CN106544417A - It is a kind of to be used to detect lymphadenomatous primer sets and detection method - Google Patents
It is a kind of to be used to detect lymphadenomatous primer sets and detection method Download PDFInfo
- Publication number
- CN106544417A CN106544417A CN201610895860.5A CN201610895860A CN106544417A CN 106544417 A CN106544417 A CN 106544417A CN 201610895860 A CN201610895860 A CN 201610895860A CN 106544417 A CN106544417 A CN 106544417A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- reverse
- pcr
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is provided to detect lymphadenomatous primer sets and its detection method, the primer of the present invention includes SEQ ID No.1 SEQ ID No.24, can carry out joint-detection to 12 genes such as CK7, CK19, CK20.By PCR or the method for quantitative fluorescent PCR, Sensitive Detection expression and the expression of target gene can be gone out at short notice；Using the PCR conditions of optimization, by the period for adjusting amplified reaction, make observation result more notable, further improve the suitability of the inventive method；Pcr amplification product has specificity, it can be ensured that PCR and fluorescence quantitative PCR detection high accuracy and sensitivity.The primer sets detected for lymphoma in implementing the present invention, the expression of the point gene that hit by detection patient's sample, can simply, conveniently and accurately diagnose lymphoma.
Description
Technical field
The present invention relates to oncogene field, and in particular to a kind of to be used to detect lymphadenomatous primer sets and detection method.
Background technology
Lymphoma is initiated by the malignant tumor of lymph node and/or knot perilymph tissue, is generally divided into Hodgkin lymphoma
With two big class of non-Hodgkin lymphoma, it is the common type in adult malignancies.Lymphoma is generally grown with solid tumor forms,
It is characterized with Silent Neuritis progressive lymphadenectasis, its clinical manifestation can be varied because affected area is different.Currently for
The topmost therapeutic scheme of lymphoma is chemotherapy, radiotherapy.Although said method can improve the life cycle of patient, it might even be possible to make
Some patientss obtain long term survival, but both modes can not thoroughly remove tumor cell, and most of patient finally can still answer
Send out or disease progression.Lymphoma as the malignant tumor that a kind of deterioration degree is high, prognosis is poor, the diagnosis and treatment of early stage for
Lymphoma is very important.
Lymphadenomatous diagnostic method includes imaging examination, cytopathology and histopathologic diagnosis at present.Iconography
Inspection includes X-ray, CT scan, nuclear magnetic resonance check etc., but which is less efficient and accuracy in detection is not high.It is common thin
Born of the same parents and histopathology include cell biopsy, need tumor is obtained from patient by the method for surgical operation or puncture
The sample of tissue.It is not only inconvenient, and human injury can be caused to patient.
Recently, detection of the appearance that circulating tumor cell (Circulating Tumor Cells, CTCs) is detected to patient
Bring new hope.CTCs is to depart from and be displaced to the tumor cell in blood from tumor focus, is malignant tumor patient art
The major reason of recurrence and metastasis, and the key factor for causing tumor patient dead afterwards.With other histological specimens such as
Bone marrow etc. is compared, and periphery blood specimen is easily obtained, and little to patient trauma, is that clinically the ideal specimen of conventional sense is come
Source.CTCs detections contribute to the early diagnosiss of tumor, judge patient's prognosis, the curative effect of assessment antitumor drug and formulate individuation
Therapeutic scheme.Compared with traditional diagnostic method, CTCs detections can more sensitively find the change of disease, and patient is not had
Side effect.
The detection of CTCs is generally carried out by extracting the blood of certain volume.Detection is divided into two classes, (rich including not capturing
Collection) direct detection and first capture (enrichment) detect afterwards, latter of which be main flow detection method.First capture (enrichment) is detected afterwards
Method is also classified into two classes, i.e. key player on a team and negative choosing.Key player on a team mainly by the physical property of CTC surface markers or cell (size,
Density) captured；The former is that, based on biomolecular technology and microfluidic chip technology, the latter is based on the original for filtering, be centrifuged
Reason.Negative choosing method captures CTC indirectly by leukocyte surface markers thing.But had based on the method that first capture (enrichment) is detected afterwards
Obvious defect.It depends critically upon the expression of tumor cell surface marker thing, therefore cannot capture the non-expressing tumor in surface
The CTCs cells of label.
It is another mode of CTCs cell detection using specific gene in RT-PCR method detection CTCs cells.It is first
The blood of certain volume is first extracted, CTCs is enriched with by way of density gradient centrifugation, is then detected by way of RT-PCR
With this, the mRNA of specific gene, judges that CTCs whether there is, and quantitative to CTCs by detecting the change of CT values.This method inspection
Survey CTCs expenses low, sensitivity is high, and easily automatization.
Detect that the standard of lymphatic cancer CTCs does not also completely set up using RT-PCR method at present.We are by detecting lymph
The CTCs characterizing genes of tumor patient, determine the detection method and examination criteria of lymphoma CTCs.These detection methods and standard
Foundation contributes to the early diagnosiss of tumor patient, judges that patient's prognosis, assessment antitumor drug, including NK and CAR-T immunity are controlled
The curative effect and formulation individualized treatment scheme for the treatment of.
For the problems referred to above, a kind of test kit of high-sensitive polygene combined detection of present invention exploitation, by combining inspection
Survey CK7, CK19, CK20, C-Met, EGFR, MUC1, N-Cadherin, CD133, VEGF, VEGFR2, PDGFR and hTERT12
Gene realizes the early screening of tumor or diagnosis.Present invention design increases substantially detection with targeting specific primer sets
Sensitivity.The recall rate of the detection method can reach 95%, be provided simultaneously with that sensitivity is high, and specificity is good, quick and precisely etc. excellent
Point.
The content of the invention
Present invention aims to the deficiencies in the prior art, there is provided a kind of to be used to detect lymphadenomatous primer sets and inspection
Survey method.
The purpose of the present invention is achieved through the following technical solutions：It is a kind of to be used to detect lymphadenomatous primer sets, comprising：
The primer sets of the present invention can realize lymphadenomatous detection by following two methods.
Method 1：PCR method
(1) 12 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid to carry
Take thing, reverse transcription, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, the condition of each circulation of PCR reactions is 94 Celsius
Degree, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；
(2) reverse transcription and PCR reactions are carried out, is detected with agarose gel electrophoresis method.
Method 2：Fluorescence quantifying PCR method
(1) 12 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid to carry
Take thing, reverse transcription, RNase inhibitor, archaeal dna polymerase, dNTP；It is separately added into 2 × ChamQ SYBR qPCR Master
Mix, wherein, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets
Found three multiple holes；
(2) reverse transcription and PCR reactions, and real-time detection fluorescence are carried out；
(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.
The beneficial effects of the present invention is：The present invention is developed for lymphoma early stage by designing Specific PCR primers
The polygene combined detection method of detection.The method：(1) PCR system set up can to CK7, CK19, CK20, C-Met, EGFR,
MUC1, N-Cadherin, CD133, VEGF, VEGFR2, PDGFR and hTERT gene carries out joint-detection；(2) by simultaneously right
Multiple genes carry out detection can make lymphoma recall rate reach 98%；(3) sensitivity is high, the gene expression water of as little as 1-5 copies
Can averagely detect；(4) high specificity, normal person or non-lymphoid patient's sample will not produce non-specific signals；(5) detect speed
Degree is fast, simple to operate, low cost.
Description of the drawings
Fig. 1 is healthy human peripheral blood pattern detection feminine gender PCR figures in embodiment.
Fig. 2 is non-lymphoid peripheral blood sample detection feminine gender PCR figures in embodiment.
Fig. 3 is non-lymphoid tissue samples detection feminine gender PCR figures in embodiment.
Fig. 4 is Lymphoma peripheral blood detection positive PCR figures in embodiment.
Fig. 5 is Lymphoma tissue detection positive PCR figures in embodiment.
In figure, M.100bp marker；1.B2M；2.CK7；3.CK19；4.CK20；5.C-Met；6.EGFR；7.MUC1；
8.N-Cadherin；9.CD133；10.VEGF；11.VEGFR2；12.PDGFR；13.hTERT.
Specific embodiment
The present invention for main driven nature mutant gene in current tumor, joint-detection CK7, CK19, CK20, C-Met,
12 genes such as EGFR, MUC1, N-Cadherin, CD133, VEGF, VEGFR2, PDGFR, hTERT gene are realized lymphadenomatous
Early screening or diagnosis.Low for current detection method sensitivity, detection process complexity is loaded down with trivial details, long the time required to detection, it is impossible to
Meet the actual demand of Clinical detection.For the problems referred to above, design for detecting a whole set of specificitys of above-mentioned 12 genes
Primer sets.
According to the reference sequences of above-mentioned 12 genes design specificity amplification primer, its PCR primer length optimum be
Between 180-200bp, not higher than 60 degree of annealing temperature, G/C content meet wanting for general primer-design software between 40-60%
Ask.By using regular-PCR or real-time fluorescence PCR reaction detection system, realizing the highly sensitive detection of multiple gene associations, its inspection
Survey method is as described below.
The present invention is further described in conjunction with the accompanying drawings and embodiments.As do not specialized part, can be according to this area skill
Familiar to art personnel institute《Molecule can grand experiment guide》The third edition (Cold Spring Harbor laboratory Press),
《Cell experiment guide》(Science Press, Beijing, China, calendar year 2001),《RNA experimental technique handbooks》(Science Press, north
Capital, China, 2004),《Immunoassay technology》1991) (Science Press, Beijing, China, laboratory manual and this paper institutes such as
In the list of references of reference, listed method is implementing.Wherein, primer used can entrust Shanghai life work biotechnology clothes
The synthesis of business company limited.
Embodiment 1:Gene Selection
Multiple studies have shown that, single-gene examination sensitivity is about 20-60%, is mostly used in the single of tumor early screening
Gene test, its detection sensitivity or specificity it is low, it is impossible to meet clinical needs.Can be effective using polygene combined detection
Solve the problems, such as that sensitivity is low, improve the accuracy of tumor early screening and diagnosis.Et al. (
A.,P.,L.,Zoric,N.,Diez,A.,Nilsson,O.,Ridell,B.(2014)
.Comparison of reverse transcription quantitative real-time PCR,flow
cytometry,and immunohistochemistry for detection of monoclonality in
Lymphomas.ISRN oncology, 2014.) while detecting IGKC and IGLC genes, as a result showing that gene association is detected is used for
The sensitivity of lymphoma early diagnosiss is 60%.In order to improve the recall rate of infantile tumour, the cure rate of tumor patient is improved, is changed
Kind patient's prognosis, we are screened the difference expression gene to lymphoma and normal structure.We are compared in fact by a large amount of
Issue after examination and approval existing CK7, CK19, CK20, C-Met, EGFR, MUC1, N-Cadherin, CD133, VEGF, VEGFR2, PDGFR and hTERT
The genome of composition has higher recall rate to lymphoma, reaches 98%, relative to existing detection technique, generates imaginary
Less than technique effect, with significant progressive.
Embodiment 2:Primer screening
(1) design primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3, i1
～i3, j1～j3, k1～k3, l1～l3, specially：Target gene A-L sequences are analyzed using bioinformatics software, profit
Specific primer group is designed with sequence analysis software, using each pairing primer of NCBI primers search software detection in human genome
Specificity, separately design out 3 couples of specificity amplification primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～
F3, g1～g3, h1～h3, i1～i3, j1～j3, k1～k3, l1～l3；
Table 1：PCR detection primers
(2) process of peripheral blood sample
The Lymphoma peripheral blood that certain hospital accepts simultaneously Jing proved by pathology for medical treatment is collected, in 7 points of early morning, on an empty stomach, Jing ulnar veins are adopted
Collection fresh blood, deposits in anticoagulant tube, shakes up, and preserves≤4 hours under room temperature.
Whole blood sample in anticoagulant tube is added equal-volume PBS (pH7.0) by 2.1,5min is centrifuged in room temperature 3000rpm, goes
Except upper plasma；
2.2 add equal-volume ammonium chloride erythrocyte cracked liquid (being purchased from the green skies), mix in room temperature 200rpm centrifugation 8min
After even, 5min, supernatant discarded are centrifuged with 3000rpm room temperatures；
2.3 by lower floor's hemocyte and normal saline according to volume ratio 1:2～2:After 1 mixing, Ficoll separating liquids are added, mixed
The volume ratio that liquid is closed with Ficoll separating liquids is 1:2～2:1, centrifugal force is 700g, and 20～40min is centrifuged；
Supernatant is abandoned in 2.4 suctions, takes cell precipitation, is washed, that is, is obtained PBMC；
2.5 take PBMC for nucleic acid extraction, and unnecessary PBMC is resuspended with RNA protective agents, are stored in -20 degree.
(3) extraction of nucleic acid
3.1 take not more than 5 × 105PBMC, add 250 μ L Buffer RLT Plus, piping and druming mix；
Lysate is transferred to gDNA by 3.2 to be removed in centrifugal type post, 8000 × g (10,000rpm) centrifugation 30s.Collect stream
Liquid is worn, centrifugal column is abandoned；
To flowing through in liquid, piping and druming is mixed 70% ethanol (350 μ L) of 3.3 1 times of volume of addition；
Sample is transferred to RNeasyMinElute centrifugal columns by 3.4, covers tightly lid, 8000 × g (10,000rpm) centrifugations
15s, abandoned stream wear liquid；
3.5 add 700 μ L Buffer RW1 in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10,
15s is centrifuged 000rpm), abandoned stream wears liquid；
3.6 add 500 μ L Buffer RPE in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10,
15s is centrifuged 000rpm), abandoned stream wears liquid；
3.7 are placed in RNeasyMinElute centrifugal columns in new 2mL collecting pipes, open lid, and centrifugation 5min, makes at full speed
Ethanol volatilizees；
3.8 are placed in RNeasyMinElute centrifugal columns in new 1.5mL collecting pipes, add 20 μ LRNase-free
H2O, covers tightly lid, at full speed centrifugation 1min eluted rnas.
(4) acquisition of template cDNA
4.1 accurately measure sample RNA concentration；
4.2 prepare reverse transcription system in strict accordance with cDNA reverse transcription reagent box description on ice；
| Composition | Volume |
| 5×Mix | 8μL |
| RNA | 500ng |
| RNase-free H2O | To 40 μ L |
4.3 soft mixing above reaction systems, and the of short duration centrifugation of centrifuge is utilized, 55 degree of 20min, 85 degree of 2min are obtained
Template cDNA；
(5) regular-PCR amplification
Reaction system is configured with Taq archaeal dna polymerases, with primer be a-l and people's reference gene (B2M) enters performing PCR amplification
Each sample, 1% gel detection of product；
Amplification system
| Composition | Volume |
| 2×Mix | 10μL |
| cDNA | 1μL |
| Primer-F | 0.8μL |
| Primer-R | 0.8μL |
| RNase-free H2O | 7.4μL |
PCR reaction conditions are 95 DEG C of denaturations 3 minutes, 1 circulation；95 DEG C of degeneration 20 seconds, 55 DEG C are annealed 20 seconds, and 72 DEG C are prolonged
Stretch 10 seconds, 35 circulations；72 DEG C extend 7 minutes.
(6) fluorescence real-time quantitative PCR amplification
Specifically draw a group a-l according to what is designed, expanded by quantitative fluorescent PCR, system is as follows：
| Composition | Volume |
| 2×ChamQ SYBR qPCR Master Mix | 10μL |
| cDNA | 2μL |
| Primer-F | 0.4μL |
| Primer-R | 0.4μL |
| RNase-free H2O | 7.2μL |
| Total | 20μL |
95 DEG C of denaturations 20s, 1 circulation；95 DEG C of 10s, 60 DEG C of 30s, 40 circulations；Often pipe sets up three multiple holes；
According to step 5 and 6 PCR results, following primer sets are filtered out, be used to detect lymphadenomatous primer as the present invention
Group.
Embodiment 3：Compliance test result
According to the selection result of embodiment 2,100 tumor samples are detected using the primer sets described in following table.
Wherein, the forward primer of CK8 is CGCCTGGAAGGGCTGACCGA, and reverse primer is
GTTGGCAATATCCTCGTACT；The forward primer of CK18 is GAGCTAGACAAGTACTGGTC, and reverse primer is
CCTCAGGCTGTTCTCCAAGC；The forward primer of EPCAM is AATGATGTGGACATAGCTGA, and reverse primer is
TAGACCCTGCATTGAGAATT。
The recall rate of 1～No. 8 primer sets as shown above, as can be seen from the table, in primer sets, with primer quantity
Increase, its recall rate can be improved to a certain extent.Further, by comparing 5～No. 8 primer sets it is found that primer
Combination in group is had a major impact for the height of recall rate.Simultaneously in the case of identical detection gene dosage, No. 5 primer sets
Recall rate be higher than 6～No. 8 primer sets.Therefore, the assortment of genes of our preferably No. 5 primer sets is used for lymphadenomatous detection.Enter
One step finds that by studying, in No. 5 primer sets, the expression of CK7, CK18, CK19 can point out the tumor of epithelial cell origin；Epidermis
The generation evolution of growth factor receptorses (EGFR) and platelet derived growth factor receptor (PDGFR) in numerous malignant tumor
In play an important role, become one of new focus of current tumor research；C-Met is used as receptor tyrosine kinase and tumor cell
Growth, invasion and attack, shift it is related to apoptosis；MUC 1 in tumor tissues more there is unconventionality expression, in inflammation and the progress of tumor
In play an important role；N-Cadherin is to rely on Ca2+Cell surface adhesion molecule, be main knot that iuntercellular is adhered
Constitute and divide；CD133 is the mark of tumor stem cell；VEGF VEGF and its receptor VEGFR2 can promote and
Adjust vascular endothelial cell division, be tumor cell fast-growth, transfer create probability.The overexpression of telomerase hTERT
Often result in the immortalization of cell, cause cancer or tumor.From the foregoing, it will be observed that the present invention is not that 12 pairs of primers are carried out simple superposition
Combination, 12 pairs of primers complement each other, functionally support one another so that recall rate is improved significantly, and achieve and expect not
The technique effect for arriving.In sum, in the present invention, the gene that selects is related to the aspects such as the metabolism of tumor, propagation, invasion and attack, can be more
Lymphadenomatous cell biological characteristics are detected comprehensively.
Embodiment 4：Specificity analyses
According to the selection result of embodiment 2, using the primer sets described in upper table to normal person's peripheral blood sample (Fig. 1), non-
The peripheral blood (Fig. 2) and tumor tissues sample (Fig. 3) of Lymphoma patients, the peripheral blood (Fig. 4) of Lymphoma patients and lymphoma group
Knit sample (Fig. 5) to be detected.In figure, 1-13 genes are respectively：1.B2M； 2.CK7；3.CK19；4.CK20；5.C-Met；
6.EGFR；7.MUC1；8.N-Cadherin；9.CD133；10.VEGF；11.VEGFR2；12.PDGFR；13.hTERT.Detection knot
Fruit as Figure 1-5, from Fig. 1-3 visible described primer sets normal human peripheral blood, the peripheral blood of non-lymphoid patient and
The obvious expression of gene is not detected by tumor tissues sample.Can detect that in the peripheral blood and tissue samples of Lymphoma patients
The expression of multiple genes, respectively 9/12 and 11/12, illustrate that heretofore described primer sets have the specificity of height.
Claims (3)
- It is 1. a kind of to be used to detect lymphadenomatous primer sets, it is characterised in that the primer sets can include a～l 12 to primer, The forward primer of the primer a as shown in SEQ ID No.1, the reverse primer of primer a as shown in SEQ ID No.2, primer b's , as shown in SEQ ID No.3, as shown in SEQ ID No.4, the forward primer of primer c is such as the reverse primer of primer b for forward primer Shown in SEQ ID No.5, the reverse primer of primer c as shown in SEQ ID No.6, the forward primer such as SEQ ID No.7 of primer d It is shown, the reverse primer of primer d as shown in SEQ ID No.8, the forward primer of primer e as shown in SEQ ID No.9, primer e Reverse primer as shown in SEQ ID No.10, as shown in SEQ ID No.11, primer f's reversely draws the forward primer of primer f Thing as shown in SEQ ID No.12, the forward primer of primer g as shown in SEQ ID No.13, the reverse primer such as SEQ of primer g Shown in ID No.14, the forward primer of primer h as shown in SEQ ID No.15, the reverse primer such as SEQ ID No.16 of primer h It is shown, the forward primer of primer i as shown in SEQ ID No.17, the reverse primer of primer i as shown in SEQ ID No.18, primer The forward primer of j as shown in SEQ ID No.19, as shown in SEQ ID No.20, draw the reverse primer of primer j by the forward direction of primer k Thing as shown in SEQ ID No.21, the reverse primer of primer k as shown in SEQ ID No.22, the forward primer such as SEQ of primer l Shown in ID No.23, the reverse primer of primer l is as shown in SEQ ID No.24.
- 2. it is a kind of to be used to detect lymphadenomatous PCR detection method, it is characterised in that to comprise the steps：(1) 12 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive, Reverse transcription, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, PCR reaction each circulation condition be 94 degrees Celsius, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；(2) reverse transcription and PCR reactions are carried out, is detected with agarose gel electrophoresis method.
- 3. it is a kind of to be used to detect lymphadenomatous fluorescent quantitative PCR detection method, it is characterised in that to comprise the steps：(1) 12 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive, Reverse transcription, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, its In, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three Multiple holes；(2) reverse transcription and PCR reactions, and real-time detection fluorescence are carried out；(3) the Ct values calculated according to fluoroscopic examination result, determine whether that target gene is expressed in sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610895860.5A CN106544417A (en) | 2016-10-14 | 2016-10-14 | It is a kind of to be used to detect lymphadenomatous primer sets and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610895860.5A CN106544417A (en) | 2016-10-14 | 2016-10-14 | It is a kind of to be used to detect lymphadenomatous primer sets and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106544417A true CN106544417A (en) | 2017-03-29 |
Family
ID=58368842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610895860.5A Pending CN106544417A (en) | 2016-10-14 | 2016-10-14 | It is a kind of to be used to detect lymphadenomatous primer sets and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106544417A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103237901A (en) * | 2010-03-01 | 2013-08-07 | 卡里斯生命科学卢森堡控股有限责任公司 | Biomarkers for theranostics |
-
2016
- 2016-10-14 CN CN201610895860.5A patent/CN106544417A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103237901A (en) * | 2010-03-01 | 2013-08-07 | 卡里斯生命科学卢森堡控股有限责任公司 | Biomarkers for theranostics |
Non-Patent Citations (3)
| Title |
|---|
| ABEER A BAHNASSY 等: "Circulating tumor and cancer stem cells in hepatitis C virus-associated liver disease", 《WORLD JOURNAL OF GASTROENTEROLOGY》 * |
| 万珊等: "外周T细胞淋巴瘤中VEGF表达和MVD水平及其临床意义", 《临床肿瘤学杂志》 * |
| 张明等: "淋巴瘤诊断及预后分子标志物研究进展", 《中华血液学杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6966508B2 (en) | Urine biomarker cohort, gene expression characteristics, and methods of their use | |
| Alix-Panabières et al. | Challenges in circulating tumour cell research | |
| Mostert et al. | Circulating tumor cells (CTCs): detection methods and their clinical relevance in breast cancer | |
| Economopoulou et al. | Liquid biopsy: an emerging prognostic and predictive tool in head and neck squamous cell carcinoma (HNSCC). Focus on circulating tumor cells (CTCs) | |
| US20190292601A1 (en) | Methods of diagnosing cancer using cancer testis antigens | |
| JP2019527544A (en) | Molecular marker, reference gene, and application thereof, detection kit, and detection model construction method | |
| US20070048750A1 (en) | Rapid efficacy assessment method for lung cancer therapy | |
| CN103866016A (en) | Circulating tumor cell detection kit and application thereof | |
| Zhang et al. | Association of chemotactic factor receptor 5 gene with breast cancer | |
| CN103074431B (en) | Special primer, kit and method for testing minRNA-128 in colorectal cancer serum | |
| CN110541030B (en) | Bladder cancer detection kit and application thereof | |
| CN107475363A (en) | Biomarker combination, the screening and its application of biomarker combination of a kind of non-small cell lung cancer | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| CN106399527A (en) | Primer group for detecting renal cancer and detecting method thereof | |
| CN107267659B (en) | Application of product for detecting TRIM gene and/or protein level | |
| Halawa et al. | The role of liquid biopsy in the diagnosis and prognosis of WHO grade 4 astrocytoma | |
| CN106544416A (en) | A kind of primer sets and detection method for detecting gastric cancer | |
| CN106834447A (en) | A kind of primer sets and detection method for detecting neuroblastoma | |
| CN106520924A (en) | Primer set and detection method for detecting ovarian cancer | |
| KR101704828B1 (en) | Method for diagnosing inflammatory diseases through analysis of protein or gene of extracellular vesicle in a body fluid | |
| Shimazui et al. | Detection of cadherin-6 mRNA by nested RT-PCR as a potential marker for circulating cancer cells in renal cell carcinoma | |
| CN106755459A (en) | A kind of primer sets and detection method for detecting breast cancer | |
| CN115261476A (en) | Method for screening serum exosome LncRNA HULC as liver cancer early marker and application of kit prepared by method | |
| CN106498041A (en) | A kind of primer sets and detection method for detecting cervical cancer | |
| CN106544417A (en) | It is a kind of to be used to detect lymphadenomatous primer sets and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170329 |
|
| RJ01 | Rejection of invention patent application after publication |