CN108531586A - A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer - Google Patents
A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer Download PDFInfo
- Publication number
- CN108531586A CN108531586A CN201810225299.9A CN201810225299A CN108531586A CN 108531586 A CN108531586 A CN 108531586A CN 201810225299 A CN201810225299 A CN 201810225299A CN 108531586 A CN108531586 A CN 108531586A
- Authority
- CN
- China
- Prior art keywords
- mir
- mirna
- breast cancer
- marker
- blood plasma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer,The marker is blood plasma marker object miR 106a 3p,miR‑106a‑5p,miR‑20b‑5p,miR‑92a‑2‑5p,miR‑500a‑5p,miR‑501‑5p,miR‑188‑3p,MiR let 7f 5p and miR 98 5p and blood serum designated object miR 106a 5p,miR‑19b‑3p,miR‑20b‑5p,miR‑92a‑3p,miR‑501‑3p,miR‑502‑3p,miR‑532‑3p,It is one or more in 188 3p of miR 532 5p and miR.MiRNA is recycled as novel biomarker, have the characteristics that stability it is good, it is minimally invasive it is easy obtain, sensitivity and specific high.The utilization of this kind of molecular marker will provide new direction for the diagnosis of the various diseases including tumour and further treatment.The more targeted breast cancer obtained with clinical diagnosis potential is recycled miRNA markers by this research.Research confirms reliabilities and repeatability of this group of miRNA as the noninvasive marker of Diagnosis of Breast cancer.
Description
Technical field
The invention belongs to genetic engineering and oncologies, are related to a kind of relevant positioned at X dyes with Computer-aided Diagnosis of Breast Cancer
Cycle miRNA marker on colour solid and its application.
Background technology
Breast cancer (Breast Cancer, BC) is the most common malignant tumour of women, is reported according to newest world's cancer
(World Cancer Report 2014), accounts for the 25.2% of the suffered from malignant tumour of global women.In China, pathogenesis of breast carcinoma
Rate is in rising trend, and Female Breast Cancer in China incidence in 2015 occupies malignant tumour first, and lethality occupies the 6th.It is existing at present
Some detection methods such as Breast ultrasonography, molybdenum target inspection, nuclear magnetic resonance check and hollow needle biopsies have been both needed to certain
The tumor tissues of volume can detect, and be had some limitations in the early diagnosis of breast cancer；And it is clinically used such as carbohydrate
The tumor markers such as antigen 1 5-3 (CA15-3), sensibility or specificity be not high.With genomics, protein science and generation
The development of the biotechnologys such as Xie Zuxue, more and more biomarkers have been observed that or study.Thus, it is found that new can be early
The marker of phase Diagnosis of Breast cancer is within sight, to promote breast cancer early intervention and treatment, extends the life cycle of patient.
Microrna (miRNAs) be a kind of evolution conservative, length the nucleotide of 18-25 or so small non-coding RNA
Molecule passes through generation, invasion and the transfer of numerous pathological processes of post-transcriptional control wide participation body, including tumour
Deng.The expression of miRNA have temporal and tissue specificity, some miRNA can participate in specific physiological and pathological with
And special lysis.The study found that the expression of miRNA has different degrees of upper reconciliation to lower in tumour, it is that it can
It lays a good foundation as a kind of emerging tumor markers.2008, Mitchell detected free in peripheral blood
MiRNA has found that it can be stable in the presence of in peripheral blood, and can be as the noninvasive marker of diagnosing tumour.This research
Start to explore curtains of the cycle miRNA as noninvasive marker it was found that having pulled open global numerous researchers.There is now research confirms
Potential diagnostic values of the cycle miRNA in the tumours such as breast cancer, gastric cancer, lung cancer, oophoroma, colorectal cancer.But due to grinding
Study carefully method and be included in the difference of crowd, causes result of study not quite identical.Therefore, this research is absolute fixed based on qRT-PCR
Amount method passes through the research of breast cancer serum and blood plasma to large sample, it is intended to which find has potential diagnostic value to breast cancer
Recycle miRNA.And the expression to these miRNA in breast cancer tissue and in the excretion body of periphery is verified, with further
Specify its relationship with breast cancer.If being directed to the diagnostic kit of breast cancer according to this kind of miRNA designs, it will push China
The treatment level of breast cancer also provides thinking for future to the further research of breast cancer.
Invention content
The purpose of the present invention is to provide a kind of relevant cycles on X chromosome of and Computer-aided Diagnosis of Breast Cancer
MiRNA marker.
Another object of the present invention is to provide above-mentioned cycle miRNA markers and its primer to be examined in preparation breast cancer auxiliary
Disconnected kit and the application in the drug for preparing treatment breast cancer.
Another object of the present invention is to provide kit and drug for Computer-aided Diagnosis of Breast Cancer and treatment.
The purpose of the present invention can be achieved through the following technical solutions：
A kind of and relevant cycle miRNA marker of Computer-aided Diagnosis of Breast Cancer, the marker are blood plasma marker object miR-
106a-3p(CUGCAAUGUAAGCACUUCUUAC),miR-106a-5p(AAAAGUGCUUACAGUGCAGGUAG),miR-20b-
5p(CAAAGUGCUCAUAGUGCAGGUAG),miR-92a-2-5p(GGGUGGGGAUUUGUUGCAUUAC),miR-500a-5p
(UAAUCCUUGCUACCUGGGUGAGA),miR-501-5p(AAUCCUUUGUCCCUGGGUGAGA),miR-188-3p
(CUCCCACAUGCAGGGUUUGCA), miR-let-7f-5p (UGAGGUAGUAGAUUGUAUAGUU) and miR-98-5p
(UGAGGUAGUAAGUUGUAUUGUU) and blood serum designated object miR-106a-5p (AAAAGUGCUUACAGUGCAGGUAG),
miR-19b-3p(UGUGCAAAUCCAUGCAAAACUGA),miR-20b-5p(CAAAGUGCUCAUAGUGCAGGUAG),miR-
92a-3p(UAUUGCACUUGUCCCGGCCUGU),miR-501-3p(AAUGCACCCGGGCAAGGAUUCU),miR-502-3p
(AAUGCACCUGGGCAAGGAUUCA),miR-532-3p(CCUCCCACACCCAAGGCUUGCA),miR-532-5p
(CAUGCCUUGAGUGUAGGACCGU) one or more and in miR-188-3p (CUCCCACAUGCAGGGUUUGCA).It should
It is preferably blood plasma marker object miR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2- to recycle miRNA marker
5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and blood serum designated object
MiR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-
The combination of two or more in 3p, miR-532-5p and miR-188-3p, further preferably blood plasma miR-106a-3p,
MiR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-
Let-7f-5p and miR-98-5p and serum miR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-
The combination that 18 kinds of miRNA of 501-3p, miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p are formed.
Application of the above-mentioned cycle miRNA marker in auxiliary diagnosis breast cancer.
Above-mentioned cycle miRNA marker answering in preparing Computer-aided Diagnosis of Breast Cancer kit or treating breast cancer medicines
With.
A kind of primer with the relevant cycle miRNA marker of Computer-aided Diagnosis of Breast Cancer, which includes blood plasma miR-
106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-
3p, miR-let-7f-5p and miR-98-5p and serum miR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-
One or more miRNA in 3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p
Primer；Preferably include blood plasma miR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-
500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and serum miR-106a-5p,
MiR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-5p
With the primer of two or more miRNA in miR-188-3p；Further preferably include blood plasma miR-106a-3p, miR-
106a-5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-
5p and miR-98-5p and serum miR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p,
The primer of 18 kinds of miRNA of miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p.
Application of the above-mentioned primer in auxiliary diagnosis breast cancer or in preparing Computer-aided Diagnosis of Breast Cancer kit.
A kind of Computer-aided Diagnosis of Breast Cancer kit contains blood plasma miR-106a-3p, miR-106a-5p in the kit,
MiR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-
98-5p and serum miR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-
The primer of one or more miRNA in 3p, miR-532-3p, miR-532-5p and miR-188-3p；Preferably contain blood plasma
MiR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-
188-3p, miR-let-7f-5p and miR-98-5p and serum miR-106a-5p, miR-19b-3p, miR-20b-5p, miR-
In 92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p two kinds or two kinds with
The primer of upper miRNA；Further preferably contain blood plasma miR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-
2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and serum miR-
106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p,
The primer of 18 kinds of miRNA of miR-532-5p and miR-188-3p.
Further include the common reagent of round pcr, such as reverse transcriptase, buffer solution, dNTPs, MgCl in the kit2, DEPC
Water and Taq enzyme etc.；Standard items and/or reference substance can also be contained.
According to the present invention and breast cancer diagnosis relevant cycle miRNA marker miR-106a-3p, miR-106a-
5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p,
MiR-98-5p, miR-19b-3p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p and miR-532-5p
In the sequence of each miRNA disclose, but each miRNA marker is combined as Computer-aided Diagnosis of Breast Cancer mark
Object needs those skilled in the art to make the creative labor.The amplimer of each miRNA marker can be bought by market and be obtained
, the primer of the cycle miRNA marker used in the embodiment of the present invention is purchased from the spy produced synthesized by the Rui Bo companies of Guangzhou
Anisotropic miRNA stem rings RT-PCR primer.
Specifically, the technical solution that the present invention solves the problems, such as includes：(1) sample storehouse and data of unified standard are established
Library：Standard compliant blood sample is acquired with S.O.P. (SOP), system collects complete demographic data and clinical money
Material.(2) serum and blood plasma miRNA differential expression spectrum analysis：Analyze the cycle of differential expression in breast cancer and normal control population
MiRNA, and further large sample multistage verification is carried out to differential expression miRNAs.(3) by multistage verification, this is specified
The ability of a little miRNA Diagnosis of Breast cancers.(4) development of miRNA diagnostic kits is recycled：According to patient with breast cancer and normal population
Differential expression miRNA in serum and blood plasma develops miRNAs diagnostic kits, and the noninvasive auxiliary of patient with breast cancer is examined in realization
It is disconnected.(4) expressions of these miRNA in breast cancer tissue and excretion body is analyzed, these miRNA and breast cancer are disclosed
Relationship may provide foundation to develop future with the drug of the relevant treatment breast cancer of these miRNA.
The present inventor acquires standard compliant blood sample with S.O.P. (SOP), and system collects complete population
Data, clinical data, and use qRT-PCR methods etc..
The experimental method specifically studied includes mainly following components：
1. studying samples selection：It just controls, row operation and chemicotherapy intervention and the patient that breast cancer is confirmed as through pathology.
Normal control is the normal population to check UP in hospital.
2. training set, verification collection：RNA is carried out using AM1556 kits (ABI companies) to each serum, plasma sample to carry
It takes, cDNA samples is obtained by reverse transcription reaction, PCR primer is added and SYBR Green fluorescent dyes carry out PCR reactions.Pass through
The Ct values for comparing standard items, obtain the miRNA contents in sample.
3. using the RNA in TRIZOL-LS reagents extraction breast cancer and cancer beside organism, (SBI is public for ExoQuick kits
Department) and AM1556 kits (ABI companies) extraction excretion body in RNA detect miRNA and organizing by the method for qRT-PCR
And the differential expression in excretion body.
4. statistical analysis：With χ2It examines, paired t-test and non-parametric rank sum test compare miRNA expressions and exist
Difference in different seminar.Serum and the diagnostic value of blood plasma miRNA are confirmed by calculating ROC curve analysis.
Seminar of the present invention carries out the table of system by the miRNA in the Peripheral Blood and blood plasma to breast cancer patients at present
Up to analysis, it has now been found that one group 18 breast cancer with clinical diagnosis potential recycle microRNA marker (blood plasma markers
Object miR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-
188-3p, miR-let-7f-5p and miR-98-5p and blood serum designated object miR-106a-5p, miR-19b-3p, miR-20b-
5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p).
Beneficial effects of the present invention：
1. compared to traditional tumor markers, cycle miRNA as novel biomarker, have stability it is good,
Minimally invasive easy acquisition, sensitivity and specific high feature.The utilization of this kind of molecular marker will be for including tumour
The diagnosis of various diseases and further treatment provide new direction.
2. researcher is by the relative quantification method of qRT-PCR, in breast cancer and normal control population's serum and blood plasma
Differential expression miRNA carries out tight, multistage verification and evaluation.Confirm this group of miRNA as the noninvasive of Diagnosis of Breast cancer
The reliability and repeatability of marker.
3. researcher find expression of the miR-106a-5p and miR-20b-5p in breast cancer tissue with blood plasma and serum
Middle expression significantly increases；Meanwhile miR-106a-3p, miR-106a-5p, miR-92a-2-5p, miR-500a-5p in blood plasma,
MiR-106a-5p, miR-19b-3p, miR-20b- in miR-188-3p, miR-let-7f-5p and miR-98-5p and serum
The expression of 5p, miR-92a-3p, miR-501-3p, miR-502-3p and miR-188-3p in breast cancer excretion body is also apparent high
In normal population.Show the close relation between this group of miRNA and breast cancer.In addition, blood plasma miR-106a-3p, miR-
The expression of 106a-5p, miR-20b-5p and miR-92a-2-5p in I phases and II primary breast cancer patients is apparently higher than III
The patient with breast cancer of phase, blood plasma miR-106a-5p, miR-20b-5p and miR-92a-2-5p are in the patient of hormone receptor positive
Expression is far above hormone receptor-negative person, and blood plasma miR-106a-5p and miR-20b-5p is expressed in HER2 is without the patient of amplification
There is amplification person far above HER2.These results for the mechanism of breast cancer and will be directed to these to these miRNA of future studies
MiRNA provides new thinking for the treatment of breast cancer.
Description of the drawings
Fig. 1：Experiment flow figure
Fig. 2：9 miRNA of high expression in plasma of breast cancer patients sample
Fig. 3：9 miRNA of high expression in blood serum of patients with human breast carcinoma sample
Fig. 4：ROC curve analysis is carried out to the plasma of breast cancer patients miRNA obtained
Wherein, A1：Training set；A2：Verification collection；A3：The intersection of training set and verification collection
Fig. 5：ROC curve analysis is carried out to the blood serum of patients with human breast carcinoma miRNA obtained
Wherein, B1：Training set；B2：Verification collection；B3：The intersection of training set and verification collection
Fig. 6：Whether there is or not amplifications in patient with breast cancer's different tissues credit phase, hormone receptor status and HER2 for blood plasma miRNA
The differential expression of state
Wherein, A：Histology is by stages；B：Hormone receptor status；C：Whether there is or not amplification states by HER2
Fig. 7：MiR-106a-5p and miR-20b-5p high expression in breast cancer tissue
Fig. 8：Expressions of 9 miRNA in patient with breast cancer's excretion body in plasma sample
Fig. 9：Expressions of 9 miRNA in patient with breast cancer's excretion body in serum sample
Specific implementation mode
Inventor had collected a large amount of breast cancer from No.1 Attached Hospital, Nanjing Medical Univ in 2014 to 2016 and suffers from
The Venous serum and plasma sample of person and normal Check-up crowd have therefrom selected 290 mammary gland by the arrangement to sample data
The laboratory sample that the sample of cancer and 402 normal controls is verified as qRT-PCR.Simultaneously also left and taken 32 breast cancer tissues and
32 cancer beside organisms.Selected patients serum's sample both from just control, row operation and chemicotherapy intervention and through pathology
It is confirmed as the patient of breast cancer.And the system acquisition demographic data of these samples, clinical data.
32 miRNA from three clusters on X chromosome by training set and are tested with reference to flow chart (Fig. 1)
Card collection, is verified using the relative quantification method based on qRT-PCR, the specific steps are：
1. serum/plasma RNA extractions：ABI company's serum RNA extracts kits (AM1556) are selected, are said with reference to kit
Bright, each sample draws 200ul and extracts RNA, and is finally dissolved with 100ul DEPC water.
The preparation of 2.cDNA：
1) 50 μ L reaction systems are used to carry out reverse transcription experiment
The above reaction system mixing after brief centrifugation, is reacted with following procedure：
2) following reactant is added in reaction system again after above-mentioned reaction
3.qPCR
1) 5 μ L reaction systems are used, are tested in the following proportions
Reaction system mixing after brief centrifugation, is positioned in real-time PCR, is reacted with following procedure：
Solubility curve is added after reaction.
Data analysis：It is for statistical analysis using 16.0 softwares of SPSS, it has obtained one group and has been concentrated in training set and verification
It is unanimously to 9 blood plasma miRNAs of high expression in breast cancer cycle：MiR-106a-3p, miR-106a-5p, miR-20b-5p,
MiR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and 9
A serum：MiR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p,
MiR-532-3p, miR-532-5p and miR-188-3p (concentrate P values to be both less than 0.05, Fig. 2 and Fig. 3) in training set and verification.
By this 18 miRNA, the ROC curve of each sample can be calculated.Such as Fig. 4 and Fig. 5, the molecule mark of this 18 miRNA compositions
Will object can be good at distinguishing patient with breast cancer and normal population.And it is analyzed by subgroup, finds blood plasma miR-106a-3p,
The expression of miR-106a-5p, miR-20b-5p and miR-92a-2-5p in I phases and II primary breast cancer patients is apparently higher than
The patient with breast cancer of III phases, the trouble of blood plasma miR-106a-5p, miR-20b-5p and miR-92a-2-5p in hormone receptor positive
Expression is far above hormone receptor-negative person in person, and blood plasma miR-106a-5p and miR-20b-5p is in HER2 without in the patient of amplification
Expression has amplification person (Fig. 6) far above HER2.
This 18 miRNA excretion body in breast cancer tissue and serum and blood plasma is further had detected after seminar
Expression, it is ExoQuick kits (SBI companies) that breast cancer tissue, which extracts RNA and utilizes TRIZOL, excretion body extracts kit,.
After the excretion body 200ul DEPC water that 200ul serum/plasmas are extracted is resuspended, utilize AM1556 kits (ABI companies)
Excretion body RNA is extracted, step is the same as serum/plasma RNA extraction process.
It is found with non-parametric test analysis, the expression of miR-106a-5p and miR-20b-5p in breast cancer tissue is wanted
Higher than cancer beside organism (Fig. 7).MiR-106a-3p in blood plasma, miR-106a-5p, miR-92a-2-5p, miR-500a-5p, miR-
MiR-106a-5p, miR-19b-3p, miR-20b-5p in 188-3p, miR-let-7f-5p and miR-98-5p and serum,
The expression of miR-92a-3p, miR-501-3p, miR-502-3p and miR-188-3p in breast cancer excretion body is also apparently higher than
Normal population (Fig. 8 and Fig. 9).
Kit includes a collection of serum and blood plasma miRNA qRT-PCR primers, can also be had normal needed for corresponding round pcr
With reagent, such as：Reverse transcriptase, buffer solution, dNTPs, MgCl2, DEPC water, fluorescence probe, RNase inhibitor, Taq enzyme etc. can
It is selected according to the experimental method specifically used, these common agents are all well known to those skilled in the art, in addition it can have
Standard items and control (normal person's sample of such as quantitative markization).The value of this kit be only to need serum/plasma without
Other tissue samples are needed, by the expression contents of miRNA in the Fluorometric assay serum/plasma sample most simplified, to assist
Diagnose the possibility of samples sources patient to suffer from breast cancer.Serum and blood plasma miRNA are easy to detect, and quantitative accurate, significantly
The sensibility and specificity of medical diagnosis on disease is improved, therefore this kit is put into and is put into practice, can help to instruct diagnosis and into one
The individualized treatment of step.
Claims (8)
1. a kind of relevant cycle miRNA marker on X chromosome of and Computer-aided Diagnosis of Breast Cancer, which is characterized in that should
Cycling markers are blood plasma marker object miR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-
500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and blood serum designated object miR-106a-
5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-
It is one or more in 5p and miR-188-3p.
2. the cycle miRNA marker according to claim 1 on X chromosome, which is characterized in that the cycle
MiRNA marker is blood plasma marker object miR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-
500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and blood serum designated object miR-106a-
5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-
The combination of two or more in 5p and miR-188-3p, preferably blood plasma miR-106a-3p, miR-106a-5p, miR-
20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-
5p and serum miR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p,
The combination that 18 kinds of miRNA of miR-532-3p, miR-532-5p and miR-188-3p are formed.
3. cycle miRNA marker the answering in auxiliary diagnosis breast cancer as claimed in claim 1 or 2 on X chromosome
With.
4. the cycle miRNA marker as claimed in claim 1 or 2 on X chromosome is preparing Computer-aided Diagnosis of Breast Cancer examination
Application in agent box or treatment breast cancer medicines.
5. a kind of primer with the relevant cycle miRNA marker on X chromosome of Computer-aided Diagnosis of Breast Cancer, feature exists
Include blood plasma marker object miR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR- in the primer
500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and blood serum designated object miR-106a-
5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-
The primer of one or more miRNA in 5p and miR-188-3p；Preferably include blood plasma marker object miR- in cycle miRNA
106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-
3p, miR-let-7f-5p and miR-98-5p and blood serum designated object miR-106a-5p, miR-19b-3p, miR-20b-5p,
Two kinds or two in miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p
Kind or more miRNA primer；Further preferably include blood plasma marker object miR-106a-3p, miR-106a- in cycle miRNA
5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and
MiR-98-5p and blood serum designated object miR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-
The primer of 18 kinds of miRNA of 3p, miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p.
6. application of the primer in auxiliary diagnosis breast cancer or in preparing Computer-aided Diagnosis of Breast Cancer kit described in claim 5.
7. a kind of Computer-aided Diagnosis of Breast Cancer kit, it is characterised in that contain the cycle being located on X chromosome in the kit
Blood plasma miR-106a-3p in miRNA, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p, miR-
501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and serum miR-106a-5p, miR-19b-3p, miR-
In 20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p
The primer of one or more miRNA；Preferably contain blood plasma miR-106a-3p, miR-106a-5p, miR- in cycle miRNA
20b-5p, miR-92a-2-5p, miR-500a-5p, miR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-
5p and serum miR-106a-5p, miR-19b-3p, miR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p,
The primer of two or more miRNA in miR-532-3p, miR-532-5p and miR-188-3p；Further preferably contain
Blood plasma miR-106a-3p, miR-106a-5p, miR-20b-5p, miR-92a-2-5p, miR-500a-5p in miRNA are recycled,
MiR-501-5p, miR-188-3p, miR-let-7f-5p and miR-98-5p and serum miR-106a-5p, miR-19b-3p,
MiR-20b-5p, miR-92a-3p, miR-501-3p, miR-502-3p, miR-532-3p, miR-532-5p and miR-188-3p
The primer of 18 kinds of miRNA.
8. diagnostic kit according to claim 7, it is characterised in that further include that round pcr commonly tries in the kit
Agent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810225299.9A CN108531586B (en) | 2018-03-19 | 2018-03-19 | Circulating miRNA marker on X chromosome related to breast cancer auxiliary diagnosis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810225299.9A CN108531586B (en) | 2018-03-19 | 2018-03-19 | Circulating miRNA marker on X chromosome related to breast cancer auxiliary diagnosis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108531586A true CN108531586A (en) | 2018-09-14 |
| CN108531586B CN108531586B (en) | 2022-03-29 |
Family
ID=63484826
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810225299.9A Active CN108531586B (en) | 2018-03-19 | 2018-03-19 | Circulating miRNA marker on X chromosome related to breast cancer auxiliary diagnosis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108531586B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609633A (en) * | 2018-12-24 | 2019-04-12 | 朱伟 | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application |
| CN111154878A (en) * | 2020-02-14 | 2020-05-15 | 北京粒基生物科技有限公司 | Application of group of miRNAs in preparation of markers for screening early breast cancer |
| WO2021159562A1 (en) * | 2020-02-13 | 2021-08-19 | 朱伟 | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof |
| CN116355899A (en) * | 2022-10-27 | 2023-06-30 | 福建医科大学附属第一医院 | Female breast cancer marker, detection method thereof and detection probe primer |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921760A (en) * | 2010-09-08 | 2010-12-22 | 南京医科大学 | Serum/plasma miRNA marker associated with breast cancer and application thereof |
| US20110237450A1 (en) * | 2008-11-12 | 2011-09-29 | Caris Life Sciences Luxembourg Holdings | Methods and systems of using exosomes for determining phenotypes |
| US20140147454A1 (en) * | 2012-11-26 | 2014-05-29 | Moderna Therapeutics, Inc. | Terminally modified rna |
| US20140308370A1 (en) * | 2013-04-15 | 2014-10-16 | Regeneron Pharmaceuticals, Inc. | Markers of tumor cell response to anti-cancer therapy |
| US20170130275A1 (en) * | 2014-06-13 | 2017-05-11 | Toray Industries, Inc. | Breast cancer detection kit or device, and detection method |
| CN107429295A (en) * | 2015-03-09 | 2017-12-01 | 新加坡科技研究局 | The method of risk to suffer from breast cancer is determined by detecting the expression of Microrna (miRNA) |
-
2018
- 2018-03-19 CN CN201810225299.9A patent/CN108531586B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110237450A1 (en) * | 2008-11-12 | 2011-09-29 | Caris Life Sciences Luxembourg Holdings | Methods and systems of using exosomes for determining phenotypes |
| CN101921760A (en) * | 2010-09-08 | 2010-12-22 | 南京医科大学 | Serum/plasma miRNA marker associated with breast cancer and application thereof |
| US20140147454A1 (en) * | 2012-11-26 | 2014-05-29 | Moderna Therapeutics, Inc. | Terminally modified rna |
| US20180000910A1 (en) * | 2012-11-26 | 2018-01-04 | Modernatx, Inc. | Terminally modified rna |
| US20140308370A1 (en) * | 2013-04-15 | 2014-10-16 | Regeneron Pharmaceuticals, Inc. | Markers of tumor cell response to anti-cancer therapy |
| CN105308189A (en) * | 2013-04-15 | 2016-02-03 | 瑞泽恩制药公司 | Markers of tumor cell response to anti-cancer therapy |
| US20170130275A1 (en) * | 2014-06-13 | 2017-05-11 | Toray Industries, Inc. | Breast cancer detection kit or device, and detection method |
| CN107429295A (en) * | 2015-03-09 | 2017-12-01 | 新加坡科技研究局 | The method of risk to suffer from breast cancer is determined by detecting the expression of Microrna (miRNA) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609633A (en) * | 2018-12-24 | 2019-04-12 | 朱伟 | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application |
| CN109609633B (en) * | 2018-12-24 | 2022-02-11 | 朱伟 | Serum miRNA marker related to breast cancer auxiliary diagnosis and application thereof |
| WO2021159562A1 (en) * | 2020-02-13 | 2021-08-19 | 朱伟 | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof |
| CN111154878A (en) * | 2020-02-14 | 2020-05-15 | 北京粒基生物科技有限公司 | Application of group of miRNAs in preparation of markers for screening early breast cancer |
| CN116355899A (en) * | 2022-10-27 | 2023-06-30 | 福建医科大学附属第一医院 | Female breast cancer marker, detection method thereof and detection probe primer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108531586B (en) | 2022-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109609633B (en) | Serum miRNA marker related to breast cancer auxiliary diagnosis and application thereof | |
| CN108624695B (en) | One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN106119392B (en) | Serum miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN109055557B (en) | Serum miRNA marker related to pancreatic cancer auxiliary diagnosis and application thereof | |
| CN109423519A (en) | Early pancreatic carcinoma marker and its detection method | |
| CN108103198A (en) | A kind of and the relevant blood plasma miRNA marker of cancer of pancreas auxiliary diagnosis and its application | |
| CN104988141B (en) | G.32912799T ＞ C mutation and its application in Computer-aided Diagnosis of Breast Cancer of BRCA2 genes | |
| CN109609634B (en) | Circulating miRNA marker related to endometrial cancer auxiliary diagnosis and application thereof | |
| CN106119347B (en) | The primer and kit of colorectal cancer transfer detection based on serum exosomal microRNAs | |
| CN109593851B (en) | Plasma miRNA marker related to breast cancer auxiliary diagnosis and application thereof | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN108103199B (en) | Circulating miRNA marker related to ovarian cancer auxiliary diagnosis and application thereof | |
| CN108929910A (en) | One kind serum miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN106086178B (en) | Serum miRNA marker related to gastric cancer auxiliary diagnosis and application thereof | |
| CN104946751B (en) | BRCA1 genes are g.41244291delT mutated and its application in Computer-aided Diagnosis of Breast Cancer | |
| CN104962613B (en) | A kind of mutated gene and its application for Computer-aided Diagnosis of Breast Cancer | |
| CN107746886B (en) | One kind blood plasma miRNA marker relevant to colorectal cancer auxiliary diagnosis and its application | |
| WO2021159562A1 (en) | Circulating mirna and carcino-embryonic mirna marker related to pan-tumor auxiliary diagnosis, and use thereof | |
| CN107723365B (en) | One kind blood plasma miRNA marker relevant to lung squamous cancer auxiliary diagnosis and its application | |
| CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN106367477A (en) | Serum miRNA marker related to auxiliary diagnosis of colorectal cancer, and application thereof | |
| CN107904309B (en) | It is a kind of for diagnose indication three negative type breast cancers Bone tumours gene diagnosis kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |