WO2024162636A1 - 망가니즈 익스포터 신규 변이체 및 이를 이용한 l-히스티딘 생산 방법 - Google Patents

망가니즈 익스포터 신규 변이체 및 이를 이용한 l-히스티딘 생산 방법 Download PDF

Info

Publication number
WO2024162636A1
WO2024162636A1 PCT/KR2024/000316 KR2024000316W WO2024162636A1 WO 2024162636 A1 WO2024162636 A1 WO 2024162636A1 KR 2024000316 W KR2024000316 W KR 2024000316W WO 2024162636 A1 WO2024162636 A1 WO 2024162636A1
Authority
WO
WIPO (PCT)
Prior art keywords
histidine
mntp
exporter
manganese
transformant
Prior art date
Application number
PCT/KR2024/000316
Other languages
English (en)
French (fr)
Inventor
한종윤
신원주
김필
조영일
Original Assignee
대상 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대상 주식회사 filed Critical 대상 주식회사
Publication of WO2024162636A1 publication Critical patent/WO2024162636A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/24—Proline; Hydroxyproline; Histidine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Definitions

  • the present invention relates to a novel manganese exporter mutant and a method for producing L-histidine using the same.
  • L-histidine is an essential amino acid that is not synthesized in humans or animals and must be supplied externally. It is generally produced by fermentation using microorganisms such as bacteria or yeast. L-histidine production can utilize a wild-type strain obtained in nature or a mutant strain modified to enhance its L-histidine production ability.
  • the present invention aims to provide a novel manganese exporter variant.
  • the present invention aims to provide a polynucleotide encoding the mutant.
  • the present invention aims to provide a transformant comprising the mutant or polynucleotide.
  • the present invention aims to provide a method for producing L-histidine using the transformant.
  • One aspect of the present invention provides a manganese exporter mutant comprising an amino acid sequence of SEQ ID NO: 1, wherein the 25th glycine in the amino acid sequence of SEQ ID NO: 3 is substituted with aspartic acid.
  • the “manganese exporter” used in the present invention is a protein expected to function as a manganese efflux pump, thereby conferring resistance to manganese.
  • the manganese exporter may be, but is not limited to, a polypeptide or protein encoded by the mntP gene or having manganese exporter activity.
  • the manganese exporter may be encoded by a base sequence of sequence number 4.
  • the manganese exporter may be a gene sequence encoding the manganese exporter of SEQ ID NO: 4 or a sequence having substantial identity therewith.
  • substantial identity means that when each gene sequence, i.e., base sequence or nucleotide sequence, and any other nucleotide sequence are aligned and analyzed to correspond as much as possible, any other nucleotide sequence has a sequence homology of 70% or more, 80% or more, 90% or more, or 98% or more with each nucleotide sequence.
  • the manganese exporter in the present invention comprises an amino acid sequence of sequence number 3.
  • the manganese exporter may be derived from wild type Escherichia coli.
  • variant refers to a polypeptide in which one or more amino acids are conservatively substituted, substituted, deleted, modified or added at the N-terminus, C-terminus and/or internally of an amino acid sequence of a specific gene, so that the polypeptide differs from the amino acid sequence before the mutation, but retains functions or properties.
  • a “conservative substitution” means replacing one amino acid with another amino acid having similar structural and/or chemical properties, and may have little or no effect on the activity of the protein or polypeptide.
  • amino acids are selected from alanine (Ala), isoleucine (Ile), valine (Val), leucine (Leu), methionine (Met), asparagine (Asn), cysteine (Cys), glutamine (Gln), serine (Ser), threonine (Thr), phenylalanine (Phe), tryptophan (Trp), tyrosine (Tyr), aspartic acid (Asp), glutamic acid (Glu), arginine (Arg), histidine (His), lysine (Lys), glycine (Gly), and proline (Pro).
  • variants include those in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted, or portions are deleted from the N- and/or C-terminus of the mature protein.
  • Such protein variants may have their abilities increased (enhanced), unchanged, or decreased (weakened) compared to the protein before the mutation.
  • increased or strengthened includes cases where the activity of the protein itself is increased compared to the protein before the mutation, cases where the overall protein activity level in the cell is higher than that of the wild-type strain or the strain expressing the protein before the mutation due to increased expression or increased translation of the gene encoding the protein, and combinations thereof.
  • “decreased or weakened” includes cases where the activity of the protein itself is decreased compared to the protein before the mutation, cases where the overall protein activity level in the cell is lower than that of the wild-type strain or the strain expressing the protein before the mutation due to inhibition of expression or inhibition of translation of the gene encoding the protein, and combinations thereof.
  • variant may be used interchangeably with variant, modification, variant polypeptide, mutated protein, mutation, etc.
  • the variant in the present invention may be a manganese exporter in which glycine, the 25th amino acid in the amino acid sequence of sequence number 3, is substituted with aspartic acid, and may be composed of the amino acid sequence of sequence number 1.
  • the manganese exporter variant may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with the amino acid sequence of SEQ ID NO: 1.
  • “homology” or “identity” means the rate of identity (%) between two amino acid sequences when the reference amino acid sequence and any other amino acid sequence are aligned and analyzed so as to correspond as much as possible.
  • Such a manganese exporter variant may include, without limitation, an amino acid sequence that maintains the function or property thereof.
  • Another aspect of the present invention provides a polynucleotide encoding the manganese exporter variant.
  • polynucleotide used in the present invention means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.
  • the above polynucleotide may comprise a base sequence encoding an amino acid sequence of sequence number 1.
  • the polynucleotide may include a base sequence represented by SEQ ID NO: 2.
  • Another aspect of the present invention provides a vector comprising a polynucleotide encoding the manganese exporter variant.
  • another aspect of the present invention provides a transformant comprising the manganese exporter mutant or polynucleotide.
  • vector refers to any type of nucleic acid sequence carrier structure used as a means for delivering a target gene to a host cell to cause expression.
  • the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and/or to be expressed independently.
  • Such a vector includes essential regulatory elements that are operably linked to allow the gene insert to be expressed, and “operably linked” means that the target gene and its regulatory sequence are functionally linked to each other to enable gene expression, and “regulatory elements” include a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that regulates the termination of transcription and translation.
  • the vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used.
  • the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state.
  • phage vectors or cosmid vectors include pWE15, M13, ⁇ MBL3, ⁇ MBL4, ⁇ IXII, ⁇ ASHII, ⁇ APII, ⁇ t10, ⁇ t11, Charon4A, Charon21A, etc.
  • plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.
  • the above vector can typically be constructed as a vector for cloning or as a vector for expression.
  • the vector for expression can be a conventional one used in the art to express foreign genes or proteins in plants, animals or microorganisms, and can be constructed through various methods known in the art.
  • the “recombinant vector” used in the present invention can be replicated independently of the genome of the host cell after being transformed into a suitable host cell, or can be incorporated into the genome itself.
  • the “suitable host cell” may include an origin of replication, which is a specific base sequence where replication is initiated as a vector capable of replicating.
  • the vector used is an expression vector and a prokaryotic cell is used as the host, it generally includes a strong promoter capable of initiating transcription (e.g., pL ⁇ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription/translation termination sequence.
  • the replication origin operating in a eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin.
  • a promoter derived from the genome of a mammalian cell e.g., a metallothionein promoter
  • a promoter derived from a mammalian virus e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV
  • an adenovirus late promoter e.g., a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV
  • an adenovirus late promoter e.g., a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV
  • an adenovirus late promoter e.g., a vaccinia virus 7.5K promoter, an
  • the above recombinant vector may include a selection marker, and the selection marker is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible.
  • Representative examples of the selection marker include, but are not limited to, kanamycin, streptomycin, chloramphenicol, etc.
  • a transformant can be created by inserting a recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell.
  • Any host cell known in the art can be used as the host cell, as long as it is capable of stably and continuously cloning or expressing the expression vector.
  • the host cells When transforming prokaryotic cells to produce recombinant microorganisms, the host cells that can be used include, but are not limited to, various enteric bacteria and strains, such as E. coli strains such as E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, and E. coli XL1-Blue, Bacillus strains such as Bacillus subtilis and Bacillus thuringiensis, Corynebacterium strains, Salmonella typhimurium, Serratia marcescens, and Pseudomonas species.
  • E. coli strains such as E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, and E. coli XL1-Blue
  • yeast e.g., Saccharomyces cerevisiae
  • insect cells plant cells
  • animal cells such as Sp2/0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines
  • Sp2/0 e.g., Saccharomyces cerevisiae
  • insect cells plant cells
  • animal cells such as Sp2/0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines
  • Transformation refers to a phenomenon in which external DNA is introduced into a host cell to artificially cause a genetic change
  • transformant refers to a host cell into which external DNA is introduced and which stably maintains the expression of a target gene.
  • the above transformation can be performed by selecting a suitable vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed in the host cell.
  • vector introduction can be performed by electroporation, heat-shock, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto.
  • the transformed gene can be included without limitation, whether it is inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell.
  • the above transformant includes a cell transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.
  • the transformant may be a strain of the genus Escherichia .
  • Escherichia genus strains include, but are not limited to, Escherichia coli , Escherichia albertii, Escherichia blattae , Escherichia fergusonii , Escherichia hermannii , and Escherichia vulneris .
  • the transformant in the present invention may be, but is not limited to, a strain comprising the manganese exporter variant described above or a polynucleotide encoding the same, or a vector comprising the same, a strain expressing the manganese exporter variant or polynucleotide, or a strain having activity against the manganese exporter variant.
  • the transformant may have the ability to produce L-histidine.
  • the above transformant may have a natural L-histidine production ability, or may have L-histidine production ability artificially added.
  • the transformant may have improved L-histidine production ability due to a change in manganese exporter activity.
  • the parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a subject that is directly the target of mutation or transformed with a recombinant vector, etc.
  • the parent strain may be a wild type Escherichia spp. strain or an Escherichia spp. strain that is mutated from the wild type.
  • the transformant according to the present invention exhibits increased L-histidine production ability compared to the parent strain due to changes in the activity of the manganese exporter caused by the introduction of the manganese exporter mutant. More specifically, the transformant may have an increase in L-histidine production by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or may have an increase in L-histidine production by 1.1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, or 10-fold, but is not limited thereto.
  • a transformant including the manganese exporter mutant may have an increased L-histidine production of
  • Another aspect of the present invention provides a method for producing L-histidine, comprising the steps of culturing the transformant in a medium; and recovering L-histidine from the transformant or the medium in which the transformant is cultured.
  • the above culture can be carried out according to appropriate media and culture conditions known in the art, and those skilled in the art can easily adjust the media and culture conditions and use them.
  • the media may be a liquid media, but is not limited thereto.
  • the culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.
  • the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art.
  • the culture medium for Escherichia spp. strains can be referred to a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981), but is not limited thereto.
  • the medium may include various carbon sources, nitrogen sources, and trace element components.
  • Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid.
  • sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose
  • oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil
  • fatty acids such as palmitic acid, stearic acid, and linoleic acid
  • alcohols such as glycerol and ethanol
  • organic acids such as acetic acid.
  • Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts. In addition, the culture medium may contain, but are not limited to, metal salts such as magnesium sulfate or iron sulfate necessary for growth.
  • essential growth substances such as amino acids and vitamins may be included.
  • suitable precursors may be used in the culture medium.
  • the medium or individual components may be added to the culture solution in a suitable manner during the culturing process, either batchwise or continuously, but are not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture solution during culturing to adjust the pH of the culture solution.
  • an antifoaming agent such as fatty acid polyglycol ester may be used during culturing to suppress bubble formation.
  • oxygen or an oxygen-containing gas e.g., air
  • the temperature of the culture solution may be typically 20 to 45°C, for example, 25 to 40°C. The culturing period may continue until a desired amount of useful substances is obtained, for example, 10 to 160 hours.
  • the step of recovering L-histidine from the cultured transformant or the medium in which the transformant is cultured can collect or recover the L-histidine produced from the medium using a suitable method known in the art depending on the culturing method.
  • a suitable method known in the art depending on the culturing method.
  • centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) can be used, but the present invention is not limited thereto.
  • the step of recovering the L-histidine can be performed by removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.
  • the step of recovering L-histidine may include a process of purifying L-histidine.
  • the manganese exporter mutant according to the present invention has a changed protein activity by substituting one or more amino acids in the amino acid sequence constituting the manganese exporter, and a recombinant microorganism containing the mutant can efficiently produce L-histidine.
  • PCR was performed using the genomic DNA of Escherichia coli DS9H (MG1655) (Accession No. KCTC14419BP) (hereinafter referred to as “DS9H”) as a template and the primer pair mntP_G25D_first-F and mntP_G25D_first-R and the primer pair mntP_G25D_second-F and mntP_G25D_second-R, respectively. Thereafter, two PCR products containing the 25th amino acid mutation of the mntP gene were used as templates and overlapping PCR was performed with the primer pair mnt_G25D_first-F and mntP_G25D_second-R to link them into a single fragment.
  • the PCR fragment and pTRC99A plasmid were treated with restriction enzymes EcoRI and HindIII (NEB) and cloned using T4 ligase.
  • the constructed plasmid was named pTRC99A-mntP_G25D, and the sequence was confirmed using the primer pair pTRC99A-CF and pTRC99A-CR.
  • pfu premix bioneer
  • pfu premix bioneer
  • the reaction was repeated 30 times at 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 1 minute and 30 seconds, and then at 72°C for 5 minutes.
  • the primer sequences used for plasmid construction are shown in Table 1 below.
  • Primer name Sequence number Primer sequence (5'-3') mntP_G25D_first-F 5 ATATGAATTCAAGCAATGAAATAATATATTCCAACAG mntP_G25D_first-R 6 GGTTTATGGAGGGTGGCATC mntP_G25D_second-F 7 GATGCCACCCTCCATAAACC mntP_G25D_second-R 8 ATATAAGCTTTTAACCGTGGAAGTGGCGTCC pTRC99A-CF 9 ACCAATGCTTCTGGCGTCAG pTRC99A-CR 10 TACTGCCGCCAGGCAAATTC
  • a one-step inactivation method was used to introduce plasmid pTRC99A-mntP_G25D containing mntP_G25D into the chromosome of E. coli DS9H strain (Warner et al., PNAS, 6:6640-6645(2000)).
  • the mntP_HF and mntP_HR fragments were amplified by PCR using the genomic DNA of Escherichia coli DS9H as a template and the primer pairs mntP_HF-F and mntP_HF-R and mntP_HR-F and mntP_HR-R, respectively, to amplify the mntP_HF and mntP_HR fragments.
  • the cassette fragment was obtained by amplification using the primer pairs FRT+mntP_HF-F and FRT-R from the pKD13 plasmid (CGSC).
  • the mntP_G25D fragment was obtained by using the primer pairs mntP-F and mntP+mntP_HR-R from the pTRC99A-mntP_G25D plasmid.
  • the four amplified PCR fragments were used as templates and linked into a single fragment using overlapping PCR with the primer pair mntP_HF-F and mntP_HR-R.
  • the linked DNA fragment was introduced into E. coli DS9H strain carrying the pKD46 plasmid (CGSC) by electroporation. Afterwards, PCR was performed using the primer pair mntP-CF and mntP-CR for cell lines showing kanamycin resistance to identify strains into which mntP_G25D was introduced.
  • CGSC pKD46 plasmid
  • the pCP20 plasmid (ADDGENE) was introduced into the strains confirmed to have introduced mntP_G25D, and FLP recombination was induced. Then, the removal of the antibiotic was confirmed through growth on LB plate media with and without added antibiotic (kanamycin). The strains from which the antibiotic had been removed grew on LB plate media, but did not grow on LB plate media with added antibiotic (kanamycin). Finally, the sequence was confirmed using the primer pair of primers mntP-CF and mntP-CR, and the mutant strain introduced with mntP_G25D was named DS9H_::mntP_G25D.
  • pfu premix bioneer
  • pfu premix bioneer
  • the reaction was repeated 30 times at 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 2 minutes and 30 seconds, and then at 72°C for 5 minutes.
  • the primer sequences used to create mutant strains are as shown in Table 2 below.
  • Primer name Sequence number Primer sequence (5'-3') mntP_HF-F 11 TTCTTCGCCAATGTCTGGAT mntP_HF-R 12 TATTGATAACGATTTTCATTTGG FRT+mntP_HF-F 13 AATGAAAATCGTTATCAATAGTGTAGGCTGGAGCTGCTTC FRT-R 14 ATCAATTCGCGCTAACTCACACATGAGAATTAATTCCGGGG mntP-F 15 CCCGGAATTAATTCTCATGTGTGAGTTAGCGCGAATTGATCTG mntP+mntP_HR-R 16 CACCTCTGGCAGCGTTCTTATTAACCGTGGAAGTGCGTCC mntP_HR-F 17 TAAGAACGCTGCCAGAGGTG mntP_HR-R 18 TGGGTCATTACTGCCACGCC mntP-CF 19 ATCATGGTGCGTTAATAACGAC mntP-CR 20 TTGCCGTTTTCCGATACCAG
  • Each strain (parent strain or mutant strain) was inoculated at 1% volume by volume into a 100 mL flask containing 10 mL of the histidine production medium in Table 3 below, and cultured with shaking at 34°C and 200 rpm for 72 hours. After completion of the culture, the concentration of L-histidine in the medium was measured using HPLC (Agilent), and the results are shown in Table 4 below.
  • the mutant strain introduced with the manganese exporter mutant was confirmed to have an approximately 27% increase in L-histidine production compared to the parent strain due to the substitution of the 25th glycine with aspartic acid.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 망가니즈 익스포터 신규 변이체 및 이를 이용한 L-히스티딘 생산 방법에 관한 것으로, 상기 망가니즈 익스포터 변이체는 망가니즈 익스포터를 구성하는 아미노산 서열 중 하나 이상의 아미노산이 치환됨으로써 단백질 활성이 변화되어, 이를 포함하는 재조합 미생물은 L-히스티딘을 효율적으로 생산할 수 있다.

Description

망가니즈 익스포터 신규 변이체 및 이를 이용한 L-히스티딘 생산 방법
본 발명은 망가니즈 익스포터 신규 변이체 및 이를 이용한 L-히스티딘 생산 방법에 관한 것이다.
L-히스티딘(L-histidine)은 사람이나 동물 체내에서 합성되지 않는 필수아미노산으로서 외부에서 공급되어야 하며, 일반적으로 세균이나 효모와 같은 미생물을 이용한 발효에 의해 생산된다. L-히스티딘 생산은 자연상태에서 수득된 야생형 균주나 이의 L-히스티딘 생산능이 향상되도록 변형된 변이주를 이용할 수 있다.
최근에는 L-히스티딘의 생산 효율을 개선시키기 위해 L-아미노산 및 기타 유용물질 생산에 많이 이용되는 대장균, 코리네박테리움 등의 미생물을 대상으로 유전자 재조합 기술을 적용하여 우수한 L-히스티딘 생산능을 갖는 다양한 재조합 균주 또는 변이주 및 이를 이용한 L-히스티딘 생산 방법이 개발되고 있다. 특히 L-히스티딘의 생합성 경로에 관여하는 효소, 전사인자, 수송 단백질 등의 유전자를 대상으로 하거나, 또는 이들의 발현을 조절하는 프로모터에 변이를 유도하여 L-히스티딘의 생산량을 증대시키려는 시도가 있었다. 그러나 L-히스티딘 생산에 직간접적으로 연관된 효소, 전사인자, 수송 단백질 등 단백질의 종류가 수십 ~ 수백여 종에 이르기 때문에 이러한 단백질의 활성 변화에 따른 L-히스티딘 생산능 증가 여부에 관해 여전히 많은 연구가 필요한 실정이다.
[선행기술문헌]
[특허문헌]
한국등록특허 제10-1904666호
한국등록특허 제10-2004917호
본 발명은 신규한 망가니즈 익스포터 변이체를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 변이체를 암호화하는 폴리뉴클레오티드를 제공하는 것을 목적으로 한다..
또한, 본 발명은 상기 변이체 또는 폴리뉴클레오티드를 포함하는 형질전환체를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기 형질전환체를 이용한 L-히스티딘의 생산 방법을 제공하는 것을 목적으로 한다.
본 발명의 일 양상은 서열번호 3의 아미노산 서열에서 25번째 글리신이 아스파트산으로 치환된, 서열번호 1의 아미노산 서열로 이루어진 망가니즈 익스포터 변이체를 제공한다.
본 발명에서 사용된 “망가니즈 익스포터(manganese exporter)”는 망간 유출 펌프(manganese efflux pump)로 기능할 것으로 예상되는 단백질로, 망간에 대한 내성을 부여한다. 상기 망가니즈 익스포터는 mntP 유전자에 의해 암호화되거나 망가니즈 익스포터 활성을 가지는 폴리펩티드 또는 단백질일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 망가니즈 익스포터는 서열번호 4의 염기서열에 의해 암호화된 것일 수 있다.
보다 구체적으로, 상기 망가니즈 익스포터는 서열번호 4의 망가니즈 익스포터를 암호화하는 유전자 서열 또는 이와 실질적 동일성을 가지는 서열일 수 있다. 여기서 “실질적 동일성”이란 각각의 유전자 서열, 즉 염기서열 또는 뉴클레오티드 서열과 임의의 다른 뉴클레오티드 서열을 최대한 대응되도록 정렬하여 분석하였을 때 상기 임의의 다른 뉴클레오티드 서열이 각각의 뉴클레오티드 서열과 70% 이상, 80% 이상, 90% 이상 또는 98% 이상의 서열 상동성을 가지는 것을 의미한다.
본 발명에서의 망가니즈 익스포터는 서열번호 3의 아미노산 서열을 포함한다.
본 발명의 일 구체예에 따르면, 상기 망가니즈 익스포터는 야생형 에스케리치아 콜라이(Escherichia coli)에서 유래한 것일 수 있다.
본 발명에서 사용된 “변이체”는 특정 유전자의 아미노산 서열 중 N-말단, C-말단 및/또는 내부에서 하나 이상의 아미노산이 보존적 치환(conservative substitution), 치환(substitution), 결실(deletion), 변형(modification) 또는 부가(addition)되어 변이 전 아미노산 서열과 상이하나, 기능(functions) 또는 특성(properties)이 유지되는 폴리펩티드를 의미한다. 여기서 “보존적 치환”이란 하나의 아미노산을 구조적 및/또는 화학적 성질이 유사한 다른 아미노산으로 치환시키는 것을 의미하며, 단백질 또는 폴리펩티드의 활성에 거의 영향을 미치지 않거나, 또는 전혀 영향을 미치지 않을 수 있다. 상기 아미노산으로는 알라닌(Ala), 이소루신(Ile), 발린(Val), 루신(Leu), 메티오닌(Met), 아스파라긴(Asn), 시스테인(Cys), 글루타민(Gln), 세린(Ser), 트레오닌(Thr), 페닐알라닌(Phe), 트립토판(Trp), 티로신(Tyr), 아스파트산(Asp), 글루탐산(Glu), 아르기닌(Arg), 히스티딘(His), 라이신(Lys), 글리신(Gly) 및 프롤린(Pro)으로부터 선택된 것이다.
또한, 변이체는 N-말단 리더 서열 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거되거나, 또는 성숙 단백질(mature protein)의 N- 및/또는 C-말단으로부터 일부분이 제거된 것을 포함한다.
이러한 단백질 변이체는 그 능력이 변이 전 단백질에 비하여 증가 (강화)되거나, 변하지 않거나, 또는 감소 (약화)될 수 있다. 여기서 "증가 또는 강화"는 단백질 자체의 활성이 변이 전 단백질에 비하여 증가한 경우, 단백질을 암호화하는 유전자의 발현 증가 또는 번역 증가 등으로 세포 내에서 전체적인 단백질 활성 정도가 야생형 균주 또는 변이 전 단백질을 발현하는 균주에 비하여 높은 경우, 및 이들의 조합을 포함한다. 또한 "감소 또는 약화"는 단백질 자체의 활성이 변이 전 단백질에 비해 감소한 경우, 단백질을 암호화하는 유전자의 발현 저해 또는 번역 저해 등으로 세포 내에서 전체적인 단백질 활성 정도가 야생형 균주 또는 변이 전 단백질을 발현하는 균주에 비하여 낮은 경우, 및 이들의 조합을 포함한다. 본 발명에서는 변이체가 변이형, 변형, 변이형 폴리펩티드, 변이된 단백질, 변이 등과 혼용될 수 있다.
본 발명에서의 변이체는 서열번호 3의 아미노산 서열에서 25번째 위치한 아미노산인 글리신이 아스파트산으로 치환된 망가니즈 익스포터로, 서열번호 1의 아미노산 서열로 이루어진 것일 수 있다.
보다 구체적으로, 상기 망가니즈 익스포터 변이체는 서열번호 1의 아미노산 서열과 비교하여 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% 또는 100%의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 여기서 "상동성" 또는 "동일성"이란 기준이 되는 아미노산 서열과 임의의 다른 아미노산 서열을 최대한 대응되도록 정렬하여 분석하였을 때 두 아미노산 서열 간의 일치율(%)을 의미한다. 이러한 망가니즈 익스포터 변이체는 그 기능 또는 특성을 유지하는 아미노산 서열이라면 제한 없이 포함할 수 있다.
본 발명의 다른 양상은 상기 망가니즈 익스포터 변이체를 암호화하는 폴리뉴클레오티드를 제공한다.
본 발명에서 사용된 “폴리뉴클레오티드(polynucleotide)”는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 보다 구체적으로는 상기 변이체를 암호화하는 폴리뉴클레오티드 단편을 의미한다.
상기 폴리뉴클레오티드는 서열번호 1의 아미노산 서열을 암호화하는 염기서열을 포함할 수 있다.
본 발명의 일 구체예에 따르면, 상기 폴리뉴클레오티드는 서열번호 2로 표시되는 염기서열을 포함하는 것일 수 있다.
본 발명의 다른 양상은 상기 망가니즈 익스포터 변이체를 암호화하는 폴리뉴클레오티드를 포함하는 벡터를 제공한다.
또한, 본 발명의 다른 양상은 상기 망가니즈 익스포터 변이체 또는 폴리뉴클레오티드를 포함하는 형질전환체를 제공한다.
본 발명에서 사용된 “벡터(vector)”는 숙주세포에 목적 유전자를 전달하여 발현시키기 위한 수단으로 사용되는 모든 유형의 핵산 서열 운반 구조체를 의미한다. 상기 벡터는 특별한 언급이 없는 한, 담지된 핵산 서열이 숙주세포 유전체 내 삽입되어 발현되도록 하는 것 및/또는 독자적으로 발현되도록 하는 것을 의미할 수 있다. 이러한 벡터는 유전자 삽입물이 발현되도록 작동가능하게 연결된 필수적인 조절요소를 포함하며, “작동가능하게 연결된(operably linked)”이란 목적 유전자와 이의 조절 서열이 서로 기능적으로 결합되어 유전자 발현을 가능케 하는 방식으로 연결된 것을 의미하고, “조절요소”는 전사를 수행하기 위한 프로모터, 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 암호화하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함한다.
본 발명에서 사용되는 벡터는 숙주세포 내에서 복제 가능한 것이라면 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 상기 벡터의 일례로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들면, 파지 벡터 또는 코스미드 벡터로는 pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A 등이 있으며, 플라스미드 벡터로는 pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등이 있으나, 이에 한정되는 것은 아니다.
상기 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 발현을 위한 벡터는 당업계에서 식물, 동물 또는 미생물에서 외래의 유전자 또는 단백질을 발현하는데 사용되는 통상의 것을 사용할 수 있으며, 당업계에 공지된 다양한 방법을 통해 구축될 수 있다.
본 발명에서 사용된 “재조합 벡터”는 적합한 숙주세포 내로 형질전환된 후, 숙주세포의 게놈과 무관하게 복제 가능하거나 게놈 그 자체에 봉합될 수 있다. 이때, 상기 "적합한 숙주세포"는 벡터가 복제 가능한 것으로서 복제가 개시되는 특정 염기서열인 복제 원점을 포함할 수 있다. 예를 들어, 사용되는 벡터가 발현 벡터이고 원핵세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터 (예컨대, pLλ 프로모터, CMV 프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 진핵세포를 숙주로 하는 경우에는, 벡터에 포함되는 진핵세포에서 작동하는 복제원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점 및 BBV 복제원점 등을 포함하나, 이에 한정되는 것은 아니다. 또한, 포유동물 세포의 게놈으로부터 유래된 프로모터 (예컨대, 메탈로 티오닌 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터 (예컨대, 아데노 바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토 메갈로 바이러스 프로모터, HSV의 tk 프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 가진다.
상기 재조합 벡터는 선택 마커(selection marker)를 포함할 수 있는데, 상기 선택 마커는 벡터로 형질전환된 형질전환체 (숙주세포)를 선별하기 위한 것으로 상기 선택 마커가 처리된 배지에서 선택 마커를 발현하는 세포만 생존할 수 있기 때문에, 형질전환된 세포의 선별이 가능하다. 상기 선택 마커는 대표적인 예로 카나마이신, 스트렙토마이신, 클로람페니콜 등이 있으나, 이에 한정되는 것은 아니다.
재조합 벡터를 숙주세포에 삽입함으로써 형질전환체를 만들 수 있으며, 상기 형질전환체는 재조합 벡터를 적절한 숙주세포에 도입시킴으로써 얻어진 것일 수 있다. 숙주세포는 상기 발현벡터를 안정되면서 연속적으로 클로닝 또는 발현시킬 수 있는 세포로서 당업계에 공지된 어떠한 숙주세포도 이용할 수 있다.
재조합 미생물을 제작하기 위하여 원핵세포에 형질전환시키는 경우에는 숙주세포로서 E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli XL1-Blue와 같은 대장균 속 균주, 바실러스 서브틸리스, 바실러스 츄린겐시스와 같은 바실러스 속 균주, 코리네박테리움 속 균주, 살모넬라 티피무리움, 세라티아 마르세슨스 및 슈도모나스 종과 같은 다양한 장내균과 균주 등이 이용되는 것일 수 있으나, 이에 한정되는 것은 아니다.
재조합 미생물을 제작하기 위하여 진핵세포에 형질전환을 하는 경우에는 숙주세포로서 효모 (예컨대, 사카로마이세스 세레비지에), 곤충 세포, 식물 세포 및 동물 세포, 예를 들어, Sp2/0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK 세포주 등이 이용될 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 사용된 “형질전환(transformation)”은 외부 DNA를 숙주세포 내로 도입하여 인위적으로 유전적인 변화를 일으키는 현상을 의미하며, “형질전환체(transformat)”는 외부 DNA가 도입되어 목적 유전자의 발현을 안정적으로 유지하는 숙주세포를 의미한다.
상기 형질전환은 숙주세포에 따라 적합한 벡터 도입 기술이 선택되어 목적 유전자 또는 이를 포함하는 재조합 벡터를 숙주세포 내에서 발현시킬 수 있다. 예를 들면, 벡터 도입은 전기천공법(electroporation), 열 충격(heat-shock), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 초산 리튬-DMSO법, 또는 이들의 조합에 의해 수행될 수 있으나, 이에 한정되는 것은 아니다. 형질전환된 유전자는 숙주세포 내에서 발현될 수 있으면 숙주세포의 염색체 내 삽입 또는 염색체 외에 위치하고 있는 것이든 제한하지 않고 포함될 수 있다.
상기 형질전환체는 생체내 또는 시험관내에서 본 발명에 따른 재조합 벡터로 형질감염, 형질전환, 또는 감염된 세포를 포함하며, 재조합 숙주세포, 재조합 세포 또는 재조합 미생물과 동일한 용어로 사용될 수 있다.
본 발명의 일 구체예에 따르면, 상기 형질전환체는 에스케리치아(Escherichia) 속 균주인 것일 수 있다.
상기 에스케리치아 속 균주로는 에스케리치아 콜라이(Escherichia coli), 에스케리치아 알베르티(Escherichia albertii), 에스케리치아 블라태(Escherichia blattae), 에스케리치아 퍼구소니(Escherichia fergusonii), 에스케리치아 헤르만니(Escherichia hermannii), 에스케리치아 불네리스(Escherichia vulneris) 등이 있으나, 이에 한정되는 것은 아니다.
본 발명에서의 형질전환체는 전술한 망가니즈 익스포터 변이체 또는 이를 암호화하는 폴리뉴클레오티드를 포함하거나, 또는 이를 포함하는 벡터를 포함하는 균주, 상기 망가니즈 익스포터 변이체 또는 폴리뉴클레오티드를 발현하는 균주, 또는 상기 망가니즈 익스포터 변이체에 대한 활성을 가지는 균주일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 형질전환체는 L-히스티딘 생산능을 가지는 것일 수 있다.
상기 형질전환체는 자연적으로 L-히스티딘 생산능을 가지고 있거나, 또는 인위적으로 L-히스티딘 생산능이 부여된 것일 수 있다.
본 발명의 일 구체예에 따르면, 상기 형질전환체는 망가니즈 익스포터 활성이 변화되어 L-히스티딘 생산능이 향상된 것일 수 있다.
본 발명에서 사용된 “생산능이 향상된”은 모균주에 비해 L-히스티딘의 생산성이 증가된 것을 의미한다. 상기 모균주는 변이의 대상이 되는 야생형 또는 변이주를 의미하며, 직접 변이의 대상이 되거나 재조합된 벡터 등으로 형질전환되는 대상을 포함한다. 본 발명에 있어서, 모균주는 야생형 에스케리치아 속 균주이거나 야생형으로부터 변이된 에스케리치아 속 균주일 수 있다.
본 발명에 따른 형질전환체는 망가니즈 익스포터 변이체가 도입됨으로써 망가니즈 익스포터의 활성이 변화하여 모균주에 비해 증가된 L-히스티딘 생산능을 나타낸다. 보다 구체적으로, 상기 형질전환체는 모균주에 비해 L-히스티딘 생산량이 적어도 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 또는 100% 증가하거나, 또는 1.1배, 1.5배, 2배, 2.5배, 3배, 3.5배, 4배, 4.5배, 5배, 5.5배, 6배, 6.5배, 7배, 7.5배, 8배, 8.5배, 9배, 9.5배 또는 10배 증가된 것일 수 있으나, 이에 한정되는 것은 아니다. 일례로, 상기 망가니즈 익스포터 변이체를 포함한 형질전환체는 모균주에 비해 L-히스티딘 생산량이 5% 이상, 구체적으로는 5 내지 50% (바람직하게는 10 내지 40%) 증가된 것일 수 있다.
본 발명의 다른 양상은 상기 형질전환체를 배지에서 배양하는 단계; 및 상기 형질전환체 또는 형질전환체가 배양된 배지로부터 L-히스티딘을 회수하는 단계를 포함하는 L-히스티딘의 생산 방법을 제공한다.
상기 배양은 당업계에 알려진 적절한 배지와 배양 조건에 따라 이루어질 수 있으며, 통상의 기술자라면 배지 및 배양 조건을 용이하게 조정하여 사용할 수 있다. 구체적으로, 상기 배지는 액체 배지일 수 있으나, 이에 한정되는 것은 아니다. 배양 방법은 예를 들면, 회분식 배양(batch culture), 연속식 배양(continuous culture), 유가식 배양(fed-batch culture) 또는 이들의 조합 배양을 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 상기 배지는 적절한 방식으로 특정 균주의 요건을 충족해야 하며, 통상의 기술자에 의해 적절하게 변형될 수 있다. 에스케리치아 속 균주에 대한 배양 배지는 공지된 문헌 (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington D.C., USA, 1981)을 참조할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배지에 다양한 탄소원, 질소원 및 미량원소 성분을 포함할 수 있다. 사용될 수 있는 탄소원으로는 글루코스, 수크로스, 락토스, 프락토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있으나, 이에 한정되는 것은 아니다. 사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산 암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함될 수 있다. 질소원 또한 개별적으로 또는 혼합물로서 사용할 수 있으나 이에 한정되는 것은 아니다. 사용될 수 있는 인의 공급원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함될 수 있으며, 이에 한정되는 것은 아니다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있으며, 이에 한정되는 것은 아니다. 그 외에, 아미노산 및 비타민과 같은 필수 성장 물질이 포함될 수 있다. 또한 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기 배지 또는 개별 성분은 배양과정에서 배양액에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 구체예에 따르면, 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산 및 황산과 같은 화합물을 미생물 배양액에 적절한 방식으로 첨가하여 배양액의 pH를 조정할 수 있다. 또한, 배양 중에 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 추가적으로, 배양액의 호기 상태를 유지하기 위하여, 배양액 내로 산소 또는 산소-함유 기체 (예, 공기)를 주입할 수 있다. 배양액의 온도는 통상 20 내지 45℃, 예를 들면 25 내지 40℃일 수 있다. 배양기간은 유용물질이 원하는 생산량으로 수득될 때까지 계속될 수 있으며, 예를 들면 10 내지 160시간일 수 있다.
본 발명의 일 구체예에 따르면, 상기 배양된 형질전환체 또는 형질전환체가 배양된 배지에서 L-히스티딘을 회수하는 단계는 배양 방법에 따라 당해 분야에 공지된 적합한 방법을 이용하여 배지로부터 생산된 L-히스티딘을 수집 또는 회수할 수 있다. 예를 들면 원심분리, 여과, 추출, 분무, 건조, 증발, 침전, 결정화, 전기영동, 분별용해 (예를 들면, 암모늄 설페이트 침전), 크로마토그래피 (예를 들면, 이온 교환, 친화성, 소수성 및 크기배제) 등의 방법을 사용할 수 있으나, 이에 한정되는 것은 않는다.
본 발명의 일 구체예에 따르면, 상기 L-히스티딘을 회수하는 단계는 배양 배지를 저속 원심분리하여 바이오매스를 제거하고 얻어진 상등액을 이온교환 크로마토그래피를 통하여 분리할 수 있다.
본 발명의 일 구체예에 따르면, 상기 L-히스티딘을 회수하는 단계는 L-히스티딘을 정제하는 공정을 포함할 수 있다.
본 발명에 따른 망가니즈 익스포터 변이체는 망가니즈 익스포터를 구성하는 아미노산 서열 중 하나 이상의 아미노산이 치환됨으로써 단백질 활성이 변화되어, 이를 포함하는 재조합 미생물은 L-히스티딘을 효율적으로 생산할 수 있다.
이하, 본 발명을 보다 상세하게 설명한다. 그러나, 이러한 설명은 본 발명의 이해를 돕기 위하여 예시적으로 제시된 것일 뿐, 본 발명의 범위가 이러한 예시적인 설명에 의하여 제한되는 것은 아니다.
실시예 1. 망가니즈 익스포터 변이체를 발현하는 균주 제작
망가니즈 익스포터의 아미노산 서열 (서열번호 3)에서 25번째 위치한 글리신(G)이 아스파트산(D)으로 치환된 변이체가 L-히스티딘의 생산에 미치는 영향을 확인하기 위해, 상기 망가니즈 익스포터 변이체를 발현하는 플라스미드 및 상기 벡터가 도입된 균주를 제작하였다.
1-1. mntP_G25D가 도입된 플라스미드 제작
대장균(Escherichia coli) DS9H (MG1655) (수탁번호 KCTC14419BP)(이하 'DS9H'라 함)의 genomic DNA를 주형으로 프라이머 mntP_G25D_first-F 및 mntP_G25D_first-R의 프라이머 쌍과 프라이머 mntP_G25D_second-F 및 mntP_G25D_second-R의 프라이머 쌍을 이용하여 각각 PCR을 수행하였다. 이후, mntP 유전자의 25번 아미노산 변이를 포함하는 두 개의 PCR 산물을 각각 주형으로 사용하여 프라이머 mnt_G25D_first-F 및 mntP_G25D_second-R의 프라이머 쌍으로 오버랩핑(overlapping) PCR을 수행하여 하나의 단편으로 연결시켰다. PCR 단편과 pTRC99A 플라스미드 (ADDGENE)에 제한효소 EcoRI 및 HindIII (NEB)을 처리하고 T4 리가아제(ligase)를 사용하여 클로닝하였다. 구축된 플라스미드는 pTRC99A-mntP_G25D로 명명하였고, 프라이머 pTRC99A-CF 및 pTRC99A-CR의 프라이머 쌍을 사용하여 서열을 확인하였다.
PCR 증폭에서는 pfu premix (bioneer)를 사용하였고, 95℃에서 5분 변성한 후 95℃에서 30초, 58℃에서 30초, 72℃에서 1분 30초를 30회 반복하고 72℃에서 5분간 반응시켰다.
플라스미드 제작에 사용된 프라이머 서열은 하기 표 1과 같다.
프라이머 명칭 서열번호 프라이머 서열 (5'-3')
mntP_G25D_first-F 5 ATATGAATTCAAGCAATGAAATAATATATTCCAACAG
mntP_G25D_first-R 6 GGTTTATGGAGGGTGGCATC
mntP_G25D_second-F 7 GATGCCACCCTCCATAAACC
mntP_G25D_second-R 8 ATATAAGCTTTTAACCGTGGAAGTGCGTCC
pTRC99A-CF 9 ACCAATGCTTCTGGCGTCAG
pTRC99A-CR 10 TACTGCCGCCAGGCAAATTC
1-2. mntP_G25D가 도입된 변이주 제작
mntP_G25D가 도입된 플라스미드 pTRC99A-mntP_G25D를 E. coli DS9H 균주의 크로모좀에 도입하기 위해 원스텝 불활성화 방법을 이용하였다 (Warner et al., PNAS, 6:6640-6645(2000)).
먼저, 상동 재조합(homologous recombination)을 위한 mntP 유전자의 앞쪽과 뒤쪽 단편을 얻기 위해 대장균(Escherichia coli) DS9H의 genomic DNA를 주형으로 하여 프라이머 mntP_HF-F 및 mntP_HF-R의 프라이머 쌍과 프라이머 mntP_HR-F 및 mntP_HR-R의 프라이머 쌍을 사용하여 PCR을 통해 mntP_HF와 mntP_HR 단편을 각각 증폭하였다. 그리고 카나마이신 항생제 마커와 FRT가 포함된 카세트를 얻기 위해, pKD13 플라스미드 (CGSC)로부터 프라이머 FRT+mntP_HF-F 및 FRT-R의 프라이머 쌍을 사용해 증폭하여 카세트 단편을 얻었다. 마지막으로 mntP_G25D를 얻기 위해서, pTRC99A-mntP_G25D 플라스미드로부터 프라이머 mntP-F 및 mntP+mntP_HR-R의 프라이머 쌍을 사용하여 mntP_G25D 단편을 얻었다. 최종적으로 증폭된 4개의 PCR 단편들을 주형으로 사용하여 프라이머 mntP_HF-F 및 mntP_HR-R의 프라이머 쌍으로 오버랩핑(overlapping) PCR을 이용하여 하나의 단편으로 연결시켰다. 하나로 연결된 DNA 단편을 pKD46 플라스미드 (CGSC)를 가지고 있는 E. coli DS9H 균주에 전기청공법으로 도입하였다. 이후 카나마이신 내성을 보이는 세포주들을 대상으로 프라이머 mntP-CF 및 mntP-CR의 프라이머 쌍을 사용해 PCR을 수행하여 mntP_G25D가 도입된 균주들을 확인하였다.
mntP_G25D 도입이 확인된 균주들을 대상으로 항생제 내성 유전자인 카나마이신 마커를 제거하는 과정을 수행하였다. mntP_G25D 도입이 확인된 균주에 pCP20 플라스미드 (ADDGENE)를 도입하여 FLP 재조합을 유도한 후, 항생제 (카나마이신) 첨가 및 미첨가된 LB 평판배지들에서 각각 생장 여부를 통해 항생제 제거 여부를 확인하였다. 항생제가 제거된 균주들은 LB 평판배지에서 생장을 하지만, 항생제 (카나마이신)가 첨가된 LB 평판배지에서는 생장하지 못함을 이용하여 확인하였다. 그리고 최종적으로 프라이머 mntP-CF 및 mntP-CR의 프라이머 쌍을 사용하여 서열을 확인하였고, mntP_G25D가 도입된 변이주를 DS9H_::mntP_G25D로 명명하였다.
PCR 증폭에서는 pfu premix (bioneer)를 사용하였고, 95℃에서 5분 변성한 후 95℃에서 30초, 58℃에서 30초, 72℃에서 2분 30초를 30회 반복하고 72℃에서 5분간 반응시켰다.
변이주 제작에 사용된 프라이머 서열은 하기 표 2와 같다.
프라이머 명칭 서열번호 프라이머 서열 (5'-3')
mntP_HF-F 11 TTCTTCGCCAATGTCTGGAT
mntP_HF-R 12 TATTGATAACGATTTTCATTTGG
FRT+mntP_HF-F 13 AATGAAAATCGTTATCAATAGTGTAGGCTGGAGCTGCTTC
FRT-R 14 ATCAATTCGCGCTAACTCACACATGAGAATTAATTCCGGGG
mntP-F 15 CCCGGAATTAATTCTCATGTGTGAGTTAGCGCGAATTGATCTG
mntP+mntP_HR-R 16 CACCTCTGGCAGCGTTCTTATTAACCGTGGAAGTGCGTCC
mntP_HR-F 17 TAAGAACGCTGCCAGAGGTG
mntP_HR-R 18 TGGGTCATTACTGCCACGCC
mntP-CF 19 ATCATGGTGCGTTAATAACGAC
mntP-CR 20 TTGCCGTTTTCCGATACCAG
실험예 1. 망가니즈 익스포터 변이체를 발현하는 균주의 L-히스티딘 생산능 평가
모균주 DS9H와 mntP_G25D가 도입된 변이주 DS9H_::mntP_G25D의 L-히스티딘 생산능을 비교하였다.
하기 표 3의 히스티딘 생산용 배지 10 mL가 담긴 100 mL 플라스크에 각 균주 (모균주 또는 변이주)를 부피 기준으로 1%씩 접종하여 34℃, 200 rpm의 조건으로 72시간 진탕 배양하였다. 배양 종료 후 HPLC (Agilent)를 사용하여 배지 내 L-히스티딘의 농도를 측정하였고, 그 결과를 하기 표 4에 나타내었다.
성분 농도
포도당 8%
황산마그네슘 0.1%
황산암모늄 2.0%
MSG 0.1%
일인산칼륨 0.1%
효모추출물 0.1%
황산칼륨 0.02%
티아민-HCl 20 ppm
니코틴산 10 ppm
황산철 5 ppm
황산아연 5 ppm
황산망간 5 ppm
탄산칼슘 (별도멸균) 5.0%
균주 명칭 L-히스티딘 (%)
DS9H 0.78
DS9H_::mntP_G25D 0.99
상기 표 4에 나타낸 바와 같이, 망가니즈 익스포터 변이체가 도입된 변이주는 25번째 글리신이 아스파트산으로 치환됨으로써 모균주에 비해 L-히스티딘 생산량이 약 27% 향상된 것으로 확인되었다. 이러한 결과는 망가니즈 익스포터의 점 돌연변이 도입이 L-히스티딘 생산성에 대한 유효한 효과를 제공함을 시사한다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.
[수탁번호]
기탁기관명 : 한국생명공학연구원 생물자원센터(KCTC)
수탁번호 : KCTC14419BP
수탁일자 : 20201228
Figure PCTKR2024000316-appb-img-000001

Claims (6)

  1. 서열번호 3의 아미노산 서열에서 25번째 글리신이 아스파트산으로 치환된, 서열번호 1의 아미노산 서열로 이루어진 망가니즈 익스포터 변이체.
  2. 청구항 1의 변이체를 암호화하는 폴리뉴클레오티드.
  3. 청구항 1의 변이체 또는 청구항 2의 폴리뉴클레오티드를 포함하는 형질전환체.
  4. 청구항 3에 있어서,
    상기 형질전환체는 에스케리치아(Escherichia) 속 미생물인 것인 형질전환체.
  5. 청구항 3에 있어서,
    상기 형질전환체는 L-히스티딘 생산능을 가지는 것인 형질전환체.
  6. 청구항 3의 형질전환체를 배지에서 배양하는 단계; 및
    상기 형질전환체 또는 형질전환체가 배양된 배지로부터 L-히스티딘을 회수하는 단계를 포함하는 L-히스티딘의 생산 방법.
PCT/KR2024/000316 2023-01-31 2024-01-08 망가니즈 익스포터 신규 변이체 및 이를 이용한 l-히스티딘 생산 방법 WO2024162636A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020230013200A KR20240120829A (ko) 2023-01-31 2023-01-31 망가니즈 익스포터 신규 변이체 및 이를 이용한 l-히스티딘 생산 방법
KR10-2023-0013200 2023-01-31

Publications (1)

Publication Number Publication Date
WO2024162636A1 true WO2024162636A1 (ko) 2024-08-08

Family

ID=92040264

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/000316 WO2024162636A1 (ko) 2023-01-31 2024-01-08 망가니즈 익스포터 신규 변이체 및 이를 이용한 l-히스티딘 생산 방법

Country Status (3)

Country Link
KR (1) KR20240120829A (ko)
CN (1) CN118420726A (ko)
WO (1) WO2024162636A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101094087B1 (ko) * 2007-09-27 2011-12-15 아지노모토 가부시키가이샤 엔테로박테리아세애 과의 세균을 사용하여 아미노산을 생산하는 방법
US8758764B2 (en) * 2005-02-18 2014-06-24 Novartis Vaccines And Diagnostics Srl Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli
KR20170106685A (ko) * 2016-03-14 2017-09-22 씨제이제일제당 (주) Ｌ-히스티딘을 생산하는 코리네박테리움 글루타미컴 변이주 및 이를 이용한 ｌ-히스티딘의 생산방법
WO2021126961A1 (en) * 2019-12-16 2021-06-24 Ginkgo Bioworks, Inc. Enhanced production of histidine, purine pathway metabolites, and plasmid dna

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101904666B1 (ko) 2017-08-02 2018-11-29 씨제이제일제당 (주) Atp 포스포리보실기 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
KR102004917B1 (ko) 2017-10-31 2019-07-30 광운대학교 산학협력단 애플리케이션 사용내역 정보에 기초하여 조명을 제어하는 장치 및 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8758764B2 (en) * 2005-02-18 2014-06-24 Novartis Vaccines And Diagnostics Srl Proteins and nucleic acids from meningitis/sepsis-associated Escherichia coli
KR101094087B1 (ko) * 2007-09-27 2011-12-15 아지노모토 가부시키가이샤 엔테로박테리아세애 과의 세균을 사용하여 아미노산을 생산하는 방법
KR20170106685A (ko) * 2016-03-14 2017-09-22 씨제이제일제당 (주) Ｌ-히스티딘을 생산하는 코리네박테리움 글루타미컴 변이주 및 이를 이용한 ｌ-히스티딘의 생산방법
WO2021126961A1 (en) * 2019-12-16 2021-06-24 Ginkgo Bioworks, Inc. Enhanced production of histidine, purine pathway metabolites, and plasmid dna

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein 19 June 2019 (2019-06-19), ANONYMOUS: "manganese efflux pump MntP [Escherichia coli]", XP093196176, retrieved from NCBI Database accession no. WP_001393446.1 *
JEON, Y. et al. Development of novel Escherichia coli cell-based biosensors to monitor Mn(II) in environmental systems. Frontiers in Microbiology. 19 December 2022, vol. 13, thesis no.: 1051926, pp. 1-12. *

Also Published As

Publication number Publication date
KR20240120829A (ko) 2024-08-08
CN118420726A (zh) 2024-08-02

Similar Documents

Publication Publication Date Title
WO2023158029A1 (ko) Atp 신타아제 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2023158175A9 (ko) 수송단백질 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
KR20220003476A (ko) 3-메틸-2-옥소뷰타노에이트 하이드록시 메틸트랜스퍼라아제의 활성이 강화된 미생물, 및 이의 용도
WO2024162636A1 (ko) 망가니즈 익스포터 신규 변이체 및 이를 이용한 l-히스티딘 생산 방법
WO2024210282A1 (ko) 트레오닌 암모니아 리아제 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024210280A1 (ko) 포스포에놀피루베이트 카르복실라아제 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024214887A1 (ko) Fe-s 클러스터 조립 단백질 sufc 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024210283A1 (ko) Abc 수송체 투과효소 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024210281A1 (ko) 5-데하이드로-2-데옥시글루코노키나아제 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024214882A1 (ko) 인산기전이효소 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024214886A1 (ko) Fe-s 클러스터 조립 단백질 sufb 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024214883A1 (ko) 피루베이트 탈수소효소 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024214884A1 (ko) 알데히드 탈수소효소 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024214885A1 (ko) Fe-s 클러스터 조립 단백질 sufd 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024090884A1 (ko) 페닐알라닌:h+ 동시수송체 phep 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법
WO2024210279A1 (ko) 뉴클레오타이드 하이드롤라아제 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024214881A1 (ko) (p)ppgpp 합성효소 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2024225802A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-글루탐산 생산 방법
WO2024090885A1 (ko) Dna-결합 전사 제어인자 malt 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법
WO2024225801A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-글루탐산 생산 방법
WO2024090883A1 (ko) 피루베이트 인산화효소 2 신규 변이체 및 이를 이용한 l-방향족 아미노산의 생산 방법
WO2024214880A1 (ko) Pts 수송체 서브유닛 eiic 신규 변이체 및 이를 이용한 5'-이노신산 생산 방법
WO2023158174A1 (ko) 시그마 38 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2023158030A1 (ko) 징크 바인딩 디하이드로게나제 신규 변이체 및 이를 이용한 l-방향족 아미노산 생산 방법
WO2024096219A1 (ko) L-글루탐산을 생산하는 코리네박테리움 속 변이 미생물 및 이를 이용한 l-글루탐산의 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24750438

Country of ref document: EP

Kind code of ref document: A1