CN106399527A - Primer group for detecting renal cancer and detecting method thereof - Google Patents

Abstract

The invention provides a primer group for detecting the renal cancer and a detecting method thereof. The primers provided by the invention consist of SEQ ID No.1 to SEQ ID No.18; the combined detection can be performed on MN/CA9, TS, CYP3A4, PD.L1, VEGFR2, cadherin-6, CK19, CD24 and EPCAM genes. The target gene expression and the expression level can be sensitively detected in short time by a PCR (polymerase chain reaction) or fluorescent quantitation PCR method; the optimized PCR conditions are adopted ; through increasing the cycle number of amplification reaction, the observation result is more obvious; the method applicability is further improved; the amplification product has specificity; high accuracy and sensitivity of PCR and RT-PCR fluorescent quantitative detection are ensured. When the primer group for detecting the renal cancer is implemented, the renal cancer can be simply, conveniently and accurately diagnosed by detecting the target gene expression in patient samples.

Description

A kind of primer sets for detecting kidney and detection method

Technical field

The present invention relates to oncogene field is and in particular to a kind of primer sets for detecting kidney and detection method.

Background technology

Kidney is initiated by the malignant tumour of kidney essence uriniferous tubule epithelial systems, and academic noun full name is clear-cell carcinoma, Also known as Grawitz's tumor, referred to as kidney, it is modal nephrolithotomy malignant tumour, due to average life span prolongation and Medical Imaging Progress, than front increase, the main suit of patients with renal cell carcinoma and clinical manifestation are changeable for the incidence of disease of kidney, easy mistaken diagnosis be other diseases. Kidney position is hidden, is urine with extraneous main contacting, and therefore blood urine is to find the modal symptom of kidney, but the appearance of blood urine must Renal plevis rear must be invaded in tumour to be possible to, not be therefore early stage symptom.Therefore the early diagnosis to kidney is very necessary.

The diagnostic method of kidney includes imaging examination, cell pathology and HD at present.Iconography is examined Look into including X-ray, CT scan, ultrasonic scanning, nuclear magnetic resonance check etc., but it is less efficient and accuracy in detection is not high. Common cell and histopathology include cell biopsy, need by the method for surgical operation or puncture from patient Obtain the sample of tumor tissues.Not only inconvenient, and human injury can be caused to patient in some instances it may even be possible to cause puncture path tumour Transfer.

Recently, the appearance that circulating tumor cell (Circulating Tumor Cells, CTCs) detects is to the detection of patient Bring new hope.CTCs is to depart from from tumor focus and be displaced to the tumour cell blood, is malignant tumor patient art The major reason of recurrence and DISTANT METASTASES IN afterwards, is also the key factor leading to tumor patient dead.With other histological specimens such as Marrow etc. is compared, and periphery blood specimen easily obtains, and little to patient trauma, is that clinically the ideal sample of conventional detection comes Source.CTCs detection contributes to the early diagnosis of tumour, judges patient's prognosis, the curative effect of assessment antineoplastic and formulate individuation Therapeutic scheme.Compared with traditional diagnostic method, CTCs detection can more sensitively find the change of disease, and patient is not had Side effect.

The detection of CTC is generally carried out by extracting the blood of certain volume.Detection is divided into two classes, including not capturing (enrichment) Direct detection and first capture (enrichment) detect afterwards, and latter of which is the detection method of main flow.The side that first capture (enrichment) detects afterwards Method is also classified into two classes, i.e. key player on a team and negative choosing.The physical property that key player on a team mainly passes through CTC surface marker or cell is (size, close Degree) captured；The former is based on biomolecular technology and microfluidic chip technology, and the latter is based on the principle filtering, be centrifuged. Negative choosing is then indirectly to capture CTC by leukocyte surface markers thing.But had based on the method that first capture (enrichment) detects afterwards Significantly defect.It depends critically upon the expression of tumor cell surface marker thing, therefore cannot capture and not express surface tumours mark The CTC cell of note thing.

Detect that the specific gene of CTC cell is another mode of CTC cell detection using the method for RT-PCR.First First extract the blood of certain volume, be enriched with CTCs by way of density gradient centrifugation, then detected by way of RT-PCR With this, the mRNA of specific gene, judges that CTCs whether there is, and quantitative to CTCs by detecting the change of CT value.This method inspection Survey CTCs expense low, susceptibility is high, and easily automates.

RT-PCR method detects that the standard of kidney CTCs detection is also not set up at present.We pass through to detect patients with renal cell carcinoma CTCs characterizing gene, determines detection method and the examination criteria of kidney CTCs.These detection methods and establishment of standard contribute to The early diagnosis of tumor patient, judge patient's prognosis, assessment antineoplastic, the curative effect including NK and CAR-T immunization therapy and Formulate individualized treatment scheme.

For the problems referred to above, the present invention develops a kind of kit of high-sensitive polygene combined detection, by combining inspection Survey MN/CA9,9 genes of TS, CYP3A4, PD-L1, VEGFR2, cadherin-6, CK19, CD24 and EPCAM realize tumour Early screening or diagnosis.Targeting specific primer sets are used in present invention design, increase substantially the sensitivity of detection.This detection side The recall rate of method can reach 96%, has been provided simultaneously with that sensitivity is high, and specificity is good, quick and precisely the advantages of.

Content of the invention

Present invention aims to the deficiencies in the prior art, provide a kind of primer sets for detecting kidney and detection Method.

The purpose of the present invention is achieved through the following technical solutions：A kind of primer sets for detecting kidney, comprise：

The primer sets of the present invention can realize the detection of kidney by following two methods.

Method 1：PCR method.

(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tube, and all add nucleic acid extraction Thing, reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, the condition of each circulation of PCR reaction is Celsius for 94 Degree, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；

(2) carry out reverse transcription and PCR reaction, detected with agarose gel electrophoresis method.

Method 2：Fluorescence quantifying PCR method

(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tube, and all add nucleic acid extraction Thing, reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；It is separately added into 2 × ChamQ SYBR qPCR Master Mix, Wherein, the condition of each circulation of PCR reaction is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Individual multiple holes；

(2) reverse transcription and PCR reaction are carried out, and real-time detection fluorescence；

(3) the Ct value being calculated according to fluoroscopic examination result, determines whether mark expression of target gene in sample.

The beneficial effects of the present invention is：The present invention passes through to design Specific PCR primers, is developed for kidney early stage inspection The polygene combined detection method surveyed.The method：(1) PCR system set up can to MN/CA9, TS, CYP3A4, PD-L1, VEGFR2, cadherin-6, CK19, CD24 and EPCAM gene carries out joint-detection；(2) by carrying out to multiple genes simultaneously Detection kidney recall rate can reach 96%；(3) sensitivity is high, and the gene expression dose of as little as 1-5 copy all can detect；(4) special The opposite sex is strong, and normal person or non-kidney patient's sample seldom can produce specific signals；(5) detection speed is fast, simple to operate, expense Cheap.

Brief description

Fig. 1 is healthy human peripheral blood pattern detection feminine gender PCR figure in embodiment.

Fig. 2 is non-patients with renal cell carcinoma peripheral blood sample detection feminine gender PCR figure in embodiment.

Fig. 3 is non-patients with renal cell carcinoma tumor tissues detection feminine gender PCR figure in embodiment.

Fig. 4 is embodiment carcinoma mesonephric peripheral blood in patients detection positive PCR figure.

Fig. 5 is embodiment carcinoma mesonephric specimens detection positive PCR figure.

In figure, M.100bp marker；1.B2M, 2.MN/CA9,3.TS, 4.CYP3A4,5.PD-L1,6.VEGFR2, 7.cadherin-6,8.CK19,9.CD24,10.EPCAM.

Specific embodiment

The present invention is directed to main driven nature mutator in current tumour, joint-detection MN/CA9, TS, CYP3A4, PD- L1, VEGFR2, cadherin-6, CK19, CD24 and EPCAM9 gene realizes early screening or the diagnosis of kidney.For current Detection method sensitivity is low, and detection process complexity is loaded down with trivial details, and detection required time length is it is impossible to meet the actual demand of clinical detection. For the problems referred to above, design a whole set of specific primer group for detecting above-mentioned 9 genes.

Reference sequences according to above-mentioned 9 genes design specificity amplification primer, and its PCR primer length optimum is in 180- Between 200bp, not higher than 60 degree of annealing temperature, G/C content, between 40-60%, meets the requirement of general primer-design software. By using real-time fluorescence PCR reaction detection system, realizing the highly sensitive detection of multiple gene association, the following institute of its detection method State.

The present invention is further described in conjunction with the accompanying drawings and embodiments.As do not specialized part, can be according to this area skill Familiar to art personnel institute《Molecule can grand experiment guide》The third edition (Cold Spring Harbor laboratory Press), 《Cell experiment guide》(Science Press, Beijing, China, calendar year 2001),《RNA experimental technique handbook》(Science Press, north Capital, China, 2004),《Immunoassay technology》(Science Press, Beijing, China, 1991) etc. laboratory manual and this paper institute In the bibliography quoted, listed method is implementing.Wherein, (tape label) probe used, primer can entrust Shanghai to give birth to work Biotechnology Services Co., Ltd synthesizes.

With reference to embodiment, the invention will be further described.

Embodiment 1:Gene selects

Multiple studies have shown that, single-gene examination susceptibility is about 20-60%, is mostly used in the single of tumour early screening Genetic test, its detection sensitivity or specificity low it is impossible to meet clinical needs.Can be effective using polygene combined detection Solve the problems, such as that susceptibility is low, improve tumour early screening and the degree of accuracy of diagnosis.In order to improve the recall rate of infantile tumour, carry The cure rate of high tumor patient, improves patient's prognosis, and we are screened to the difference expression gene of kidney and normal structure. We pass through a large amount of control experiments and find MN/CA9, TS, CYP3A4, PD-L1, VEGFR2, cadherin-6, CK19, CD24 and The genome of EPCAM composition has higher recall rate to kidney, reaches 96%, with respect to existing detection technique, creates Unexpected technique effect, has and significantly improves.

Embodiment 2:Primer screening

(1) design primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3, i1 ～i3, specially：Using bioinformatics software, target gene A-I sequence is analyzed, is designed using sequence analysis software special Specific primer group, using NCBI primer search software detection each pairing specificity in human genome for the primer, separately designs out 3 To specificity amplification primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3, i1～ i3；

Table 1：PCR detection primer

(2) process of peripheral blood sample

Collect certain hospital to accept for medical treatment and the patients with renal cell carcinoma peripheral blood through proved by pathology, 7 points of early morning, on an empty stomach, through ulnar vein collection New blood, deposits in anticoagulant tube, shakes up, preservation≤4h under normal temperature.

Whole blood sample in anticoagulant tube is added equal-volume PBS (pH7.0) by 2.1, is centrifuged 5min in room temperature 3000rpm, goes Except upper plasma；

2.2 add equal-volume ammonium chloride erythrocyte cracked liquid (being purchased from the green skies), mix in room temperature 200rpm centrifugation 8min After even, 5min, supernatant discarded are centrifuged with 3000rpm room temperature；

2.3 by lower floor's haemocyte and physiological saline according to volume ratio 1:2～2:After 1 mixing, add Ficoll separating liquid, mix The volume ratio closing liquid with Ficoll separating liquid is 1:2～2:1, centrifugal force is 700g, is centrifuged 20～40min；

Supernatant is abandoned in 2.4 suctions, takes cell precipitation, and washing obtains PBMC；

2.5 take PBMC to be used for nucleic acid extraction, and unnecessary PBMC is resuspended with RNA protective agent, are stored in -20 degree.

(3) extraction of nucleic acid

3.1 take not more than 5 × 10⁵PBMC, add 250 μ L Buffer RLT Plus, piping and druming mix；

Lysate is transferred to gDNA by 3.2 to be removed in centrifugal type post, and 8000 × g (10,000rpm) is centrifuged 30s.Collect stream Wear liquid, abandon centrifugal column；

To flowing through in liquid, piping and druming mixes 70% ethanol (350 μ L) of 3.3 1 times of volume of addition；

Sample is transferred to RNeasyMinElute centrifugal column by 3.4, covers tightly lid, and 8000 × g (10,000rpm) is centrifuged 15s, abandoned stream wears liquid；

3.5 add 700 μ L Buffer RW1 in RNeasyMinElute centrifugal column, cover tightly lid, 8000 × g (10, 000rpm) it is centrifuged 15s, abandoned stream wears liquid；

3.6 add 500 μ L Buffer RPE in RNeasyMinElute centrifugal column, cover tightly lid, 8000 × g (10, 000rpm) it is centrifuged 15s, abandoned stream wears liquid；

3.7 RNeasyMinElute centrifugal column is placed in new 2mL collecting pipe, opens lid, centrifugation 5min, makes at full speed Ethanol volatilizees；

3.8 RNeasyMinElute centrifugal column is placed in new 1.5mL collecting pipe, adds 20 μ LRNase-free H₂O, covers tightly lid, at full speed centrifugation 1min eluted rna.

(4) acquisition of template cDNA

4.1 accurately record sample RNA concentration；

4.2 prepare reverse transcription system in strict accordance with cDNA reverse transcription reagent box specification on ice；

Composition	Volume
		5×Mix	8μL
RNA	500ng
		RNase-free H2O	To 40 μ L

The 4.3 above reaction systems of soft mixing, and utilize the of short duration centrifugation of centrifuge, 55 degree of 20min, 85 degree of 2min, obtain Template cDNA；

(5) regular-PCR amplification

Configure reaction system with Taq archaeal dna polymerase, with primer be a-i and people's reference gene (B2M) enters performing PCR amplification respectively Sample, product 1% gel detection；

Amplification system

Composition	Volume
		2×Mix	10μL
cDNA	1μL
		Primer-F	0.8μL
Primer-R	0.8μL
		RNase-free H2O	7.4μL

PCR reaction condition is 95 DEG C of denaturations 3 minutes, 1 circulation；95 DEG C of denaturation 20 seconds, anneal 20 seconds for 55 DEG C, 72 DEG C are prolonged Stretch 10 seconds, 35 circulations；72 DEG C extend 7 minutes.

(6) fluorescence real-time quantitative PCR amplification

A-i is organized according to specifically drawing of design, is expanded by quantitative fluorescent PCR, system is as follows：

95 DEG C of denaturations 20s, 1 circulation；95 DEG C of 10s, 60 DEG C of 30s, 40 circulations；Often three multiple holes set up by pipe；

According to the pcr result of step 5 and 6, filter out following primer sets, be used for detecting the primer of kidney as the present invention Group.

Embodiment 3：Compliance test result

According to the selection result of embodiment 2, using the primer sets described in following table, 100 tumor samples are detected.

Wherein, the forward primer of CD10 is TGATGATAAGAATTCTGTGA, and reverse primer is The forward primer of GCAAGCTGGTTTTCATCGAT, N-cadherin is CCTTAACTGAGGAGTCAGTG, and reverse primer is The forward primer of CAGACCTGATCCTGACAAGC, Vimentin is CGTGACGTACGTCAGCAATA, and reverse primer is AAGGGCATCCACTTCACAGG.

The recall rate of 1～No. 8 primer sets as shown above, as can be seen from the table, in primer sets, with primer quantity Increase, its recall rate can be improved to a certain extent.Further, by comparing 5～No. 8 primer sets it is found that primer Combination in group has a major impact for the height of recall rate.Simultaneously in the case of identical detection gene dosage, No. 5 primer sets Recall rate be higher than 6～No. 8 primer sets.Therefore, the assortment of genes of our preferably No. 5 primer sets is used for the detection of kidney.Enter one Step finds by research, in No. 5 primer sets, the expression of CK19 can point out the tumour of epithelial cell origin, is considered have tumour to turn Move diagnostic value；The expression of EPCAM can point out human cancers cell, and MN/CA9 is carbonic anhydrase family member, Seldom express in health adult tissue, kidney malignant tumour presents high expression；TS is the biosynthetic key enzyme of DNA, with tumour Malignant behaviors closely related；CYP3A4 is the Major Members of CYP3A subfamily, is also adult's liver cytochrome 450 In most important composition it has now been found that CYP3A4 take part in about 38 classifications, totally 150 multi-medicaments (account for whole medicines 50%) metabolism, has directive function to oncotherapy medication；Mutual between the T cell of activation and tumor correlated albumen PD-L1 Effect leads to apoptosis, and clinical research shows, PD-L1 expression is related to poor prognosis and/or PD； VEGFR-1 is interacted with VEGF (VEGF) affects tumor vessel and lymphatic vessel；Cadherin-6 is in tissue Grow in play a significant role, the infiltration to tumour cell and transfer related；CD24 is promoting tumor cell proliferation, is sticking Play an important role in attached and transfer process, CD24 overexpression is related to the poor prognosis of tumor patient simultaneously.From the foregoing, it will be observed that The present invention is not that 9 pairs of primers are carried out simple superposition combination, 9 pairs of primer with each others, functionally supports one another so that examining Go out rate to be improved significantly, achieve unexpected technique effect.In sum, the gene selecting in this patent is related to swell The aspects such as the metabolism of knurl, propagation, invasion and attack, more can comprehensively detect the cell biological characteristics of kidney.

Embodiment 4：Specificity analysis

According to the selection result of embodiment 2, using the primer sets described in following table to normal person's peripheral blood sample (Fig. 1), non- The peripheral blood (Fig. 2) of kidney patient and tissue samples (Fig. 3), the peripheral blood (Fig. 4) of kidney patient and tissue samples (Fig. 5) are carried out Detection.Result as Figure 1-5, as seen from the figure described primer sets normal human peripheral blood (Fig. 1), non-kidney patient outer All it is not detected by the expression of stronger gene in all blood (Fig. 2) and tissue samples (Fig. 3).Peripheral blood (Fig. 4) in kidney patient With the strongly expressed that can detect that multiple genes in tissue samples (Fig. 5), respectively 6/9 and 9/9, heretofore described primer is described Group has relatively high level specificity.

Claims (3)

1. a kind of primer sets for detecting kidney are it is characterised in that described primer sets can comprise a～i 9 to primer, described The forward primer of primer a as shown in SEQ ID No.1, the reverse primer of primer a as shown in SEQ ID No.2, the forward direction of primer b Primer as shown in SEQ ID No.3, the reverse primer of primer b as shown in SEQ ID No.4, the forward primer such as SEQ of primer c Shown in ID No.5, the reverse primer of primer c as shown in SEQ ID No.6, the forward primer such as SEQ ID No.7 institute of primer d Show, the reverse primer of primer d as shown in SEQ ID No.8, the forward primer of primer e as shown in SEQ ID No.9, primer e's Reverse primer as shown in SEQ ID No.10, the forward primer of primer f as shown in SEQ ID No.11, the reverse primer of primer f As shown in SEQ ID No.12, the forward primer of primer g as shown in SEQ ID No.13, the reverse primer such as SEQ ID of primer g Shown in No.14, the forward primer of primer h as shown in SEQ ID No.15, the reverse primer such as SEQ ID No.16 institute of primer h Show, as shown in SEQ ID No.17, the reverse primer of primer i is as shown in SEQ ID No.18 for the forward primer of primer i.

2. a kind of PCR detection method for detecting kidney is it is characterised in that comprise the steps：

(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tube, and all add nucleic acid extractive, Reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, PCR reaction each circulation condition be 94 degrees Celsius, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；

(2) carry out reverse transcription and PCR reaction, detected with agarose gel electrophoresis method.

3. a kind of fluorescent quantitative PCR detection method for detecting kidney is it is characterised in that comprise the steps：

(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tube, and all add nucleic acid extractive, Reverse transcriptase, RNase inhibitor, archaeal dna polymerase, dNTP；It is separately added into 2 × ChamQ SYBR qPCR Master Mix, its In, the condition of each circulation of PCR reaction is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Multiple holes；

(2) reverse transcription and PCR reaction are carried out, and real-time detection fluorescence；

(3) the Ct value being calculated according to fluoroscopic examination result, determines whether mark expression of target gene in sample.