manner. After that, it was again inoculated into the production fermenter with an inoculum of 1%. The working volume was 2L, and the pH was fixed at pH 7 using 10N NaOH and 3N HCl.

The results are shown in Fig. 10, when all of the initial sugar was consumed and feeding started, shikimic acid production started, and the shikimic acid productivity continued to increase until 121 hours of culture. At the final 121 hours, a maximum of 99 g/L of shikimic acid was produced, and the maximum productivity per hour was 0.84/g/L/hr, and the production yield was 0.34 g/g.

In addition to this, E. coli having a defective gene and overexpressing shiA tktA genes ptsG △ △ tyrR pykA △ △ AB2834 aroK aroL △ △ △ shiA lacI :: galP-Plac-Plac-ppsA-aroG-aroF-Plac-aroB- The aroD /PoppA-aroE-tktA strain was used and cultured under the same conditions as above. Afterwards, feeding was started from 11 hours, when all the initial sugars fell, and the initial rate was 0.1701 ml/min. Thereafter, the rates were changed to 0.2268 ml/min and 0.2646 ml/min, respectively, at 41 hours and 85 hours. The total incubation time was 87 hours. Specific test methods such as culture conditions, use medium, working capacity, and pH conditions are as described above.

The results are shown in FIG. 11, and when all of the initial sugar was consumed and feeding started, shikimic acid started to be produced, and the shikimic acid productivity continued to increase until 78 hours of culture. Thereafter, the culture was terminated as productivity began to decline. At 78 hours of culture, the maximum productivity of shikimic acid was 103 g/L, and the maximum productivity at this time was 1.34 g/L/hr and the yield was very high as 0.48 g/g.

From this, shiA gene deletion and tktA gene overexpression reduced the culture time for maximum shikimic acid production from 121 hours to 78 hours by more than 40 hours, and compared with the maximum productivity, 0.84 g/L/hr to 1.34 g/L/ hr increased by about 1.59 times, and it was confirmed that the yield also increased by 1.41 times from 0.34 g/g to 0.48 g/g.

<110> STR biotech <120> MICROORGANISM FOR PRODUCING SHIKIMIC ACID AND METHOD FOR PRODUCING SHIKIMIC ACID USING THE MICROORGANISM <130> 19p515/ind <160> 71 <170> KoPatentIn 3.0 <210> 1 <211> 522 <212> DNA <213> Artificial Sequence <220> <223> aroK coding DNA <400> 1 atggcagaga aacgcaatat ctttctggtt gggcctatgg gtgccggaaa aagcactatt 60 gggcgccagt tagctcaaca actcaatatg gaattttacg attccgatca agagattgag 120 aaacgaaccg gagctgatgt gggctgggtt ttcgatttag aaggcgaaga aggcttccgc 180 gatcgcgaag aaaaggtcat caatgagttg accgagaaac agggtattgt gctggctact 240 ggcggcggct ctgtgaaatc ccgtgaaacg cgtaaccgtc tttccgctcg tggcgttgtc 300 gtttatcttg aaacgaccat cgaaaagcaa cttgcacgca cgcagcgtga taaaaaacgc 360 ccgttgctgc acgttgaaac accgccgcgt gaagttctgg aagcgttggc caatgaacgc 420 aatccgctgt atgaagagat tgccgacgtg accattcgta ctgatgatca aagcgctaaa 480 gtggttgcaa accagattat tcacatgctg gaaagcaact aa 522 <210> 2 <211> 525 <212> DNA <213> Artificial Sequence <220> <223> aroL coding DNA <400> 2 atgacacaac ctctttttct gatcgggcct cggggctgtg gtaaaacaac ggtcggaatg 60 gcccttgccg attcgcttaa ccgtcggttt gtcgataccg atcagtggtt gcaatcacag 120 ctcaatatga cggtcgcgga gatcgtcgaa agggaagagt gggcgggatt tcgcgccaga 180 gaaacggcgg cgctggaagc ggtaactgcg ccatccaccg ttatcgctac aggcggcggc 240 attattctga cggaatttaa tcgtcacttc atgcaaaata acgggatcgt ggtttatttg 300 tgtgcgccag tatcagtcct ggttaaccga ctgcaagctg caccggaaga agatttacgg 360 ccaaccttaa cgggaaaacc gctgagcgaa gaagttcagg aagtgctgga agaacgcgat 420 gcgctatatc gcgaagttgc gcatattatc atcgacgcaa caaacgaacc cagccaggtg 480 atttctgaaa ttcgcagcgc cctggcacag acgatcaatt gttga 525 <210> 3 <211> 1542 <212> DNA <213> Artificial Sequence <220> <223> tyrR coding DNA <400> 3 atgcgtctgg aagtcttttg tgaagaccga ctcggtctga cccgcgaatt actcgatcta 60 ctcgtgctaa gaggcattga tttacgcggt attgagattg atcccattgg gcgaatctac 120 ctcaattttg ctgaactgga gtttgagagt ttcagcagtc tgatggccga aatacgccgt 180 attgcgggtg ttaccgatgt gcgtactgtc ccgtggatgc cttccgaacg tgagcatctg 240 gcgttgagcg cgttactgga ggcgttgcct gaacctgtgc tctctgtcga tatgaaaagc 300 aaagtggata tggcgaaccc ggcgagctgt cagctttttg ggcaaaaatt ggatcgcctg 360 cgcaaccata ccgccgcaca attgattaac ggctttaatt ttttacgttg gctggaaagc 420 gaaccgcaag attcgcataa cgagcatgtc gttattaatg ggcagaattt cctgatggag 480 attacgcctg tttatcttca ggatgaaaat gatcaacacg tcctgaccgg tgcggtggtg 540 atgttgcgat caacgattcg tatgggccgc cagttgcaaa atgtcgccgc ccaggacgtc 600 agcgccttca gtcaaattgt cgccgtcagc ccgaaaatga agcatgttgt cgaacaggcg 660 cagaaactgg cgatgctaag cgcgccgctg ctgattacgg gtgacacagg tacaggtaaa 720 gatctctttg cctacgcctg ccatcaggca agccccagag cgggcaaacc ttacctggcg 780 ctgaactgtg cgtctatacc ggaagatgcg gtcgagagtg aactgtttgg tcatgctccg 840 gaagggaaga aaggattctt tgagcaggcg aacggtggtt cggtgctgtt ggatgaaata 900 ggggaaatgt caccacggat gcaggcgaaa ttactgcgtt tccttaatga tggcactttc 960 cgtcgggttg gcgaagcca tgaggtgcat gtcgatgtgc gggtgatttg cgctacgcag 1020 aagaatctgg tcgaactggt gcaaaaaggc atgttccgtg aagatctcta ttatcgtctg 1080 aacgtgttga cgctcaatct gccgccgcta cgtgactgtc cgcaggacat catgccgtta 1140 actgagctgt tcgtcgcccg ctttgccgac gagcagggcg tgccgcgtcc gaaactggcc 1200 gctgacctga atactgtact tacgcgttat gcgtggccgg gaaatgtgcg gcagttaaag 1260 aacgctatct atcgcgcact gacacaactg gacggttatg agctgcgtcc acaggatatt 1320 ttgttgccgg attatgacgc cgcaacggta gccgtgggcg aagatgcgat ggaaggttcg 1380 ctggacgaaa tcaccagccg ttttgaacgc tcggtattaa cccagcttta tcgcaattat 1440 cccagcacgc gcaaactggc aaaacgtctc ggcgtttcac ataccgcgat tgccaataag 1500 ttgcgggaat atggtctgag tcagaagaag aacgaagagt aa 1542 <210> 4 <211> 1434 <212> DNA <213> Artificial Sequence <220> <223> ptsG coding DNA <400> 4 atgtttaaga atgcatttgc taacctgcaa aaggtcggta aatcgctgat gctgccggta 60 tccgtactgc ctatcgcagg tattctgctg ggcgtcggtt ccgcgaattt cagctggctg 120 cccgccgttg tatcgcatgt tatggcagaa gcaggcggtt ccgtctttgc aaacatgcca 180 ctgatttttg cgatcggtgt cgccctcggc tttaccaata acgatggcgt atccgcgctg 240 gccgcagttg ttgcctatgg catcatggtt aaaaccatgg ccgtggttgc gccactggta 300 ctgcatttac ctgctgaaga aatcgcctct aaacacctgg cggatactgg cgtactcgga 360 gggattatct ccggtgcgat cgcagcgtac atgtttaacc gtttctaccg tattaagctg 420 cctgagtatc ttggcttctt tgccggtaaa cgctttgtgc cgatcatttc tggcctggct 480 gccatcttta ctggcgttgt gctgtccttc atttggccgc cgattggttc tgcaatccag 540 accttctctc agtgggctgc ttaccagaac ccggtagttg cgtttggcat ttacggtttc 600 atcgaacgtt gcctggtacc gtttggtctg caccacatct ggaacgtacc tttccagatg 660 cagattggtg aatacaccaa cgcagcaggt caggttttcc acggcgacat tccgcgttat 720 atggcgggtg acccgactgc gggtaaactg tctggtggct tcctgttcaa aatgtacggt 780 ctgccagctg ccgcaattgc tatctggcac tctgctaaac cagaaaaccg cgcgaaagtg 840 ggcggtatta tgatctccgc ggcgctgacc tcgttcctga ccggtatcac cgagccgatc 900 gagttctcct tcatgttcgt tgcgccgatc ctgtacatca tccacgcgat tctggcaggc 960 ctggcattcc caatctgtat tcttctgggg atgcgtgacg gtacgtcgtt ctcgcacggt 1020 ctgatcgact tcatcgttct gtctggtaac agcagcaaac tgtggctgtt cccgatcgtc 1080 ggtatcggtt atgcgattgt ttactacacc atcttccgcg tgctgattaa agcactggat 1140 ctgaaaacgc cgggtcgtga agacgcgact gaagatgcaa aagcgacagg taccagcgaa 1200 atggcaccgg ctctggttgc tgcatttggt ggtaaagaaa acattactaa cctcgacgca 1260 tgtattaccc gtctgcgcgt cagcgttgct gatgtgtcta aagtggatca ggccggcctg 1320 aagaaactgg gcgcagcggg cgtagtggtt gctggttctg gtgttcaggc gattttcggt 1380 actaaatccg ataacctgaa aaccgagatg gatgagtaca tccgtaacca ctaa 1434 <210> 5 <211> 1443 <212> DNA <213> Artificial Sequence <220> <223> pykA coding DNA <400> 5 atgtccagaa ggcttcgcag aacaaaaatc gttaccacgt taggcccagc aacagatcgc 60 gataataatc ttgaaaaagt tatcgcggcg ggtgccaacg ttgtacgtat gaacttttct 120 cacggctcgc ctgaagatca caaaatgcgc gcggataaag ttcgtgagat tgccgcaaaa 180 ctggggcgtc atgtggctat tctgggtgac ctccaggggc ccaaaatccg tgtatccacc 240 tttaaagaag gcaaagtttt cctcaatatt ggggataaat tcctgctcga cgccaacctg 300 ggtaaaggtg aaggcgacaa agaaaaagtc ggtatcgact acaaaggcct gcctgctgac 360 gtcgtgcctg gtgacatcct gctgctggac gatggtcgcg tccagttaaa agtactggaa 420 gttcagggca tgaaagtgtt caccgaagtc accgtcggtg gtcccctctc caacaataaa 480 ggtatcaaca aacttggcgg cggtttgtcg gctgaagcgc tgaccgaaaa agacaaagca 540 gacattaaga ctgcggcgtt gattggcgta gattacctgg ctgtctcctt cccacgctgt 600 ggcgaagatc tgaactatgc ccgtcgcctg gcacgcgatg caggatgtga tgcgaaaatt 660 gttgccaagg ttgaacgtgc ggaagccgtt tgcagccagg atgcaatgga tgacatcatc 720 ctcgcctctg acgtggtaat ggttgcacgt ggcgacctcg gtgtggaaat tggcgacccg 780 gaactggtcg gcattcagaa agcgttgatc cgtcgtgcgc gtcagctaaa ccgagcggta 840 atcacggcga cccagatgat ggagtcaatg attactaacc cgatgccgac gcgtgcagaa 900 gtcatggacg tagcaaacgc cgttctggat ggtactgacg ctgtgatgct gtctgcagaa 960 actgccgctg ggcagtatcc gtcagaaacc gttgcagcca tggcgcgcgt ttgcctgggt 1020 gcggaaaaaa tcccgagcat caacgtttct aaacaccgtc tggacgttca gttcgacaat 1080 gtggaagaag ctattgccat gtcagcaatg tacgcagcta accacctgaa aggcgttacg 1140 gcgatcatca ccatgaccga atcgggtcgt accgcgctga tgacctcccg tatcagctct 1200 ggtctgccaa ttttcgccat gtcgcgccat gaacgtacgc tgaacctgac tgctctctat 1260 cgtggcgtta cgccggtgca ctttgatagc gctaatgacg gcgtagcagc tgccagcgaa 1320 gcggttaatc tgctgcgcga taaaggttac ttgatgtctg gtgacctggt gattgtcacc 1380 cagggcgacg tgatgagtac cgtgggttct actaatacca cgcgtatttt aacggtagag 1440 taa 1443 <210> 6 <211> 1317 <212> DNA <213> Artificial Sequence <220> <223> shiA coding DNA <400> 6 atggactcca cgctcatctc cactcgtccc gatgaaggga cgctttcgtt aagtcgcgcc 60 cgacgagctg cgttaggcag cttcgctggt gccgtcgtcg actggtatga ttttttactc 120 tatggcatca ccgccgcact ggtgtttaat cgcgagtttt tcccgcaagt aagcccggcg 180 atgggaacgc tcgccgcatt tgctaccttt ggcgtcggat ttcttttccg tccgctcggc 240 ggtgtcattt tcggtcactt tggcgaccga ctgggacgta agcgcatgtt aatgctgacc 300 gtctggatga tgggcatcgc gacagccttg attggtattc ttccttcatt ctcgaccatt 360 gggtggtggg cacctatttt gctggtgaca ctgcgtgcca ttcagggatt tgcagtcggc 420 ggcgaatggg gaggcgcggc gttgctttcc gttgaaagtg caccgaaaaa taaaaaagcc 480 ttttacagta gcggtgtaca agttggctac ggtgtaggtt tactgctttc aaccggactg 540 gtttcattga tcagtatgat gacgactgac gaacagtttt taagctgggg ctggcgcatt 600 cctttcctgt ttagcatcgt actggtactg ggagcattgt gggtgcgcaa tggcatggag 660 gagtccgcgg aatttgaaca acagcaacat tatcaagctg ccgcgaaaaa acgcatcccg 720 gttatcgaag cgctgttacg acatcccggt gctttcctga agattattgc gctacgactg 780 tgcgaattgc tgacgatgta catcgttact gcctttgcac ttaattattc aacccagaat 840 atggggctac cgcgcgaact tttccttaat attggtttgc tggtaggtgg attaagctgc 900 ctgacaattc cctgttttgc ctggcttgcc gatcgttttg gtcgccgtag ggtttatatc 960 acaggtacgt taatcggaac gttgagcgca tttcctttct ttatggcgct tgaagcacaa 1020 tctattttct ggatagtttt cttctccata atgctggcaa acatgcgca tgacatggtg 1080 gtgtgtgtgc aacaaccgat gtttaccgaa atgtttggtg ccagttatcg ctatagtggc 1140 gctggagtcg gttatcaggt tgccagtgtg gttggcggtg gatttacacc ttttattgcc 1200 gctgcactca tcacttactt tgccgggaac tggcatagcg tcgccattta tttgctggct 1260 ggatgcctga tttccgcaat gaccgctttg ttgatgaaag acagtcaacg cgcttga 1317 <210> 7 <211> 1266 <212> DNA <213> Artificial Sequence <220> <223> ydiN coding DNA <400> 7 atgtctcaaa ataaggcttt cagcacgcca tttatcctgg ctgttctttg tatttacttc 60 agctacttcc tgcacggcat tagtgttatt acgcttgccc aaaatatgtc atctctggcg 120 gaaaagtttt ccactgacaa cgcgggcatt gcctacttaa tttccggtat cggtttgggg 180 cgattgatca gtattttatt cttcggtgtg atctccgata agtttggtcg tcgggcggtg 240 atattaatgg cagtaataat gtatctgcta ttcttctttg gtattcccgc ttgcccgaat 300 ttaactctcg cctacggtct ggcagtgtgc gtaggtatcg ctaactcagc gctggatacg 360 ggtggctacc ccgcgctcat ggaatgcttt ccgaaagcct ctggttcggc ggtcatactg 420 gttaaagcga tggtgtcatt tgggcaaatg ttctacccaa tgctggtgag ctatatgttg 480 ctcaataata tctggtacgg ctatgggctg attattccgg gtattctatt tgtactgatc 540 acgctgatgc tgttgaaaag caaattcccc agccagttgg tggacgccag cgtaactaat 600 gaattaccgc aaatgaacag caaaccgtta gtctggctgg aaggtgtttc atcggtactg 660 ttcggtgtag ccgcattctc gaccttttat gtgattgtgg tgtggatgcc caaatatgcg 720 atggcttttg ctggtatgtc agaagctgag gcattaaaaa ccatctctta ttacagtatg 780 ggctcgttgg tctgtgtctt tatttttgcc gcactactga aaaaaatggt ccggcccatc 840 tgggctaatg tatttaactc tgcactggca acaataacag cagccattat ctacctgtac 900 ccttctccac tggtgtgcaa tgccggagcc tttgttatcg gtttctcagc agctggcggc 960 attttacagc tcggcgtttc ggtcatgtca gagttttttc ccaaaagcaa agccaaagtc 1020 accagtattt atatgatgat gggtggactg gctaactttg ttattccact gattaccggt 1080 tatctgtcga acatcggcct gcaatatatc attgttctcg attttacttt cgcgctgctg 1140 gccctgatta ccgcaattat tgtttttatc cgctattacc gcgttttcat tattcctgaa 1200 aatgatgtgc ggtttggcga gcgtaaattt tgcacccggt taaacacaat taagcataga 1260 ggttaa 1266 <210> 8 <211> 1083 <212> DNA <213> Artificial Sequence <220> <223> lacI coding DNA <400> 8 gtgaaaccag taacgttata cgatgtcgca gagtatgccg gtgtctctta tcagaccgtt 60 tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa cgcgggaaaa agtggaagcg 120 gcgatggcgg agctgaatta cattcccaac cgcgtggcac aacaactggc gggcaaacag 180 tcgttgctga ttggcgttgc cacctccagt ctggccctgc acgcgccgtc gcaaattgtc 240 gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg tggtggtgtc gatggtagaa 300 cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc ttctcgcgca acgcgtcagt 360 gggctgatca ttaactatcc gctggatgac caggatgcca ttgctgtgga agctgcctgc 420 actaatgttc cggcgttatt tcttgatgtc tctgaccaga cacccatcaa cagtattatt 480 ttctcccatg aagacggtac gcgactgggc gtggagcatc tggtcgcatt gggtcaccag 540 caaatcgcgc tgttagcggg cccattaagt tctgtctcgg cgcgtctgcg tctggctggc 600 tggcataaat atctcactcg caatcaaatt cagccgatag cggaacggga aggcgactgg 660 agtgccatgt ccggttttca acaaaccatg caaatgctga atgagggcat cgttcccact 720 gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa tgcgcgccat taccgagtcc 780 gggctgcgcg ttggtgcgga tatctcggta gtgggatacg acgataccga agacagctca 840 tgttatatcc cgccgttaac caccatcaaa caggattttc gcctgctggg gcaaaccagc 900 gtggaccgct tgctgcaact ctctcagggc caggcggtga agggcaatca gctgttgccc 960 gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata cgcaaaccgc ctctccccgc 1020 gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag 1080 tga 1083 <210> 9 <211> 1395 <212> DNA <213> Artificial Sequence <220> <223> galP coding DNA <400> 9 atgcctgacg ctaaaaaaca ggggcggtca aacaaggcaa tgacgttttt cgtctgcttc 60 cttgccgctc tggcgggatt actctttggc ctggatatcg gtgtaattgc tggcgcactg 120 ccgtttattg cagatgaatt ccagattact tcgcacacgc aagaatgggt cgtaagctcc 180 atgatgttcg gtgcggcagt cggtgcggtg ggcagcggct ggctctcctt taaactcggg 240 cgcaaaaaga gcctgatgat cggcgcaatt ttgtttgttg ccggttcgct gttctctgcg 300 gctgcgccaa acgttgaagt actgattctt tcccgcgttc tactggggct ggcggtgggt 360 gtggcctctt ataccgcacc gctgtacctc tctgaaattg cgccggaaaa aattcgtggc 420 agtatgatct cgatgtatca gttgatgatc actatcggga tcctcggtgc ttatctttct 480 gataccgcct tcagctacac cggtgcatgg cgctggatgc tgggtgtgat tatcatcccg 540 gcaattttgc tgctgattgg tgtcttcttc ctgccagaca gcccacgttg gtttgccgcc 600 aaacgccgtt ttgttgatgc cgaacgcgtg ctgctacgcc tgcgtgacac cagcgcggaa 660 gcgaaacgcg aactggatga aatccgtgaa agtttgcagg ttaaacagag tggctgggcg 720 ctgtttaaag agaacagcaa cttccgccgc gcggtgttcc ttggcgtact gttgcaggta 780 atgcagcaat tcaccgggat gaacgtcatc atgtattacg cgccgaaaat cttcgaactg 840 gcgggttata ccaacactac cgagcaaatg tgggggaccg tgattgtcgg cctgaccaac 900 gtacttgcca cctttatcgc aatcggcctt gttgaccgct ggggacgtaa accaacgcta 960 acgctgggct tcctggtgat ggctgctggc atgggcgtac tcggtacaat gatgcatatc 1020 ggtattcact ctccgtcggc gcagtatttc gccatcgcca tgctgctgat gtttattgtc 1080 ggttttgcca tgagtgccgg tccgctgatt tgggtactgt gctccgaaat tcagccgctg 1140 aaaggccgcg attttggcat cacctgctcc actgccacca actggattgc caacatgatc 1200 gttggcgcaa cgttcctgac catgctcaac acgctgggta acgccaacac cttctgggtg 1260 tatgcggctc tgaacgtact gtttatcctg ctgacattgt ggctggtacc ggaaaccaaa 1320 cacgtttcgc tggaacatat tgaacgtaat ctgatgaaag gtcgtaaact gcgcgaaata 1380 ggcgctcacg attaa 1395 <210> 10 <211> 2379 <212> DNA <213> Artificial Sequence <220> <223> ppsA coding DNA <400> 10 atgtccaaca atggctcgtc accgctggtg ctttggtata accaactcgg catgaatgat 60 gtagacaggg ttgggggcaa aaatgcctcc ctgggtgaaa tgattactaa tctttccgga 120 atgggtgttt ccgttccgaa tggtttcgcc acaaccgccg acgcgtttaa ccagtttctg 180 gaccaaagcg gcgtaaacca gcgcatttat gaactgctgg ataaaacgga tattgacgat 240 gttactcagc ttgcgaaagc gggcgcgcaa atccgccagt ggattatcga cactcccttc 300 cagcctgagc tggaaaacgc catccgcgaa gcctatgcac agctttccgc cgatgacgaa 360 aacgcctctt ttgcggtgcg ctcctccgcc accgcagaag atatgccgga cgcttctttt 420 gccggtcagc aggaaacctt cctcaacgtt cagggttttg acgccgttct cgtggcagtg 480 aaacatgtat ttgcttctct gtttaacgat cgcgccatct cttatcgtgt gcaccagggt 540 tacgatcacc gtggtgtggc gctctccgcc ggtgttcaac ggatggtgcg ctctgacctc 600 gcatcatctg gcgtgatgtt ctccattgat accgaatccg gctttgacca ggtggtgttt 660 atcacttccg catggggcct tggtgagatg gtcgtgcagg gtgcggttaa cccggatgag 720 ttttacgtgc ataaaccgac actggcggcg aatcgcccgg ctatcgtgcg ccgcaccatg 780 gggtcgaaaa aaatccgcat ggtttacgcg ccgacccagg agcacggcaa gcaggttaaa 840 atcgaagacg taccgcagga acagcgtgac atcttctcgc tgaccaacga agaagtgcag 900 gaactggcaa aacaggccgt acaaattgag aaacactacg gtcgcccgat ggatattgag 960 tgggcgaaag atggccacac cggtaaactg ttcattgtgc aggcgcgtcc ggaaaccgtg 1020 cgctcacgcg gtcaggtcat ggagcgttat acgctgcatt cacagggtaa gattatcgcc 1080 gaaggccgtg ctatcggtca tcgcatcggt gcgggtccgg tgaaagtcat ccatgacatc 1140 agcgaaatga accgcatcga acctggcgac gtgctggtta ctgacatgac cgacccggac 1200 tgggaaccga tcatgaagaa agcatctgcc atcgtcacca accgtggcgg tcgtacctgt 1260 cacgcggcga tcatcgctcg tgaactgggc attccggcgg tagtgggctg tggagatgca 1320 acagaacgga tgaaagacgg tgagaacgtc actgtttctt gtgccgaagg tgataccggt 1380 tacgtctatg cggagttgct ggaatttagc gtgaaaagct ccagcgtaga aacgatgccg 1440 gatctgccgt tgaaagtgat gatgaacgtc ggtaacccgg accgtgcttt cgacttcgcc 1500 tgcctaccga acgaaggcgt gggccttgcg cgtctggaat ttatcatcaa ccgtatgatt 1560 ggcgtccacc cacgcgcact gcttgagttt gacgatcagg aaccgcagtt gcaaaacgaa 1620 atccgcgaga tgatgaaagg ttttgattct ccgcgtgaat tttacgttgg tcgtctgact 1680 gaagggatcg cgacgctggg tgccgcgttt tatccgaagc gcgtcattgt ccgtctctct 1740 gattttaaat cgaacgaata tgccaacctg gtcggtggtg agcgttacga gccagatgaa 1800 gagaacccga tgctcggctt ccgtggcgcg ggccgctatg tttccgacag cttccgcgac 1860 tgtttcgcgc tggagtgtga agcagtgaaa cgtgtgcgca acgacatggg actgaccaac 1920 gttgagatca tgatcccgtt cgtgcgtacc gtagatcagg cgaaagcggt ggttgaagaa 1980 ctggcgcgtc aggggctgaa acgtggcgag aacgggctga aaatcatcat gatgtgtgaa 2040 atcccgtcca acgccttgct ggccgagcag ttcctcgaat atttcgacgg cttctcaatt 2100 ggctcaaacg atatgacgca gctggcgctc ggtctggacc gtgactccgg cgtggtgtct 2160 gaattgttcg atgagcgcaa cgatgcggtg aaagcactgc tgtcgatggc tatccgtgcc 2220 gcgaagaaac agggcaaata tgtcgggatt tgcggtcagg gtccgtccga ccacgaagac 2280 tttgccgcat ggttgatgga agaggggatc gatagcctgt ctctgaaccc ggacaccgtg 2340 gtgcaaacct ggttaagcct ggctgaactg aagaaataa 2379 <210> 11 <211> 1089 <212> DNA <213> Artificial Sequence <220> <223> aroB coding DNA <400> 11 atggagagga ttgtcgttac tctcggggaa cgtagttacc caattaccat cgcatctggt 60 ttgtttaatg aaccagcttc attcttaccg ctgaaatcgg gcgagcaggt catgttggtc 120 accaacgaaa ccctggctcc tctgtatctc gataaggtcc gcggcgtact tgaacaggcg 180 ggtgttaacg tcgatagcgt tatcctccct gacggcgagc agtataaaag cctggctgta 240 ctcgataccg tctttacggc gttgttacaa aaaccgcatg gtcgcgatac tacgctggtg 300 gcgcttggcg gcggcgtagt gggcgatctg accggcttcg cggcggcgag ttatcagcgc 360 ggtgtccgtt tcattcaagt cccgacgacg ttactgtcgc aggtcgattc ctccgttggc 420 ggcaaaactg cggtcaacca tcccctcggt aaaaacatga ttggcgcgtt ctaccaacct 480 gcttcagtgg tggtggatct cgactgtctg aaaacgcttc ccccgcgtga gttagcgtcg 540 gggctggcag aagtcatcaa atacggcatt attcttgacg gtgcgttttt taactggctg 600 gaagagaatc tggatgcgtt gttgcgtctg gacggtccgg caatggcgta ctgtattcgc 660 cgttgttgtg aactgaaggc agaagttgtc gccgccgacg agcgcgaaac cgggttacgt 720 gctttactga atctgggaca cacctttggt catgccattg aagctgaaat ggggtatggc 780 aattggttac atggtgaagc ggtcgctgcg ggtatggtga tggcggcgcg gacgtcggaa 840 cgtctcgggc agtttagttc tgccgaaacg cagcgtatta taaccctgct caagcgggct 900 gggttaccgg tcaatgggcc gcgcgaaatg tccgcgcagg cgtatttacc gcatatgctg 960 cgtgacaaga aagtccttgc gggagagatg cgcttaattc ttccgttggc aattggtaag 1020 agtgaagttc gcagcggcgt ttcgcacgag cttgttctta acgccattgc cgattgtcaa 1080 tcagcgtaa 1089 <210> 12 <211> 759 <212> DNA <213> Artificial Sequence <220> <223> aroD coding DNA <400> 12 atgaaaaccg taactgtaaa agatctcgtc attggtacgg gcgcacctaa aatcatcgtc 60 tcgctgatgg cgaaagatat cgccagcgtg aaatccgaag ctctcgccta tcgtgaagcg 120 gactttgata ttctggaatg gcgtgtggac cactatgccg acctctccaa tgtggagtct 180 gtcatggcgg cagcaaaaat tctccgtgag accatgccag aaaaaccgct gctgtttacc 240 ttccgcagtg ccaaagaagg cggcgagcag gcgatttcca ccgaggctta tattgcactc 300 aatcgtgcag ccatcgacag cggcctggtt gatatgatcg atctggagtt atttaccggt 360 gatgatcagg ttaaagaaac cgtcgcctac gcccacgcgc atgatgtgaa agtagtcatg 420 tccaaccatg acttccataa aacgccggaa gccgaagaaa tcattgcccg tctgcgcaaa 480 atgcaatcct tcgacgccga tattcctaag attgcgctga tgccgcaaag taccagcgat 540 gtgctgacgt tgcttgccgc gaccctggag atgcaggagc agtatgccga tcgtccaatt 600 atcacgatgt cgatggcaaa aactggcgta atttctcgtc tggctggtga agtatttggc 660 tcggcggcaa cttttggtgc ggtaaaaaaa gcgtctgcgc cagggcaaat ctcggtaaat 720 gatttgcgca cggtattaac tattttacac caggcataa 759 <210> 13 <211> 1053 <212> DNA <213> Artificial Sequence <220> <223> aroG coding DNA <400> 13 atgaattatc agaacgacga tttacgcatc aaagaaatca aagagttact tcctcctgtc 60 gcattgctgg aaaaattccc cgctactgaa aatgccgcga atacggttgc ccatgcccga 120 aaagcgatcc ataagatcct gaaaggtaat gatgatcgcc tgttggttgt gattggccca 180 tgctcaattc atgatcctgt cgcggcaaaa gagtatgcca ctcgcttgct ggcgctgcgt 240 gaagagctga aagatgagct ggaaatcgta atgcgcgtct attttgaaaa gccgcgtacc 300 acggtgggct ggaaagggct gattaacgat ccgcatatgg ataatagctt ccagatcaac 360 gacggtctgc gtatagcccg taaattgctg cttgatatta acgacagcgg tctgccagcg 420 gcaggtgagt ttctcgatat gatcacccca caatatctcg ctgacctgat gagctggggc 480 gcaattggcg cacgtaccac cgaatcgcag gtgcaccgcg aactggcatc agggctttct 540 tgtccggtcg gcttcaaaaa tggcaccgac ggtacgatta aagtggctat cgatgccatt 600 aatgccgccg gtgcgccgca ctgcttcctg tccgtaacga aatgggggca ttcggcgatt 660 gtgaatacca gcggtaacgg cgattgccat atcattctgc gcggcggtaa agagcctaac 720 tacagcgcga agcacgttgc tgaagtgaaa gaagggctga acaaagcagg cctgccagca 780 caggtgatga tcgatttcag ccatgctaac tcgtccaaac aattcaaaaa gcagatggat 840 gtttgtgctg acgtttgcca gcagattgcc ggtggcgaaa aggccattat tggcgtgatg 900 gtggaaagcc atctggtgga aggcaatcag agcctcgaga gcggggagcc gctggcctac 960 ggtaagagca tcaccgatgc ctgcatcggc tgggaagata ccgatgctct gttacgtcaa 1020 ctggcgaatg cagtaaaagc gcgtcgcggg taa 1053 <210> 14 <211> 1071 <212> DNA <213> Artificial Sequence <220> <223> aroF coding DNA <400> 14 atgcaaaaag acgcgctgaa taacgtacat attaccgacg aacaggtttt aatgactccg 60 gaacaactga aggccgcttt tccattgagc ctgcaacaag aagcccagat tgctgactcg 120 cgtaaaagca tttcagatat tatcgccggg cgcgatcctc gtctgctggt agtatgtggt 180 ccttgttcca ttcatgatcc ggaaactgct ctggaatatg ctcgtcgatt taaagccctt 240 gccgcagagg tcagcgatag cctctatctg gtaatgcgcg tctattttga aaaaccccgt 300 accactgtcg gctggaaagg gttaattaac gatccccata tggatggctc ttttgatgta 360 gaagccgggc tgcagatcgc gcgtaaattg ctgcttgagc tggtgaatat gggactgcca 420 ctggcgacgg aagcgttaga tccgaatagc ccgcaatacc tgggcgatct gtttagctgg 480 tcagcaattg gtgctcgtac aacggaatcg caaactcacc gtgaaatggc ctccgggctt 540 tccatgccgg ttggttttaa aaacggcacc gacggcagtc tggcaacagc aattaacgct 600 atgcgcgccg ccgcccagcc gcaccgtttt gttggcatta accaggcagg gcaggttgcg 660 ttgctacaaa ctcaggggaa tccggacggc catgtgatcc tgcgcggtgg taaagcgccg 720 aactatagcc ctgcggatgt tgcgcaatgt gaaaaagaga tggaacaggc gggactgcgc 780 ccgtctctga tggtagattg cagccacggt aattccaata aagattatcg ccgtcagcct 840 gcggtggcag aatccgtggt tgctcaaatc aaagatggca atcgctcaat tattggtctg 900 atgatcgaaa gtaatatcca cgagggcaat cagtcttccg agcaaccgcg cagtgaaatg 960 aaatacggtg tatccgtaac cgatgcctgc attagctggg aaatgaccga tgccttgctg 1020 cgtgaaattc atcaggatct gaacgggcag ctgacggctc gcgtggctta a 1071 <210> 15 <211> 1632 <212> DNA <213> Artificial Sequence <220> <223> oppA coding DNA <400> 15 atgaccaaca tcaccaagag aagtttagta gcagctggcg ttctggctgc gctaatggca 60 gggaatgtcg cgctggcagc tgatgtaccc gcaggcgtca cactggcgga aaaacaaaca 120 ctggtacgta acaatggttc agaagttcag tcattagatc cgcacaaaat tgaaggtgtt 180 ccggagtcta atatcagccg agacctgttt gaaggcttac tggtcagcga tcttgacggt 240 catccagcac ctggcgtcgc tgaatcctgg gataataaag acgcgaaagt ctggaccttc 300 catttgcgta aagatgcgaa atggtctgat ggcacgccag tcacagcaca agactttgtg 360 tatagctggc aacgttctgt tgatccgaac actgcttctc cgtatgccag ttatctgcaa 420 tatgggcata tcgccggtat tgatgaaatt cttgaaggga aaaaaccgat taccgatctc 480 ggcgtgaaag ctattgatga tcacacatta gaagtcacct taagtgaacc cgttccgtac 540 ttctataaat tacttgttca cccatcaact tcaccggtgc caaaagccgc tatcgagaaa 600 ttcggcgaaa aatggaccca gcctggtaat atcgtcacca acggtgccta taccttaaaa 660 gattgggtcg taaacgaacg aatcgttctt gaacgcagcc cgacctactg gaacaacgcg 720 aaaaccgtta ttaaccaggt aacctatttg cctattgctt ctgaagttac cgatgtcaac 780 cgctaccgta gtggtgaaat cgacatgacg aataacagca tgccgatcga attgttccag 840 aagctgaaaa aagagatccc ggacgaagtt cacgttgatc catacctgtg cacttactat 900 tacgaaatta acaaccagaa accgccattc aacgatgtgc gtgtgcgtac cgcactgaaa 960 ctaggtatgg accgcgatat cattgttaat aaagtgaaag cgcagggcaa catgcccgcc 1020 tatggttaca ctccaccgta tactgatggc gcaaaattga ctcagccaga atggtttggc 1080 tggagccagg aaaaacgtaa cgaagaagcg aaaaaactgc tggctgaagc gggttatacc 1140 gcagacaaac cgttgaccat caacctgttg tataacacct ccgatctgca taaaaagctg 1200 gcgattgctg cctcttcatt gtggaagaaa aacattggtg taaacgtcaa actggttaac 1260 caggagtgga aaacgttcct cgacacccgt caccagggta cttttgatgt ggcccgtgca 1320 ggctggtgtg ctgactacaa cgaaccaact tccttcctga acaccatgct ttcgaacagc 1380 tcgatgaata ccgcgcatta taagagcccg gcctttgaca gcattatggc ggaaacgctg 1440 aaagtgactg acgaggcgca gcgcacagct ctgtacacta aagcagaaca acagctggat 1500 aaggattcgg ccattgttcc tgtttattac tacgtgaatg cgcgtctggt gaaaccgtgg 1560 gttggtggct ataccggcaa agatccgctg gataatacct atacccggaa tatgtacatt 1620 gtgaagcact aa 1632 <210> 16 <211> 819 <212> DNA <213> Artificial Sequence <220> <223> aroE coding DNA <400> 16 atggaaacct atgctgtttt tggtaatccg atagcccaca gcaaatcgcc attcattcat 60 cagcaatttg ctcagcaact gaatattgaa catccctatg ggcgcgtgtt ggcacccatc 120 aatgatttca tcaacacact gaacgctttc tttagtgctg gtggtaaagg tgcgaatgtg 180 acggtgcctt ttaaagaaga ggcttttgcc agagcggatg agcttactga acgggcagcg 240 ttggctggtg ctgttaatac cctcatgcgg ttagaagatg gacgcctgct gggtgacaat 300 accgatggtg taggcttgtt aagcgatctg gaacgtctgt cttttatccg ccctggttta 360 cgtattctgc ttatcggcgc tggtggagca tctcgcggcg tactactgcc actcctttcc 420 ctggactgtg cggtgacaat aactaatcgg acggtatccc gcgcggaaga gttggctaaa 480 ttgtttgcgc acactggcag tattcaggcg ttgagtatgg acgaactgga aggtcatgag 540 tttgatctca ttattaatgc aacatccagt ggcatcagtg gtgatattcc ggcgatcccg 600 tcatcgctca ttcatccagg catttattgc tatgacatgt tctatcagaa aggaaaaact 660 ccttttctgg catggtgtga gcagcgaggc tcaaagcgta atgctgatgg tttaggaatg 720 ctggtggcac aggcggctca tgcctttctt ctctggcacg gtgttctgcc tgacgtagaa 780 ccagttataa agcaattgca ggaggaattg tccgcgtga 819 <210> 17 <211> 1992 <212> DNA <213> Artificial Sequence <220> <223> tktA coding DNA <400> 17 atgtcctcac gtaaagagct tgccaatgct attcgtgcgc tgagcatgga cgcagtacag 60 aaagccaaat ccggtcaccc gggtgcccct atgggtatgg ctgacattgc cgaagtcctg 120 tggcgtgatt tcctgaaaca caacccgcag aatccgtcct gggctgaccg tgaccgcttc 180 gtgctgtcca acggccacgg ctccatgctg atctacagcc tgctgcacct caccggttac 240 gatctgccga tggaagaact gaaaaacttc cgtcagctgc actctaaaac tccgggtcac 300 ccggaagtgg gttacaccgc tggtgtggaa accaccaccg gtccgctggg tcagggtatt 360 gccaacgcag tcggtatggc gattgcagaa aaaacgctgg cggcgcagtt taaccgtccg 420 ggccacgaca ttgtcgacca ctacacctac gccttcatgg gcgacggctg catgatggaa 480 ggcatctccc acgaagtttg ctctctggcg ggtacgctga agctgggtaa actgattgca 540 ttctacgatg acaacggtat ttctatcgat ggtcacgttg aaggctggtt caccgacgac 600 accgcaatgc gtttcgaagc ttacggctgg cacgttattc gcgacatcga cggtcatgac 660 gcggcatcta tcaaacgcgc agtagaagaa gcgcgcgcag tgactgacaa accttccctg 720 ctgatgtgca aaaccatcat cggtttcggt tccccgaaca aagccggtac ccacgactcc 780 cacggtgcgc cgctgggcga cgctgaaatt gccctgaccc gcgaacaact gggctggaaa 840 tatgcgccgt tcgaaatccc gtctgaaatc tatgctcagt gggatgcgaa agaagcaggc 900 caggcgaaag aatccgcatg gaacgagaaa ttcgctgctt acgcgaaagc ttatccgcag 960 gaagccgctg aatttacccg ccgtatgaaa ggcgaaatgc cgtctgactt cgacgctaaa 1020 gcgaaagagt tcatcgctaa actgcaggct aatccggcga aaatcgccag ccgtaaagcg 1080 tctcagaatg ctatcgaagc gttcggtccg ctgttgccgg aattcctcgg cggttctgct 1140 gacctggcgc cgtctaacct gaccctgtgg tctggttcta aagcaatcaa cgaagatgct 1200 gcgggtaact acatccacta cggtgttcgc gagttcggta tgaccgcgat tgctaacggt 1260 atctccctgc acggtggctt cctgccgtac acctccacct tcctgatgtt cgtggaatac 1320 gcacgtaacg ccgtacgtat ggctgcgctg atgaaacagc gtcaggtgat ggtttacacc 1380 cacgactcca tcggtctggg cgaagacggc ccgactcacc agccggttga gcaggtcgct 1440 tctctgcgcg taaccccgaa catgtctaca tggcgtccgt gtgaccaggt tgaatccgcg 1500 gtcgcgtgga aatacggtgt tgagcgtcag gacggcccga ccgcactgat cctctcccgt 1560 cagaacctgg cgcagcagga acgaactgaa gagcaactgg caaacatcgc gcgcggtggt 1620 tatgtgctga aagactgcgc cggtcagccg gaactgattt tcatcgctac cggttcagaa 1680 gttgaactgg ctgttgctgc ctacgaaaaa ctgactgccg aaggcgtgaa agcgcgcgtg 1740 gtgtccatgc cgtctaccga cgcatttgac aagcaggatg ctgcttaccg tgaatccgta 1800 ctgccgaaag cggttactgc acgcgttgct gtagaagcgg gtattgctga ctactggtac 1860 aagtatgttg gcctgaacgg tgctatcgtc ggtatgacca ccttcggtga atctgctccg 1920 gcagagctgc tgtttgaaga gttcggcttc actgttgata acgttgttgc gaaagcaaaa 1980 gaactgctgt aa 1992 <210> 18 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> ribosome binding site <400> 18 gaagga 6 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lacI_UP Forward primer <400> 19 attcggatcc tgctcatcca tgacctgacc 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lacI_UP Reverse primer <400> 20 gaactctaga taatgcagct ggcaccacag 30 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> lacI_DOWN Forward primer <400> 21 atggtctaga gaatgtaatt cagctccgcc 30 <210> 22 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> lacI_DOWN Reverse primer <400> 22 atgcgtcgac ttgtgcgctc agtataggaa g 31 <210> 23 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> aroK_UP Forward primer <400> 23 tttcgcacct gggatccaat acgcctgcgc ggacattt 38 <210> 24 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> aroK_UP Reverse primer <400> 24 cgactctaga ggatccgttg gccaatgaac gcaatcc 37 <210> 25 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> aroK_DOWN Forward primer <400> 25 tcctctagag tcgacttgag ttgttgagct aactgg 36 <210> 26 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aroK_DOWN Reverse primer <400> 26 ccattctccg gtcgatctgc tggcctcaca tcttc 35 <210> 27 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aroL_UP Forward primer <400> 27 ttcgcacctg ggatcgacgc gtgtcccaat gtaat 35 <210> 28 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aroL_UP Reverse primer <400> 28 cacctggctg ggttcacggt taagcgaatc ggcaa 35 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aroL_DOWN Forward primer <400> 29 gaacccagcc aggtgatttc 20 <210> 30 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aroL_DOWN Reverse primer <400> 30 cgactctaga ggatctgaag caccactgct gacac 35 <210> 31 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> sgRNA-shiA Forward primer <400> 31 gtcctaggta taatactagt attcagggat ttgcagtcgg gttttagagc tagaaatagc 60 60 <210> 32 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> sgRNA-HindIII Reverse primer <400> 32 taatagatct aagcttctgc aggtcgactc t 31 <210> 33 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> shiA_UP Forward primer <400> 33 gacctgcaga agctaatatg gatgacaaca aagt 34 <210> 34 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> shiA_UP Reverse primer <400> 34 gtcgacgacg gcaccagcga agctgc 26 <210> 35 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> shiA_DOWN Forward primer <400> 35 ggtgccgtcg tcgacaaaga cagtcaacgc gctt 34 <210> 36 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> shiA_DOWN Reverse primer <400> 36 aatagatcta agcttccagt tctgttgtcg ggaag 35 <210> 37 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> sgRNA-ydiN Forward primer <400> 37 gtcctaggta taatactagt gtggatgccc aaatatgcga gttttagagc tagaaatagc 60 60 <210> 38 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ydiN_UP Forward primer <400> 38 ttctctagag tcgacgcaat attcttttca ggtca 35 <210> 39 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ydiN_UP Reverse primer <400> 39 cgcacactgc cagaccgtag gcgaga 26 <210> 40 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ydiN_DOWN Forward primer <400> 40 gtctggcagt gtgcgtttgt tattccactg attac 35 <210> 41 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ydiN_DOWN Reverse primer <400> 41 cttctgcagg tcgacgccat catcattaac gatgg 35 <210> 42 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UP Forward primer <400> 42 ttacatatgc gggatccggt aggcgaacgt 30 <210> 43 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> ptsG_UP Reverse primer <400> 43 catggtttta accatctaga cataggcaac aactcgagcc agcgcggata 50 <210> 44 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> ptsG_DOWN Forward primer <400> 44 tccacgcgat tctagaaggc ctggcattcc caagctttat tcttctgggg 50 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ptsG_DOWN Reverse primer <400> 45 gtcgacctac gccagctata 20 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> tyrR_UP Forward primer <400> 46 caggtgatgg atgtcgacaa accactaccg 30 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> tyrR_UP Reverse primer <400> 47 tcgacagaga gcaaagcttc aggcaacgcc 30 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> tyrR_DOWN Forward primer <400> 48 actgacacaa ctcgagggtt ctgagctgcg 30 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> tyrR_DOWN Reverse primer <400> 49 gcatcgcaac gcctggatcc gccaatagct 30 <210> 50 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pykA_UP Forward primer <400> 50 cgtttctaga caccgtctcg aggttcagtt cgac 34 <210> 51 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pykA_UP Reverse primer <400> 51 ccgccaagga tccgtgatcc cattct 26 <210> 52 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> pykA_DOWN Forward primer <400> 52 caaccgcgcc gtcgacttgc tc 22 <210> 53 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> pykA_DOWN Reverse primer <400> 53 caaacggctt ctagacgttc aagcttggca acaa 34 <210> 54 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> aroE_OVER Forward primer <400> 54 ggagatatac atatggaaac ctatgctgtt tt 32 <210> 55 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> aroE_OVER Reverse primer <400> 55 tcggggcaag cttaatcacg cggacaattc ctcc 34 <210> 56 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> tktA_OVER Forward primer <400> 56 gtccgcgtga agcttaaggg cgtgcccttc atcat 35 <210> 57 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> tktA_OVER Reverse primer <400> 57 tgtcggggca agctttaatt acagcagttc ttttg 35 <210> 58 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aroG_OVER Forward primer <400> 58 aggagatata ctcgaatgaa ttatcagaac gacga 35 <210> 59 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aroG_OVER Reverse primer <400> 59 gaattcgatt ctcgattacc cgcgacgcgc tttta 35 <210> 60 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aroF_OVER Forward primer <400> 60 ctcccggccg ccatgataaa cctcttaagc cacgc 35 <210> 61 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> aroF_OVER Reverse primer <400> 61 cccgcggccg ccatgtacgt catcctcgct gagga 35 <210> 62 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> aroB_OVER Forward primer <400> 62 gagggagtcc aaaaaacaat ggagaggatt gtcgttactc tcg 43 <210> 63 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> aroB_OVER Reverse primer <400> 63 tttacagtta cggttttcat tacgctgatt gacaatcgg 39 <210> 64 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> aroD_OVER Forward primer <400> 64 ttgtcaatca gcgtaatgaa aaccgtaact gtaaaaga 38 <210> 65 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> aroD_OVER Reverse primer <400> 65 ggcgggtgtc ggggcaagct tttatgcctg gtgtaaaata gtt 43 <210> 66 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> galP_OVER Forward primer <400> 66 aggagatata ctcgaatgcc tgacgctaaa aaaca 35 <210> 67 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> galP_OVER Reverse primer <400> 67 gaattcgatt ctcgaggaga ttaatcgtga gcgcc 35 <210> 68 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ppsA_OVER Forward primer <400> 68 ctcccggccg ccatgcacat aaccccggcg actaa 35 <210> 69 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ppsA_OVER Reverse primer <400> 69 cccgcggccg ccatgcacaa aaggattgtt cgatg 35 <210> 70 <211> 3280 <212> DNA <213> Artificial Sequence <220> <223> PoppA-aroE_plasmid sequences <400> 70 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctttgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggg aattcaatgt gtctcgacag gggagacaca 2100 gtacgaatcg acataaggtg atcgtctgaa tcaccagaat aaataaagtc ggtgatagta 2160 atacgtaacg ataaagtaac ctgacagcag aaagtctccg agcctgtgca gggtcccaat 2220 ccgggattac acatgctggt taataccagt aattataatg agggagtcca aaaaacatct 2280 agaaataatt ttgtttaact ttaagaagga gatatacata tggaaaccta tgctgttttt 2340 ggtaatccga tagcccacag caaatcgcca ttcattcatc agcaatttgc tcagcaactg 2400 aatattgaac atccctatgg gcgcgtgttg gcacccatca atgatttcat caacacactg 2460 aacgctttct ttagtgctgg tggtaaaggt gcgaatgtga cggtgccttt taaagaagag 2520 gcttttgcca gagcggatga gcttactgaa cgggcagcgt tggctggtgc tgttaatacc 2580 ctcatgcggt tagaagatgg acgcctgctg ggtgacaata ccgatggtgt aggcttgtta 2640 agcgatctgg aacgtctgtc ttttatccgc cctggtttac gtattctgct tatcggcgct 2700 ggtggagcat ctcgcggcgt actactgcca ctcctttccc tggactgtgc ggtgacaata 2760 actaatcgga cggtatcccg cgcggaagag ttggctaaat tgtttgcgca cactggcagt 2820 attcaggcgt tgagtatgga cgaactggaa ggtcatgagt ttgatctcat tattaatgca 2880 acatccagtg gcatcagtgg tgatattccg gcgatcccgt catcgctcat tcatccaggc 2940 atttattgct atgacatgtt ctatcagaaa ggaaaaactc cttttctggc atggtgtgag 3000 cagcgaggct caaagcgtaa tgctgatggt ttaggaatgc tggtggcaca ggcggctcat 3060 gcctttcttc tctggcacgg tgttctgcct gacgtagaac cagttataaa gcaattgcag 3120 gaggaattgt ccgcgtgaag cttgccccga cacccgccaa cacccgctga cgcgccctga 3180 cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc 3240 atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3280 <210> 71 <211> 5368 <212> DNA <213> Artificial Sequence <220> <223> PoppA-aroE-tktA_plasmid sequences <400> 71 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60 cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620 agctttgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980 cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040 cgattcatta atgcagctgg cacgacaggg aattcaatgt gtctcgacag gggagacaca 2100 gtacgaatcg acataaggtg atcgtctgaa tcaccagaat aaataaagtc ggtgatagta 2160 atacgtaacg ataaagtaac ctgacagcag aaagtctccg agcctgtgca gggtcccaat 2220 ccgggattac acatgctggt taataccagt aattataatg agggagtcca aaaaacatct 2280 agaaataatt ttgtttaact ttaagaagga gatatacata tggaaaccta tgctgttttt 2340 ggtaatccga tagcccacag caaatcgcca ttcattcatc agcaatttgc tcagcaactg 2400 aatattgaac atccctatgg gcgcgtgttg gcacccatca atgatttcat caacacactg 2460 aacgctttct ttagtgctgg tggtaaaggt gcgaatgtga cggtgccttt taaagaagag 2520 gcttttgcca gagcggatga gcttactgaa cgggcagcgt tggctggtgc tgttaatacc 2580 ctcatgcggt tagaagatgg acgcctgctg ggtgacaata ccgatggtgt aggcttgtta 2640 agcgatctgg aacgtctgtc ttttatccgc cctggtttac gtattctgct tatcggcgct 2700 ggtggagcat ctcgcggcgt actactgcca ctcctttccc tggactgtgc ggtgacaata 2760 actaatcgga cggtatcccg cgcggaagag ttggctaaat tgtttgcgca cactggcagt 2820 attcaggcgt tgagtatgga cgaactggaa ggtcatgagt ttgatctcat tattaatgca 2880 acatccagtg gcatcagtgg tgatattccg gcgatcccgt catcgctcat tcatccaggc 2940 atttattgct atgacatgtt ctatcagaaa ggaaaaactc cttttctggc atggtgtgag 3000 cagcgaggct caaagcgtaa tgctgatggt ttaggaatgc tggtggcaca ggcggctcat 3060 gcctttcttc tctggcacgg tgttctgcct gacgtagaac cagttataaa gcaattgcag 3120 gaggaattgt ccgcgtgaaa agcttttaag ggcgtgccct tcatcatccg atctggagtc 3180 aaaatgtcct cacgtaaaga gcttgccaat gctattcgtg cgctgagcat ggacgcagta 3240 cagaaagcca aatccggtca cccgggtgcc cctatgggta tggctgacat tgccgaagtc 3300 ctgtggcgtg atttcctgaa acacaacccg cagaatccgt cctgggctga ccgtgaccgc 3360 ttcgtgctgt ccaacggcca cggctccatg ctgatctaca gcctgctgca cctcaccggt 3420 tacgatctgc cgatggaaga actgaaaaac ttccgtcagc tgcactctaa aactccgggt 3480 cacccggaag tgggttacac cgctggtgtg gaaaccacca ccggtccgct gggtcagggt 3540 attgccaacg cagtcggtat ggcgattgca gaaaaaacgc tggcggcgca gtttaaccgt 3600 ccgggccacg acatgtcga ccactacacc tacgccttca tgggcgacgg ctgcatgatg 3660 gaaggcatct cccacgaagt ttgctctctg gcgggtacgc tgaagctggg taaactgatt 3720 gcattctacg atgacaacgg tatttctatc gatggtcacg ttgaaggctg gttcaccgac 3780 gacaccgcaa tgcgtttcga agcttacggc tggcacgtta ttcgcgacat cgacggtcat 3840 gacgcggcat ctatcaaacg cgcagtagaa gaagcgcgcg cagtgactga caaaccttcc 3900 ctgctgatgt gcaaaaccat catcggtttc ggttccccga acaaagccgg tacccacgac 3960 tcccacggtg cgccgctggg cgacgctgaa attgccctga cccgcgaaca actgggctgg 4020 aaatatgcgc cgttcgaaat cccgtctgaa atctatgctc agtgggatgc gaaagaagca 4080 ggccaggcga aagaatccgc atggaacgag aaattcgctg cttacgcgaa agcttatccg 4140 caggaagccg ctgaatttac ccgccgtatg aaaggcgaaa tgccgtctga cttcgacgct 4200 aaagcgaaag agttcatcgc taaactgcag gctaatccgg cgaaaatcgc cagccgtaaa 4260 gcgtctcaga atgctatcga agcgttcggt ccgctgttgc cggaattcct cggcggttct 4320 gctgacctgg cgccgtctaa cctgaccctg tggtctggtt ctaaagcaat caacgaagat 4380 gctgcgggta actacatcca ctacggtgtt cgcgagttcg gtatgaccgc gattgctaac 4440 ggtatctccc tgcacggtgg cttcctgccg tacacctcca ccttcctgat gttcgtggaa 4500 tacgcacgta acgccgtacg tatggctgcg ctgatgaaac agcgtcaggt gatggtttac 4560 acccacgact ccatcggtct gggcgaagac ggcccgactc accagccggt tgagcaggtc 4620 gcttctctgc gcgtaacccc gaacatgtct acatggcgtc cgtgtgacca ggttgaatcc 4680 gcggtcgcgt ggaaatacgg tgttgagcgt caggacggcc cgaccgcact gatcctctcc 4740 cgtcagaacc tggcgcagca ggaacgaact gaagagcaac tggcaaacat cgcgcgcggt 4800 ggttatgtgc tgaaagactg cgccggtcag ccggaactga ttttcatcgc taccggttca 4860 gaagttgaac tggctgttgc tgcctacgaa aaactgactg ccgaaggcgt gaaagcgcgc 4920 gtggtgtcca tgccgtctac cgacgcattt gacaagcagg atgctgctta ccgtgaatcc 4980 gtactgccga aagcggttac tgcacgcgtt gctgtagaag cgggtattgc tgactactgg 5040 tacaagtatg ttggcctgaa cggtgctatc gtcggtatga ccaccttcgg tgaatctgct 5100 ccggcagagc tgctgtttga agagttcggc ttcactgttg ataacgttgt tgcgaaagca 5160 aaagaactgc tgtaattaaa gcttgcatgc ctgcaggtcg actctagagg atccccgggt 5220 accgagagct tgccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg 5280 ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg 5340 ttttcaccgt catcaccgaa acgcgcga 5368

Claims (8)

tyrR, ptsG, pykA, aroK, and aroL genes; tyrR, ptsG, pykA, aroK, aroL, and shiA genes; tyrR, ptsG, pykA, aroK, aroL, and ydiN genes; or a recombinant E. coli in which the tyrR, ptsG, pykA, aroK, aroL, shiA, and ydiN genes are inactivated. The method of claim 1,
Inactivation of the gene is that the gene is deleted (deletion) in the E. coli, recombinant E. coli. The method of claim 1,
The E. coli, galactose permease, PEP synthetase converting oxaloacetate to PEP, DAHP synthase A converting E4P to DAHP, DAHP synthetase B converting PEP to DAHP, DAHP It overexpresses DHQ synthetase and DHQ dehydratase that converts to DHQ, and the lacI gene encoding a lactose degradation inhibitory protein (lac repressor) is deleted, recombinant E. coli. According to claim 3, wherein the E. coli,
Introduced from foreign, galP gene coding for the galactose transmission enzyme, ppsA gene encoding the PEP synthase, aroG gene coding for the DAHP synthase A, aroF gene coding for the DAHP synthase B, the DHQ Synthesis Recombinant E. coli comprising the aroB gene encoding the enzyme, and the aroD gene encoding the DHQ dehydratase According to claim 1, wherein the E. coli,
aroE ; or aroE and tktA ; it contains a polynucleotide encoding each, and each upstream of the polynucleotide includes a ribosome binding site (rbs) derived from E. coli, and a polynucleotide encoding the aroE or tktA The recombinant E. coli, which is further transformed with a recombinant vector containing a promoter of the oppA gene upstream of the ribosome binding site of the first transcribed polynucleotide among the nucleotides. The method according to any one of claims 1 to 5,
The source strain of the recombinant E. coli is E. coli AB2834, recombinant E. coli. The method according to any one of claims 1 to 5,
The E. coli is shikimic acid (shikimic acid) production Yongin, recombinant E. coli. A method for producing shikimic acid, comprising the step of culturing the recombinant E. coli of any one of claims 1 to 5.

Images