CN106987649A - A kind of primer sets and detection method for being used to detect glioma - Google Patents

A kind of primer sets and detection method for being used to detect glioma Download PDF

Info

Publication number
CN106987649A
CN106987649A CN201710405289.9A CN201710405289A CN106987649A CN 106987649 A CN106987649 A CN 106987649A CN 201710405289 A CN201710405289 A CN 201710405289A CN 106987649 A CN106987649 A CN 106987649A
Authority
CN
China
Prior art keywords
primer
seq
pcr
reverse
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710405289.9A
Other languages
Chinese (zh)
Inventor
朱珍芳
陈婷婷
冯姜焜
李静
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Bo Kang Biotechnology Co Ltd
Original Assignee
Shanghai Bo Kang Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Bo Kang Biotechnology Co Ltd filed Critical Shanghai Bo Kang Biotechnology Co Ltd
Priority to CN201710405289.9A priority Critical patent/CN106987649A/en
Publication of CN106987649A publication Critical patent/CN106987649A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention is provided to detect the primer sets of glioma, primer of the invention includes SEQ ID No.1 SEQ ID No.14, can carry out joint-detection to CEA, CK8, EPCAM, Muc1, CK18, CK19, KLF4 gene.By PCR or quantitative fluorescent PCR method, Sensitive Detection expression and the expression of target gene can be gone out in a short time；Using the PCR conditions of optimization, by increasing the period of amplified reaction, make observation result more notable, further improve method applicability；Amplified production has specificity, it is ensured that PCR and fluorescence quantitative PCR detection high accuracy and sensitivity.

Description

A kind of primer sets and detection method for being used to detect glioma
Technical field
The present invention relates to oncogene field, and in particular to a kind of primer sets and detection side for being used to detect glioma Method.
Background technology
Glioma (alias：Glioma English：Glioma spongiocytoma) is also referred to as, is most common primary Central nerve neuroma, accounts for the half of all encephalic primary tumo(u)rs, broad sense refers to the tumour of all neuroepithelial origins, narrow Justice refers to the tumour for coming from all kinds of spongiocytes.The glioma death rate is very high, causes the reason for its case fatality rate remains high It is due to that glioma growth site is hidden, it is impossible to be immediately seen, early stage glioma symptom is not obvious, still lacks simple and practical Diagnostic method.Therefore the early diagnosis to glioma is very necessary.
The diagnostic method of current glioma includes imageological examination, cell pathology and histopathological diagnosis.Image Learning inspection includes lymphography, CT scan, nuclear magnetic resonance check etc., but its is less efficient and accuracy in detection is not high.It is logical Normal cell and histopathology include cell biopsy, it is necessary to be obtained by surgical operation or the method for puncture from patient Take the sample of tumor tissues.It is not only inconvenient, and human injury can be caused to patient, in some instances it may even be possible to cause puncture path tumour to turn Move.
Recently, detection of the appearance of circulating tumor cell (Circulating Tumor Cells, CTCs) detection to patient Bring new hope.CTCs is to depart from from tumor focus and the tumour cell in being displaced to blood, is malignant tumor patient art The major reason of recurrence and DISTANT METASTASES IN, is also the key factor for causing tumor patient dead afterwards.With other histological specimens such as Marrow etc. is compared, and periphery blood specimen is easily obtained, and small to patient trauma, is that clinically the ideal sample of conventional detection comes Source.CTCs detections contribute to the early diagnosis of tumour, judge patient's prognosis, assess the curative effect of antineoplastic and formulate individuation Therapeutic scheme.Compared with traditional diagnostic method, CTCs detections can more sensitively find the change of disease, and not have to patient Side effect.
CTC detection is generally carried out by extracting the blood of certain volume.Detection is divided into two classes, including does not capture (enrichment) Directly detection and first capture (enrichment) detects that latter of which is the detection method of main flow afterwards.The side that first capture (enrichment) is detected afterwards Method is also classified into two classes, i.e. key player on a team and negative choosing.Key player on a team is mainly (size, close by the physical property of CTC surface markers or cell Degree) captured；The former is to be based on biomolecular technology and microfluidic chip technology, and the latter is the principle based on filtering, centrifugation. Negative choosing is then to capture CTC indirectly by leukocyte surface markers thing.But had based on the method that first capture (enrichment) is detected afterwards Obvious defect.It depends critically upon the expression of tumor cell surface marker thing, therefore can not capture and do not express surface tumours mark Remember the CTC cells of thing.
Detect that the specific gene of CTC cells is another mode of CTC cell detections using RT-PCR method.It is first The blood of certain volume is first extracted, CTCs is enriched with by way of density gradient centrifugation, is then detected by way of RT-PCR The mRNA of specific gene, judges that CTCs whether there is with this, and by detecting that the change of CT values is quantitative to CTCs.This method inspection Survey CTCs expenses low, susceptibility is high, and easily automates.
The standard for detecting glioma CTCs using RT-PCR method at present is not completely set up also.We are by detecting brain The CTCs characterizing genes of patients with gliomas, determine glioma CTCs detection method and examination criteria.These detection methods and Establishment of standard contributes to the early diagnosis of tumor patient, judges patient's prognosis, assesses antineoplastic, including NK and CAR-T The curative effect and formulation individualized treatment scheme of immunization therapy.
In view of the above-mentioned problems, a kind of kit of highly sensitive polygene combined detection of present invention exploitation, is examined by combining Surveying CEA, CK8, EPCAM, Muc1, CK18, CK19 and KLF4, totally 7 genes realize early screening or the diagnosis of tumour.The present invention Targeting specific primer sets are used in design, increase substantially the sensitivity of detection.The recall rate of the detection method can reach 96%, Be provided simultaneously with sensitivity high, specificity is good, quick and precisely the advantages of.
The content of the invention
In view of the above-mentioned deficiencies in the prior art, it is an object of the present invention to provide it is a kind of be used for detect glioma primer sets and Detection method.
The purpose of the present invention is achieved through the following technical solutions：A kind of primer sets for being used to detect glioma, bag Contain：
The primer sets of the present invention can realize the detection of glioma by following two methods.
Method 1：PCR method.
(1) 7 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extraction Thing, reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, the condition of each circulation of PCR reactions is Celsius for 94 Degree, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；
(2) reverse transcription and PCR reactions are carried out, is detected with agarose gel electrophoresis method.
Method 2：Fluorescence quantifying PCR method
(1) 7 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extraction Thing, reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, Wherein, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Individual multiple holes；
(2) reverse transcription and PCR reactions are carried out, and detects fluorescence in real time；
(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.
The beneficial effects of the present invention are：The present invention is developed early for glioma by designing Specific PCR primers The polygene combined detection method of phase detection.The method：(1) set up PCR system can to CEA, CK8, EPCAM, Muc1, CK18, CK19 and KLF4 gene carry out joint-detection；(2) can by carrying out detection glioma recall rate to multiple genes simultaneously Reach 96%；(3) sensitivity is high, and the gene expression dose of as little as 1-5 copies can be detected；(4) specificity it is stronger, normal person or Non- Puncture in Brain Glioma Patients sample will not produce very strong non-specific signals；(5) detection speed is fast, simple to operate, low-cost.
Brief description of the drawings
Fig. 1 is healthy human peripheral blood pattern detection feminine gender PCR figures in embodiment.
Fig. 2 is non-glioma blood of cancer patients pattern detection feminine gender PCR figures in embodiment.
Fig. 3 is non-Patients with gliomas tissue samples detection feminine gender PCR figures in embodiment.
Fig. 4 is Patients with gliomas peripheral blood detection positive PCR figures in embodiment.
Fig. 5 is Patients with gliomas tumor tissues detection positive PCR figures in embodiment.
In figure, M.100bp marker；1.B2M；2.CEA；3.CK8；4.EPCAM；5.Muc1；6.CK18；7.CK19； 8.KLF4
Embodiment
The present invention is directed to main driven nature mutator in current tumour, joint-detection CEA, CK8, EPCAM, Muc1, Totally 7 genes realize early screening or the diagnosis of glioma by CK18, CK19 and KLF4.For current detection method sensitivity Low, detection process complexity is cumbersome, long the time required to detection, it is impossible to meet the actual demand of clinical detection.In view of the above-mentioned problems, setting Count out a whole set of specific primer group for detecting above-mentioned 7 genes.
Specificity amplification primer is designed according to the reference sequences of above-mentioned 7 genes, its optimal PCR primer length is in 180- Between 220bp, annealing temperature is not higher than 60 degree, and G/C content meets the requirement of general primer-design software between 40-60%. By using real-time fluorescence PCR reaction detection system, the highly sensitive detection of multiple gene associations, the following institute of its detection method are realized State.
The present invention is further described in conjunction with the accompanying drawings and embodiments., can be according to this area skill as do not specialized part Known to art personnel《Molecule can grand experiment guide》The third edition (Cold Spring Harbor laboratory Press), 《Cell experiment guide》(Science Press, Beijing, China, 2001),《RNA experimental technique handbooks》(Science Press, north Capital, China, 2004),《Immunoassay technology》Laboratory manual and this paper institutes such as (Science Press, Beijing, China, 1991) Listed method is implemented in the bibliography of reference.Wherein, (tape label) probe used, primer can entrust Shanghai to give birth to work Biotechnology Services Co., Ltd synthesizes.
With reference to embodiment, the invention will be further described.
Embodiment 1:Gene selects
Multiple studies have shown that, single-gene examination susceptibility is about 20-60%, is mostly used in the single of tumour early screening Genetic test, its detection sensitivity or specificity are relatively low, it is impossible to meet clinical needs.Can be effective using polygene combined detection The problem of susceptibility is low is solved, the degree of accuracy of tumour early screening and diagnosis is improved.
In order to improve the recall rate of infantile tumour, the cure rate of tumor patient is improved, improves patient's prognosis, we are to brain glue The difference expression gene of matter knurl and normal structure is screened.We by a large amount of control experiments find CEA, CK8, EPCAM, The genome of Muc1, CK18, CK19 and KLF4 composition has higher recall rate to glioma, reaches 96%.
Embodiment 2:Primer screening
(1) design primer a1~a3, b1~b3, c1~c3, d1~d3, e1~e3, f1~f3, g1~g3, be specially：Profit Target gene A-G sequences are analyzed with bioinformatics software, specific primer group is designed using sequence analysis software, are utilized Specificity of each pairing primer of NCBI primers search software detection in human genome, separately designs out 3 pairs of specific amplifications and draws Thing a1~a3, b1~b3, c1~c3, d1~d3, e1~e3, f1~f3, g1~g3；
Table 1：PCR detection primers
(2) processing of peripheral blood sample
Collect certain hospital to accept for medical treatment and the Patients with gliomas peripheral blood through proved by pathology, 7 points of early morning, on an empty stomach, through ulnar vein New blood is gathered, deposits in anticoagulant tube, shakes up, preservation≤4h under normal temperature.
Whole blood sample in anticoagulant tube is added isometric PBS (pH7.0) by 2.1, is centrifuged 5min in room temperature 3000rpm, is gone Except upper plasma；
2.2 add isometric ammonium chloride erythrocyte cracked liquid, after room temperature 200rpm centrifugations 8min is mixed, with 3000rpm Room temperature centrifuges 5min, supernatant discarding；
2.3 by lower floor's haemocyte and physiological saline according to volume ratio 1:2~2:After 1 mixing, Ficoll separating liquids are added, are mixed The volume ratio for closing liquid and Ficoll separating liquids is 1:2~2:1, centrifugal force is 700g, centrifuges 20~40min；
Supernatant is abandoned in 2.4 suctions, takes cell precipitation, is washed, that is, is obtained PBMC；
2.5 take PBMC to be used for nucleic acid extraction, and unnecessary PBMC is resuspended with RNA protective agents, is stored in -20 degree.
(3) extraction of nucleic acid
3.1 take not more than 5 × 105PBMC, add 250 μ L Buffer RLT Plus, piping and druming mix；
Lysate is transferred to gDNA by 3.2 to be removed in centrifugal type post, 8000 × g (10,000rpm) centrifugations 30s.Collect stream Liquid is worn, centrifugal column is abandoned；
70% ethanol (350 μ L) of 3.3 1 times of volume of addition is to flowing through in liquid, and piping and druming is mixed；
Sample is transferred to RNeasyMinElute centrifugal columns by 3.4, covers tightly lid, 8000 × g (10,000rpm) centrifugations 15s, abandoned stream wears liquid；
3.5 add 700 μ L Buffer RW1 in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10, 15s 000rpm) is centrifuged, abandoned stream wears liquid；
3.6 add 500 μ L Buffer RPE in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10, 15s 000rpm) is centrifuged, abandoned stream wears liquid；
3.7 are placed in RNeasyMinElute centrifugal columns in new 2mL collecting pipes, open lid, centrifugation 5min, makes at full speed Ethanol volatilizees；
3.8 are placed in RNeasyMinElute centrifugal columns in new 1.5mL collecting pipes, add 20 μ LRNase-free H2O, covers tightly lid, at full speed centrifugation 1min eluted rnas.
(4) template cDNA acquisition
4.1 accurately measure sample RNA concentration；
4.2 prepare reverse transcription system on ice in strict accordance with cDNA reverse transcription reagent box specifications；
Composition Volume
5×Mix 8μL
RNA 500ng
RNase-free H2O To 40 μ L
4.3 mix above reaction system, and utilize the of short duration centrifugation of centrifuge, and 55 degree of 20min, 85 degree of 2min obtain template cDNA；
(5) regular-PCR is expanded
Reaction system is configured with Taq archaeal dna polymerases, with primer be a-g and people's reference gene (B2M) enters performing PCR amplification respectively Sample, 1% gel detection of product；Amplification system is as follows：
Composition Volume
2×Mix 10μL
cDNA 1μL
Primer-F 0.8μL
Primer-R 0.8μL
RNase-free H2O 7.4μL
PCR reaction conditions are：95 DEG C of pre-degenerations 3 minutes, 1 circulation；95 DEG C are denatured 20 seconds, and 55 DEG C are annealed 20 seconds, 72 DEG C Extension 10 seconds, 35 circulations；72 DEG C extend 7 minutes.
(6) fluorescence real-time quantitative PCR is expanded
Special according to design draws a group a-g, is expanded by quantitative fluorescent PCR, system is as follows：
PCR reaction conditions are：95 DEG C of pre-degeneration 20s, 1 circulation；95 DEG C of 10s, 60 DEG C of 30s, 40 circulations；Often pipe is set up Three multiple holes；
According to step 5 and 6 pcr results, following primer sets are filtered out, are used to detect drawing for glioma as the present invention Thing group.
Embodiment 3：Compliance test result
According to the selection result of embodiment 2,100 tumor samples are detected using the primer sets of following table.
Sequence number Polygene combined detection Recall rate
1 CEA, CK8, EPCAM and Muc1 70%
2 CEA, CK8, EPCAM, Muc1 and CK18 75%
3 CEA, CK8, EPCAM, Muc1, CK18 and KLF4 83%
4 CEA, CK8, EPCAM, Muc1, CK18, CK19 and KLF4 96%
5 CEA, CK8, EPCAM, Muc1, CK18, CK19 and EGFR 82%
6 CEA, CK8, EPCAM, Muc1, CK18, CK19 and hTERT 84%
Wherein, CEA forward primer is ACAGTCACGACGATCACAGT, and reverse primer is CAGCTGCAGCCTGGGACTGA；
CK8 forward primer is GAGCTAGACAAGTACTGGTC, and reverse primer is CCTCAGGCTGTTCTCCAAGC；
EPCAM forward primer is AATGATGTGGACATAGCTGA, and reverse primer is TAGACCCTGCATTGAGAATT；
Muc1 forward primer is GCCTCTCGATATAACCTGAC, and reverse primer is TCGGCGGCACTGACAGACAG；
CK18 forward primer is GAGCTAGACAAGTACTGGTC, and reverse primer is CCTCAGGCTGTTCTCCAAGC；
CK19 forward primer is AGCTGGCCTACCTGAAGAAG, and reverse primer is AGGCTTCAGCATCCTTCCGG；
KLF4 forward primer is CGGGAAGGGAGAAGACACTG, and reverse primer is GGTTGCTACCGCCGCAAGCC；
The recall rate of 1~No. 6 primer sets as shown above, as can be seen from the table, in primer sets, with primer quantity Increase, can improve its recall rate to a certain extent.Further, by comparing 1~No. 6 primer sets it can be found that primer Combination in group has a major impact for the height of recall rate.Simultaneously in the case of identical detection gene dosage, No. 4 primer sets Recall rate higher than 5~No. 6 primer sets.Therefore, the assortment of genes of our preferably No. 4 primer sets is used for the detection of glioma. Further found by studying, in No. 4 primer sets, EPCAM, CK8, CK18, CK19 expression can point out epithelial cell origin CK18 and CK19 is considered as having diagnosis of metastasis value in tumour, CK various ingredients；MUC1 in tumor tissues more to be occurred Unconventionality expression, plays an important role in the progress of inflammation and tumour；KLF4 is the dryness molecule of tumour cell, the height of expression It is low directly related with tumour grade malignancy.7 pairs of primer sets complement each other so that recall rate is improved significantly.To sum up institute State, the gene selected in this patent is related in terms of the metabolism of tumour, propagation, invasion and attack, more can comprehensively detect brain colloid The cell biological characteristics of knurl.
Embodiment 4：Specificity analysis
According to the selection result of embodiment 3, using No. 4 primer sets to normal person's peripheral blood sample (Fig. 1), non-glioma The peripheral blood (Fig. 2) of patient, the tumor tissues (Fig. 3) of non-Patients with gliomas are detected.1-8 genes are respectively in figure： CEA, CK8, EPCAM, Muc1, CK18, CK19 and KLF4 testing result as Figure 1-5, described primer sets as seen from the figure In the tissue of normal human peripheral blood (Fig. 1), the peripheral blood (Fig. 2) of non-Puncture in Brain Glioma Patients and non-Puncture in Brain Glioma Patients (Fig. 3) It is not detected by stronger gene expression.Can in the peripheral blood sample (Fig. 4) and tissue samples (Fig. 5) of Puncture in Brain Glioma Patients Detect the strongly expressed of multiple genes, respectively 4/7 and 7/7, illustrate that primer sets described in this patent have the specificity of height.
SEQUENCE LISTING
<110>Shanghai Bo Kang bio tech ltd
<120>A kind of primer sets and detection method for being used to detect glioma
<160> 14
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 1
acagtcacga cgatcacagt 20
<210> 2
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 2
cagctgcagc ctgggactga 20
<210> 3
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 3
gagctagaca agtactggtc 20
<210> 4
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 4
cctcaggctg ttctccaagc 20
<210> 5
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 5
aatgatgtgg acatagctga 20
<210> 6
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 6
tagaccctgc attgagaatt 20
<210> 7
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 7
gcctctcgat ataacctgac 20
<210> 8
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 8
tcggcggcac tgacagacag 20
<210> 9
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 9
gagctagaca agtactggtc 20
<210> 10
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 10
cctcaggctg ttctccaagc 20
<210> 11
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 11
agctggccta cctgaagaag 20
<210> 12
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 12
aggcttcagc atccttccgg 20
<210> 13
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 13
cgggaaggga gaagacactg 20
<210> 14
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 14
ggttgctacc gccgcaagcc 20

Claims (3)

1. a kind of primer sets for being used to detect glioma, it is characterised in that the primer sets include a~g7 to primer, described Primer a forward primer is as shown in SEQ ID No.1, and primer a reverse primer is as shown in SEQ ID No.2, primer b forward direction Primer is as shown in SEQ ID No.3, and primer b reverse primer is as shown in SEQ ID No.4, primer c forward primer such as SEQ Shown in ID No.5, primer c reverse primer is as shown in SEQ ID No.6, primer d forward primer such as SEQ ID No.7 institutes Show, primer d reverse primer as shown in SEQ ID No.8, primer e forward primer as shown in SEQ ID No.9, primer e's Reverse primer is as shown in SEQ ID No.10, and primer f forward primer is as shown in SEQ ID No.11, primer f reverse primer As shown in SEQ ID No.12, primer g forward primer is as shown in SEQ ID No.13, primer g reverse primer such as SEQ ID Shown in No.14.
2. a kind of PCR detection method for being used to detect glioma, it is characterised in that comprise the following steps：
(1) 7 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive, Reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, PCR reaction each circulation condition for 94 degrees Celsius, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；
(2) reverse transcription and PCR reactions are carried out, is detected with agarose gel electrophoresis method.
3. a kind of fluorescent quantitative PCR detection method for being used to detect glioma, it is characterised in that comprise the following steps：
(1) 7 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive, Reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, its In, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Multiple holes；
(2) reverse transcription and PCR reactions are carried out, and detects fluorescence in real time；
(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.
CN201710405289.9A 2017-05-31 2017-05-31 A kind of primer sets and detection method for being used to detect glioma Pending CN106987649A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710405289.9A CN106987649A (en) 2017-05-31 2017-05-31 A kind of primer sets and detection method for being used to detect glioma

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710405289.9A CN106987649A (en) 2017-05-31 2017-05-31 A kind of primer sets and detection method for being used to detect glioma

Publications (1)

Publication Number Publication Date
CN106987649A true CN106987649A (en) 2017-07-28

Family

ID=59421435

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710405289.9A Pending CN106987649A (en) 2017-05-31 2017-05-31 A kind of primer sets and detection method for being used to detect glioma

Country Status (1)

Country Link
CN (1) CN106987649A (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004024957A3 (en) * 2002-09-12 2004-07-29 Yissum Res And Dev Method for detection of micro-metastasis
CN103122387A (en) * 2013-02-05 2013-05-29 苏州华益美生物科技有限公司 Rapid circulating tumor cell (CTCs) fluorescence PCR (Polymerase Chain Reaction) hypersensitivity detection kit and application thereof
US20130171621A1 (en) * 2010-01-29 2013-07-04 Advanced Cell Diagnostics Inc. Methods of in situ detection of nucleic acids
CN103792364A (en) * 2012-10-31 2014-05-14 张宝弘 Reagent for detection of ROR1 protein of circulating tumor cells in peripheral blood and application thereof
CN103874770A (en) * 2011-08-08 2014-06-18 卡里斯生命科学卢森堡控股有限责任公司 Biomarker compositions and methods
CN103866016A (en) * 2014-03-07 2014-06-18 复旦大学附属中山医院 Circulating tumor cell detection kit and application thereof
WO2014193999A2 (en) * 2013-05-28 2014-12-04 Caris Science, Inc. Biomarker methods and compositions
CN104774959A (en) * 2015-04-27 2015-07-15 刘志东 Kit for detecting blood circulation tumor cells
CN106544416A (en) * 2016-10-14 2017-03-29 浙江大学 A kind of primer sets and detection method for detecting gastric cancer

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004024957A3 (en) * 2002-09-12 2004-07-29 Yissum Res And Dev Method for detection of micro-metastasis
US20130171621A1 (en) * 2010-01-29 2013-07-04 Advanced Cell Diagnostics Inc. Methods of in situ detection of nucleic acids
CN103874770A (en) * 2011-08-08 2014-06-18 卡里斯生命科学卢森堡控股有限责任公司 Biomarker compositions and methods
CN103792364A (en) * 2012-10-31 2014-05-14 张宝弘 Reagent for detection of ROR1 protein of circulating tumor cells in peripheral blood and application thereof
CN103122387A (en) * 2013-02-05 2013-05-29 苏州华益美生物科技有限公司 Rapid circulating tumor cell (CTCs) fluorescence PCR (Polymerase Chain Reaction) hypersensitivity detection kit and application thereof
WO2014193999A2 (en) * 2013-05-28 2014-12-04 Caris Science, Inc. Biomarker methods and compositions
CN103866016A (en) * 2014-03-07 2014-06-18 复旦大学附属中山医院 Circulating tumor cell detection kit and application thereof
CN104774959A (en) * 2015-04-27 2015-07-15 刘志东 Kit for detecting blood circulation tumor cells
CN106544416A (en) * 2016-10-14 2017-03-29 浙江大学 A kind of primer sets and detection method for detecting gastric cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
FENG GE等: "Enhanced detection and comprehensive in situ phenotypic characterization of circulating and disseminated heteroploid epithelial and glioma tumor cells", 《ONCOTARGET》 *
JOHAN M. KROS等: "Circulating glioma biomarkers", 《NEURO-ONCOLOGY》 *
KIRSTEN HATTERMAN等: "Stem cell markers in glioma progression and recurrence", 《INTERNATIONAL JOURNAL OF ONCOLOGY》 *
RANA FALAHAT等: "A Cell ELISA for the quantification of MUC1 mucin (CD227) expressed by cancer cells of epithelial and neuroectodermal origin", 《CELLULAR IMMUNOLOGY》 *

Similar Documents

Publication Publication Date Title
CN107663533A (en) A kind of lung cancer EGFR L858R and 19Del ddPCR detection methods and application
CN108277263A (en) A kind of the primer combination of probe object and its detection method of detection BRAF gene V600E
CN103074431B (en) Special primer, kit and method for testing minRNA-128 in colorectal cancer serum
CN106399527A (en) Primer group for detecting renal cancer and detecting method thereof
CN107475363A (en) Biomarker combination, the screening and its application of biomarker combination of a kind of non-small cell lung cancer
RU2012121874A (en) DIAGNOSTIC METHODS FOR DETERMINING THE FORECAST OF NON-SMALL CELL LUNG CANCER
CN106520924A (en) Primer set and detection method for detecting ovarian cancer
CN105648075A (en) Liver cancer diagnosis composition and kit containing same
CN106834447A (en) A kind of primer sets and detection method for detecting neuroblastoma
KR102211972B1 (en) Method for early diagnosis of breast cancer and monitoring after treatment using liquid biopsy multi-cancer gene biomarkers
CN103602747B (en) Internal reference substance for detecting bladder cancer serum miRNA and its detection primers and use
CN106755309A (en) Application of the molecular marked compound in cancer of pancreas prognosis evaluation product is prepared
CN106544416A (en) A kind of primer sets and detection method for detecting gastric cancer
CN106636440B (en) Blood plasma microRNAs is used to prepare the purposes of the diagnostic reagent of patients with lung adenocarcinoma in sieving and diagnosis male population
CN110257514A (en) A kind of new cancer of the esophagus blood miRNA marker and its application
CN106755459A (en) A kind of primer sets and detection method for detecting breast cancer
CN106987649A (en) A kind of primer sets and detection method for being used to detect glioma
CN105219841A (en) The detection kit of a kind of lung cancer differential expression microRNA and application thereof
CN106498041A (en) A kind of primer sets and detection method for detecting cervical cancer
CN107326092A (en) Applications and colorectal cancer detection kit of the related miRNA of colorectal cancer as biomarker
CN104073432B (en) Kit for detecting liver cancer marker nucleic acid molecules and detection method of kit
CN106434936A (en) Primer group used for detecting lung cancer and detection method thereof
CN102021169A (en) Serum/plasma miRNA composition and use thereof
CN106701954A (en) Primer group for detecting liver cancer and detection method
CN111690746A (en) Platelet RNA marker related to lung cancer and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20170728

RJ01 Rejection of invention patent application after publication