KR102270151B1 - Pig Knocked Out of the PKD2 Gene and the uses thereof - Google Patents

Abstract

The present invention relates to a pig in which the PKD2 gene is knocked out. Specifically, a pig is produced and used to find out the mechanism and treatment method of PKD as a disease model.

Description

Pig Knocked Out of the PKD2 Gene and the uses thereof}

It relates to a transgenic pig for PKD2 knockout disease model, a manufacturing method thereof, and its use, and more specifically, to a polycystic kidney disease model using a transgenic pig in which a PKD2 gene is knocked out. It's about using.

A method for artificially manipulating DNA as desired is a major challenge in the art. Recently, various techniques have been developed to solve this problem.

However, it is difficult to find an animal model that expresses all human disease symptoms enough to be used as an effective disease model.

Most animals have significant differences when compared to the dimenzone, reproductive, longevity, and behavioral patterns seen in humans. Therefore, the need to use a species similar to that of humans as a disease animal model has been raised. Pigs have been recognized anatomically and physiologically similar to humans and are being used in research for pathological mechanisms and treatment of various diseases. In addition, ethical problems can be avoided than when using other medium/large animals as disease models, and since a stable breeding system is established, it has the advantage of easy maintenance and management when developing experimental animal models.

Chen F et al. (2015) Proteome Differences in Placenta and Endometrium between Normal and Intrauterine Growth Restricted Pig Fetuses PloS one 10:e0142396 doi:10.1371/journal.pone.0142396 Harris PC, Hopp K (2013) The mutation, a key determinant of phenotype in ADPKD J Am Soc Nephrol 24:868-870 doi:10.1681/ASN.20133040417

An object of the present invention described in the specification is to provide a polycystin-2 deficient polycystin-2 pig for polycystic kidney disease model and a method for producing the same.

Another object of the invention described in the specification is to provide a gene knockout (Knock out) or knock down (Knock down) method using the CRISPR system, which is necessary for the method for producing a pig for the disease model.

Another object of the invention described in the specification is to provide various uses of the polycystin-2 deficient disease model for pigs.

In order to solve the above problems, the invention described in the specification,

Provided are transformed cells and their use for the production of pigs for a polycystin-2 deficiency disease model. More specifically, it is possible to provide a transformed cell in which the PKD2 gene has been artificially engineered.

In one embodiment,

One of the inventions described in the specification is that the PKD2 gene is knocked out and Polycystin-2 is not expressed because the nucleotide sequence encoding PC2 in the transformed cell has a different sequence from the nucleotide sequence encoding PC2 in the wild type cell. It is possible to provide transformed cells that do not The transformed cell may be a pig-derived cell,

as another embodiment

The transformed cell may be a transformed cell having the same nucleotide sequence as one or more nucleotides deleted, inserted, substituted, or inverted in the nucleotide sequence of the exon 2 region of the wild-type PKD2 gene. The transformed cell may not express Polycystin-2 because the nucleotide sequence of the exon 2 region is manipulated or modified. More specifically, the nucleotide sequence of exon 2 of the transformed cell may be a transformed cell having a nucleotide sequence comprising SEQ ID NO: 1 or 2. In addition, since the nucleotide sequence of exon 2 is the same as the nucleotide sequence comprising SEQ ID NO: 1 or 2, it is possible to provide a transformed cell that cannot express Polycystin-2.

Pigs having a polycystin-2 deficient phenotype and uses thereof can be provided.

In one embodiment,

comprising at least one cell in which the PKD2 gene is knocked out;

The nucleotide sequence of the PKD2 gene of the cell in which the PKD2 gene is knocked out has a sequence different from that of the wild-type PKD2 gene, and SOD1, Catalase, Caspase-3, The expression level of at least any one of Bcl-2 is 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times than the expression level of at least any one of SOD1, Catalase, Caspase-3, and Bcl-2 in the endometrium of wild-type pigs. 2x, 1.7x, 1.8x, 1.9.x, 2x, 2.5x, 3x. It is possible to provide a pig in which the PKD2 gene is knocked out, characterized in that it has an expression level of 3.5 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times or more. .

In one embodiment,

comprising at least one cell in which the PKD2 gene is knocked out;

The nucleotide sequence of the PKD2 gene of the cell in which the PKD2 gene is knocked out has a sequence different from that of the wild-type PKD2 gene, and at least one of Caspase-3 and Bcl-2 in placenta of a pig in which the PKD2 gene is knocked out Any one or more expression levels are 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times than the expression levels of at least any one of Caspase-3 and Bcl-2 in the placenta of wild-type pigs. 2x, 2x, 2.5x, 3x. It is possible to provide a pig in which the PKD2 gene is knocked out, characterized in that it has an expression level of 3.5 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times or more. .

In one embodiment,

comprising at least one cell in which the PKD2 gene is knocked out;

The nucleotide sequence of the PKD2 gene of the cell in which the PKD2 gene is knocked out has a sequence different from that of the wild-type PKD2 gene, and at least one of SOD1, Catalase, and PC2 in the placenta of a pig in which the PKD2 gene is knocked out. The expression level is 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times than the expression level of at least one of SOD1, Catalase, and PC2 in the placenta of wild-type pigs. , 2.5 times, 3 times. It is possible to provide a pig knocked out of the PKD2 gene, characterized in that it has an expression level of 3.5 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times or less. have.

In one embodiment,

comprising at least one cell in which the PKD2 gene is knocked out;

The nucleotide sequence of the PKD2 gene of the cell in which the PKD2 gene is knocked out has a different sequence from the nucleotide sequence of the wild-type PKD2 gene, and the PC2 expression level of the PKD2 gene knockout pig is 1.2 times higher than the PC2 expression level of the wild-type pig , 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 2.5 times, 3 times. It is possible to provide a pig in which the PKD2 gene is knocked out, characterized in that it has a development amount of 3.5 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times or less. have.

In one embodiment,

Pigs in which the PKD2 gene is knocked out may include a larger amount of amniotic fluid than that of wild-type pigs during pregnancy, thereby providing a pig characterized in that it exhibits polyhydramnios. At this time, the amount of amniotic fluid during pregnancy of pigs in which the PKD2 gene was knocked out was 1.1 times, 1.2 times, 1.3, 4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times than that of wild-type pigs. 2x, 2.5x, 3x. It is possible to provide a pig in which the PKD2 gene is knocked out, characterized in that it has a 3.5-fold, 4-fold, 5-fold or more amount.

In one embodiment,

comprising at least one cell in which the PKD2 gene is knocked out;

The nucleotide sequence of the PKD2 gene of the cell in which the PKD2 gene is knocked out has a different sequence from the nucleotide sequence of the wild-type PKD2 gene, and the expression level of PC2 in the body of the pig in which the PKD2 gene is knocked out is the expression of PC2 in the body of the wild type. 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 2.5 times, 3 times. PKD2 gene, characterized in that it has an expression level of 3.5 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 50 times, 100 times, 1000 times or less can provide knocked out pigs.

Also, in one embodiment,

Pigs in which the PKD2 gene is knocked out may exhibit placental abnormality during pregnancy. The placental abnormality may mean overexpression, underexpression, or non-expression of any one or more of the substances described above, such as SOD1, Catalase, PC2, Bcl-2, and Caspase-3. The abnormality of the placenta may mean a difference in physical and chemical composition of the placenta or a difference in materials constituting the placenta. In addition, due to the above abnormalities, the placenta may not function properly, leading to miscarriage.

The meaning of having a sequence different from the wild-type PKD2 gene sequence means that the PKD2 gene is knocked out and the expression level of Polycystin-2 is reduced or the expression of Polycystin-2 does not occur in cells having a sequence different from the wild-type PKD2 gene sequence. do.

Through the description in the specification, a composition for modifying or manipulating the PKD2 gene for a specific purpose and a method of using the same are provided.

In one embodiment,

One of the inventions described in the specification is a composition for genetic manipulation, wherein the composition for genetic manipulation is identical to or complementary to i) any one or more of Cas9 or a vector comprising a nucleic acid sequence encoding Cas9, and ii) a part of the PKD2 gene. an sgRNA having a specific sequence, or a vector comprising a nucleic acid encoding the sgRNA; In this case, the target sequence of the sgRNA may be a composition for genetic manipulation of any one of SEQ ID NOs: 3 to 7. The sgRNA may be any one of SEQ ID NOs: 8 to 12.

In one embodiment of the invention described in the specification, the modification in the nucleic acid sequence can be artificially caused by a nuclease (nuclease) agent.

For example, the nuclease agent may use one or more of the following nucleases:

(a) zinc finger nuclease (ZFN);

(b) transcriptional activator-like effector nucleases (TALENs);

(c) meganucleases; or

(d) RNA-Guided Endonuclease (RGEN)

(e) CRISPR/Cas system

In one embodiment, the modification in the nucleic acid sequence may be artificially manipulated by RNA-Guided Endonuclease (RGEN) or the CRISPR/Cas system. The subject may be a target nucleic acid, gene, chromosome or protein.

Pigs for polycystin-2 deficiency disease models are genetically similar to humans, so they are useful not only to study the exact cause and mechanism of disease, but also to be an optimal animal model for toxicity and safety evaluation. Therefore, it will be very useful as an animal model for polycystin-2 deficiency disease because it can be used in various ways to identify the mechanism of polycystin-2 deficiency disease, search for therapeutic substances, and develop diagnostic methods.

1 is about CRISPR/Cas9 targeting the PKD2 gene in porcine fibroblasts. (A) sgRNA targeting the exon 2 region of the PKD2 gene. (B) Indel frequency of sgRNA targeting exon 2 region of PKD2 gene.
Figure 2 is an analysis of the appearance (appearance), PC2 expression, genetic analysis and mitochondrial membrane potential of the founder cloned pig. (A) Morphology of 6 pig embryos (conceptuses) 28 days after ET (embryo transfer) of cloned embryos derived from the edited pool. (B) As a result of Western blot analysis of PC2 protein in pig PKD2 fetus 1, the expression level of PC2 in PKD2 knockout pigs was significantly lower than that of wild-type pigs.
3 is sequencing data for selecting nuclear-donor cells.
4 shows that normal cells have a high ΔΨ value, so green fluorescence is not detected and only red fluorescence is detected, but PKD2 cells have a low ΔΨ value, indicating that green fluorescence and some red fluorescence are detected. It is verified data.
5 is data on the expression levels of MnSOD, Caspase3, Bcl2 and PC2 in the endometrium and placenta of pigs. Cervix (left), PKD2 +/- embryos, placenta and endometrium at day 42 ET. PKD2 +/- sac at 42 days post ET are data showing polyhydramnios (indicated by yellow asterisks).
6 is data on the expression levels of MnSOD, Caspase3, Bcl2 and PC2 in the endometrium and placenta of pigs. This is data confirming the expression levels of MnSOD, Catalase, Caspase3, and Bcl2 in the endometrium and placenta at day ET42 using quantitative RT-PCR.
7 is data on the expression levels of MnSOD, Caspase3, Bcl2 and PC2 in the endometrium and placenta of pigs. For data on PC2 expression.
Figure 8 is for embryo development (Embryo development), the sequencing profile of the embryo after RNP treatment (sequencing profile).

[ Definition ]

The terms "modified" or "engineered" applied to a nucleic acid or gene are used interchangeably in the invention described herein, and mean artificial alteration in the nucleic acid sequence constituting the gene. The alteration may include deletion, substitution, insertion or inversion of one or more nucleotides, and the like. Modified or engineered nucleic acid sequences may manifest in the form of alteration, eg, increase, promotion, decrease or loss, etc. of the expression and/or functional activity of these nucleic acids or expression products thereof.

A 'disease model animal' refers to an animal with a disease that is very similar to a human disease. The significance of disease model animals in the study of human diseases is due to the physiological or genetic similarity between humans and animals. In disease research, biomedical disease model animals provide research materials for various causes, pathogenesis, and diagnosis of diseases, and through research on disease model animals, it is possible to find out genes related to diseases and to understand the interactions between genes. It is possible to obtain basic data for judging the feasibility of practical use through actual efficacy and toxicity tests of the developed new drug candidates.

'Animal' or 'experimental animal' means any mammalian animal other than humans. Such animals include animals of all ages. In the invention described herein, animals are laboratory animals or other animals, rabbits, rodents (eg, mice, rats, hamsters, gerbils and guinea pigs), cattle, sheep, pigs, goats, horses, dogs, cats, birds ( Examples include, but are not limited to, chickens, turkeys, ducks, geese), primates (eg, chimpanzees, monkeys, rhesus monkeys). The animal most suitable as an experimental animal may be a pig.

'Knock out (knock out) or knock down (knock down)' refers to a decrease in function due to a modification in the gene sequence of a target gene. Due to the modification in the gene sequence, the expression level of the target gene may be reduced or non-expressed. For example, when gene A is knocked out, it means that the expression level of gene A is decreased or is not expressed. Furthermore, when gene A is knocked out, the detectable amount of a substance originally expressed by gene A may be reduced or may not be detected. Cells of an individual in which the A gene is knocked out may be one in which only one A gene is knocked out or two or more A genes are knocked out.

A 'target gene' refers to a sequence of a nucleic acid encoding a specific protein to be targeted in order to create the 'disease model animal'. A “target sequence” may be a portion of the target gene, unless specifically stated otherwise. For example, it may be a part of one of an exon sequence of a target gene, an intron sequence of a target gene, or a regulatory sequence, and may be a part of a combination of two of an exon sequence of a target gene, an intron sequence of a target gene, or a regulatory sequence.

"Vector" means having a nucleotide sequence encoding a specific protein, and is inserted into a specific cell so that the specific sequence can be replicated or expressed. For example, a plasmid, a bacteriophage, a nucleic acid molecule derived from a plant virus, suitably a DNA molecule, but is not limited thereto, and may be any vector that can be easily employed by those skilled in the art. A vector may contain one or more restriction sites.

"Wild-type" means that a gene comprising a naturally occurring nucleic acid sequence and a substance expressed from the gene have normal functional properties. Wild-type genes are most frequently observed in the population.

'Nuclear transfer' refers to artificially inserting or fusing another cell or nucleus into a denucleated egg. An individual generated by differentiating a nuclear-transferred cell refers to a genetic manipulation technology that aims to have the same genetic information as that artificially inserted. A 'nuclear transfer embryo' refers to an egg into which a nuclear donor cell is inserted or fused.

A 'nuclear donor cell' refers to a cell or nucleus of a cell that transfers its nucleus to a nuclear receptor, a nuclear recipient. The 'egg' may be a mature egg that has reached the middle stage of the second meiosis. In the invention described in the specification, as the nuclear donor cell, somatic cells or stem cells of pigs may be used.

A 'living offspring' is an animal that can survive outside the womb. The live offspring may be an animal capable of surviving more than one second, one minute, one hour, one day, one week, one month, six months or one year. The animal does not require an intrauterine environment for survival.

'Treatment' means an action to obtain a beneficial or desirable clinical result. 'Treatment' refers to both therapeutic treatment and prophylactic or prophylactic measures. Such treatments include treatment required for a disorder that has already occurred as well as preventing a disorder that may occur in the future. 'Palliating' a disease means that the clinical signs occurring in the case of a disorder are reduced or the condition is relatively improved by the expression of a target substance, compared to the case where there is no treatment.

'About' means 30, 25, 20, 25, 10, 9, 8, 7, 6, 5, 4 for a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. , means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight or length varying by 3, 2 or 1%.

As used herein, the terms "comprises" and "comprises" mean to include a given component, object, or method, and the word "comprising" does not, by itself, exclude other components, objects, or methods.

Hereinafter, it will be described in detail.

The invention described in the specification relates to an animal model of polycystin-2 deficiency disease.

More specifically, it relates to a method for artificially modifying the nucleic acid sequence of PKD2 and an animal model for polycystin-2 deficiency disease using the same.

[Disease model]

Polycystin-2 deficiency disease

The PKD2 gene encodes Polycystin-2 (PC2), a member of the Polycystin protein family. Polycystin-2 may be an integral membrane protein involved in interactions between cells, between matrices, or between cells and matrices. Polycystin-2 may affect the development, morphology, and/or function of the renal tubular. In addition, Polycystin-2 may be involved in homeostasis of intracellular calcium and other signal transduction pathways. In addition, Polycystin-2 may interact with Polycystin-1 to produce a cation-permeable current.

Polycystic kidney disease includes genetically very heterogenous diseases, and among them, autosomal dominant polycystic kidney disease (ADPKD) is the most common. ADPKD may be caused by mutations in PKD 1 and/or PKD2 genes, and it is known that the incidence rate of the former is 85% and the incidence rate of the latter is about 15%. However, in the latter case, the progress is relatively slower than in the former case.

Polycystic kidney disease is a disease caused by a genetic disorder of ciliary function and structure, and the number of kidney Cysts increases as well as the size of the formed Cysts gradually enlarges, leading to a decrease in renal function. . Moreover, cardiovascular complications such as liver cysts and intracranial aneurysms or mitral valve prolapse have also been associated with polycystic kidney disease. In addition, early ADPKD is characterized by oxidative stress even when renal function is maintained. Since mitochondrial damage is mainly caused by intracellular superoxide generation, we found that PKD2 monoallelic mutation can cause mitochondrial damage and oxidative stress, which leads to abortion in response to oxidative stress during fetal development. In addition, it was confirmed through the present invention that KO of the biallelic PKD2 gene does not occur as a living fetus.

There are currently no drugs that inhibit the onset of polycystic new disease or treat the disease progression. Therefore, at present, only treatment for high blood pressure treatment, prevention of urolithiasis, and management of various complications caused by a decrease in renal function can be performed. The new polycystic disease is a genetic disease that occurs in about 1 in 1,000 people, so there is a need for a treatment.

In this situation, using an animal model to discover a new treatment is an essential element for discovering a new therapeutic target and conducting drug testing in the preclinical stage. Accordingly, in the invention described in the specification, an animal model having a disease similar to a human disease is made by artificially modifying or manipulating an animal gene.

PKD2 gene knockout disease model

Until now, most rodents have been used as disease models for drug treatment or mechanism studies of polycystic kidney disease, but the pathological patterns and symptoms of animal disease models are very different from those observed in humans. There have been many problems when conducting clinical trials.

That is, a model animal that expresses all the symptoms of human polycystic kidney disease enough to be used as an effective disease model has not yet been established.

Pigs can be used as an animal model of the invention described in the specification.

As an example of the invention described in the specification, by confirming the induction of polycystic kidney disease by polycystin-2 deficiency, a more reliable PKD2 deficiency disease animal model was developed and used. An example of the invention described in the specification may be more useful through the production and behavior of a disease model that surpasses a rodent model using a large animal, a pig.

As an animal model, pigs have a longer survival period than existing rodent models, and are more useful than rodent models because they have biological mechanisms similar to humans. In addition, pigs are useful because they mature relatively quickly, have a short gestation period, have a large body weight and volume, and produce many live births in one pregnancy.

As the pig used for carrying out the invention described in the specification, any known kind that can be appropriately selected and used by a person skilled in the art can be used.

In one embodiment, a mini-pig (eg, Pittman, Moore) having a maximum weight of 60-70 kg close to that of a human is used, or a small pig (adult weight: 30-40 kg) that is easier to use in an experiment Göttingen , suburban mini-pigs (NIH-based), Yucatan-based mini-pigs, micro-pigs, etc. may be used.

An example of the invention described in the specification relates to an animal in which a specific gene has been artificially modified. More specifically, it relates to an animal in which the PKD2 gene has been artificially modified or engineered.

Another example relates to an animal suffering from polycystic kidney disease.

Another example relates to an animal in which the PKD2 gene is artificially modified or manipulated and suffers from polycystic kidney disease.

Another example is an animal in which the PKD2 gene is engineered to be knocked out, and the expression of polycystin-2 protein is significantly reduced or inactivated when compared to a wild type animal.

Another example is a pig in which the PKD2 gene is knocked out, and includes at least one cell in which the PKD2 gene is knocked out, and the cell in which the PKD2 gene is knocked out has only one PKD2 gene among the two PKD2 genes wild-type ( The nucleotide sequence of the PKD2 gene different from the nucleotide sequence of the PKD2 gene of wild type), and the PC2 (Polycystin-2) expression level of the pig in which the PKD2 gene is knocked out is at least 2 times lower than the PC2 expression level of the wild type pig, Alternatively, the PKD2 gene may be a pig knocked out, characterized in that the mitochondrial membrane potential of the cell in which the PKD2 gene is knocked out is lower than the mitochondrial membrane potential of the wild-type cell.

An example of the invention described in the specification is a pig in which the PKD2 gene is knocked out, and includes at least one cell in which the PKD2 gene is knocked out. More specifically, the cell may be one in which only one PKD2 gene among the two internal PKD2 genes is knocked out. The two endogenous PKD2 genes are present or located on any chromosome and homologous chromosomes of the arbitrary chromosome, respectively.

In another example, the cell in which the PKD2 gene is knocked out has the same sequence as the deletion, insertion, substitution or inversion of one or more nucleotides in the nucleic acid sequence of the exon 2 region of the wild-type PKD2 gene. It could be a knocked-out pig. In another example, the nucleic acid sequence of the exon 2 region may be a pig in which the PKD2 gene is knocked out, characterized in that the nucleic acid sequence includes SEQ ID NO: 1 or 2.

Disease model pig production method

One embodiment described in the specification relates to a method for producing a disease model pig. Specifically, it relates to a method for producing a transgenic pig for a PKD2 deficiency disease model in which the PKD2 gene is knocked out, and a pig for a PKD2 deficiency disease model prepared thereby.

One embodiment described in the specification relates to a method for producing live offspring using the above-mentioned cells in which genes have been modified or engineered. Another embodiment described in the specification relates to a method of producing live offspring using a cell in which a gene is modified or manipulated by the above method of modifying or manipulating a gene of a cell. Another embodiment described in the specification relates to a method for producing live offspring using a knockout cell in which the PKD2 gene is modified or manipulated.

As an embodiment of the invention described herein, in order to produce pigs in which polycystin-2 protein expression is inactivated, cells in which the PKD2 gene has been artificially modified or engineered may be used.

As an embodiment of the invention described in the specification, a pig with polycystin-2 protein expression inactivated or reduced in expression can be produced using cells artificially modified or engineered with only one of the two PKD2 genes.

As an embodiment of the invention described in the specification, pigs in which polycystin-2 protein expression is inactivated can be produced using cells artificially modified or engineered for both PKD2 genes.

Somatic cell nuclear transfer (SCNT) can be used using somatic cells of pigs transformed to develop into pigs. Individuals generated using SCNT cells can produce non-chimeric animals, even though they are the first generation.

In addition to the above-mentioned somatic cell nuclear transfer method, it can also be generated into an individual using a known method that can be easily adopted by those skilled in the art. One of the methods that can be generated in individuals may be ET (embryo transfer), in vitro generation using an incubator, or the like.

As an embodiment, a nuclear transfer embryo of a pig formed by transplanting the nucleus of a pig-derived somatic cell, embryonic cell or stem cell transformed with a composition for knocking out the PKD2 gene into a denucleated egg, and a method for manufacturing the same.

As an embodiment, there is provided a transgenic pig for a PKD2 deficiency disease model in which the PKD2 gene is knocked out, including the step of producing live offspring by transplanting the nuclear transfer egg into the fallopian tube of a surrogate mother, and a method for producing the same.

As an example, as a method for producing a pig in which a PKD2 gene is knocked out, (i) preparing a pig cell in which only one PKD2 gene is knocked out, (ii) a pig cell in which only one PKD2 gene is knocked out is prepared under a specific environment. Development into a fetus, at this time, the specific environment is the concentration of Caspase-3 or Bcl-2 in the specific environment Caspase-3 in the placenta or endometrium in the development process of wild-type pigs Alternatively, it may have a value twice or more than the concentration of Bcl-2. (iii) inducing the fetus to become a living offspring, at this time, the expression level of PC2 (Polycystin-2) of the living offspring is PKD2, which may be characterized in that it is N times or more lower than that of a wild-type pig It may be a method for producing a pig in which the gene is knocked out. As another example, the PKD2 gene may be a method for producing a pig knocked out, characterized in that the mitochondrial membrane potential of the cell in which the PKD2 gene is knocked out is lower than the mitochondrial membrane potential of the wild-type cell. As another example, the specific environment may be a method for producing a pig in which the PKD2 gene is knocked out, characterized in that it refers to an environment within the uterus or placenta within the uterus of the pig.

In one embodiment, it comprises a method for producing a genetically engineered animal,

The method comprises exposing the embryo or cell to a targeting nuclease (eg, meganuclease, zinc finger, TALEN, guide RNA, recombinase fusion molecules) or a vector encoding the same;

Cloning a cell in a surrogate mother or transplanting embryos in a surrogate mother, wherein the targeting nuclease specifically binds to a target chromosomal site in the embryo or cell to cause a change in the cell chromosome, and the surrogate mother is at the target chromosomal site Genetically engineered animals can become pregnant.

In the process of generating a pig in which the PKD2 gene is knocked out, a specific environment can be created so that the individual does not have a stillbirth or abortion and normally develops as an independent individual. As an example, the environment in which the individual is generated is at least any one of SOD1, Catalase, Caspase-3, and Bcl-2 required when the concentration of at least one of SOD1, Catalase, Caspase-3, Bcl-2, and PC2 is generated in wild-type pigs. 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 2.5 times, 3 times than one or more concentrations. 3.5 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times or more may be characterized as higher or lower.

[genetically modified or manipulated]

[genetically modified or manipulated]

Examples of the invention described in the specification include inventions directed to the modification or manipulation of specific genes.

The invention described herein involves genetically engineering the PKD2 gene. By modifying or manipulating the PKD2 gene, it is possible to reduce the expression level of the protein Polycystin-2 originally encoded by PKD2, or to prevent the expression at all. Alternatively, it may occur by modifying or manipulating the gene to express factors that will inhibit the transcription or translation of the gene of PKD2.

The genetic modification may be such that the protein encoded in the gene is not expressed in the form of a protein having an original function by inactivating the gene.

In one embodiment of the invention described in the specification, the genetic modification catalyzes single-stranded or double-stranded cleavage of a specific site within the targeted gene by a genome editing system comprising a cleavage endonuclease to catalyze the targeted gene may be inactivated.

Nucleic acid strand breaks catalyzed by cleavage endonucleases can be repaired through mechanisms such as homologous recombination or nonhomologous end joining (NHEJ). In this case, when the NHEJ mechanism occurs, a change is induced in the DNA sequence at the cleavage site, thereby inactivating the gene.

In this case, when the NHEJ mechanism occurs, a change is induced in the DNA sequence at the cleavage site, thereby inactivating the gene. Repair via NHEJ results in substitutions, insertions or deletions of short gene fragments and can be used to induce gene knockout.

The PKD2 gene sequence of the animal in which the PKD2 gene has been modified or engineered is at least 70%, 75% 80%, 85% 90%, 95%, 96%, 97%, 98%, or 99% of the PKD2 gene sequence of a wild-type animal. It may have more than one sequence homology.

The modification or manipulation of the gene may include deletion, substitution, insertion or inversion of one or more nucleotides.

The modification or manipulation of the gene may include addition of one or more nucleotides, deletion of one or more nucleotides, substitution of one or more nucleotides, knockout of a polynucleotide of interest or a portion thereof, knock-in of a polynucleotide of interest or a portion thereof. , substitution of an endogenous nucleic acid sequence with a heterologous nucleic acid sequence, or combinations thereof.

In one embodiment, for inactivation of a desired PKD2 gene, some of the PKD2 gene nucleic acid sequences involved therein may be manipulated or modified. As a result of manipulation, it includes all types of knock down, knock out, and knock in.

In one embodiment, the nucleic acid modification is one or more nucleotides, e.g., 1-1000 bp, 1-200 bp, 1-100 bp, 1-90 bp, 1-80 bp, 1-70 bp. 1 to 60 bp, 1 to 50 bp, 1 to 40 bp, 1 to 30 bp, 1 to 27 bp, 1 to 25 bp, 1 to 23 bp, 1 to 20 bp, 1 to 15 bp, 1 to 10 bp, 1 to 5 bp, 1 to 3 bp, or 1 bp It may be a substitution, deletion, and/or insertion of a nucleotide of

The modification or manipulation of the gene may occur in a part of one of an exon sequence, an intron sequence of a target gene, or a regulatory sequence, or may occur in a part of a combination of two of an exon sequence of a target gene, an intron sequence of a target gene, or a regulatory sequence have.

The modification or manipulation of the gene may occur in the exon region of the PKD2 gene.

More specifically, the modification or manipulation of the gene includes exon 1 region, exon 2 region, exon 3 region, exon 4 region, exon 5 region, exon 6 region, exon 7 region, exon 8 region ¸ exon 9 region, exon 3 region of the PKD2 gene. It may occur in at least one of the 10 region, the exon 11 region, the exon 12 region, and the exon 13 region. However, the present invention is not limited thereto.

The modification or manipulation of the gene may occur in the exon 2 region of the PKD2 gene. The modification or manipulation of the gene may be one in which one or more nucleotides of the exon2 region of the PKD2 gene are deleted, inserted, substituted, or inverted so that the PKD2 gene is knocked out.

In one embodiment, the concentration and/or expression level of Polycystin-2 or Catalase in an animal in which the PKD2 gene is modified or manipulated is at least 1%, 5%, 10% compared to the cells of a control wild-type animal or a wild-type individual. , 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90%.

In one embodiment, the concentration and / or expression level of SOD1 (superoxide dismutase 1), Catalase, Caspase-3, or Bcl-2 (B-cell lymphoma 2) in the animal in which the modification or manipulation of the PKD2 gene has occurred is a control group and at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% improvement over cells of a wild-type animal or a wild-type individual.

In another example, the manipulation or modification of the PKD2 gene may be caused in a cell, an embryonic cell, a somatic cell or a stem cell.

The cells include cumulus cells, epithelial cells, fibroblasts, nerve cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, macrophages, monocytes, muscle cells, B lymphocytes, T lymphocytes, embryonic stem cells, embryonic germ cells, fetuses Derived cells, placental cells, embryonic cells, and the like. In addition, adult stem cells derived from various origin tissues, for example, may be tissue-derived stem cells such as fat, uterus, bone marrow, muscle, placenta, umbilical cord blood, or skin (epithelium). In addition, a non-human host embryo may be an embryo that generally comprises a 2-cell stage, a 4-cell stage, an 8-cell stage, a 16-cell stage, a 32-cell stage, a 64-cell stage, a morula, or a blastocyst. have. In addition, it may be fetal-derived cells, adult fibroblasts, or cumulus cells.

In one embodiment of the invention described in the specification, PKD2 genetic manipulation may be made in consideration of the gene expression regulation process. The genetic manipulation may mean that one or more nucleotides of the PKD2 gene are deleted, inserted, substituted, or inverted to knock out the PKD2 gene.

In one embodiment of the invention described in the specification, it can be made by selecting an operation means suitable for each step in the step of transcription regulation, RNA processing regulation, RNA transport regulation, RNA degradation regulation, translation regulation or protein modification regulation step.

In one embodiment of the invention described in the specification, using RNAi (RNA interference or RNA silencing), small RNAs (sRNAs) interfere with mRNA or reduce stability, and in some cases, destroy it so that protein synthesis information is transmitted in the middle It is possible to control the expression of genetic information by preventing it from happening.

In one embodiment of the invention described herein, a wild-type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of bonds between nucleic acids in a DNA or RNA molecule may be used.

In one embodiment of the invention described herein, meganuclease (meganuclease); zinc finger nuclease; TALE-nuclease; RNA-Guided Endonuclease (RGEN), for example, using one or more nucleases selected from the group consisting of CRISPR/Cas9 (Cas9 protein), CRISPR-Cpf1 (Cpf1 protein), and the like. can be manipulated to control the expression of genetic information.

In one embodiment of the invention described in the specification, it is possible to provide a composition and method for genetic manipulation by targeting part or all of the non-coding or coding region of the PKD2 gene.

In one embodiment of the invention described in the specification,

The Cas protein can cleave nucleic acids at sites inside or outside of the nucleic acid sequence present in the target DNA to which the DNA targeting segment of the gRNA will bind.

A “cleavage site” includes a nucleic acid site at which a Cas protein causes a single-stranded break or a double-stranded break. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 from, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 from a nucleic acid sequence present in the target DNA to which the DNA targeting segment of the gRNA is bound , 20, 50, 70, 100 or more base pairs, cleavage may occur. It can cause cleavage of one or both strands.

The cleavage site may be on only one or both strands of the nucleic acid. The cleavage sites may be at the same location on both strands of the nucleic acid (creating blunt ends), or they may be at different sites on each strand (creating staggered ends).

Site-specific cleavage of a target DNA by a Cas protein can occur at a location in the target DNA determined by (i) base-pairing complementarity between the gRNA and target DNA and (ii) a short motif referred to as PAM.

A protospacer adjacent motif (PAM) may be flanked by a CRISPR RNA recognition sequence. Optionally, the CRISPR RNA recognition sequence may be flanked by PAM. For example, the cleavage site of Cas can be from about 1 to about 10, or from about 2 to about 5 base pairs (eg, 3 base pairs) upstream or downstream of the PAM sequence. The Cas protein may be a Cas9 protein.

[Composition for genetic modification or manipulation]

In one embodiment of the invention described in the specification, a composition for genetic modification or manipulation of the PKD2 gene and a method of using the same are provided.

In one embodiment of the invention described in the specification, the composition for genetic manipulation may include a recombinant vector capable of producing an animal model of polycystic kidney disease by knocking out the PKD2 gene.

In one embodiment of the invention described in the specification, 'vector' or 'expression vector' refers to a plasmid known in the art into which a nucleic acid encoding a structural gene can be inserted and the nucleic acid can be expressed in a host cell, means a viral vector or other carrier. The vector may be a plasmid vector.

In one embodiment of the invention described in the specification, a vector may be introduced into a cell and a known expression vector such as a plasmid vector, a cosmid vector, or a bacteriophage vector may be used as a means for knocking out the PKD2 gene, and the vector is DNA recombination technology. It can be readily prepared by those skilled in the art according to any known method used.

In one embodiment of the invention described in the specification, the vector includes a nucleotide sequence encoding a gene scissors having an activity to recognize and cut a PKD2 gene specific sequence, wherein the gene scissors are Zinc finger nuclease (ZFN), It may be one or more of a transcription activator-like effector nuclease (TALEN talen) and an RNA-guided engineered nuclease (RGEN).

In one embodiment of the invention described in the specification, the recombinant expression vector may use a promoter in the art for expressing a gene.

In one embodiment of the invention described in the specification, the vector for knockout of the PKD2 gene may include a reporter gene, and the reporter gene may include a reporter system.

In one embodiment of the invention described herein, the recombinant expression vector may include a selection marker, wherein the selection marker includes an antibiotic resistance gene such as a kanamycin resistance gene, a neomycin resistance gene, a puromycin resistance gene, and a green fluorescent protein; fluorescent proteins such as red fluorescent protein, and the like, but are not limited thereto.

In one embodiment of the invention described in the specification, the vector may further include a tag sequence for isolation, purification or confirmation of the protein. Examples of the tag sequence include GFP, Glutathione S-transferase (GST)-tag, HA, His-tag, Myc-tag, T7-tag, etc., but the tag sequence is not limited by the above examples.

In one embodiment of the invention described in the present specification, the recombinant vector for knockout of the PKD2 gene causes polycystin-2 expression to be absent or reduced by causing a mutation that knocks out the PKD2 gene in pig cells, thereby causing polycystic kidney disease.

In one embodiment, the composition for modifying or manipulating the PKD2 gene may include a component of the RNA-guided endonuclease (RGEN) system.

For example, there is provided a composition for genome manipulation comprising a guide RNA or a nucleic acid molecule encoding the same, and RNA-Guided Endonuclease (RGEN) or a nucleic acid molecule encoding the same. In this case, the RGEN may be a CRISPR system. In this case, the RGEN may be a CRISPR/Cas system.

For example, (i) a guide RNA or a DNA molecule encoding said guide RNA, or (ii) said guide RNA or a DNA molecule encoding said guide RNA and an RNA-guided endonuclease or said RNA-guided endonuclease Provided is a PKD2 gene inactivation composition comprising a gene encoding a clease.

For example, (i) a guide RNA or a DNA molecule encoding said guide RNA,

or (ii) the guide RNA or a DNA molecule encoding the guide RNA and an RNA-guided endonuclease or a gene encoding the RNA-guided endonuclease.

The composition may be provided in the form of an expression cassette.

In one embodiment of the invention described herein, a guide RNA sequence for genetic manipulation of the PKD2 gene is provided. For example, a guide RNA sequence corresponding to the PKD2 gene target sequence is provided. For example, the guide RNA sequence shown in FIG. 1 can be provided.

In one embodiment of the invention described herein, there is provided a CRISPR-related nuclease that interacts with, for example, forms a complex with, a guide RNA corresponding to a target sequence for genetic manipulation of the PKD2 gene.

In one embodiment of the invention described in the specification, each nucleic acid modification product artificially manipulated in the target sequence region of the PKD2 gene and an expression product thereof are provided.

In one embodiment of the invention described in the specification, a complex of 'guide RNA-CRISPR-related nuclease' used for nucleic acid modification at the target site of the PKD2 gene is provided.

In one embodiment of the invention described in the specification, a gRNA molecule comprising a domain capable of complementary binding to a target site from a gene, for example, an isolated or non-naturally occurring gRNA molecule and DNA encoding the same can be provided. have.

In one embodiment of the invention described herein, when two or more gRNAs are used to locate two or more cleavage events in a target nucleic acid, eg, double-stranded or single-stranded breaks, the two or more cleavage events are the same or different Cas protein or Cas9 protein.

The gRNA is, for example,

It can target two or more sites in the PKD2 gene,

Two or more sites can be targeted for each PKD2 gene,

can independently induce double-stranded and/or single-stranded breaks of the PKD2 gene;

It is also possible to induce the insertion of one foreign nucleotide into the cleavage site of the PKD2 gene.

In one embodiment of the invention described in the specification, the nucleic acid constituting the complex of 'guide RNA-CRISPR-related nuclease' is

(a) a sequence encoding a gRNA molecule complementary to a target site sequence in the PKD2 gene as disclosed herein; and

(b) a sequence encoding a CRISPR-associated nuclease.

In this case, in (a), two or more may be present depending on the target site, and in (b), the same type or two or more nucleases may be used.

In one embodiment of the invention described in the specification, an enzymatically inactive editor protein or a fusion protein thereof (eg, a transcriptional protein sufficiently close to the knockdown target site to reduce, reduce or inhibit the function or expression of the PKD2 gene) repressor domain fusion).

[Gene manipulation method]

One embodiment of the invention described in the specification relates to a method for introducing a composition for genetic modification or manipulation of the PKD2 gene into a pig cell.

The contacting may be performed in vivo or in vitro.

For example, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran-mediated transfection ( Transgenic animals by DEAEDextran-mediated transfection, polybrene-mediated transfection, electroporation, gene gun and other known methods for introducing nucleic acids into cells It can be introduced into cells for production.

In one embodiment of the invention described herein, for the genetic modification or manipulation, for example, knockout, gene inactivation, or to obtain expression of a specific gene, or for other purposes, various nucleic acids are added to the cell. can be introduced.

Nucleic acid refers to, e.g., cDNA, genomic DNA, synthetic (e.g., chemically synthesized) DNA, as well as naturally occurring and chemically modified nucleic acids, e.g., both RNA and DNA containing synthetic bases or alternating backbones. . Nucleic acid molecules may be double-stranded or single-stranded.

The nucleic acid may be included in a vector.

A vector may refer to an expression vector or vector system, and may be a set of components necessary to effect DNA insertion into a genome or other targeted DNA sequence, such as an episome, a plasmid, or even a viral/phage DNA segment.

Viral vectors used for gene transfer in animals can be used. In addition, non-viral vectors may be used.

Examples of vectors include plasmids (which may also be carriers of other types of vectors), adenoviruses, adeno-associated viruses (AAV), lentiviruses (eg, modified HIV-1, SIV or FIV), retroviruses ( For example, ASV, ALV or MoMLV), and a transposon (eg, Sleeping Beauty, P-elements, Tol-2, Frog Prince, piggyBac).

In addition, plasmid and viral vectors, such as retroviral vectors, can be used. or a mammalian expression plasmid having an origin of replication, an appropriate promoter, and optional enhancers and any essential ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences, and 5' flanking non-transcriptional sequences it could be

In one embodiment, the target nucleic acid sequence may be operably linked to a regulatory region such as a promoter.

In one embodiment, additional control regions may be introduced together. polyacetylation sequences, translational control sequences (eg, internal ribosome entry segment, IRES), enhancers, inducible elements or introns. However, the present invention is not limited thereto.

In one embodiment, nucleic acid constructs encoding signal peptides or selectable markers may be used.

In one embodiment, the exogenous nucleic acid encodes a polypeptide. It may include a tag sequence encoding a “tag”.

The nucleic acid may be delivered in a non-viral vector delivery method.

For example, Cas9 and sgRNA in the form of mRNA can be packaged and delivered in lipid nanoparticles. DNA or nucleic acid constituting CRISPR/Cas9 having an anion can form nanoparticles by electrostatically complexing with substances having a cation, which is a cell by receptor-mediated endocytosis or phagocytosis. can penetrate. The most widely known cationic materials for delivering nucleic acids include naturally-occurring polymers, synthetic polymers, and lipids.

For example, it can be delivered in the form of a Cas9 / sgRNA complex (Complex).

It may be a method of making Cas9 protein and sgRNA in RNP (ribonucleoprotein) form before administration and then delivering it to a desired cell using a delivery material such as liposome. The RNP form is expressed simultaneously with delivery into the cell, and when delivered in the aforementioned mRNA form, there is no delay until it is translated into a protein, and the expression is transient. By introducing the sgRNA and Cas9 protein into the cell in the form of an RNP complex, it is introduced as an active Cas9 protein, which has the advantage of enabling faster and minimizing off-target effect.

In one embodiment of the invention described in the specification, sgRNA and Cas9 protein can be introduced into pig embryonic cells in the form of a Ribonucleoprotein (RNP) complex.

In one embodiment of the invention described herein, it is possible to provide a pig cell having an inactivated or removed PKD2 gene.

For example, it relates to a method for introducing a recombinant vector comprising a composition for PKD2 knockout into a nuclear donor cell, and to a cell into which the recombinant vector is introduced.

For example, it relates to a method for introducing an RNP complex comprising a composition for PKD2 knockout into a nuclear donor cell, and to a cell into which the RNP complex is introduced.

In one embodiment, the cell may be a pig embryonic cell, a somatic cell or a stem cell.

In one embodiment, but not limited to, cumulus cells, epithelial cells, fibroblasts, nerve cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, macrophages, monocytes, muscle cells, B lymphocytes, T lymphocytes, embryonic stem cells cells, embryonic germ cells, fetal-derived cells, placental cells and embryonic cells. In addition, adult stem cells derived from various origin tissues, for example, tissue-derived stem cells such as fat, uterus, bone marrow, muscle, placenta, umbilical cord blood, or skin (epithelium) may be used. A non-human host embryo may generally be an embryo comprising a 2-cell stage, a 4-cell stage, an 8-cell stage, a 16-cell stage, a 32-cell stage, a 64-cell stage, a morula, or a blastocyst. .

Alternatively, fetal-derived cells and adult fibroblasts and cumulus cells may be used.

Alternatively, fibroblasts isolated from fetal and adult pigs are used. The characteristics of these cells are that a large number of cells can be obtained during initial isolation, cell culture is relatively easy, and in vitro culture and manipulation are easy.

The embryonic cells, somatic cells or stem cells provided as nuclear donor cells can be obtained from a method for preparing a surgical specimen or a biopsy specimen using a conventional method known in the art.

Meanwhile, nuclear donor cells transformed with a vector for knockout of the PKD2 gene may be proliferated and cultured according to methods known in the art.

A suitable medium is any use that can be developed for the culture of animal cells and, in particular, mammalian cells, or prepared in the laboratory with appropriate components necessary for animal cell growth, such as anabolic carbon, nitrogen and/or micronutrients. Any available medium may be used.

The medium is any basic medium suitable for animal cell growth, as a non-limiting example, as a basic medium generally used for culture, MEM (Minimal Essential Medium), DMEM (Dulbecco modified Eagle Medium), RPMI (Roswell Park Memorial Institute) Medium), and K-SFM (Keratinocyte Serum Free Medium), and in addition to this, any medium used in the industry may be used without limitation.

The medium is α-MEM medium (GIBCO), K-SFM medium, DMEM medium (Welgene), MCDB 131 medium (Welgene), IMEM medium (GIBCO), DMEM/F12 medium, PCM medium, M199/F12 (mixture) ( GIBCO), and MSC expansion medium (Chemicon).

To this basal medium may be added anabolic sources of carbon, nitrogen and micronutrients, including but not limited to, serum sources, growth factors, amino acids, antibiotics, vitamins, reducing agents, and/or sugar sources.

It will be apparent that a person skilled in the art can properly culture by a known method by selecting or combining a suitable medium. In addition, it is apparent that culture can be performed while controlling conditions such as a suitable culture environment, time, and temperature based on common knowledge in this field.

[Use of disease model]

One embodiment described in the specification provides the use of a pig in which the expression of polycystin-2 is reduced or hardly expressed because the PKD gene is knocked out by modification in the nucleic acid sequence of the PKD2 gene.

Pigs, which are polycystic kidney disease models in which the PKD2 gene is knocked out according to an embodiment described in the specification, can produce live offspring through mating, and the knocked-out PKD2 gene can be transmitted to the next generation. Therefore, a disease model pig in which the PKD2 gene is knocked out has an advantage of easy repeatability, and is very useful as an animal model for polycystic kidney disease.

Using a pig, which is a polycystic kidney disease model in which the PKD2 gene is knocked out according to an embodiment described in the specification, various applications such as identification of the mechanism of polycystic kidney disease, identification of polycystin-2 mechanism, discovery of therapeutic substances, and development of diagnostic methods are possible. will be.

Another use of the polycystic kidney disease model pig in which the PKD2 gene produced by the method described in the specification is knocked out is included. It can be used in the process of researching or searching for a substance to treat or prevent polycystic kidney disease, and can also be used as an administration target in the process of screening a test drug.

In one embodiment of the invention described in the specification, the screening method is

1) administering a prophylactic and therapeutic candidate substance to a polycystic kidney disease model pig containing the knocked-out PKD2 gene;

2) after administration of the candidate substance, comparing and analyzing the pig tissue with a control group to which the candidate substance is not administered.

The candidate material may be any one selected from the group consisting of peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and plasma. This is not limited. A novel compound may be sufficient as the said compound, and a well-known compound may be sufficient as it. Such a candidate substance may form a salt.

As a method of administering the candidate substance as described above, for example, oral administration, intravenous injection, subcutaneous administration, intradermal administration, or intraperitoneal administration may be appropriately selected according to the symptoms of the target animal, the properties of the candidate substance, and the like. In addition, the dose of the candidate substance can be appropriately selected according to the administration method or the properties of the candidate substance.

[Example]

The invention described in the specification has been described in more detail through the following examples. These examples are intended to illustrate the invention described in the specification, and the scope of the invention is not limited by these examples.

Materials and Methods

1. Oocyte collection and in vitro maturation (IVM)

Pig ovaries were obtained from young sows before puberty and stored in a saline solution maintained at a temperature between 30 and 35 ºC. Using an 18-gauge needle connected to a syringe, 3-6 mm of follicles were aspirated. Sediment containing cumulus-oocyte-complexes (CoCs) was collected from tissue culture medium-199 (TCM-199; Invitrogen, Carlsbad, CA, USA), 10 mM 4-(2-Hydroxyethyl) piperazine-1-ethanesulfonic acid (HEPES) , 0.3% polyvinyl alcohol, 5 mM sodium hydroxide, 2 mM sodium bicarbonate and 1% penicillin-streptomycin (Invitrogen) were mixed (pooled). The selected COCs were TCM-199, 10 μl/mL insulin transferrin selenium solution (ITS) 100X (Invitrogen), 2 mM sodium pyruvate, 0.57 mM cysteine, 10 ng/mL epidermal growth factor (EGF), 10% porcine follicular fluid ( v/v), 10 IU/mL human chorionic gonadotropin (hCG), and 10 IU/mL equine chorionic gonadotropin (eCG) were transferred to an IVM medium, with a humidity of 95% air containing _{5% CO 2 and} It was incubated under a temperature of 38.5 ºC. After 22 hours of incubation, the cells were further cultured for an additional 22 hours in hormone-free IVM medium.

2. Cas9-sgRNA ribonucleoprotein (RNP) delivery to donor cells and deep sequencing results

Finally, five types of RNPs (by ToolGen Inc.) targeting exon 2 of the pig PKD2 gene were synthesized ( FIG. 1 ). Cas9-sgRNA RNP was introduced into porcine fetal fibroblasts through the Neon Transfection system (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) using a single pulse of 1400 V for 30 ms. The ratios of Cas9 protein and sgRNA were 6.4 μg and 1.6 μg, respectively. Two days after electroporation, the degree of InDel of sgRNA was comparatively analyzed through deep sequencing of the target locus.

Genomic DNA obtained from donor cells and cloned fetal cells was amplified by on-target region analysis. Illumina MiSeq (v2, 300-cycle) was used to perform paired-end read sequencing analysis. The same amount of PCR amplicon was tested. Insertions or deletions that occurred about 3 bp upstream of PAM were induced by RNP. mutations were considered.

As a result of analyzing the mutation efficiency of five sgRNAs targeting the exon 2 region of the PKD2 gene (the specific sequence is FIG. 1A), sgRNA1, sgRNA2, sgRNA3, sgRNA4, and sgRNA5 were 49.3%, 9.3%, 24.2%, respectively, It showed mutation efficiencies of 10.7% and 3.8% (FIG. 1B). Therefore, to form the PKD2 KO cell line, the Cas9-sgRNA1 targeting vector was co-transfected during the initial passage of the primary porcine fibroblast. As a result, genetically modified ones were used as donor cells.

The target sequence of sgRNA1 is SEQ ID NO: 3, the target sequence of sgRNA2 is SEQ ID NO: 4 The target sequence of sgRNA3 is SEQ ID NO: 5, the target sequence of sgRNA4 is SEQ ID NO: 6, and the target sequence of sgRNA5 is SEQ ID NO: 7.

3. Donor Cell Preparation

10% under the rear cut a pig embryo tissue collected 30 days after the artificial insemination with a bit, the air _{5% CO 2 fetal bovine serum (} FBS; Thermo Fisher Scientific) (vol / vol), 1 mM sodium pyruvate, and It was cultured in Dulbecco's modied Eagle's medium (DMEM; Thermo Fisher Scientific) containing 100 IU/mL each of penicillin and streptomycin. Pig embryonic cells were isolated and cryopreserved prior to transfection.

4. SCNT, ET (embryo transfer) and surgical collection of fetus, endometrium, and placenta

After 44 h of incubation, cumulus cells were removed from the COCs by gently pipetting in Tyrode's albumin lactate pyruvate (TALP) medium containing 0.1% hyaluronidase. Then, the nucleus of the oocyte was removed. Thereafter, PKD2 gene heterozygous knockout cells or wild-type cells were injected into the perivitelline space of the enucleated oocytes, respectively. This couplet was fused to 20 μL droplets of fusion medium using an electric pulsing machine (LF101; Nepa Gene, Chiba, Japan) that generated a single DC pulse of 200 V/mm for 30 μs. After fusion, the couplet was activated using the BTX ElectroCell Manipulator 2001 (BTX Inc., San Diego, CA, USA) that emitted a single DC pulse of 1.5 kV/cm for 60 μs. Activated embryos (embryo) were cultured for 7 days under a temperature of 38.5 º in air composed _{of 5% O 2} , 5% CO ₂ and 90% N _{2 .} For embryo transfer (ET), one cell, cleaved embryos 1 day after SCNT, and cleaved embryos 2 days after SCNT were collected, and they were delivered to gilt recipients to be synchronized spontaneously. Fetuses were obtained by cesarean section. Gilt's abdomen was opened and hysterectomized on day 28 of gestation (corresponding to day 30 of embryo development in SCNT embryos). And embryos (conceptuses) were recovered from uterine horns. After 42 days of ET of re-cloned embryos in which the PKD2 gene was eterozygous KO, laparoscopic surgery was performed on one recipient. Endometrial and placental tissues were recovered from the mesometrial side of the uterine horn. For wild type cells, endometrium and placenta were also collected on the same day.

Recipient No. No. of Transferred Embryos Pregnancy Diagnosis Fetus Collection No. Mutants One 147 + - - 2 184 - - - 3 117 - - - 4 155 + 7 Fetuses 3 Fetuses Total 603 2 (50%) - -

Summary of SCNT, embryo transfer and fetus collection 28 days after ET

Recipient No. No. of Transferred embryos Pregnancy Diagnosis Full Term Pregnancy One 160 + - 2 133 + - 3 126 - - 4 208 - - 5 178 - - 6 234 + Laparoscopic surgery at 42 days Total 1039 3 (50%) -

PKD2 Summary of SCNT and embryo transfer and pregnancy maintenance for reconstructed embryos using PKD2 Monoallelic Knockout Fetal Fibroblasts

5. Embryo evaluation and total blastocyst cell counts

Cleavage rate was confirmed at 48 hours of IVC, and blastocyte formation rate was confirmed at 168 hours. For in vitro developmental monitoring, the blastocyst obtained from each group was stained with bisbenzimide (Hoechst 33342) 25 μg/mL, and then glycerol was dropped on a glass slide and gently covered with a cover slip (mounted). ). The final number of blastocysts was measured with a fluorescence microscope (Nikon Corp., Tokyo, Japan).

6. Mitochondrial Membrane Potential Assay

The mitochondrial membrane potential was measured using the JC-1 mitochondrial membrane potential assay kit (Thermo Fisher Scientific). After one day, wild-type cells and PKD2 gene heterozygous knockout cells were respectively placed in appropriate places, and JC-1 working solution was added thereto. After incubation at 37 °C for 20 minutes, the cells were washed and fluorescence was measured by microscopy. The mean intensity of the fluorescence level was measured with ImageJ software (Version 1.49q; National Institutes of Health, MD, USA), and the wild type was normalized as a control.

7. Immunoblotting

gien, France)로 비쥬얼라이즈(visualized) 하였다.Placental and endometrial tissues obtained from wild-type cells, PKD2 gene knockout cells, PKD2 gene knockout re-cloned fetus or from wild-type cells were lysed in Protein Extraction Solution (iNtRON, Seoul, Korea), and finally Protein concentration was measured using the Pierce BCA protein assay kit (Thermo Fisher Scientific, Rockford, IL, USA) using bovine serum albumin. After boiling the protein sample mixed with 5x SDS loading buffer for 5 days, the protein was separated using SDS-PAGE and polyvinylidene fluoride membranes (PVDF, Bio-Rad Labs, Hercules, CA) under electrical stimulation (350 mA, 1 h 15 min). , USA). After destroying the cell membrane using Tris-buffered saline with Tween solution (TBST) containing 5% skim milk at room temperature for 30 minutes, this and PC2 (recombinant antibody, 1:1,000 (Boletta et al. 2000); sc- 47734, 1:1,000) and β-actin (ab6276, 1:1,000) together with a mouse monoclonal antibody to 4 ℃ incubation (overnight). The next day, after washing with TBST, it was incubated with horse-radish peroxidase-conjugated secondary antibody at room temperature for 2 hours. Secondary antibodies were detected by enhanced chemiluminescence substrates (Thermo Fisher Scientific). Blot is Fusion-Capt Software (Vilver Lourmat, Coll.) using wild type endometrium and placenta as 100 (control).

gien, France) was visualized.

8. Quantitative PCR analysis

Total RNA was extracted from endometria and placentas using the easy-spin Total RNA Extraction Kit (iNtRON, Seoul, Korea). 100 μg of RNA was quantified using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA), and then used for first strand cDNA synthesis using a complementary DNA synthesis kit (Invitrogen). Quantitative PCR using SYBR green PCR master mix (Applied Biosystems) was used for various gene expression. The sample was replicated 6 times, and the RT negative sample was used to confirm DNA contamination. Primer sequences, expected product sizes, and GenBank accession numbers for real-time PCR analysis are listed in Table N. And the annealing process of all primers was carried out at a temperature of 60 ℃. There was also a water control, and the level was normalized for the GAPDH gene.

Statistical analysis in quantitative PCR and immunoblot were all performed by Student's t- test using GraphPad Prism 5 (San Diego, CA, USA). This experiment was repeated at least 5 times for each group. Results were expressed as 'standard error of the mean (SEM)', and a significant difference was considered when P <0.05.

Gene Primer sequences (5'->3') Product size (bp) GenBank accession number GAPDH F: GTCGGTTGTGGATCTGACCT 207 NM_001206359 R: TTGACGAAGTGGTCGTTGAG SOD1 F: GAGACCTGGGCAATGTGACT 189 NM_001190422.1 R:CCAAACGACTTCCAGCATTT Catalase F:CAGCTTTAGTGCTCCCGAAC 180 NM_214301.2 R:AGATGACCCGCAATGTTCTC Caspase3 F:GCCATGGTGAAGAAGGAAAA 167 NM_214131.1 R:GTCCGTCTCAATCCCACAGT Bcl2 F: AGGGCATTCAGTGACCTGAC 193 NM_214285 R: CGATCCGACTCACCAATAACC

real-time PCR primer sequences

9. establish PKD2 single knockout (monoallelic KO) cells

ET was performed on four PKD2 gene KO cells. As a result, both recipients were confirmed to be pregnant. However, one of them aborted on the 49th day after ET. Therefore, seven embryos were obtained from the last one (fetus1 to fetus7, FIG. 2B). Fetus 1 and 6 had shorter transverse abdominal compared to the rest. In addition, PC2 expression levels were compared (Fig. 2B). Through deep sequencing, it was confirmed that biallelic KO occurred in fetus 6 and monoallelic KO occurred in fetus 1 and 7 ( FIG. 2C ). In this experiment, we were only interested in monoallelic inactivation of PKD2 pigs, so the mitochondrial membrane potential of fetus 1 was confirmed (Fig. 2D). Since JC-1 is a marker for mitochondrial membrane potential, mitochondrial disruption was measured through the intensity of JC-1. When the mitochondrial membrane potential is low, the JC-1 monomer emits green fluorescence. Therefore, in fetus 1, it was confirmed that the mitochondrial membrane potential was lower than that of the wild type mitochondrial membrane potential. This is because fetus 1 showed an increase in green fluorescence and a decrease in red fluorescence.

SCNT was performed using PKD2 fetus 1, and 1039 reconstructed embryos were ETed to 6 recipients. As a result, pregnancy was confirmed one month later for three of them, and two of them aborted on the 49th day after ET. Therefore, laparoscopic surgery was performed on one last animal and the placental and endometrial tissue status were examined.

Total Reads Insertions Deletions indel frequency WT 43896 71 182 253 (0.6%) Fetus 1 46013 14970 46 15016 (32.6%) Fetus 2 56949 6 0 6 (0.0%) Fetus 3 49229 98 239 337 (0.7%) Fetus 4 47181 29 78 107 (0.2%) Fetus 5 55002 34 92 126 (0.2%) Fetus 6 51286 48320 173 48493 (94.6%) Fetus 7 49545 131 16986 17117 (34.5%)

founder cloned fetus analysis

cell type No. of embryos
cultured No. of embryos developed to (N, % Mean ± SEM) >= 2-cells Blastocyst wild type 100 77 75.3±4.3% 20 20.8 ± 3.1% PKD2 KO fetus 1 110 80 71.7± 1.8 % 24 20.2 ± 3.3%

In vitro development of re-cloned embryos using PKD2 knockout fetus 1 as donor cells

10. Gene expression analysis result

Fetal and placental status were also confirmed by laparoscopy. In all fetuses, polyhydramnios and abnomality were clearly confirmed in the placental tissue (FIG. 3A). It was confirmed that the PKD2 gene KO embryo showed a difference in gene expression when compared with the wild type. There was no significant difference between the expression of SOD1 in placenta and the expression of bcl-2 in the endometrium.

However, the expression levels of SOD1 and Caspase-3 in the endometrium were significantly higher in PKD2 gene KO fetus compared with the expression level of the wild type (P < 0.005, FIG. 3B). The expression level of catalase in placenta was significantly lower than that of the wild type (P < 0.001, FIG. 3B).

The expression level of PC2 was measured by Western blot. The expression level in placental tissue or endometria of pig and wild type knocked out PKD2 gene was compared and measured (FIG. 3C). The expression of PC2 in the placental tissue of re-cloned embryos in which the PKD2 gene was knocked out was significantly lower than that of the wild type.

<110> SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION <120> Pig Knocked Out of the PKD2 Gene and the uses thereof <130> CP19-212 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> modified Exon 2 of porcine PKD2 gene <400> 1 ccgaccggtg agagatacct taaa 24 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> modified Exon 2 of porcine PKD2 gene <400> 2 ccgaccgaga taccttaaa 19 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> target sequence of sgRNA1 <400> 3 tttaaggtat ctctcacggt cgg 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> target sequence of sgRNA2 <400> 4 cacttttaag gtatctctca cgg 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> target sequence of sgRNA3 <400> 5 gataccttaa aagtgtttta cgg 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> target sequence of sgRNA4 <400> 6 ataccttaaa agtgttttac ggg 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> target sequence of sgRNA5 <400> 7 gttcccgtaa aacactttta agg 23 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> sgRNA1 <400> 8 ccgaccguga gagauaccuu aaa 23 <210> 9 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> sgRNA2 <400> 9 ccgugagaga uaccuuaaaa gug 23 <210> 10 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> sgRNA3 <400> 10 ccguaaaaca cuuuuaaggu auc 23 <210> 11 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> sgRNA4 <400> 11 cccguaaaac acuuuuaagg uau 23 <210> 12 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> sgRNA5 <400> 12 ccuuaaaagu guuuuacggg aac 23

Claims (13)

As a pig in which the PKD2 gene is knocked out,
at least one cell in which the PKD2 gene is knocked out;
The cell in which the PKD2 gene is knocked out has a nucleotide sequence different from the nucleotide sequence of the PKD2 gene of a wild type cell, so that only one PKD2 gene among the two PKD2 genes is knocked out, resulting in monoallelic ( monoallelic),
A pig in which the PKD2 gene is knocked out has a PC2 expression level of less than twice that of a wild-type pig, or
The PKD2 gene knockout cell is characterized in that it has a lower mitochondrial membrane potential than the mitochondrial membrane potential of the wild-type cell,
Pigs with the PKD2 gene knocked out.
According to claim 1,
Cells in which the PKD2 gene is knocked out are
Characterized in that it has the same sequence of the exon 2 region as the deletion, insertion, substitution or inversion of one or more nucleotides in the nucleotide sequence of the exon 2 region of the wild-type PKD2 gene,
Pigs with the PKD2 gene knocked out.
3. The method of claim 2,
The nucleotide sequence of the exon 2 region of the PKD2 gene of the cell in which the PKD2 gene is knocked out is characterized in that it comprises SEQ ID NO: 1 or 2,
Pigs with the PKD2 gene knocked out.
4. The method according to any one of claims 1 to 3,
The PKD2 gene is knocked out cells, characterized in that the pig fibroblast (fibroblast),
Pigs with the PKD2 gene knocked out.
As a method for producing a pig in which the PKD2 gene is knocked out,
(i) preparing pig cells in which only one PKD2 gene was knocked out;
- At this time, the pig cells have a monoallelic,
(ii) developing pig cells in which only one PKD2 gene is knocked out above into a fetus under a specific environment;
- At this time, the specific environment
i) an environment having a concentration more than twice the concentration of Caspase-3 or Bcl-2 in the placenta or endometrium during development of wild-type pigs, or
ii) It is implanted in the uterus of a pig and developed into a fetus.
At this time, the placental environment has a concentration of not more than twice the concentration of SOD1 or Catalase in the placenta of wild-type pigs, or the endometrial environment has a concentration of SOD1 or Catalase more than twice the concentration of SOD1 or Catalase in the endometrium of wild-type pigs. having; and
(iii) inducing said fetus to become a living offspring;
At this time, the expression level of PC2 (Polycystin-2) of the live pig is characterized in that it has an expression level of 2 times or less than that of a wild-type pig,
A method for producing a pig in which the PKD2 gene is knocked out, comprising a.
6. The method of claim 5,
Preparing a cell in which only one PKD2 gene is knocked out is
(i) injecting the composition for genetic manipulation into wild-type pig cells;
- At this time, the composition for genetic manipulation
i) at least one Cas9 or a nucleotide sequence encoding said Cas9;
ii) comprising a sgRNA that complementarily binds to any one or more sequences of SEQ ID NOs: 3 to 7, which is a part of the nucleotide sequence of the PKD2 gene, or a nucleotide sequence encoding the sgRNA; and
(ii) induces the wild-type pig cells to become a cell in which only one PKD2 gene is knocked out
A method for producing a pig in which the PKD2 gene is knocked out, comprising a.
6. The method of claim 5,
Preparing a cell in which only one PKD2 gene is knocked out is
(i) injecting the composition for genetic manipulation into wild-type pig cells;
- At this time, the composition for genetic manipulation
i) at least one Cas9 or a nucleotide sequence encoding said Cas9;
ii) a sgRNA comprising any one or more sequences of SEQ ID NOs: 8 to 12 that are part of the nucleotide sequence of the PKD2 gene, or a nucleotide sequence encoding the sgRNA; and
(ii) induces the wild-type pig cells to become a cell in which only one PKD2 gene is knocked out
A method for producing a pig in which the PKD2 gene is knocked out, comprising a.
8. The method according to any one of claims 5 to 7,
The PKD2 gene is knocked out cell mitochondrial membrane potential (mitochondrial membrane potential) is characterized in that lower than the mitochondrial membrane potential of the wild-type cell,
A method for producing a pig in which the PKD2 gene is knocked out.
7. The method of claim 6,
The sgRNA is characterized in that it complementarily binds to SEQ ID NO: 3, which is a part of the nucleotide sequence of the PKD2 gene, or comprises SEQ ID NO: 8,
A method for producing a pig in which the PKD2 gene is knocked out.
8. The method according to any one of claims 5 to 7,
The PKD2 gene is knocked out cells, characterized in that the pig fibroblast (fibroblast),
A method for producing a pig in which the PKD2 gene is knocked out.
A composition for genetic manipulation, comprising:
The composition for genetic manipulation is
i) at least one Cas9 or a nucleotide sequence encoding said Cas9; and
ii) a sgRNA that complementarily binds to any one or more sequences of SEQ ID NOs: 3 to 7, which is a part of the nucleotide sequence of the pig PKD2 gene, or a nucleotide sequence encoding the sgRNA,
A composition for genetic manipulation.
12. The method of claim 11,
The nucleotide sequence encoding the Cas9 or sgRNA is characterized in that it is encoded in at least one vector,
A composition for genetic manipulation.
13. The method of claim 12,
The sgRNA is characterized in that it complementarily binds to SEQ ID NO: 3, which is a part of the nucleotide sequence of the PKD2 gene, or comprises at least one of SEQ ID NOs: 8 to 12
A composition for genetic manipulation.

Images