WO2024143294A1 - Genetically modified experimental animal production method by which mosaic modification is reduced or avoided - Google Patents

Abstract

Provided is a genetically modified experimental animal production method by which a mosaic modification is reduced or avoided when producing a genetically modified experimental animal.　This method for reducing the frequency at which mosaic modified embryos are produced when modifying genes of fertilized eggs or embryos of vertebrates by a genetic modification technology comprises injecting a genetic modification tool into fertilized eggs or embryos and then dividing embryos of 2-32 cell stages to produce embryos composed of one or more blastomeres.

Description

Methods for producing genetically modified experimental animals that reduce or avoid mosaic alterations

The present invention relates to a method for producing genetically modified experimental animals that reduces or avoids mosaic modifications when producing genetically modified experimental animals.

When genetically modified marmosets are produced by injecting gene modification tools such as genome editing into embryos, "mosaic modified embryos" are often produced in which the desired homogeneous modification does not occur within the embryo (see Non-Patent Document 1). This mosaic modification is not limited to marmosets, but occurs in many genetically modified experimental animals, and depending on the content, it can affect phenotypic expression. In particular, when mosaic modification occurs in an embryo that results in a low rate of desired gene modification, there is a possibility that the individual produced from that embryo will not exhibit the desired phenotype.

The present invention aims to provide a method for producing genetically modified experimental animals that reduces or avoids mosaic modifications when producing genetically modified experimental animals.

The inventors conducted extensive research into methods for reducing or avoiding mosaic alterations that occur when producing genetically modified marmosets. As a result, they discovered that it is possible to produce individuals with a reduced frequency of mosaic alterations or to avoid them by dividing the blastomere at the embryo stage to produce an embryo with a reduced mosaic rate, or by producing a cloned fertilized egg derived from a single blastomere and transferring the embryo to a foster parent, which led to the completion of the present invention.

That is, the present invention is as follows.
[1] A method for reducing the frequency of occurrence of mosaic modified embryos that occurs when modifying genes in vertebrate eggs or fertilized eggs by gene modification techniques, comprising the steps of:
A method for reducing the occurrence frequency of mosaic modified embryos, comprising injecting a genetic modification tool into an egg or fertilized egg, dividing an embryo at the 2-32 cell stage, producing an embryo consisting of one or more blastomeres, and culturing it in vitro, or transplanting the embryo into the uterus of a foster parent after division for development.
[2] The method of [1], wherein the vertebrate is a primate.
[3] The method of [2], wherein the primate is a common marmoset.
[4] The method according to any one of [1] to [3], wherein the gene modification tool is selected from the group consisting of a genome editing tool, a base editing tool, a prime editing tool, and a tool for the PiggyBac transposon method.
[5] The method of [4], wherein the genome editing tool is selected from the group consisting of ZFN, TALEN and CRISPR/Cas9.
[6] Any of the methods [1] to [5], in which a blastomere of an 8-cell stage embryo is divided to generate an embryo consisting of 5 blastomeres.
[7] A method for avoiding the occurrence of mosaic modified embryos that occur when modifying genes in vertebrate eggs or fertilized eggs by gene modification techniques, comprising the steps of:
A method for avoiding the generation of mosaic modified embryos, comprising isolating each blastomere of an embryo that develops after injecting a genetic modification tool into an egg or fertilized egg, and then performing nuclear transfer of each blastomere as a donor into an enucleated egg or fertilized egg to produce a reconstructed embryo.
[8] A method for producing a genetically modified vertebrate animal, comprising, when the reconstructed embryo produced by the method of [7] develops to the blastomere stage, dividing the blastomere, analyzing the genetic modification, selecting an embryo having the desired modified gene, transferring it into the uterus of a surrogate mother, and allowing the offspring to live birth.
[9] A method for producing a genetically modified vertebrate animal, comprising transplanting an embryo generated by reducing the frequency of mosaic modified embryos using any of the methods [1] to [7] into the uterus of a surrogate mother and giving birth to a child.
This specification includes the disclosure of Japanese Patent Application No. 2022-210571, which is the priority basis of this application.

　According to the method of the present invention, after injecting a gene modification tool into a marmoset egg, embryos develop and cleave, and by dividing the blastomeres, the variability of the genetic modification content within the embryo is reduced, thereby decreasing the frequency of mosaic modifications, and making it possible to efficiently produce genetically modified experimental animals.

This is a diagram showing the mechanism of how mosaic modified embryos are produced by genome editing. After inserting a genome editing tool into a marmoset fertilized egg at the one-cell stage, stepwise modifications occur from the two-cell stage onwards, producing mosaic modified embryos or individuals. This is a diagram showing the mechanism for reducing and avoiding mosaic alterations from generated mosaic alterations in mosaic alterations. Figure 2A shows the mechanism for reducing mosaic alterations, in which the number of alteration patterns in one embryo is reduced by dividing the blastomeres from an 8-cell stage embryo presumed to be causing mosaic alterations, thereby reducing the frequency of mosaic alterations. Figure 2B shows the mechanism for avoiding mosaic alterations, in which a blastomere from a mosaic altered embryo is nuclear transferred to an enucleated egg as a donor to produce a donor-derived fertilized egg. A portion of the blastomeres of the embryos generated from the donor are analyzed, and embryos showing the desired gene alterations are selected to produce homogeneous genetically altered individuals. FIG. 1 shows the sequence of the unmodified (wild-type) marmoset INS gene (part 1). This shows the sequence of the unmodified (wild-type) marmoset INS gene (part 2, continued from Figure 3-1). 1 shows the structure of each marmoset gene-targeting genome editing tool. The guideRNA (black line) + PAM (diagonal line) sequences in CRISPR/Cas9 targeting the marmoset INS gene (A) and c-kit gene (B) are shown. This is a diagram showing a method for investigating gene modification using embryo blastomeres. Each blastomere of an embryo into which a genome editing tool has been inserted is analyzed as a template to investigate the genetic modification in the embryo. This is a diagram showing a method for analyzing gene modification in a cloned fertilized egg using a blastomere from a mosaic modified embryo as a donor. The genome editing tool is injected into the embryo, and each blastomere from the embryo is used as a template for PCR and sequence analysis to analyze the genetic modification in the embryo. 1 shows INS gene modifications detected in embryos injected with a genome editing tool, and the results are shown in which each blastomere of an embryo that developed at the 5-cell stage after the injection of the genome editing tool was analyzed as a template. FIG. 1 shows a method for producing an INS gene-modified marmoset using the mosaic reduction method. After the genome editing tool was injected, the blastomeres of embryos that had developed to about the 8-cell stage were divided and then transplanted into a foster parent female marmoset to produce an individual. This figure shows the results of creating an INS gene-modified marmoset using the mosaic reduction method, and shows the results of performing PCR targeting the INS gene site using the hair root cell genome of the created marmoset, creating subclones from the PCR products, and performing sequence analysis. This figure shows the results of generating INS gene modified marmosets using the mosaic reduction method, and also shows the blood glucose level transition during insulin treatment in the generated insulin gene modified marmosets. Although insulin treatment is essential for survival, there are cases where hyperglycemia (blood glucose level of 250 mg/dL or higher) occurs even during insulin treatment, revealing the onset of diabetes. FIG. 1 shows the results of preparing a reconstructed embryo using a wild-type embryo and transferring the embryo (A), obtaining a baby derived from the reconstructed embryo (B), and the results showing that the numbers of microsatellite markers derived from the father (sperm) and mother (egg) matched (C). 9A shows an outline of a method for producing a cloned embryo from a fertilized egg that avoids mosaic modification, in which Fig. 9A shows the division of a blastomere, Fig. 9B shows the PCR analysis of each blastomere, and Fig. 9C shows the results of the analysis.

The present invention will be described in detail below.
The present invention relates to a method for producing an individual with reduced mosaic frequency, which occurs when producing a genetically modified animal using a genetic modification tool such as genome editing, by dividing an embryonic blastomere and transplanting one or more blastomeres into the uterus of a surrogate mother. Genetic modification tools are also called gene editing tools.

In the production of genetically modified vertebrates such as genetically modified marmosets, by injecting gene modification tools such as genome editing technology into eggs or fertilized eggs, or by injecting a mixture of gene modification tools and sperm into eggs, a "mosaic modified embryo" is often produced in which the intended modification does not occur uniformly within the embryo. In other words, during cell division, blastomeres in which the target gene is not modified are produced, and blastomeres in which the gene is modified and blastomeres in which the gene is not modified are mixed in one embryo, and the embryo as a whole becomes a "mosaic modified embryo" (Figure 1). Depending on the content, it may affect the expression of the phenotype, and if the rate of intended modification in the blastomere cells in the embryo is low, it may result in an individual that does not exhibit the phenotype due to the genetic modification. Note that a "mosaic modified embryo" is also called a "mosaic embryo." The production of a "mosaic modified embryo" is also called "mosaic modification." Eggs and fertilized eggs are sometimes called eggs.

In the method of the present invention, a gene modification tool is injected into an animal egg, and the blastomere of the embryo that develops and cleaves is divided to produce an embryo consisting of one or more blastomeres, which is then transplanted into the uterus of a surrogate parent to develop into an individual (Figure 2A). In addition, in the method of the present invention, a gene modification tool is injected into an animal egg, and the blastomere of the embryo that develops and cleaves is separated, transplanted into an enucleated egg, and the egg and blastomere are fused to develop multiple embryos derived from each blastomere, and each embryo is screened for genetic modification, and the genetically modified embryo is transplanted into the uterus of a surrogate parent to develop into an individual (Figure 2B).

The method of the present invention can be applied to all organisms in which a fertilized egg cleaves to produce a blastomere.

In the present invention, the subject animal is a vertebrate, preferably a primate, and among primates, species used for experimental purposes are preferred. Examples include primates belonging to the family Capuchin monkeys and primates belonging to the family Cercopithecidae and the genus Macaca, with the common marmoset (Callithrix jacchus) and cynomolgus macaque (Macaca fascicularis) being particularly preferred.

In the method of the present invention, the genes of an embryo are modified by a gene modification method. Examples of gene modification methods include genome editing, base editing, the PiggyBac transposon method, prime editing, and other modification methods. Examples of genome editing include methods using site-specific nucleases such as ZFN (Zinc-Finger Nuclease), TALEN (Transcription Activator-Like Effector Nuclease), Platinum TALEN, and CRISPR/Cas9, and genome editing tools such as ZFN, TALEN, Platinum TALEN, and CRISPR/Cas9 are used as gene modification tools. For base editing, a base editing tool called a base editor is used as the gene modification tool, and examples of base editors include the Cytosine base editor (CBE) and the Adenine base editor (ABE). Examples of base editors include inactive Cas9 (dCas9) or a complex of Cas9 nickase (Cas9n) and deaminase. Prime editing uses a gene modification tool called a Prime Editor, and examples of Prime Editors include CAS9 nickase, RT (Reverse Transcriptase), and pegRNA (prime editing guide RNA).

Among the above gene modification tools, gene modification tools using enzymes are preferred.
In the method of the present invention, genes are modified using the above-mentioned gene modification techniques. Specifically, genes of a target animal are modified by injecting a gene modification tool into an embryo of the target animal.

In one aspect of the present invention, in order to reduce mosaic modification, a gene modification tool is injected into the egg or fertilized egg of an animal from which a genetically modified individual is to be produced, and the blastomere of the developed embryo is divided to produce an embryo consisting of one or more blastomeres. The created embryo is cultured in vitro, or promptly transferred to the uterus of a host parent after division to develop the embryo. Here, "promptly" means "without culturing." "Several" includes all blastomeres, and all blastomeres may be transferred. If there are blastomeres in which the target gene is not modified in an embryo that has developed and cleaved, or if the target gene is modified in one or more blastomeres transferred to the uterus of a host parent, the individual that develops from that embryo will be an individual whose gene is completely modified, or an individual whose proportion of cells whose target gene is not modified is small, and an individual whose phenotype is recognized. Furthermore, when multiple blastomeres containing all the blastomeres are transplanted into the uterus of a surrogate parent, multiple embryos may develop, resulting in the birth of multiple offspring such as twins or triplets. If these offspring develop from a blastomere in which the target gene has been modified, the individual will be an individual in which the phenotype due to the gene modification in which the gene has been completely modified is recognized. In this way, the method of the present invention makes it possible to reduce the variation in the genetic modification content within the embryo, that is, to reduce mosaic modification. Specifically, after injecting a genetic modification tool into an egg or fertilized egg, the mosaic reduction method incises the zona pellucida of a developing embryo in which cleavage has progressed, divides the blastomeres by micromanipulation, and transplants them into the uterus of a surrogate parent to produce an individual with a reduced frequency of mosaic modification. The incision of the zona pellucida of the developing embryo can be performed by laser perforation of the zona pellucida under a microscope.

In this case, it is preferable to divide the blastomere into multiple pieces when the embryo has developed to the 2-32 cell stage, preferably the 8-32 cell stage. An embryo consisting of the divided blastomere is prepared and cultured in vitro, or immediately after division, transferred to the uterus of a surrogate mother to generate an individual. In this case, an embryo consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 divided blastomeres may be prepared. When using an embryo that has developed to the 8 cell stage, an embryo consisting of 1, 2, 3, 4, 5, 6, 7, or 8 divided blastomeres may be generated, preferably an embryo consisting of 5, 6, 7, or 8 divided blastomeres may be generated. As a result, if the divided blastomere is a genetically modified blastomere, it is possible to produce an individual in which the desired modified gene has been homogenized (including homozygous and heterozygous modifications). Therefore, this method can reduce the frequency of mosaic modification in embryos in which it is unclear whether mosaic modification has occurred. Reducing the frequency of mosaic modification is also referred to as reducing the frequency of occurrence of mosaic modified embryos, or eliminating mosaicism.

The above-mentioned method for reducing mosaic alterations, which involves dividing blastomeres, is called the "blastomere division method for reducing mosaic alterations."

In one aspect of the present invention, in order to avoid mosaic modification, a gene modification tool is injected into an unfertilized egg of an animal from which a genetically modified individual is to be produced, and then the blastomeres of the embryo that develops are separated one by one, and each blastomere is nuclear transferred to an enucleated egg as a donor, i.e., the enucleated egg and the blastomere are fused to develop an embryo, thereby producing a reconstituted embryo. The separation of the blastomeres is performed at the 2-32 cell stage, preferably the 8-32 cell stage. Specifically, the zona pellucida of the mosaic modified embryo that was developed by injecting the gene modification tool is removed, and the blastomeres are separated one by one, and each blastomere is nuclear transferred to an enucleated egg as a donor. The embryo that develops thereafter is called a reconstituted embryo. When the reconstituted embryo develops to the blastomere stage, the zona pellucida is incised, and a part of the blastomere is extracted to analyze the genetic modification. An embryo carrying the desired modified gene is selected and transplanted into the uterus of a surrogate parent. As a result, an individual in which the desired modified gene is homogenized (including homozygous modification and heterozygous modification) can be produced.

Embryonic blastomeres can be separated by removing the zona pellucida from the blastomeres, immersing them in Biopsy medium, and then isolating them. Transplantation into an egg can be achieved by fusing the blastomere with an enucleated egg using HVJ (Sendai virus).

This method makes it possible to reliably select embryos with modified genes, thus avoiding mosaic modifications.

The method of avoiding mosaic alterations, which involves transplanting the above-mentioned blastomere nucleus into an egg, is called the "blastomere nucleus transplantation embryo production method for avoiding mosaic alterations."

In the blastomere division method for reducing mosaic alterations and the blastomere nuclear transfer embryo production method for avoiding mosaic alterations, the embryo or reconstruction after blastomere division is transplanted into the uterus of a foster parent whose sexual cycle is synchronized with that of the female animal from which the unfertilized eggs were collected. In this case, the transplant can be performed by a transvaginal transplantation procedure using a catheter.

　Analysis of the genomic DNA of the newborn can be carried out by collecting hair root cells from the newborn, extracting DNA using standard methods, amplifying the genes using PCR or other methods, and then performing sequence analysis on the DNA obtained.

The present invention will be specifically explained by the following examples, but the present invention is not limited to these examples.

1. Materials and Methods (1) Marmosets Adult marmosets (2-4.5 years old, weighing 300-450g) used in this study were purchased from a laboratory animal breeding company (CLEA Japan, Tokyo, Japan). All animal experiments were approved by the Central Institute for Experimental Animals' Laboratory Animal Committee (CIEA: 11028) and were conducted in accordance with the Central Institute for Experimental Animals' regulations and bylaws regarding animal experiments, as well as the standard operating procedures for marmosets. The Central Institute for Experimental Animals' regulations regarding animal experiments are in accordance with the "Guidelines for Proper Conduct of Animal Experiments" established by the Science Council of Japan.

(2) CRISPR/Cas9
Crispr RNA (crRNA) containing target gene sequences of marmoset insulin (INS) gene and c-kit gene was designed and artificially synthesized by an RNA synthesis contract company (FASMAC Co., Ltd.). The crRNA sequence is shown in Figure 3. Transactivating crRNA (tracrRNA, FASMAC Co., Ltd.) and Cas9 nuclease (Integrated DNA Technologies, 1074181) were purchased from each company. The CRISPR/Cas9 injection solution, which was a mixture of crRNA 16.6ng/μL, tracrRNA 33.3ng/μL, Cas9 nuclease 100ng/μL, and 0.1×Tris-EDTA pH 8.0 buffer, was incubated at 37°C for 30 minutes and injected into marmoset eggs obtained by the method described below using a pneumatic microinjector (FemtoJet, Eppendorf) and a glass needle.

The unmodified wild-type DNA sequence of the marmoset insulin gene is shown in SEQ ID NO:1 and in Figures 3-1 and 3-2. The guideRNA+PAM sequence is shown in SEQ ID NO:2, and its complementary sequence is shown in SEQ ID NO:3 (Figure 3-3A). The guideRNA+PAM of the marmoset c-kit gene is shown in SEQ ID NO:20, and its complementary sequence is shown in SEQ ID NO:21 (Figure 3-3B).

(3) Collection of marmoset eggs and production of embryos by in vitro fertilization Wild-type female marmosets, whose sexual cycles were monitored by measuring plasma progesterone concentrations, were intramuscularly injected with 25 IU of human follicle-stimulating hormone (hFSH, Fuji Pharmaceutical) every other day for 9 days, and on the 10th day, 75 IU of chorionic gonadotropin (hCG, Aska Pharmaceutical) was intramuscularly injected to stimulate ovarian follicles. 17-20 hours after hCG injection, eggs (unfertilized eggs) were surgically collected from the ovaries of the female marmosets under anesthesia. The eggs obtained were then subjected to 1. After injecting the CRISPR/Cas9 injection solution prepared as described in (2), the eggs were cultured for maturation for 27-29 hours at 37°C in POM medium (Functional Peptide Institute, IFP1010P) containing 5 (w/v)% FBS, 0.15 IU/mL hFSH, and 10 IU/mL hCG under 5% CO ₂ , 5% O ₂ , and 90% N _2. After culture, eggs that had matured to the MI (Metaphase I) stage or higher were selected and used for in vitro fertilization. The sperm used for in vitro fertilization were collected from wild-type male marmosets by physical stimulation, washed with TYH medium (LSI Medience, DR01031), and diluted with TYH medium to a concentration of 3.6 × 10 ⁶ sperm/mL. Mature eggs and diluted sperm were co-cultured in TYH medium for 10-16 hours, after which fertilization was determined by the presence or absence of pronuclei, and fertilized eggs were cultured in Sequential Cleav™ medium (Origio, 83040010A).

(4) Detection of gene modification using embryo blastomeres CRISPR/Cas9-injected marmoset embryos, which were developing about 5 days after in vitro fertilization, were washed with PBS (-) and immersed in acidic Tyrode's solution (Origio, 10605000) for about 3 seconds to dissolve the zona pellucida and expose the blastomeres. The blastomeres were immersed in Biopsy Medium (Origio, 10620010) at 37°C for 15 minutes to loosen the adhesion between the blastomeres, and then split into single blastomeres using a glass capillary. Single blastomeres were collected in 0.2 ml tubes and used as PCR template samples (Figure 4). Amplification of the target gene site was performed by nested PCR, and KOD-Plus-Neo (TOYOBO, 401) was used for the PCR reaction according to the product instructions. In the PCR targeting the INS gene, the first PCR was performed using forward primer: TCCCTGACTGTGCCATCCTGTGTCCTC (SEQ ID NO: 4) and reverse primer: GACTAGCTGCGGTTCTCCAGCTGGCAG (SEQ ID NO: 5), and touchdown PCR was performed by heating at 94°C for 2 minutes, followed by 5 cycles of amplification at 98°C for 10 seconds and 30 seconds at each annealing temperature. The annealing temperature was set at 2°C intervals from 74°C to 68°C for 5 cycles each, and the final reaction at 68°C was performed for 28 cycles. After the reaction was completed, the presence or absence of amplification was confirmed by agarose gel electrophoresis. In the second PCR, the forward primer: TGGGGGCTCTATCACGGGCAGCCTGCCG (SEQ ID NO: 6), reverse primer: GACTAGCTGCGGTTCTCCAGCTGGCAG (SEQ ID NO: 7), and 1 μL of the amplified product of the first PCR were used, and amplification was performed under the same touchdown PCR conditions as the first PCR. After confirming amplification by agarose gel electrophoresis, subclones were prepared using the Zero Blunt PCR Cloning Kit (Thermo Fisher Scientific, K275040). The amplified product was ligated to the cloning vector plasmid included in the kit, and competent cells of E. coli DH5α were transformed with the ligation reaction solution. The transformed DH5α was selected in a drug medium, and 10 colonies were inoculated into a liquid medium for proliferation. Plasmid DNA was extracted from the bacterial solution and sequence analysis was performed. Sequence analysis was performed using an ABI 3130 Genetic Analyzer. When the c-kit gene was targeted, the first PCR was performed using forward primer: TGGAATTGCGGGGCTATGGCAG (sequence number 8) and reverse primer: AACCTTCCCAAAAGCACCAGC (sequence number 9), and the second PCR was performed using forward primer: AAATCCAGCCCCACACCCTGTTCA (sequence number 10) and reverse primer: ATCAGGGAGGTGCAATTTCACAGA (sequence number 11), and analysis was performed under the same conditions as in the case of the INS gene target described above (Kumita W. et al., Scientific Reports, 2019).

(5) Division of intraembryonic blastomeres to reduce mosaicism CRISPR/Cas9-injected embryos that had developed to the 8-cell stage approximately 5 days after in vitro fertilization were immersed in Biopsy Medium at 37°C for 5 minutes. The zona pellucida was then laser-perforated (XYClone, Hamilton Thorne, Inc.) under a microscope, and the blastomeres were divided by manipulation.

(6) Creation of blastomere nuclear transfer embryos to avoid mosaic modification Metaphase II stage eggs are placed in Hepes-CZB medium containing sucrose and cytochalasin B (CCB) to remove the nucleus and polar body. After resting the eggs for 30 minutes to an hour, they are activated with ionomycin for 5 minutes. They are then cultured in Sequential Cleav medium for 3 hours. The zona pellucida of the blastomeres of the genetically modified embryos is removed, and they are immersed in Biopsy Medium at 37°C for 5 minutes, after which they are separated one by one to be used as donors. After 3 hours of activation, they are fused with an egg enucleated using HVJ. Once the donor cell and the enucleated egg have fused, they are cultured in CCB for 3 hours and then cultured in Sequential Cleav™ medium (Figure 5).
When the reconstructed embryo develops into the blastomere stage, it is immersed in Biopsy Medium at 37°C for 5 minutes, after which the zona pellucida is incised to extract some blastomeres, and genetic modification is detected by the method in (4).

(7) Embryo transfer, pregnancy management and birth The embryos after cleavage of the blastomeres and the reconstructed embryos were transferred intrauterinely through a catheter into the uterus of a female foster parent marmoset whose sexual cycle was synchronized with that of the female marmoset from which the eggs were collected. After the embryo transfer, the foster parents were diagnosed as pregnant by measuring their blood P4 (progesterone) levels and observing the uterus with an ultrasound diagnostic device, and those whose pregnancy was confirmed were regularly observed by weekly ultrasound examinations for the condition of the fetal heartbeat and the presence or absence of morphological abnormalities. After a gestation period of approximately 140 days from the embryo transfer, a baby was born by natural birth.

(8) Genomic DNA analysis of offspring Hair root cells were collected from newborn marmosets, and genomic DNA was extracted using a QIAamp DNA Micro Kit (QIAGEN, 56304). Using 10 ng of the obtained genomic DNA as a PCR template, PCR amplification and subclones were produced in the same manner as in 3.4. Fifty colonies of the obtained subclones were multiplied, and plasmid DNA was extracted from each of them and subjected to sequence analysis.

2. Results (1) Mosaic modification reduction method After injection of insulin gene-targeting CRISPR/Cas9, the blastomeres of the marmoset IVF embryos were divided and genetic modifications were confirmed one by one. As a result, up to five genetic modification patterns were detected in one embryo. For each insulin gene modification detected in the analyzed 5-cell stage embryos, one out of five blastomeres (20%) had an 8bp deletion mutation, one blastomere (20%) had a 9bp deletion mutation, one blastomere (20%) had a 19bp deletion mutation, one blastomere (20%) had a 4bp deletion to 10bp insertion substitution mutation, and one unmodified blastomere (20%) (Figure 6). Figure 6 shows the sequences of the modified parts of blastomeres 1 to 5 (SEQ ID NOs: 12 to 16, respectively). Therefore, in order to reduce the number of modified blastomere patterns in the developing embryos after injection of the same CRISPR/Cas9 tool, the blastomeres in the 8-cell stage embryos were divided into one, two, and five, and transplanted into the uterus of a female foster parent marmoset. This individual production method resulted in the acquisition of offspring (Figure 7-1). As a result of sequence analysis of 50 subclones derived from the hair root cell genome of the born marmoset, 21 (42%) of the 50 were wild-type sequences, 18 (36%) were modified pattern A, and 11 (22%) were modified pattern B, resulting in three sequence patterns of the target gene (Figure 7-2). Figure 7-2 shows the partial sequence of the wild type (SEQ ID NO: 17), the sequence of modified pattern A (SEQ ID NO: 18), and the sequence of modified pattern B (SEQ ID NO: 19) corresponding to the partial sequence. In addition, the offspring showed constant hyperglycemia immediately after birth (Figure 7-3), indicating the phenotype (onset of disease) expected from the modification of the target gene.

(2) Method to avoid mosaic modification Reconstructed embryos (Fig. 8A) in which the blastomere nuclei of wild-type marmoset naturally mated embryos were transplanted into the uterus of a surrogate mother were born by Caesarean section on the 146th day. The birth weight was 36.8g, and the child had no external abnormalities (Fig. 8B). Parentage test results of donor embryos were obtained (Fig. 8C), and a method for producing reconstructed embryos was established. After injecting c-kit gene-targeted CRISPR/Cas9 (Kumita W. et al., Scientific Reports, 2019), which is known to cause mosaic modification, into GV (Germinal Vesicle) eggs or IVM-IVF (in vitro maturation-in vivo maturation) eggs, the blastomeres of the developed embryos are divided to become donors. By producing reconstructed embryos from these donors and examining the developed blastomeres, it is possible to confirm that homogeneous embryos derived from the donors have been produced (Fig. 9). Embryos that show the desired genetic modification pattern are transferred to the uterus of a female foster marmoset. This individual production method allows birth of offspring. Subclones derived from the hair root cell genome of the born marmoset are sequenced to confirm that a homogeneous genetic modification pattern has been obtained.

3. Discussion Using a tool that was found to cause mosaic modification in which five target gene modification patterns occur in the embryos developed after injection by injecting CRSPR/Cas9 targeting the INS gene into fertilized marmoset eggs, the blastomeres of the embryos developed after injection were divided and transplanted into foster parents to produce individuals in which the number of modification patterns was reduced to three. This result revealed that the method of the present invention can reduce the number of target gene modification patterns expected in embryos into which a genome editing tool has been inserted, and that it is possible to reduce the rate of mosaic modification even in born individuals. In addition, since the born individuals showed the expected pathology of the disease as early as 1.5 months after birth, it is believed that the method of the present invention contributed to the phenotypic expression of the born individuals.

In the method of producing individuals with homogenized modification patterns, if it is confirmed that embryos with nuclear transplanted blastomeres can be conceived and born normally, it will be shown to be useful for producing individuals with homogenized target gene modifications. As a result, homogenization of the blastomeres and individuals obtained by producing reconstructed embryos using blastomeres from mosaic-modified embryos as donors will be confirmed, making it clear that it is possible to avoid mosaic modifications that occur during gene modification.

The present invention can also be applied to the production of individuals using gene modification tools other than genome editing technology, such as inserting a target gene using a transposon system such as piggyBac. Furthermore, this method is considered to be useful for reducing mosaics not only in marmosets, but in all animal species in which the blastomeres in the embryo can divide.

The method of the present invention makes it possible to efficiently produce genetically modified model animals.

SEQ ID NOs: 2, 3, 12-21 Synthetic SEQ ID NOs: 4-11 Primers All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety.

Claims (9)

1. A method for reducing the frequency of occurrence of mosaic modified embryos that occurs when modifying genes in vertebrate eggs or fertilized eggs by gene modification techniques, comprising:
   A method for reducing the occurrence frequency of mosaic modified embryos, comprising injecting a genetic modification tool into an egg or fertilized egg, dividing some of the blastomeres from an embryo at the 2-32 cell stage, producing an embryo consisting of one or more blastomeres, and culturing it in vitro, or transplanting the embryo into the uterus of a foster parent after division for development.
2. The method of claim 1, wherein the vertebrate is a primate.
3. The method of claim 2, wherein the primate is a common marmoset.
4. The method of claim 1, wherein the gene modification tool is selected from the group consisting of a genome editing tool, a base editing tool, a prime editing tool, and a tool for the PiggyBac transposon method.
5. The method of claim 4, wherein the genome editing tool is selected from the group consisting of ZFN, TALEN, and CRISPR/Cas9.
6. The method according to claim 1, in which a blastomere of an 8-cell stage embryo is divided to generate an embryo consisting of 5 blastomeres.
7. A method for avoiding the occurrence of mosaic modified embryos that occur when modifying genes in vertebrate eggs or fertilized eggs by gene modification techniques, comprising:
   A method for avoiding the generation of mosaic modified embryos, comprising isolating each blastomere of an embryo that develops after injecting a genetic modification tool into an egg or fertilized egg, and then performing nuclear transfer of each blastomere as a donor into an enucleated egg or fertilized egg to produce a reconstructed embryo.
8. A method for producing a genetically modified vertebrate animal, comprising: extracting a portion of the blastomere when the reconstructed embryo produced by the method of claim 7 develops into the blastomere stage, analyzing the genetic modification, selecting an embryo having the desired modified gene, transplanting it into the uterus of a surrogate mother, and allowing the offspring to be born.
9. A method for producing a genetically modified vertebrate animal, comprising implanting an embryo generated by reducing the frequency of mosaic modified embryos using the method according to any one of claims 1 to 7 into the uterus of a surrogate mother and causing the offspring to give birth.

Images