CN106520924A - Primer set and detection method for detecting ovarian cancer - Google Patents

Abstract

The present invention provides a primer set and a detection method for detecting ovarian cancer. According to the present invention, the primers comprise SEQ ID No.1-SEQ ID No.16, and can perform combined detection on genes such as CK19, MUC1, ERCC1, HER2, Survivin, CK7, CA125, and CK20; through PCR or fluorescence quantitative PCR, the expression and the expression level of the target gene can be sensitively detected in a short time; by using the optimized PCR conditions and increasing the amplification reaction cycle number, the observation result is significant, and the applicability of the method is further improved; the amplification product has specificity so as to ensure the high accuracy and the high sensitivity of the PCR detection and the fluorescence quantitative PCR detection; and with the primer set for the ovarian cancer detection, by detecting the expression of the target gene in the patient sample, the ovarian cancer can be simple and conveniently diagnosed.

Description

A kind of primer sets and detection method for detecting oophoroma

Technical field

The present invention relates to oncogene field, and in particular to a kind of primer sets and detection method for detecting oophoroma.

Background technology

Malignant tumor of ovary, also known as oophoroma, is one of common tumour of female sex organ, and the incidence of disease is only second to uterus Neck cancer and carcinoma of uterine body and arrange the 3rd, residence.But because oophoroma causes the dead, the first place of all kinds of gynecological tumors is but accounted for, to women's life Cause serious threat.The reason for causing its case fatality rate high is as malignant tumor of ovary growth site is hidden, it is impossible to straight Connect and see, early stage malignant tumor of ovary symptom is not obvious, still lacks simple and practical diagnostic method.Therefore the early stage to oophoroma Diagnosis is very necessary.

The diagnostic method of oophoroma includes imaging examination, cell pathology and HD at present.Iconography Inspection includes lymphography, CT scan, nuclear magnetic resonance check, hysteroscopy etc., but which is less efficient and detection is accurate Degree is not high.Common cell and histopathology include cell biopsy, need the method by surgical operation or puncture The sample of tumor tissues is obtained from patient.It is not only inconvenient, and human injury can be caused to patient, in some instances it may even be possible to cause to wear Thorn road metastases.

Recently, detection of the appearance that circulating tumor cell (Circulating Tumor Cells, CTCs) is detected to patient Bring new hope.CTCs is to depart from and be displaced to the tumour cell in blood from tumor focus, is malignant tumor patient art The major reason of recurrence and DISTANT METASTASES IN, and the key factor for causing tumor patient dead afterwards.With other histological specimens such as Marrow etc. is compared, and periphery blood specimen is easily obtained, and little to patient trauma, is that clinically the ideal sample of conventional detection comes Source.CTCs detections contribute to the early diagnosis of tumour, judge patient's prognosis, the curative effect of assessment antineoplastic and formulate individuation Therapeutic scheme.Compared with traditional diagnostic method, CTCs detections can more sensitively find the change of disease, and patient is not had There is side effect.

The detection of CTC is generally carried out by extracting the blood of certain volume.Detection is divided into two classes, including not capturing (be enriched with) Direct detection and first capture (enrichment) detect afterwards, latter of which for main flow detection method.The side that (enrichment) is detected afterwards is captured first Method is also classified into two classes, i.e. key player on a team and negative choosing.Key player on a team is mainly (size, close by the physical property of CTC surface markers or cell Degree) captured；The former is that, based on biomolecular technology and microfluidic chip technology, the latter is based on the principle for filtering, be centrifuged. Negative choosing is then to capture indirectly CTC by leukocyte surface markers thing.But had based on the method that first capture (enrichment) is detected afterwards Obvious defect.It depends critically upon the expression of tumor cell surface marker thing, therefore cannot capture and do not express surface tumours mark The CTC cells of note thing.

It is another mode of CTC cell detections using the specific gene of the method detection CTC cells of RT-PCR.It is first The blood of certain volume is first extracted, CTCs is enriched with by way of density gradient centrifugation, is then detected by way of RT-PCR With this, the mRNA of specific gene, judges that CTCs whether there is, and quantitative to CTCs by detecting the change of CT values.This method inspection Survey CTCs expenses low, susceptibility is high, and easily automates.

Detect that the standard of oophoroma CTCs does not also completely set up using RT-PCR method at present.We are by detecting ovary The CTCs characterizing genes of cancer patient, determine detection method and the examination criteria of oophoroma CTCs.These detection methods and standard Foundation contributes to the early diagnosis of tumor patient, judges patient's prognosis, assessment antineoplastic, controls including NK and CAR-T immunity The curative effect and formulation individualized treatment scheme for the treatment of.

For the problems referred to above, a kind of kit of high-sensitive polygene combined detection of present invention exploitation, by combining inspection Survey CK19, MUC1, ERCC1, HER2, Survivin, CK7, CA125 and CK20 totally 8 genes realize tumour early screening or Diagnosis.Present invention design increases substantially the sensitivity of detection with targeting specific primer sets.The recall rate of the detection method Can reach 95%, be provided simultaneously with that sensitivity is high, specificity is good, quick and precisely the advantages of.

The content of the invention

Present invention aims to the deficiencies in the prior art, there is provided a kind of primer sets and inspection for detecting oophoroma Survey method.

The purpose of the present invention is achieved through the following technical solutions：A kind of primer sets for detecting oophoroma, comprising：

The primer sets of the present invention can realize the detection of oophoroma by following two methods.

Method 1：PCR method.

(1) 8 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extraction Thing, reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, the condition of each circulation of PCR reactions is 94 Celsius Degree, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；

(2) reverse transcription and PCR reactions is carried out, is detected with agarose gel electrophoresis method.

Method 2：Fluorescence quantifying PCR method

(1) 8 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extraction Thing, reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, Wherein, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Individual multiple holes；

(2) reverse transcription and PCR reactions, and real-time detection fluorescence are carried out；

(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.

The beneficial effects of the present invention is：The present invention is developed for oophoroma early stage by designing Specific PCR primers The polygene combined detection method of detection.The method：(1) PCR system set up can to CK19, MUC1, ERCC1, HER2, Survivin, CK7, CA125 and CK20 gene carries out joint-detection；(2) by carrying out detection oophoroma to multiple genes simultaneously Recall rate can reach 95%；(3) sensitivity is high, and the gene expression dose of as little as 1-5 copies can be detected；(4) specificity is relatively strong, Normal person or non-human ovarian cancer patients' sample will not produce very strong non-specific signals；(5) detection speed is fast, simple to operate, takes With cheap.

Description of the drawings

Fig. 1 is healthy human peripheral blood pattern detection feminine gender PCR figures in embodiment.

Fig. 2 is non-oophoroma tumor peripheral blood in patients pattern detection feminine gender PCR figures in embodiment.

Fig. 3 is non-ovarian cancer patients tissue samples detection feminine gender PCR figures in embodiment.

Fig. 4 is ovarian cancer patients peripheral blood detection positive PCR figures in embodiment.

Fig. 5 is ovarian cancer patients tumor tissues detection positive PCR figures in embodiment.

In figure, M.100bp marker；1.B2M；2.CK19；3.MUC1；4.ERCC1；5.HER2；6.Survivin； 7.CK7；8.CA125.

Specific embodiment

The present invention for main driven nature mutator in current tumour, joint-detection CK19, MUC1, ERCC1, Totally 8 genes realize early screening or the diagnosis of oophoroma for HER2, Survivin, CK7, CA125 and CK20.For detection at present Method sensitivity is low, and detection process complexity is loaded down with trivial details, long the time required to detection, it is impossible to meet the actual demand of clinical detection.For The problems referred to above, design a whole set of specific primer group for detecting above-mentioned 8 genes.

Specificity amplification primer is designed according to the reference sequences of above-mentioned 8 genes, its PCR primer length optimum is in 180- Between 200bp, not higher than 60 degree of annealing temperature, G/C content meets the requirement of general primer-design software between 40-60%. By using real-time fluorescence PCR reaction detection system, realizing the highly sensitive detection of multiple gene associations, the following institute of its detection method State.

The present invention is further described in conjunction with the accompanying drawings and embodiments.As do not specialized part, can be according to this area skill Familiar to art personnel institute《Molecule can grand experiment guide》The third edition (Cold Spring Harbor laboratory Press), 《Cell experiment guide》(Science Press, Beijing, China, calendar year 2001),《RNA experimental technique handbooks》(Science Press, north Capital, China, 2004),《Immunoassay technology》1991) (Science Press, Beijing, China, laboratory manual and this paper institutes such as In the bibliography of reference, listed method is implementing.Wherein, (tape label) probe used, primer can entrust Shanghai life work Biotechnology Services Co., Ltd synthesizes.

With reference to embodiment, the invention will be further described.

Embodiment 1:Gene selects

Multiple studies have shown that, single-gene examination susceptibility is about 20-60%, is mostly used in the single of tumour early screening Genetic test, its detection sensitivity or specificity it is low, it is impossible to meet clinical needs.Can be effective using polygene combined detection Solve the problems, such as that susceptibility is low, improve the degree of accuracy of tumour early screening and diagnosis.In order to improve the recall rate of infantile tumour, carry The cure rate of high tumor patient, improves patient's prognosis, and we are sieved the difference expression gene to oophoroma and normal structure Choosing.We have found CK19, MUC1, ERCC1, HER2, Survivin, CK7, CA125 and CK20 composition by a large amount of control experiments Genome to oophoroma have higher recall rate, reach 95%, relative to existing detection technique, generate unexpected Technique effect, with significant progressive.

Embodiment 2:Primer screening

(1) primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3, tool are designed Body is：Target gene A-H sequences are analyzed using bioinformatics software, specific primer is designed using sequence analysis software Group, using NCBI primers search software detection it is each pairing specificity of the primer in human genome, separately design out 3 pairs it is specific Amplimer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3；

Table 1：PCR detection primers

(2) process of peripheral blood sample

The ovarian cancer patients peripheral blood that certain hospital accepts simultaneously Jing proved by pathology for medical treatment is collected, in 7 points of early morning, on an empty stomach, Jing ulnar veins are adopted Collection new blood, deposits in anticoagulant tube, shakes up, preservation≤4h under normal temperature.

Whole blood sample in anticoagulant tube is added equal-volume PBS (pH7.0) by 2.1,5min is centrifuged in room temperature 3000rpm, goes Except upper plasma；

2.2 add equal-volume ammonium chloride erythrocyte cracked liquid, after room temperature 200rpm centrifugation 8min is mixed, with 3000rpm Room temperature is centrifuged 5min, supernatant discarded；

2.3 by lower floor's haemocyte and physiological saline according to volume ratio 1:2～2:After 1 mixing, Ficoll separating liquids are added, mixed The volume ratio that liquid is closed with Ficoll separating liquids is 1:2～2:1, centrifugal force is 700g, and 20～40min is centrifuged；

Supernatant is abandoned in 2.4 suctions, takes cell precipitation, is washed, that is, is obtained PBMC；

2.5 take PBMC for nucleic acid extraction, and unnecessary PBMC is resuspended with RNA protective agents, are stored in -20 degree.

(3) extraction of nucleic acid

3.1 take not more than 5 × 10⁵PBMC, add 250 μ L Buffer RLT Plus, piping and druming mix；

Lysate is transferred to gDNA by 3.2 to be removed in centrifugal type post, 8000 × g (10,000rpm) centrifugation 30s.Collect stream Liquid is worn, centrifugal column is abandoned；

To flowing through in liquid, piping and druming is mixed 70% ethanol (350 μ L) of 3.3 1 times of volume of addition；

Sample is transferred to RNeasyMinElute centrifugal columns by 3.4, covers tightly lid, 8000 × g (10,000rpm) centrifugations 15s, abandoned stream wear liquid；

3.5 add 700 μ L Buffer RW1 in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10, 15s is centrifuged 000rpm), abandoned stream wears liquid；

3.6 add 500 μ L Buffer RPE in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10, 15s is centrifuged 000rpm), abandoned stream wears liquid；

3.7 are placed in RNeasyMinElute centrifugal columns in new 2mL collecting pipes, open lid, and centrifugation 5min, makes at full speed Ethanol volatilizees；

3.8 are placed in RNeasyMinElute centrifugal columns in new 1.5mL collecting pipes, add 20 μ LRNase-free H₂O, covers tightly lid, at full speed centrifugation 1min eluted rnas.

(4) acquisition of template cDNA

4.1 accurately measure sample RNA concentration；

4.2 prepare reverse transcription system in strict accordance with cDNA reverse transcription reagent box specifications on ice；

Composition	Volume
		5×Mix	8μL
RNA	500ng
		RNase-free H2O	To 40 μ L

4.3 mix above reaction system, and utilize the of short duration centrifugation of centrifuge, and 55 degree of 20min, 85 degree of 2min obtain template cDNA；

(5) regular-PCR amplification

Reaction system is configured with Taq archaeal dna polymerases, with primer be a-h and people's reference gene (B2M) enters performing PCR amplification respectively Sample, 1% gel detection of product；Amplification system is as follows：

Composition	Volume
		2×Mix	10μL
cDNA	1μL
		Primer-F	0.8μL
Primer-R	0.8μL
		RNase-free H2O	7.4μL

PCR reaction conditions are 95 DEG C of denaturations 3 minutes, 1 circulation；95 DEG C of denaturation 20 seconds, 55 DEG C are annealed 20 seconds, and 72 DEG C are prolonged Stretch 10 seconds, 35 circulations；72 DEG C extend 7 minutes.

(6) fluorescence real-time quantitative PCR amplification

Specifically draw a group a-h according to what is designed, expanded by quantitative fluorescent PCR, system is as follows：

Composition	Volume
		2×ChamQ SYBR qPCR Master Mix	10μL
cDNA	2μL
		Primer-F	0.4μL
Primer-R	0.4μL
		RNase-free H2O	7.2μL
Total	20μL

95 DEG C of denaturations 20s, 1 circulation；95 DEG C of 10s, 60 DEG C of 30s, 40 circulations；Often pipe sets up three multiple holes；

According to step 5 and 6 pcr results, following primer sets are filtered out, be used for detecting the primer of oophoroma as the present invention Group.

Embodiment 3：Compliance test result

According to the selection result of embodiment 2,100 tumor samples are detected using the primer sets described in following table.

Wherein, the forward primer of EPCAM is AATGATGTGGACATAGCTGA, and reverse primer is The forward primer of TAGACCCTGCATTGAGAATT, CD24 is CACTGCTCCTACCCACGCAG, and reverse primer is The forward primer of GCAGAAGAGAGAGTGAGACC, CEA is ACAGTCACGACGATCACAGT, and reverse primer is CAGCTGCAGCCTGGGACTGA。

The recall rate of 1～No. 7 primer sets as shown above, as can be seen from the table, in primer sets, with primer quantity Increase, its recall rate can be improved to a certain extent.Further, by comparing 4～No. 7 primer sets it is found that primer Combination in group is had a major impact for the height of recall rate.Simultaneously in the case of identical detection gene dosage, No. 4 primer sets Recall rate be higher than 5～No. 7 primer sets.Therefore, the assortment of genes of our preferably No. 4 primer sets is used for the detection of oophoroma.Enter One step finds that by studying, in No. 4 primer sets, CK7, CK19, the expression of CK20 can point out the tumour of epithelial cell origin, CK's In various ingredients, CK19 and CK20 is considered as having diagnosis of metastasis to be worth；MUC1 in tumor tissues more there is unconventionality expression, Play an important role in the progress of inflammation and tumour；HER2 is a kind of oncogene of cell derived, also known as proto-oncogene, ginseng With cell growth, differentiation regulation；ERCC1 is the important symbol of signal tumor prognosis and platinum class resistance, is had in oncotherapy Important function；Survivin is the important member in survivin family, adjust cell division, cellular stress, Play a crucial role in the activation of cell cycle checkpoint, enterprise schema, cytokine activation and different cell-signaling pathways, quilt It is considered the most strong survivin for finding so far.From the foregoing, it will be observed that the present invention is not simply to fold 8 pairs of primers Plus combine, 8 pairs of primers complement each other, functionally support one another so that recall rate is improved significantly, and achieve and expect not The technique effect for arriving.In sum, in the present invention, the gene that selects is related to the aspects such as the metabolism of tumour, propagation, invasion and attack, can be more The cell biological characteristics of oophoroma are detected comprehensively.

Embodiment 4：Specificity analysis

According to the selection result of embodiment 2, using the primer sets described in upper table to normal person's peripheral blood sample (Fig. 1), non- The peripheral blood (Fig. 2) of ovarian cancer patients, the tumor tissues (Fig. 3) of non-ovarian cancer patients are detected.1-9 genes difference in figure For：1.B2M；2.CK19；3.MUC1；4.ERCC1；5.HER2；6.Survivin；7.CK7；8.CA125.Testing result such as Fig. 1- Shown in 5, described primer sets are in normal human peripheral blood (Fig. 1), the peripheral blood (Fig. 2) of non-human ovarian cancer patients and non-as seen from the figure In the tissue of human ovarian cancer patients, (Fig. 3) is not detected by stronger gene expression.In the peripheral blood sample (figure of human ovarian cancer patients 4) and can detect that the strongly expressed of multiple genes in tissue samples (Fig. 5), respectively 5/8 and 8/8, illustrate heretofore described drawing Thing group has the specificity of height.

Claims (3)

1. a kind of primer sets for detecting oophoroma, it is characterised in that the primer sets can be comprising a～h8 to primer, institute The forward primer of primer a is stated as shown in SEQ ID No.1, as shown in SEQ ID No.2, primer b is just for the reverse primer of primer a To primer as shown in SEQ ID No.3, the reverse primer of primer b as shown in SEQ ID No.4, the forward primer such as SEQ of primer c Shown in ID No.5, the reverse primer of primer c as shown in SEQ ID No.6, the forward primer such as SEQ ID No.7 institutes of primer d Show, the reverse primer of primer d as shown in SEQ ID No.8, the forward primer of primer e as shown in SEQ ID No.9, primer e's Reverse primer as shown in SEQ ID No.10, the forward primer of primer f as shown in SEQ ID No.11, the reverse primer of primer f As shown in SEQ ID No.12, the forward primer of primer g as shown in SEQ ID No.13, the reverse primer such as SEQ ID of primer g Shown in No.14, the forward primer of primer h as shown in SEQ ID No.15, the reverse primer such as SEQ ID No.16 institutes of primer h Show.

2. a kind of PCR detection method for detecting oophoroma, it is characterised in that comprise the steps：

(1) 8 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive, Reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, PCR reaction each circulation condition be 94 degrees Celsius, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；

(2) reverse transcription and PCR reactions is carried out, is detected with agarose gel electrophoresis method.

3. a kind of fluorescent quantitative PCR detection method for detecting oophoroma, it is characterised in that comprise the steps：

(1) 8 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive, Reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, its In, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Multiple holes；

(2) reverse transcription and PCR reactions, and real-time detection fluorescence are carried out；

(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.