WO2024129459A1 - Réparation d'un dysfonctionnement de la barrière dans l'œsophage - Google Patents

Réparation d'un dysfonctionnement de la barrière dans l'œsophage Download PDF

Info

Publication number
WO2024129459A1
WO2024129459A1 PCT/US2023/082667 US2023082667W WO2024129459A1 WO 2024129459 A1 WO2024129459 A1 WO 2024129459A1 US 2023082667 W US2023082667 W US 2023082667W WO 2024129459 A1 WO2024129459 A1 WO 2024129459A1
Authority
WO
WIPO (PCT)
Prior art keywords
promoter
mrckα
vector
subject
nka
Prior art date
Application number
PCT/US2023/082667
Other languages
English (en)
Inventor
David Dean
Zhongren ZHOU
Original Assignee
University Of Rochester
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Rochester filed Critical University Of Rochester
Publication of WO2024129459A1 publication Critical patent/WO2024129459A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11001—Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0016—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the nucleic acid is delivered as a 'naked' nucleic acid, i.e. not combined with an entity such as a cationic lipid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes

Definitions

  • GERD gastroesophageal reflux disease
  • This disease is characterized by a broad spectrum of typical symptoms, such as heartburn and acid regurgitation, and extra-esophageal manifestations, such as asthma, chronic cough and laryngitis 1-3 .
  • Obesity has been considered to be a key risk factor of GERD.
  • PPIs proton pump inhibitors
  • the disclosure provides a method of treating a gastroesophageal reflux disease (GERD) in a subject in need thereof.
  • the method comprises expressing a Na+, K+ - ATPase (NKA) ⁇ 1 subunit or a myotonic dystrophy kinase-related Cdc42-binding kinases ⁇ (MRCK ⁇ ) or both in one or more cells in the esophagus of the subject.
  • the cells can be transitional basal cells, and suprabasal epithelial cells.
  • the disclosure provides a method of reducing the risk of developing esophageal cancer in a subject in need thereof.
  • the method comprises expressing a NKA ⁇ 1 subunit or a MRCK ⁇ or both in one or more cells in the esophagus of the subject.
  • the disclosure provides a method of increasing expression of a tight junction protein in the esophagus of a subject in need thereof.
  • the method comprises expressing a NKA ⁇ 1 subunit or a MRCK ⁇ or both in one or more cells in the esophagus of the subject.
  • the expressing step comprises administering to the subject a genetic construct comprising a nucleic acid sequence encoding the NKA ⁇ 1 subunit or the MRCK ⁇ or both.
  • the genetic construct further comprises a regulatory sequence that is operatively linked to the nucleic acid sequence.
  • the regulatory sequence comprises a promoter or an enhancer.
  • the promoter is one selected from the group consisting of a CMV promoter, a ubiquitin (Ubc) promoter, a CAG promoter, an EF1a promoter, a SV40 early promoter, and a PGK promoter.
  • the promoter is an inducible promoter.
  • the inducible UR 6-23001 /FR Ref.: 161118.04201 promoter is a tetracycline (doxycycline)-controlled inducible protomer or a tamoxifen- inducible promoter.
  • the promoter or enhancer is selective or specific for an esophagus cell.
  • the genetic construct is administered by electroporation or in a liposome. In one embodiment, the genetic construct is administered in an expression vector.
  • the expression vector is a viral vector, plasmid vector, or bacterial vector. Examples of the viral vector include one selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a vaccinia vector.
  • the subject is mammal. In one embodiment, the subject is a human.
  • FIG. 1 is a set of photographs showing that gene transfer of the Na+,K+-ATPase ⁇ 1 subunit (“ ⁇ 1”) to the rat esophagus upregulated tight junction proteins.
  • FIG.2 is a set of photographs showing that dilated intercellular space (DIS) formation was unaffected by electroporation in the rabbit GERD model.
  • Total cardiomyectomy was carried out with or without simultaneous electroporation of pUbC-GFP and evaluated by TEM at 12 weeks. Yellow arrows show uniform tight junctions and barriers between cells in naive animals.
  • FIG. 3 is a set of photographs showing gene transfer of the ⁇ 1 subunit of the Na,K- ATPase prevented formation of DIS in the rabbit GERD model.
  • Total cardiomyectomy was carried out with simultaneous electroporation of pUbC-GFP or pUbC- ⁇ 1 and evaluated by TEM at 12 weeks. Na ⁇ ve animals (no cardiomyectomy) are also shown for comparison.
  • DIS is indicated by the “bubbly” looking white area between cells which is present in animals receiving the GFP plasmid but lacking in those receiving the ⁇ 1 plasmid.
  • NKA ⁇ 1, MRCK ⁇ , or other components of the signaling pathway can be used as therapeutic for treating GERD, including refractory GERD, and for preventing related disorders or conditions such as BE and cancer, including EAC.
  • Esophageal Epithelium Barrier Functions and GERD Gastroesophageal reflux disease (GERD) is a chronic disorder caused by prolonged exposure of the distal esophagus to gastric or gastroduodenal content.
  • the barrier function of the esophageal epithelium is a major defense against gastroesophageal reflux disease.
  • Dilated intercellular space (DIS) is a special pathological feature of the esophageal squamous epithelium in individuals with GERD, especially in the early stages, that is associated with increased space between cells and decreased barrier function of the epithelium 15 .
  • stomach acid and bile acids regurgitate into the distal esophagus and cause DIS formation and loss of barrier function through epithelial injury and disruption of tight and adherent junctions in the human esophagus as well as in animal models of the disease1 6-18 .
  • claudin-1 and -4 are significantly decreased in GERD patients while the leak protein claudin-2 is increased in GERD patients 19,20 .
  • bile acids and other reflux constituents continually bathe the cells and decrease the intercellular pH, resulting in cell injury, inflammation, and in turn, tissue repair.
  • Basal progenitor cells underly the squamous epithelium and the adjacent metaplastic and transitional epithelium, and it is believed that these cells, in response to continual exposure to bile acids and reflux constituents, generate BE and lead to EAC. It was recently identified by fate mapping in mouse models a distinct p63+ KRT5+ KRT7+ basal progenitor cell that is the origin for the metaplastic multi-layered epithelium and BE 21 .
  • the barrier-enhancing effect of the Na + , K + -ATPase is specific to the ⁇ 1 subunit and appears to be independent on the ion-transport activity. Targeting this pathway provides a new therapeutic strategy to treat GERD.
  • the Na + , K + -ATPase is a heterodimer of the catalytic ⁇ subunit and the noncatalytic ⁇ subunit, which facilitates the maturation and membrane targeting of the ⁇ subunit.
  • loss-of-function, chemical inhibition, and gain-of-function experiments it was revealed that a novel molecular pathway by which the NKA ⁇ 1 subunit binds and activates MRCK ⁇ , thereby phosphorylates non-muscle myosin II and increase tight junction expression.
  • MRCK ⁇ is a Serine/Threonine protein kinase.
  • ORF open reading frame
  • SEQ ID NO: 1 atgtctggagaagtgcgtttgaggcagttggagcagtttattttggacgggcccgctcagaccaatgggcagtgcttcagtgt ggagacattactggatatactcatctgcctttatgatgaatgcaataattctccattgagaagagagaacattctcgaat acctagaatgggctaaaccatttacttctaaagtgaacaaatgcgattacatagagaag
  • the results herein have identified new functions of this enzyme.
  • the data disclosed herein indicated a non-transport role of the NKA ⁇ 1 subunit in the regulation of tight junctions in esophagus.
  • This disclosure has enhanced the understanding of the Na + , K + -ATPase and MRCK ⁇ and is valuable in advancing related therapies to human clinical UR 6-23001 /FR Ref.: 161118.04201 trials. Accordingly, this disclosure provides agents and methods for improving or repairing integrity or function of an esophageal epithelial barrier.
  • the methods in general may comprise increasing a level of the NKA ⁇ 1 subunit or the MRCK ⁇ in one or more cells in the epithelial or endothelial barrier.
  • the disclosure provides compositions and method for treating or preventing related diseases.
  • the present disclosure provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with integrity or function of an epithelial or endothelial barrier in esophagus.
  • Another aspect of the disclosure pertains to methods of modulating NKA ⁇ 1 and/or MRCK ⁇ expression or activity for therapeutic purposes.
  • the modulatory method of the disclosure involves contacting a cell with an active agent or compound that modulates one or more of the activities of NKA ⁇ 1 and/or MRCK ⁇ activity associated with the cell.
  • an active compound that modulates NKA ⁇ 1 and/or MRCK ⁇ activity can be an agent as described herein.
  • the active agent can be NKA ⁇ 1 or MRCK ⁇ protein or polypeptide, or a nucleic acid molecule encoding NKA ⁇ 1 or MRCK ⁇ .
  • the active agent can be a nucleic acid or a protein, a naturally-occurring target molecule of an MRCK ⁇ protein (e.g., an MRCK ⁇ ligand or substrate).
  • the active agent can be agonist of MRCK ⁇ or NKA ⁇ 1, a peptidomimetic of an MRCK ⁇ or NKA ⁇ 1 agonist, or other small molecule.
  • the active compound stimulates one or more NKA ⁇ 1 and/or MRCK ⁇ activities.
  • modulatory methods can be performed in vitro (e.g., by culturing the cell with the active compound) or, alternatively, in vivo (e.g., by administering the active compound to a subject).
  • the present disclosure provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant or insufficient expression or activity of an NKA ⁇ 1 or MRCK ⁇ protein or nucleic acid molecule such as a GERD.
  • the method involves administering an active compound, or combination of active compounds that modulates (e.g., upregulates) NKA ⁇ 1 and/or MRCK ⁇ expression or activity.
  • the method involves administering a chimeric NKA ⁇ 1 and/or MRCK ⁇ protein or nucleic acid molecule as therapy to compensate for reduced, aberrant, or unwanted NKA ⁇ 1 and/or MRCK ⁇ expression or activity.
  • the present disclosure also provides for replacement of NKA ⁇ 1 and/or MRCK ⁇ , whether by gene transfer to express the normal allele or protein replacement with purified NKA ⁇ 1 and/or MRCK ⁇ or recombinant NKA ⁇ 1 and/or MRCK ⁇ or NKA ⁇ 1 and/or UR 6-23001 /FR Ref.: 161118.04201 MRCK ⁇ analogues, are beneficial for the treatment of, e.g., GERD.
  • the active agent e.g., the NKA ⁇ 1 and/or MRCK ⁇ gene or protein
  • Polypeptides the present disclosure provides a method of introducing NKA ⁇ 1 and/or MRCK ⁇ polypeptides into the cells.
  • the NKA ⁇ 1 is a human NKA ⁇ 1.
  • the human NKA ⁇ 1 has the amino acid sequence set out in SEQ ID NO: 3.
  • the term "NKA ⁇ 1" also includes variants of the protein of SEQ ID NO: 3, in which one or more amino acid residues have been changed, deleted, or inserted, and which has comparable biological activity as the not modified protein, such as those reported herein.
  • the MRCK ⁇ is a human MRCK ⁇ .
  • the human MRCK ⁇ has the amino acid sequence set out in SEQ ID NO: 2.
  • the term "MRCK ⁇ " also denotes variants of the protein of SEQ ID NO: 2, in which one or more amino acid residues have been changed, deleted, or inserted, and which has comparable biological activity as the not modified protein, such as those reported herein.
  • splice variants of MRCK ⁇ are known in the art and result in slightly different translated proteins. Some of them may have difference in about 50 of their amino acid residues but the remainder are the same while some other variants produce slightly smaller proteins. These variants may have the same activity as SEQ ID NO: 2. Examples of such variants include NM_001366011.1, NM_001366019.1, NM_003607.3, NM_001366010.1, XM_017002581.2, and XM_011544307.3.
  • the specific activity of MRCK ⁇ can be determined by various assays known in the art or described herein.
  • Amino acid sequence variants of NKA ⁇ 1 or MRCK ⁇ can be prepared by introducing appropriate modifications into the nucleotide sequence encoding the NKA ⁇ 1 or MRCK ⁇ , or by peptide synthesis. Such modifications include, for example, deletions from, and/or insertions into, and/or substitutions of residues within the amino acid sequences of the NKA ⁇ 1 or MRCK ⁇ . Any combination of deletion, insertion, and substitution can be made to arrive at the final construct, provided that the final construct possesses comparable biological activity to the human NKA ⁇ 1 or MRCK ⁇ .
  • the term "conservative sequence modifications” refers to amino acid modifications that do not significantly affect or alter the activity of the NKA ⁇ 1 or MRCK ⁇ .
  • Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. Amino acid substitutions can be made, in some cases, by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, (b) the charge or hydrophobicity of the molecule at the target sit; or (c) the bulk of the side chain.
  • residues can be divided into groups based on side-chain properties; (1) hydrophobic amino acids (norleucine, methionine, alanine, valine, leucine, and isoleucine); (2) neutral hydrophilic amino acids (cysteine, serine, threonine, asparagine, and glutamine,); (3) acidic amino acids (aspartic acid and glutamic acid); (4) basic amino acids (histidine, lysine, and arginine); (5) amino acids that influence chain orientation (glycine and proline); and (6) aromatic amino acids (tryptophan, tyrosine, and phenylalanine). Substitutions made within these groups can be considered conservative substitutions.
  • substitutions include, without limitation, substitution of valine for alanine, lysine for arginine, glutamine for asparagine, glutamic acid for aspartic acid, serine for cysteine, asparagine for glutamine, aspartic acid for glutamic acid, proline for glycine, arginine for histidine, leucine for isoleucine, isoleucine for leucine, arginine for lysine, leucine for methionine, leucine for phenylalanine, glycine for proline, threonine for serine, serine for threonine, tyrosine for tryptophan, phenylalanine for tyrosine, and/or leucine for valine.
  • substitutions are shown in the table below. Amino acid substitutions may be introduced into human NKA ⁇ 1 or MRCK ⁇ and the products screened for retention of the biological activity of human NKA ⁇ 1 or MRCK ⁇ .
  • "functional equivalent" of a polypeptide refers to a nucleic acid molecule that encodes a polypeptide that has a NKA ⁇ 1 or MRCK ⁇ activity or a polypeptide that has a NKA ⁇ 1 or MRCK ⁇ activity.
  • the functional equivalent may displays 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more activity compared to a parent sequence (e.g., SEQ ID NO: 2 or 3).
  • Functional equivalents may be artificial or naturally-occurring. For example, naturally-occurring variants of the sequence in a population fall within the scope of functional equivalent.
  • NKA ⁇ 1 or MRCK ⁇ sequences derived from other species also fall within the scope of the term "functional equivalent", e.g., a murine NKA ⁇ 1 or MRCK ⁇ sequence.
  • the functional equivalent is a nucleic acid with a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to the parent sequence.
  • the functional equivalent is a polypeptide with an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% identity to a parent sequence.
  • sequence identity should be calculated along the entire length of the nucleic acid.
  • Functional equivalents may contain one or more, e.g.
  • nucleotide insertions, deletions and/or substitutions when compared to a parent sequence.
  • the term "functional equivalent” also encompasses nucleic acid sequences that encode a NKA ⁇ 1 or MRCK ⁇ polypeptide with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% sequence identity to the parent amino acid sequence, but that show little homology to the parent nucleic acid sequence because of the degeneracy of the genetic code.
  • active fragment refers to a nucleic acid molecule that encodes a polypeptide that has an activity of a parent polypeptide (e.g., MRCK ⁇ kinase activity) or polypeptide that has the activity, but which is a fragment of the nucleic acid as set forth in the parent polynucleotide sequence or the amino acid sequence as set forth in the UR 6-23001 /FR Ref.: 161118.04201 parent polypeptide sequence.
  • An active fragment may be of any size provided that the activity is retained or it has the active domain.
  • a fragment will have at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 100% identity to the parent sequence along the length of the alignment between the shorter fragment and longer parent sequence.
  • Fusion proteins including these fragments can be comprised in the nucleic acid vectors needed to carry out the methods. For example, an additional 5, 10, 20, 30, 40, 50 or even 100 amino acid residues from the polypeptide sequence, or from a homologous sequence, may be included at either or both the C terminal and/or N terminus without prejudicing the ability of the polypeptide fragment to fold correctly and exhibit biological activity.
  • Sequence identity may be calculated by any one of the various methods in the art, including for example BLAST (Altschul S F, Gish W, Miller W, Myers E W, Lipman D J (1990). "Basic local alignment search tool”. J Mol Biol 215 (3): 403-410) and PASTA (Lipman, D J; Pearson, W R (1985). "Rapid and sensitive protein similarity searches”. Science 227 (4693): 1435-41; http://fasta.bioch.virginia.edu/fasta www2/fasta list2.shtml) and variations on these alignment programs.
  • the polypeptides described in this application can be prepared by conventional methods known in the art.
  • a NKA ⁇ 1 or MRCK ⁇ polypeptide described herein can be delivered into cells of interest via protein transfection or transduction.
  • the polypeptide can be obtained as a recombinant polypeptide.
  • a nucleic acid encoding it can be linked to another nucleic acid encoding a fusion partner, e.g., glutathione- s-transferase (GST), 6x-His epitope tag, or M13 Gene 3 protein.
  • GST glutathione- s-transferase
  • 6x-His epitope tag or M13 Gene 3 protein.
  • the resultant fusion nucleic acid expresses in suitable host cells a fusion protein that can be isolated by methods known in the art.
  • the isolated fusion protein can be further treated, e.g., by enzymatic digestion, to remove the fusion partner and obtain the recombinant polypeptide of this disclosure.
  • the peptides/polypeptides/proteins of the disclosure can be chemically synthesized (see e.g., Creighton, “Proteins: Structures and Molecular Principles,” W.H. Freeman & Co., NY, 1983).
  • skilled artisans may consult Ausubel et al. (Current Protocols in Molecular Biology and Short Protocols in Molecular Biology, 3rd Ed. 2002 & 2002), Sambrook et al.
  • NKA ⁇ 1 or MRCK ⁇ polypeptide can be associated with, e.g., conjugated or fused to, one or more of an amino acid sequence comprising a cell-penetrating peptide (CPP) sequence, and the like.
  • CPP cell-penetrating peptide
  • the NKA ⁇ 1 or MRCK ⁇ polypeptide may be delivered by itself or as a fusion with one or more of a CPP and/or other domains. See, e.g., Tachikawa et al. PNAS (2004) vol.101, no.42:15225-15230, US 20090156503.
  • a cell-penetrating peptide generally consists of less than 30 amino acids and has a net positive charge. CPPs internalize in living animal cells in vitro and in vivo in an endocytotic or receptor/energy- independent manner. There are several classes of CPPs with various origins, from totally protein-derived CPPs via chimeric CPPs to completely synthetic CPPs. Examples of CPPs are known in the art.
  • a cell-penetrating molecule may comprise a phosphorothioate nucleic acid. It is known in the art that phosphorothioate nucleic acids can enhance the intracellular delivery of both proteins and nucleic acids.
  • phosphorothioate nucleic acid refers to a nucleic acid in which one or more internucleotide linkages are through a phosphorothioate moiety (thiophosphate).
  • the phosphorothioate moiety may be a monothiophosphate (—P(O)3(S) 3 ⁇ —) or a dithiophosphate (—P(O) 2 (S) 2 3 ⁇ —).
  • the phosphorothioate nucleic acid can be a monothiophosphate nucleic acid.
  • one or more of the nucleosides of a phosphorothioate nucleic acid can be linked through a phosphorothioate moiety (e.g., monothiophosphate), and the remaining nucleosides can be linked through a phosphodiester moiety (—P(O)4 3 ⁇ —).
  • one or more of the nucleosides of a phosphorothioate nucleic acid can be linked through a phosphorothioate moiety (e.g., monothiophosphate), and the remaining nucleosides can be linked through a methylphosphonate linkage.
  • all the nucleosides of a phosphorothioate nucleic acid can be linked through a phosphorothioate moiety (e.g., a monothiophosphate).
  • Phosphorothioate oligonucleotides are typically from about 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 40, 50 or more nucleotides in length, up to about 100 nucleotides in length. Phosphorothioate nucleic acids may also be longer in lengths, e.g., UR 6-23001 /FR Ref.: 161118.04201 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10,000, etc. As described above, in certain embodiments, the phosphorothioate nucleic acids herein contain one or more phosphodiester bonds.
  • the phosphorothioate nucleic acids can include alternate backbones (e.g., mimics or analogs of phosphodiesters as known in the art, such as boranophosphate, methylphosphonate, phosphoramidate, or O-methylphosphoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press).
  • alternate backbones e.g., mimics or analogs of phosphodiesters as known in the art, such as boranophosphate, methylphosphonate, phosphoramidate, or O-methylphosphoroamidite linkages (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press).
  • the phosphorothioate nucleic acids may also include one or more nucleic acid analog monomers known in the art, such as peptide nucleic acid monomer or polymer, locked nucleic acid monomer or polymer, morpholino monomer or polymer, glycol nucleic acid monomer or polymer, or threose nucleic acid monomer or polymer.
  • nucleic acid analog monomers known in the art, such as peptide nucleic acid monomer or polymer, locked nucleic acid monomer or polymer, morpholino monomer or polymer, glycol nucleic acid monomer or polymer, or threose nucleic acid monomer or polymer.
  • Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, Carbohydrate Modifications in
  • NKA ⁇ 1 or MRCK ⁇ proteins can be used in the methods and applications disclosed herein.
  • the term “NKA ⁇ 1” or “MRCK ⁇ ” also covers chemically modified NKA ⁇ 1 or MRCK ⁇ .
  • Examples of chemically modified NKA ⁇ 1 or MRCK ⁇ include NKA ⁇ 1 or MRCK ⁇ subjected to a conformational change, addition or deletion of one or more post-translation modifications and NKA ⁇ 1 or MRCK ⁇ to which a compound such as a phosphorothioate nucleic acids or a polyethylene glycol has been bound.
  • NKA ⁇ 1 or MRCK ⁇ can be included in a pharmaceutical composition.
  • Recombinant NKA ⁇ 1 or MRCK ⁇ protein may be prepared via expression in eukaryotic cells, for example in CHO cells, BHK cells, or HeLa cells by recombinant DNA technology or by endogenous gene activation, i.e., the NKA ⁇ 1 or MRCK ⁇ protein is expressed by endogenous gene activation, see, for example, U.S. Pat. No. 5,733,761, U.S. Pat. No. 5,641,670, U.S. Pat. No.
  • one aspect of this disclosure includes a method of improving integrity or function of an esophageal epithelial barrier, comprising increasing a level of UR 6-23001 /FR Ref.: 161118.04201 NKA ⁇ 1 and/or MRCK ⁇ in one or more cells in the epithelial barrier.
  • aspects of the disclosure include methods of treating a disease or condition associated with compromised function of an esophageal epithelial barrier comprising increasing a level of NKA ⁇ 1 and/or MRCK ⁇ in one or more cells in the epithelial or endothelial barrier of a subject in need thereof.
  • methods are provided for supplying NKA ⁇ 1 and/or MRCK ⁇ function to cells of the esophagus, such as basal cells, epithelial cells, and endothelial cells, by gene therapy.
  • the NKA ⁇ 1 and/or MRCK ⁇ genes, a modified NKA ⁇ 1 and/or MRCK ⁇ gene, or a part of the gene may be introduced into the cell in a vector such that the gene remains extrachromosomal or may be integrated into the subjects chromosomal DNA for expression.
  • These methods provide for administering to a subject in need of such treatment a therapeutically effective amount of an NKA ⁇ 1 and/or MRCK ⁇ gene, or pharmaceutically acceptable composition thereof, for overexpressing the NKA ⁇ 1 and/or MRCK ⁇ gene.
  • the MRCK ⁇ or NKA ⁇ 1 gene or a part of the gene may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the subject's target cells.
  • the genes may be introduced into the cell such that the gene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location.
  • the cells may also be transformed where the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication.
  • the gene may be introduced into an appropriate vector for extrachromosomal maintenance or for integration into the host. Vectors for introduction of genes both for recombination and for extrachromosomal maintenance are known in the art, and any suitable vector may be used.
  • the gene of the present disclosure as described herein is a polynucleotide or nucleic acid which may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence of MRCK ⁇ polynucleotide which encodes the mature polypeptide identified by SEQ ID NO: 2 may be identical or different from SEQ ID NO: 1.
  • the coding sequence of NKA ⁇ 1 polynucleotide which encodes the mature polypeptide identified by SEQ ID NO: 3 may be identical or different from SEQ ID NO: 4 or 5.
  • said coding sequence encodes the same mature polypeptide.
  • the polynucleotide or nucleic acid which encodes for the mature MRCK ⁇ or NKA ⁇ 1 polypeptide may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • the polynucleotide or nucleic acid compositions or molecules of this disclosure can include RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified or may contain non- natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art.
  • Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.).
  • uncharged linkages e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.
  • charged linkages e.g., phosphorothioates, phosphorodithioates, etc.
  • pendent moieties e.
  • NKA ⁇ 1 and/or MRCK ⁇ transgenes can be carried out by injection of transgenes directly into a specific tissue, such as direct injection of naked DNA or of DNA-cationic liposome complexes, or to ex vivo transfection of host cells, with subsequent reinfusion. Multiple approaches for introducing functional new genetic material into cells, both in vitro and in vivo are known.
  • lipid carriers may be used to transfect the esophagus cells of the host.
  • the polynucleotides or nucleic acids described above may be produced by replication in a suitable host cell. Natural or synthetic polynucleotide fragments coding for a desired fragment can be incorporated into recombinant polynucleotide constructs, usually DNA constructs, capable of introduction into and replication in a prokaryotic or eukaryotic cell.
  • polynucleotide constructs can be suitable for replication in a unicellular host, such as yeast or bacteria, but may also be intended for introduction to (with and without integration within the genome) cultured mammalian or plant or other eukaryotic cell lines.
  • the polynucleotides or nucleic acids may also be produced by chemical synthesis and may be performed on commercial, automated oligonucleotide synthesizers.
  • a double- stranded fragment may be obtained from the single-stranded product of chemical synthesis either by synthesizing the complementary strand and annealing the strands together under appropriate conditions or by adding the complementary strand using DNA polymerase with an appropriate primer sequence.
  • Polynucleotide or nucleic acid constructs prepared for introduction into a prokaryotic or eukaryotic host may comprise a replication system recognized by the host, including the intended polynucleotide fragment encoding the desired polypeptide, and will preferably also include transcription and translational initiation regulatory sequences operably linked to the polypeptide encoding segment.
  • Expression vectors may include, for example, an origin of replication or autonomously replicating sequence (ARS) and expression control sequences, a promoter, an enhancer and necessary processing information sites, such as ribosome-binding sites, RNA splice sites, polyadenylation sites, transcriptional terminator sequences, and mRNA stabilizing sequences.
  • ARS autonomously replicating sequence
  • Such vectors may be prepared by means of standard recombinant techniques well known in the art.
  • An appropriate promoter and other necessary vector sequences can be selected so as to be functional in the host, and may include, when appropriate, those naturally associated with NKA ⁇ 1 and/or MRCK ⁇ genes.
  • Many useful vectors are known in the art and may be obtained from such vendors as STRATAGENE, NEW ENGLAND BIOLABS, PROMEGA BIOTECH, and others. Promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters may be used in prokaryotic hosts.
  • Useful yeast promoters include promoter regions for metallothionein, 3-phosphoglycerate kinase or other glycolytic enzymes such as enolase or glyceraldehyde-3-phosphate dehydrogenase, enzymes responsible for maltose and galactose utilization, and others.
  • Appropriate non-native UR 6-23001 /FR Ref.: 161118.04201 mammalian promoters might include the early and late promoters from SV40 or promoters derived from murine Moloney leukemia virus, mouse tumor virus, avian sarcoma viruses, adenovirus II, bovine papilloma virus or polyoma.
  • the construct may be joined to an amplifiable gene so that multiple copies of the gene may be made.
  • the nucleic acid construct can include at least one promoter selected from the group consisting of RNA polymerase III, RNA polymerase II, CMV promoter and enhancer, SV40 promoter, an HBV promoter, an HCV promoter, an HSV promoter, an HPV promoter, an EBV promoter, an HTLV promoter, an HIV promoter, and cdc25C promoter, a cyclin a promoter, a cdc2 promoter, a bmyb promoter, a DHFR promoter and an E2F-1 promoter.
  • a method is provided of supplying MRCK ⁇ or NKA ⁇ 1 function to cells of the esophagus, such as basal cells and epithelial cells, by MRCK ⁇ or NKA ⁇ 1 gene therapy.
  • the MRCK ⁇ or NKA ⁇ 1 gene, a modified MRCK ⁇ or NKA ⁇ 1 gene, or a part of the gene may be introduced into the cell in a vector such that the gene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location.
  • an esophagus disease or condition such as GERD, BE, and EAC
  • a method of treating or preventing an esophagus disease or condition comprising the administration to a patient in need of such treatment a therapeutically effective amount of a nucleic acid encoding NKA ⁇ 1 and/or MRCK ⁇ , or pharmaceutically acceptable composition thereof.
  • aspects of the methods include administering to the subject a first nucleic acid alone or in a vector including a coding sequence for NKA ⁇ 1 subunit and/or a second nucleic alone or in a vector encoding an MRCK ⁇ polypeptide.
  • the first nucleic acid may include both coding sequences.
  • Gene therapy methods that utilize the nucleic acid are also provided.
  • Embodiments of the disclosure include compositions, e.g., nucleic acid alone or in vectors and kits, etc., that find use in the methods.
  • the methods may lead to increase the expression of NKA ⁇ 1 and/or MRCK ⁇ gene when administered to subjects (e.g., mammals).
  • Administration of the vectors to the subject may ameliorate one or more symptoms or markers of the disease or condition.
  • Vectors As disclosed herein, one aspect of the disclosure is a nucleic acid in a vector.
  • the vector is a nucleic acid vector comprising a coding sequence for NKA ⁇ 1.
  • the nucleic acid vector comprises a coding sequence for one or more NKA ⁇ 1 and/or MRCK ⁇ .
  • the vector comprises a coding sequence for NKA ⁇ 1 and/or MRCK ⁇ suitable for use in gene therapy.
  • Gene therapy vectors of interest include any kind of particle that comprises a polynucleotide fragment encoding the NKA ⁇ 1 and/or MRCK ⁇ protein, operably linked to a regulatory element such as a promoter, which allows the expression of a functional NKA ⁇ 1 and/or MRCK ⁇ protein demonstrating its activity in the targeted cells.
  • NKA ⁇ 1 is encoded by the nucleic acid sequence as set forth in SEQ ID NO: 4 or 5, or is an active fragment or functional equivalent of NKA ⁇ 1.
  • MRCK ⁇ is encoded by the nucleic acid sequence as set forth in SEQ ID NO: 1 or is an active fragment or functional equivalent of MRCK ⁇ .
  • the vector include a regulatory sequence which is a constitutive promoter such as the cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • the NKA ⁇ 1 and/or MRCK ⁇ sequence used in the gene therapy vector may be derived from the same species as the subject. Any convenient NKA ⁇ 1 and/or MRCK ⁇ sequences, or fragments or functional equivalents thereof, may be utilized in the subject vectors, including sequences from any convenient animal, such as a primate, ungulate, cat, dog, or other domestic pet or domesticated mammal, rabbit, pig, horse, sheep, cow, or a human.
  • gene therapy in humans may be carried out using the human NKA ⁇ 1 and/or MRCK ⁇ sequence.
  • nucleic acid molecules encoding NKA ⁇ 1 and/or MRCK ⁇ and their analogs can be used for (i) improving integrity or function of an epithelial or endothelial barrier or (ii) treatment of disorders related to barrier dysfunction.
  • the analogs can include NKA ⁇ 1 /or MRCK ⁇ isoforms, mimetics, fragments, hybrid proteins, fusion proteins oligomers and multimers of the above, homologues of the above, regardless of the method of synthesis or manufacture thereof including but not limited to, recombinant vector expression whether produced from cDNA or genomic DNA, synthetic, transgenic, and gene activated methods.
  • UR 6-23001 /FR Ref.: 161118.04201 Viral Vectors Any convenient viruses may be utilized in delivering the vector of interest to the subject. Viruses of interest include, but are not limited to a retrovirus, an adenovirus, an adeno-associated virus (AAV), a herpes simplex virus and a lentivirus. Viral gene therapy vectors are well known in the art, see e.g., Heilbronn & Weger (2010) Handb Exp Pharmacal. 197:143-70.
  • Vectors of interest include integrative and non-integrative vectors such as those based on retroviruses, adenoviruses (AdV), adeno-associated viruses (AAV), lentiviruses, pox viruses, alphaviruses, and herpes viruses.
  • non-integrative viral vectors such as AAV
  • non-integrative vectors do not cause any permanent genetic modification.
  • the vectors may be targeted to adult tissues to avoid having the subjects under the effect of constitutive expression from early stages of development.
  • non-integrative vectors effectively incorporate a safety mechanism to avoid over-proliferation of NKA ⁇ 1 and/or MRCK ⁇ expressing cells.
  • Non-integrative vectors of interest include those based on adenoviruses (AdV) such as gutless adenoviruses, adeno-associated viruses (AAV), integrase deficient lentiviruses, pox viruses, alphaviruses, and herpes viruses.
  • AdV adenoviruses
  • AAV adeno-associated viruses
  • the non-integrative vector used is an adeno-associated virus-based non-integrative vector, similar to natural adeno- associated virus particles.
  • adeno-associated virus-based non integrative vectors include vectors based on any AAV serotype, i.e., AAVI, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVIO, AAVII and pseudotyped AAV.
  • Vectors of interest include those capable of transducing a broad range of tissues at high efficiency, with poor immunogenicity and an excellent safety profile. In some cases, the vectors transduce post- mitotic cells and can sustain long-term gene expression (up to several years) both in small and large animal models of the related disorders.
  • Exogenous genetic material e.g., a nucleic acid or a vector encoding one or more therapeutic proteins
  • a target cells of interest in vivo by genetic transfer methods, such as transfection or transduction, to provide a genetically modified cell.
  • Various expression vectors i.e., vehicles for facilitating delivery of exogenous genetic material into a target cell
  • exogenous genetic material refers to a nucleic acid or an oligonucleotide, either natural or UR 6-23001 /FR Ref.: 161118.04201 synthetic, that is not naturally found in the cells; or if it is naturally found in the cells, it is not transcribed or expressed at biologically significant levels by the cells.
  • exogenous genetic material includes, for example, a non-naturally occurring nucleic acid that can be transcribed into a RNA.
  • transfection of cells refers to the acquisition by a cell of a protein or new genetic material by incorporation of added protein or nucleic acid (DNA, RNA, or a hybrid thereof).
  • transfection refers to the introducing of protein or nucleic acid into a cell using physical or chemical methods.
  • transfection techniques are known to those of ordinary skill in the art including: calcium phosphate nucleic acid co-precipitation, strontium phosphate nucleic acid co-precipitation, DEAE-dextran, electroporation, cationic liposome-mediated transfection, and tungsten particle-facilitated microparticle bombardment.
  • transduction of cells refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus.
  • a RNA virus i.e., a retrovirus
  • a transducing chimeric retrovirus for transferring a nucleic acid into a cell.
  • Exogenous genetic material contained within the retrovirus is incorporated into the genome of the transduced cell.
  • a cell that has been transduced with a chimeric DNA virus e.g., an adenovirus carrying a cDNA encoding a therapeutic agent
  • the exogenous genetic material includes a heterologous gene (coding for a therapeutic RNA or protein) together with a promoter to control transcription of the new gene.
  • the promoter characteristically has a specific nucleotide sequence necessary to initiate transcription.
  • the exogenous genetic material further includes additional sequences (i.e., enhancers) required to obtain the desired gene transcription activity.
  • enhancers i.e., an "enhancer” is simply any non-translated DNA sequence that works contiguous with the coding sequence (in cis) to change the basal transcription level dictated by the promoter.
  • the exogenous genetic material may introduced into the cell genome immediately downstream from the promoter so that the promoter and coding sequence are operatively linked so as to permit transcription of the coding sequence.
  • a retroviral expression vector may include an exogenous promoter element to control transcription of the inserted exogenous gene.
  • exogenous promoters include both constitutive and inducible promoters. Naturally-occurring constitutive promoters control the expression of essential cell functions.
  • a gene under the control of a constitutive promoter is expressed under UR 6-23001 /FR Ref.: 161118.04201 all conditions of cell growth.
  • Exemplary constitutive promoters include the promoters for the following genes that encode certain constitutive or "housekeeping" functions: hypoxanthine phosphoribosyl transferase (HPRT), dihydrofolate reductase (DHFR), adenosine deaminase, phosphoglycerol kinase (PGK), pyruvate kinase, phosphoglycerol mutase, the actin promoter, ubiquitin, elongation factor-1 and other constitutive promoters known to those of skill in the art.
  • HPRT hypoxanthine phosphoribosyl transferase
  • DHFR dihydrofolate reductase
  • PGK phosphoglycerol kinase
  • pyruvate kinase phosphogly
  • any of the above-referenced constitutive promoters can be used to control transcription of a heterologous gene insert. Genes that are under the control of inducible promoters are expressed only or to a greater degree, in the presence of an inducing agent, (e.g., transcription under control of the metallothionein promoter is greatly increased in presence of certain metal ions).
  • Inducible promoters include responsive elements (REs) which stimulate transcription when their inducing factors are bound.
  • REs responsive elements
  • Promoters containing a particular RE can be chosen in order to obtain an inducible response and in some cases, the RE itself may be attached to a different promoter, thereby conferring inducibility to the recombinant gene.
  • the gene encoding the therapeutic agent is under the control of an inducible promoter
  • delivery of the therapeutic agent in situ is triggered by exposing the genetically modified cell in situ to conditions for permitting transcription of the therapeutic agent, e.g., by injection of specific inducers of the inducible promoters which control transcription of the agent.
  • in situ expression by genetically modified cells of a therapeutic agent encoded by a gene under the control of the metallothionein promoter is enhanced by contacting the genetically modified cells with a solution containing the appropriate (i.e., inducing) metal ions in situ.
  • the amount of therapeutic agent that is delivered in situ is regulated by controlling such factors as: (1) the nature of the promoter used to direct transcription of the inserted gene, (i.e., whether the promoter is constitutive or inducible, strong or weak); (2) the number of copies of the exogenous gene that are inserted into the cell; (3) the number of transduced/transfected cells that are administered (e.g., implanted) to the patient; (4) the size of the implant (e.g., graft or encapsulated expression system); (5) the number of implants; (6) UR 6-23001 /FR Ref.: 161118.04201 the length of time the transduced/transfected cells or implants are left in place; and (7) the production rate of the therapeutic agent by the genetically modified cell.
  • factors as: (1) the nature of the promoter used to direct transcription of the inserted gene, (i.e., whether the promoter is constitutive or inducible, strong or weak); (2) the number of copies of the exogenous gene that are inserted into the
  • the expression vector may include a selection gene, for example, a neomycin resistance gene, for facilitating selection of cells that have been transfected or transduced with the expression vector.
  • the cells are transfected with two or more expression vectors, at least one vector containing the gene(s) encoding the therapeutic agent(s), the other vector containing a selection gene.
  • an expression vector the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art.
  • the expression vector can be transferred into a host cell by physical, chemical, or biological means. Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art.
  • Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors.
  • Viral vectors, and especially retroviral vectors have become the most widely used method for inserting genes into mammalian, e.g., human cells.
  • Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
  • Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
  • UR 6-23001 /FR Ref.: 161118.04201 Addition of DNA binding proteins such as Transcription Factor A Mitochondria (TFAM) can be used to condense DNA and shield charge.
  • TFAM Transcription Factor A Mitochondria
  • DNA:Protein (DNP) complexes can then be delivered to cells by cell penetrating peptides, PEG derivative, liposomes or electroporation.
  • DNA binding proteins can encode nuclear localization signals to actively transport of DNPs from the cytoplasm to the nucleus where the vectors are transcribed.
  • an exemplary delivery vehicle is a liposome.
  • lipid formulations is contemplated for the introduction of the nucleic acids into a host cell (in vitro, ex vivo or in vivo).
  • the nucleic acid may be associated with a lipid.
  • the nucleic acid associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid.
  • Lipid, lipid/DNA or lipid/expression vector associated compositions are not limited to any particular structure in solution.
  • Lipids are fatty substances which may be naturally occurring or synthetic lipids.
  • lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.
  • Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St.
  • Liposome is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates.
  • Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an UR 6-23001 /FR Ref.: 161118.04201 inner aqueous medium.
  • Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed.
  • the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules.
  • lipofectamine-nucleic acid complexes are also contemplated.
  • the nucleic acid molecules described herein can be administered via electroporation, such as by a method described in U.S. Patent No. 7,664,545, the contents of which are incorporated herein by reference.
  • the electroporation can be by a method and/or apparatus described in U.S. Patent Nos.
  • the electroporation may be carried out via a minimally invasive device.
  • the minimally invasive electroporation device (“MID”) may be an apparatus for injecting the composition described above and associated fluid into body tissue.
  • the device may comprise a hollow needle, DNA cassette, and fluid delivery means, wherein the device is adapted to actuate the fluid delivery means in use so as to concurrently (for example, automatically) inject DNA into body tissue during insertion of the needle into the said body tissue.
  • This has the advantage that the ability to inject the DNA and associated fluid gradually while the needle is being inserted leads to a more even distribution of the fluid through the body tissue. The pain experienced during injection may be reduced due to the distribution of the DNA being injected over a larger area.
  • the MID may inject the composition into tissue without the use of a needle.
  • the MID may inject the composition as a small stream or jet with such force that the composition pierces the surface of the tissue and enters the underlying tissue and/or muscle.
  • the force behind the small stream or jet may be provided by expansion of a compressed gas, such as carbon dioxide through a micro-orifice within a fraction of a second.
  • a compressed gas such as carbon dioxide
  • Examples of minimally invasive electroporation devices, and methods of using them, are described in published U.S. Patent Application No.20080234655; U.S. Patent No.6,520,950; U.S. Patent No.7, 171,264; U.S. Patent No. 6,208,893; U.S. Patent NO. 6,009,347; U.S. Patent No. 6, 120,493; U.S. Patent No.7,245,963; U.S. Patent No.7,328,064; and U.S.
  • the MID may comprise an injector UR 6-23001 /FR Ref.: 161118.04201 that creates a high-speed jet of liquid that painlessly pierces the tissue.
  • Such needle-free injectors are commercially available. Examples of needle-free injectors that can be utilized herein include those described in U.S. Patent Nos. 3,805,783; 4,447,223; 5,505,697; and 4,342,310, the contents of each of which are herein incorporated by reference.
  • a needle-free injector may be used to propel a liquid that contains the composition to the surface and into the subject's mucosal or epithelium layers.
  • the MID may have needle electrodes that electroporate the tissue.
  • needles were disposed in a circular array, but have connectors and switching apparatus enabling a pulsing between opposing pairs of needle electrodes.
  • a pair of needle electrodes for delivering recombinant expression vectors to cells may be used.
  • Such a device and system is described in U.S. Patent No. 6,763,264, the contents of which are herein incorporated by reference.
  • a single needle device may be used that allows injection of the DNA and electroporation with a single needle resembling a normal injection needle and applies pulses of lower voltage than those delivered by presently used devices, thus reducing the electrical sensation experienced by the patient.
  • the MID may comprise one or more electrode arrays.
  • the arrays may comprise two or more needles of the same diameter or different diameters.
  • the needles may be evenly or unevenly spaced apart.
  • the needles may be between 0.005 inches and 0.03 inches, between 0.01 inches and 0.025 inches; or between 0.015 inches and 0.020 inches.
  • the needle may be UR 6-23001 /FR Ref.: 161118.04201 0.0175 inches in diameter.
  • the needles may be 0.5 mm, 1.0 mm, 1.5 mm, 2.0 mm, 2.5 mm, 3.0 mm, 3.5 mm, 4.0 mm, or more spaced apart.
  • the MID may consist of a pulse generator and a two or more-needle composition injectors that deliver the composition and electroporation pulses in a single step.
  • the pulse generator may allow for flexible programming of pulse and injection parameters via a flash card operated personal computer, as well as comprehensive recording and storage of electroporation and patient data.
  • the pulse generator may deliver a variety of volt pulses during short periods of time. For example, the pulse generator may deliver three 15 volt pulses of 100 ms in duration.
  • An example of such a MID is the ELGEN 1000 system, described in U.S. Patent No. 7,328,064, the contents of which are herein incorporated by reference.
  • the MID may be a CELLECTRA (INOVIO Pharmaceuticals) device and system, which is a modular electrode system, that facilitates the introduction of a macromolecule, such as a DNA, into cells of a selected tissue in a body.
  • the modular electrode system may comprise a plurality of needle electrodes; a hypodermic needle; an electrical connector that provides a conductive link from a programmable constant-current pulse controller to the plurality of needle electrodes; and a power source.
  • An operator can grasp the plurality of needle electrodes that are mounted on a support structure and firmly insert them into the selected tissue in a body.
  • the macromolecules are then delivered via the hypodermic needle into the selected tissue.
  • the programmable constant-current pulse controller is activated and constant-current electrical pulse is applied to the plurality of needle electrodes.
  • the applied constant-current electrical pulse facilitates the introduction of the macromolecule into the cell between the plurality of electrodes.
  • the Cellectra device and system is described in U.S. Patent No.7,245,963, the contents of which are herein incorporated by reference.
  • the MID may be an ELGEN 1000 system (INOVIO Pharmaceuticals).
  • the ELGEN 1000 system may comprise device that provides a hollow needle; and fluid delivery means, wherein the apparatus is adapted to actuate the fluid delivery means in use so as to concurrently (for example automatically) inject fluid, the described composition herein, into body tissue during insertion of the needle into the said body tissue.
  • the advantage is the ability to inject the fluid gradually while the needle is being inserted leads to a more even distribution of the fluid through the body tissue.
  • the automatic injection of fluid facilitates automatic monitoring and registration of an actual dose of fluid injected.
  • This data can be stored by a control unit for documentation purposes if desired.
  • the rate of injection could be either linear or non-linear and that the injection may be carried out after the needles have been inserted through the tissue of the subject to be treated and while they are inserted further into the body tissue.
  • the apparatus further comprises needle insertion means for guiding insertion of the needle into the body tissue. The rate of fluid injection is controlled by the rate of needle insertion.
  • both the needle insertion and injection of fluid can be controlled such that the rate of insertion can be matched to the rate of injection as desired. It also makes the apparatus easier for a user to operate. If desired means for automatically inserting the needle into body tissue could be provided. A user could choose when to commence injection of fluid. Ideally however, injection is commenced when the tip of the needle has reached muscle tissue and the apparatus may include means for sensing when the needle has been inserted to a sufficient depth for injection of the fluid to commence. This means that injection of fluid can be prompted to commence automatically when the needle has reached a desired depth (which will normally be the depth at which muscle tissue begins).
  • the depth at which tissue begins could for example be taken to be a preset needle insertion depth such as a value of 4 mm which would be deemed sufficient for the needle to get through the epithelia layer.
  • the sensing means may comprise an ultrasound probe.
  • the sensing means may comprise a means for sensing a change in impedance or resistance. In this case, the means may not as such record the depth of the needle in the body tissue but will rather be adapted to sense a change in impedance or resistance as the needle moves from a different type of body tissue into another. Either of these alternatives provides a relatively accurate and simple to operate means of sensing that injection may commence.
  • the depth of insertion of the needle can further be recorded if desired and could be used to control injection of fluid such that the volume of fluid to be injected is determined as the depth of needle insertion is being recorded.
  • the apparatus may further comprise: a base for supporting the needle; and a housing for receiving the base therein, wherein the base is moveable relative to the housing such that the needle is retracted within the housing when the base is in a first rearward position relative to the housing and the needle extends out of the housing when the base is in a second forward position within the housing.
  • the fluid delivery means may comprise piston driving means adapted to inject fluid at a controlled rate.
  • the piston driving means could for example be activated by a servo motor.
  • the piston driving means may be actuated by the base being moved in the axial direction relative to the housing. It will be appreciated that alternative means for fluid delivery could be provided.
  • a closed container which can be squeezed for fluid delivery at a controlled or non-controlled rate could be provided in the place of a syringe and piston system.
  • the apparatus described above could be used for any type of injection. It is however envisaged to be particularly useful in the field of electroporation and so it may further comprises means for applying a voltage to the needle. This allows the needle to be used not only for injection but also as an electrode during, electroporation. This is particularly advantageous as it means that the electric field is applied to the same area as the injected fluid.
  • compositions containing a therapeutically effective amount of NKA ⁇ 1 and/or MRCK ⁇ polypeptides, or nucleic acid sequences encoding NKA ⁇ 1 and/or MRCK ⁇ polypeptides, and a UR 6-23001 /FR Ref.: 161118.04201 pharmaceutically acceptable carrier.
  • the coding nucleic acid sequences are contained within an expression vector, such as plasmid DNA or virus.
  • the pharmaceutical composition can be adapted for administration to the esophagus or surround/adjacent areas by methods known in the art. Administration can be continuous or at distinct intervals as can be determined by a person skilled in the art.
  • the pharmaceutical compositions can be formulated according to known methods for preparing pharmaceutically useful compositions.
  • pharmaceutically acceptable carrier means any of standard pharmaceutically acceptable carriers.
  • the pharmaceutically acceptable carrier can include diluents, adjuvants, and vehicles, as well as implant carriers, and inert, non-toxic solid or liquid fillers, diluents, or encapsulating material that does not react with the active ingredients of the disclosure. Examples include, but are not limited to, phosphate buffered saline, physiological saline, water, and emulsions, such as oil/water emulsions.
  • the carrier can be a solvent or dispersing medium containing, for example, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • ethanol for example, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • polyol for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like
  • suitable mixtures thereof for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like
  • Formulations suitable for parenteral administration include, for example, aqueous sterile injection solutions, which may contain antioxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and nonaqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze dried (lyophilized) condition requiring only the condition of the sterile liquid carrier, for example, water for injections, prior to use.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powder, granules, tablets, etc.
  • the formulations described herein can include other agents conventional in the art having regard to the type of formulation in question.
  • the pharmaceutical compositions can be administered to a subject by any route that results in prevention or alleviation of symptoms associated with a disease or condition associated with compromised function of an epithelial or endothelial barrier.
  • UR 6-23001 /FR Ref.: 161118.04201 the polypeptides or nucleic acid molecules can be administered parenterally, intravenously (I.V.), intramuscularly (I.M.), subcutaneously (S.C.), intradermally (I.D.), orally, intranasally, etc.
  • intranasal administration can be by means of a spray, drops, powder or gel and also described in U.S. Pat. No. 6,489,306, US20180344816, US20060078558, US20080070858, US20180298057, and US20150313924, which are incorporated herein by reference in their entireties.
  • other means of drug administrations are well within the scope of the present disclosure.
  • the NKA ⁇ 1 and/or MRCK ⁇ polypeptide or encoding nucleic acid molecule can be administered and dosed in accordance with good medical practice, taking into account the clinical condition of the individual patient, the site and method of administration, scheduling of administration, patient age, sex, body weight, and other factors known to medical practitioners.
  • an effect amount of the polypeptide or encoding nucleic acid molecule is that amount necessary to provide a therapeutically effective amount of NKA ⁇ 1 and/or MRCK ⁇ , when expressed in vivo.
  • the amount of NKA ⁇ 1 and/or MRCK ⁇ or encoding nucleic acid molecule must be effective to achieve improvement including but not limited to total prevention and to improved survival rate or more rapid recovery, or improvement or elimination of symptoms associated with the related disorders and other indicators as are selected as appropriate measures by those skilled in the art.
  • a suitable single dose size is a dose that is capable of preventing or alleviating (reducing or eliminating) a symptom in a patient when administered one or more times over a suitable time period.
  • One of skill in the art can readily determine appropriate single dose sizes for systemic administration based on the size of a mammal and the route of administration.
  • Therapeutic Uses Pharmaceutical compositions according to the disclosure can be generally administered systemically.
  • the pharmaceutical compositions described herein may be administered orally, parenterally (e.g., via intravenous, subcutaneous, intracutaneous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional or intracranial injection), topically, mucosally (e.g., rectally or vaginally), nasally, buccally, ophthalmically, via inhalation spray (e.g., delivered via nebulzation, propellant or a dry powder device) or via an implanted reservoir.
  • parenterally e.g., via intravenous, subcutaneous, intracutaneous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional or intracranial injection
  • mucosally e.g., rectally or vaginally
  • nasally e.g., buccally, ophthalmically
  • inhalation spray e.g., delivered via ne
  • the method comprises expressing a NKA ⁇ 1 subunit or a MRCK ⁇ or both in one or more cells in the esophagus of the subject.
  • the disclosure provides a method of reducing the risk of developing esophageal cancer in a subject in need thereof.
  • the method comprises expressing a NKA ⁇ 1 subunit or a MRCK ⁇ or both in one or more cells in the esophagus of the subject.
  • the disclosure provides a method of increasing expression of a tight junction protein in the esophagus of a subject in need thereof.
  • the method comprises expressing a NKA ⁇ 1 subunit or a MRCK ⁇ or both in one or more cells in the esophagus of the subject.
  • the expressing step comprises administering to the subject a NKA ⁇ 1 or MRCK ⁇ polypeptide or protein, or a variant thereof. In some embodiments, the expressing step comprises administering to the subject a genetic construct comprising a nucleic acid sequence encoding the NKA ⁇ 1 subunit or the MRCK ⁇ or both. In one embodiment, the genetic construct further comprises a regulatory sequence that is operatively linked to the nucleic acid sequence. In one embodiment, the regulatory sequence comprises a promoter or an enhancer.
  • the promoter is one selected from the group consisting of a CMV promoter, a Ubc promoter, a CAG promoter, an EF1a promoter, a SV40 early promoter, and a PGK promoter.
  • the promoter is an inducible promoter.
  • the inducible promoter is a tetracycline (doxycycline)-controlled inducible protomer or a tamoxifen-inducible promoter.
  • the promoter or enhancer is selective or specific for an esophagus cell.
  • the genetic construct is administered by electroporation or in a liposome. In one embodiment, the genetic construct is administered in an expression vector.
  • the expression vector is a viral vector, plasmid vector, or bacterial vector.
  • the viral vector include one selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a vaccinia vector.
  • the subject is mammal. UR 6-23001 /FR Ref.: 161118.04201
  • the subject is a human.
  • the disclosure provides methods of treating or preventing GERD comprising administering an effective amount of a pharmaceutical composition comprising an active pharmaceutical agent disclosed herein to a subject in need thereof.
  • protein or gene transfer can be achieved by direct submucosal administration or injection for delivery of the protein or viral vectors into the locoregional area of the esophagus.
  • fibrin glues as a vehicle of recombinant viral evection in the manner described in Teraishi et al.
  • a fibrinogen solution and a thrombion solution containing an expression vector can be endoscopically sprayed on the esophagus through the catheter attached to the dual-barrel syringe.
  • an expression vector such as a recombinant adenovirus vector or an AAV vector
  • instillation or injection can be used.
  • protein or nucleic acid transfer can be achieved by using cationic liposomes.
  • the transfer can be done by either luminal instillation into a closed segment using a double balloon catheter, or by intramural injection through a needle. See, e.g., Schmid RM et al. Liposome mediated gene transfer into the rat oesophagus.
  • liposome mediated nucleic acid transfer UR 6-23001 /FR Ref.: 161118.04201 does not require cell replication.
  • nucleic acid introduced with a liposome complex generally remains episomal, the potential risk of insertional mutagenesis is small compared with DNA of retroviral origin.
  • the above-described therapeutic agents and compositions can be used for treating, protecting against, and/or preventing a disease or condition associated with dysfunction in epithelial or endothelial barrier in esophagus, such as GERD, BE, EAC, and esophageal squamous-cell carcinoma (SCC) in a subject in need thereof by administering one or more composition described herein to the subject.
  • a disease or condition associated with dysfunction in epithelial or endothelial barrier in esophagus such as GERD, BE, EAC, and esophageal squamous-cell carcinoma (SCC)
  • SCC esophageal squamous-cell carcinoma
  • the composition dose can be between 1 ⁇ g to 10 mg active component/kg body weight/time, and can be 20 ⁇ g to 10 mg component/kg body weight/time.
  • the composition can be administered every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 days.
  • the number of composition doses for effective treatment can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • the agent or composition can be administered prophylactically or therapeutically. In therapeutic applications, the agents or compositions are administered to a subject in need thereof in an amount sufficient to elicit a therapeutic effect.
  • Amounts effective for this use will depend on, e.g., the particular composition of the composition regimen administered, the manner of administration, the stage and severity of the disease, the general state of health of the subject, and the judgment of the prescribing physician.
  • the agent or composition can be administered by methods well known in the art as described in Donnelly et al. (Ann. Rev. Immunol. 15:617-648 (1997)), U.S. Pat. No. 5,580,859, U.S. Pat. No.5,703,055, and U.S. Pat. No.5,679,647, the contents of all of which are incorporated herein by reference in their entirety.
  • the nucleic acid (DNA or RNA) of the composition can be complexed to particles or beads that can be administered to an individual, for example.
  • a pharmaceutically acceptable carrier including a physiologically acceptable compound
  • the composition can be delivered via a variety of routes.
  • the composition can be incorporated into liposomes, microspheres or other polymer matrices (U.S. Pat. No.5,703,055; Gregoriadis, Liposome Technology, Vols. Ito III (2nd ed. UR 6-23001 /FR Ref.: 161118.04201 1993), the contents of which are incorporated herein by reference in their entirety).
  • the veterinarian can readily determine the dosing regimen and route of administration that is most appropriate for a particular animal.
  • the composition may be administered by traditional syringes, needleless injection devices, microprojectile bombardment gene guns, or other physical methods such as electroporation, hydrodynamic method, or ultrasound.
  • the polypeptide or nucleic acid molecule encoding the polypeptide may be delivered to the mammal by several well-known technologies including DNA injection with and without in vivo electroporation, liposome mediated, nanoparticle facilitated, recombinant vectors such as recombinant adenovirus, recombinant adenovirus associated virus and recombinant vaccinia.
  • the polypeptide or nucleic acid molecule encoding the polypeptide may be delivered via DNA injection and along with in vivo electroporation.
  • Electroporation Administration of the composition via electroporation may be accomplished using electroporation devices that can be configured to deliver to a desired tissue of a mammal a pulse of energy effective to cause reversible pores to form in cell membranes, and preferable the pulse of energy is a constant current similar to a preset current input by a user.
  • the electroporation device may comprise an electroporation component and an electrode assembly or handle assembly.
  • the electroporation component may include and incorporate one or more of the various elements of the electroporation devices, including: controller, current waveform generator, impedance tester, waveform logger, input element, status reporting element, communication port, memory component, power source, and power switch.
  • the electroporation may be accomplished using an in vivo electroporation device, for example CELLECTRA EP system or ELGEN electroporator to facilitate transfection of cells by the plasmid.
  • the electroporation component may function as one element of the electroporation devices, and the other elements are separate elements (or components) in communication with the electroporation component.
  • the electroporation component may function as more than one element of the electroporation devices, which may be in communication with still other elements of the electroporation devices separate from the electroporation component.
  • the elements of the electroporation devices existing as parts of one electromechanical or mechanical device may not limited as the elements can function as one device or as separate elements in communication with one another.
  • the electroporation component may be capable of delivering the pulse of energy that produces the constant current in the desired tissue, and includes a feedback mechanism.
  • the electrode assembly may include an electrode array having a plurality of electrodes in a spatial arrangement, wherein the electrode assembly receives the pulse of energy from the electroporation component and delivers same to the desired tissue through the electrodes.
  • At least one of the plurality of electrodes is neutral during delivery of the pulse of energy and measures impedance in the desired tissue and communicates the impedance to the electroporation component.
  • the feedback mechanism may receive the measured impedance and can adjust the pulse of energy delivered by the electroporation component to maintain the constant current.
  • a plurality of electrodes may deliver the pulse of energy in a decentralized pattern.
  • the plurality of electrodes may deliver the pulse of energy in the decentralized pattern through the control of the electrodes under a programmed sequence, and the programmed sequence is input by a user to the electroporation component.
  • the programmed sequence may comprise a plurality of pulses delivered in sequence, wherein each pulse of the plurality of pulses is delivered by at least two active electrodes with one neutral electrode that measures impedance, and wherein a subsequent pulse of the plurality of pulses is delivered by a different one of at least two active electrodes with one neutral electrode that measures impedance.
  • the feedback mechanism may be performed by either hardware or software.
  • the feedback mechanism may be performed by an analog closed-loop circuit. The feedback occurs every 50 ⁇ , 20 ⁇ , 10 or 1 ⁇ , but is preferably a real-time feedback or instantaneous (i.e., substantially instantaneous as determined by available techniques for determining response time).
  • the neutral electrode may measure the impedance in the desired tissue and communicates the impedance to the feedback mechanism, and the feedback mechanism responds to the impedance and adjusts the pulse of energy to maintain the constant current at UR 6-23001 /FR Ref.: 161118.04201 a value similar to the preset current.
  • the feedback mechanism may maintain the constant current continuously and instantaneously during the delivery of the pulse of energy. Examples of electroporation devices and electroporation methods that may facilitate delivery of the compositions described herein, include those described in US7245963 and US2005/0052630, the contents of which are hereby incorporated by reference in their entirety. Other electroporation devices and electroporation methods known in the art can also be used for facilitating delivery of the compositions.
  • kits include one or more components employed in methods, e.g., vectors, as described herein.
  • the subject kit includes a vector (as described herein), and one or more components selected from a promoter, a virus, a cell, and a buffer.
  • kits e.g., cells, constructs (e.g., vectors) encoding for NKA ⁇ 1 and/or MRCK ⁇ , components suitable for use in expression systems (e.g., cells, cloning vectors, multiple cloning sites (MSC), bi-directional promoters, an internal ribosome entry site (IRES), etc.), etc.
  • components suitable for use in making and using constructs, cloning vectors and expression systems may find use in the subject kits.
  • Kits may also include tubes, buffers, etc., and instructions for use.
  • kits may further include instructions for practicing the subject methods. These instructions may be present in the kits in a variety of forms, one or more of which may be present in the kit.
  • One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc.
  • a computer readable medium e.g., diskette, compact disk (CD), hard drive etc., on which the information has been recorded.
  • aspects of the disclosure include providing a virus particle that includes a nucleic acid vector, e.g., as described above. Any convenient virus particles may be utilized, and include viral vector particles described above. Aspects of the disclosure include providing a cell that includes a nucleic acid vector. The cell that is provided with the vector of interest may vary depending on the specific application being performed. Target cells of interest include eukaryotic cells, e.g., animal cells, where specific types of animal cells include, but are not limited to: insect, worm or mammalian cells.
  • Various mammalian cells may be used, including, by way of example, equine, bovine, ovine, canine, feline, murine, non-human primate and human cells.
  • various types of cells may be used, such as epithelial, endothelial, pulmonary, hematopoietic, neural, glial, mesenchymal, cutaneous, mucosal, stromal, muscle (including smooth muscle cells), spleen, reticulo-endothelial, hepatic, kidney, gastrointestinal, fibroblast, and other cell types.
  • gene therapy refers to the transfer of genetic material (e.g., DNA or RNA) of interest into a host to treat or prevent a genetic or acquired disease or condition phenotype.
  • the genetic material of interest encodes a product (e.g., a protein, polypeptide, peptide, or functional RNA) whose production in vivo is desired.
  • the genetic material of interest can encode a hormone, receptor, enzyme, polypeptide or peptide of therapeutic value.
  • ex vivo gene therapy Two basic approaches to gene therapy have evolved: (1) ex vivo and (2) in vivo gene therapy. In ex vivo gene therapy, cells are removed from a patient and, while being cultured, are treated in vitro.
  • a functional replacement gene is introduced into the cell via an appropriate gene delivery vehicle/method (transfection, transduction, homologous recombination, etc.) and an expression system as needed and then the modified cells are expanded in culture and returned to the host/patient.
  • These genetically reimplanted cells have been shown to produce the transfected gene product in situ.
  • target cells are not removed from the subject, rather the gene to be transferred is introduced into the cells of the recipient organism in situ, that is within the recipient.
  • the host gene is defective, the gene is repaired in situ.
  • These genetically altered cells have been shown to produce the transfected gene product in situ.
  • peptide refers to a peptide, polypeptide, or protein produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired peptide.
  • a “synthetic” peptide, polypeptide, or protein refers to a peptide, polypeptide, or protein prepared by chemical synthesis.
  • fusion proteins containing one or more of the afore-mentioned sequences and a heterologous sequence.
  • a heterologous polypeptide, nucleic acid, or gene is one that originates from a foreign species, or, if from the same species, is substantially modified from its original form. Two fused domains or sequences are heterologous to each other if they are not adjacent to each other in a naturally occurring protein or nucleic acid.
  • a conservative modification or functional equivalent of a peptide, polypeptide, or protein disclosed in this disclosure refers to a polypeptide derivative of the peptide, polypeptide, or protein, e.g., a protein having one or more point mutations, insertions, deletions, truncations, a fusion protein, or a combination thereof.
  • a nucleic acid or polynucleotide refers to a DNA molecule (e.g., a cDNA or genomic DNA), an RNA molecule (e.g., an mRNA), or a DNA or RNA analog.
  • a DNA or RNA analog can be synthesized from nucleotide analogs.
  • the nucleic acid molecule can be single- stranded or double-stranded, but preferably is double-stranded DNA.
  • An "isolated nucleic acid” refers to a nucleic acid the structure of which is not identical to that of any naturally occurring nucleic acid or to that of any fragment of a naturally occurring genomic nucleic acid.
  • the term therefore covers, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the coding sequences that flank that part of the molecule in the genome of the organism in which it naturally occurs; (b) a nucleic acid incorporated into a vector or into the genomic DNA of a UR 6-23001 /FR Ref.: 161118.04201 prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion protein.
  • a DNA which has the sequence of part of a naturally occurring genomic DNA molecule but is not flanked by both of the
  • the nucleic acid described above can be used to express the proteins described herein.
  • a vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • the vector can be capable of autonomous replication or integrate into a host DNA. Examples of the vector include a plasmid, cosmid, or viral vector.
  • the vector includes a nucleic acid in a form suitable for expression of the nucleic acid in a host cell.
  • the vector includes one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed.
  • a “regulatory sequence” includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include those that direct constitutive expression of a nucleotide sequence, as well as tissue-specific regulatory and/or inducible sequences.
  • the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein or RNA desired, and the like.
  • the expression vector can be introduced into host cells to produce a polypeptide described herein.
  • a promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis.
  • a strong promoter is one which causes mRNAs to be initiated at high frequency.
  • intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence, and the promoter sequence can still be considered "operably-linked" to the coding sequence.
  • Each nucleotide sequence coding for a polypeptide will typically have its own operably-linked promoter sequence.
  • UR 6-23001 /FR Ref.: 161118.04201 "Expression cassette" as used herein means a nucleic acid sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, which may include a promoter operably linked to the nucleotide sequence of interest that may be operably linked to termination signals.
  • the coding region usually codes for a functional RNA of interest.
  • the expression cassette including the nucleotide sequence of interest may be chimeric.
  • the expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
  • the expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of a regulatable promoter that initiates transcription only when the host cell is exposed to some particular stimulus. In the case of a multicellular organism, the promoter can also be specific to a particular tissue or organ or stage of development.
  • Such expression cassettes can include a transcriptional initiation region linked to a nucleotide sequence of interest.
  • Such an expression cassette is provided with a plurality of restriction sites for insertion of the gene of interest to be under the transcriptional regulation of the regulatory regions.
  • the expression cassette may additionally contain selectable marker genes.
  • Coding sequence refers to a DNA or RNA sequence that codes for a specific amino acid sequence. It may constitute an "uninterrupted coding sequence", i.e., lacking an intron, such as in a cDNA, or it may include one or more introns bounded by appropriate splice junctions. As used herein, the percent homology between two amino acid sequences is equivalent to the percent identity between the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, as described in the non-limiting examples below.
  • the percent identity between two amino acid sequences can be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl.
  • the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol.48:444-453 (1970)) algorithm which has been incorporated into the GAP program UR 6-23001 /FR Ref.: 161118.04201 in the GCG software package (available at www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
  • treating refers to administration of a compound or agent to a subject who has a disorder or is at risk of developing the disorder with the purpose to cure, alleviate, relieve, remedy, delay the onset of, prevent, or ameliorate the disorder, the symptom of the disorder, the disease state secondary to the disorder, or the predisposition toward the disorder.
  • the terms “prevent,” “preventing,” “prevention,” “prophylactic treatment” and the like refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.
  • An effective amount refers to the amount of an active compound/agent that is required to confer a therapeutic effect on a treated subject.
  • compositions refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo.
  • a “pharmaceutically acceptable carrier,” after administered to or upon a subject, does not cause undesirable physiological effects.
  • the carrier in the pharmaceutical composition must be “acceptable” also in the sense that it is compatible with the active ingredient and can be capable of stabilizing it.
  • One or more solubilizing agents can be utilized as pharmaceutical carriers for delivery of an active compound.
  • Examples of a pharmaceutically acceptable carrier include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents to achieve a composition usable as a dosage form.
  • examples of other carriers include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate.
  • a “subject” refers to a human and a non-human animal. Examples of a non-human animal include all vertebrates, e.g., mammals, such as non-human mammals, non-human primates (particularly higher primates), dog, rodent (e.g., mouse or rat), guinea pig, cat, and rabbit, and non-mammals, such as birds, amphibians, reptiles, etc.
  • the subject is a human.
  • the subject is an experimental, non-human animal or animal suitable as a disease model.
  • a number of ranges of values are provided. It is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly UR 6-23001 /FR Ref.: 161118.04201 dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the disclosure.
  • the upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included.
  • the term “about” generally refers to plus or minus 10% of the indicated number. For example, “about 10%” may indicate a range of 9% to 11%, and “about 1” may mean from 0.9-1.1. Other meanings of “about” may be apparent from the context, such as rounding off, so, for example “about 1” may also mean from 0.5 to 1.4.
  • electroporation refers to the process of subjecting a living cell to an electric field such that, when the voltage across the plasma membrane of the cell exceeds its dielectric strength, the membrane is disrupted and pores form in it through which substances, in particular polar substances that normally are unable to traverse the membrane, can pass and enter the cytoplasm of the cell. If the strength of the electric field coupled with the time of exposure is properly selected, the pores reseal after the cell is removed from the electric field.
  • Example 1 To determine whether NKA ⁇ 1 overexpression in the esophagus can upregulate tight junctions and barrier function, the distal esophagus of rats was electroporated with either saline (no DNA) or plasmid expressing a GFP- NKA ⁇ 1 (GFP-ß1) fusion, and animals were harvested 3 days later for analysis (Fig. 1). When no DNA was transferred, endogenous expressions of occludin, ZO-1 (both weak), and NKA ß1 (ß1) were seen.
  • NKA ⁇ 1 represents a treatment for refractory GERD and can prevent progression to cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne la réparation et l'amélioration de la fonction de la barrière épithéliale dans l'œsophage.
PCT/US2023/082667 2022-12-16 2023-12-06 Réparation d'un dysfonctionnement de la barrière dans l'œsophage WO2024129459A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263387771P 2022-12-16 2022-12-16
US63/387,771 2022-12-16

Publications (1)

Publication Number Publication Date
WO2024129459A1 true WO2024129459A1 (fr) 2024-06-20

Family

ID=89619928

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/082667 WO2024129459A1 (fr) 2022-12-16 2023-12-06 Réparation d'un dysfonctionnement de la barrière dans l'œsophage

Country Status (1)

Country Link
WO (1) WO2024129459A1 (fr)

Citations (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3805783A (en) 1971-02-12 1974-04-23 A Ismach Hand powered hypodermic jet injector gun
US4342310A (en) 1980-07-08 1982-08-03 Istvan Lindmayer Hydro-pneumatic jet injector
US4447223A (en) 1982-04-16 1984-05-08 Cct Associates Medicament implant applicator
WO1990011354A1 (fr) 1989-03-20 1990-10-04 Institut Pasteur Procede de remplacement specifique d'une copie d'un gene present dans le genome receveur par l'integration d'un gene different de celui ou se fait l'integration
WO1991006667A1 (fr) 1989-11-06 1991-05-16 Cell Genesys, Inc. Production de proteines par recombinaison homologue
WO1991009955A1 (fr) 1989-12-22 1991-07-11 Applied Research Systems Ars Holding N.V. Modification de l'expression de genes endogenes a l'aide d'un element regulateur
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
WO1993009222A2 (fr) 1991-11-05 1993-05-13 Transkaryotic Therapies, Inc. Transfection de cellules de vertebres, par exemple par recombinaison homologue
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5273525A (en) 1992-08-13 1993-12-28 Btx Inc. Injection and electroporation apparatus for drug and gene delivery
WO1994012650A2 (fr) 1992-12-03 1994-06-09 Transkaryotic Therapies, Inc. Activation d'expression et d'amplification d'un gene endogene par recombinaison homologue
US5350674A (en) 1992-09-04 1994-09-27 Becton, Dickinson And Company Intrinsic factor - horse peroxidase conjugates and a method for increasing the stability thereof
WO1995031560A1 (fr) 1994-05-13 1995-11-23 Transkaryotic Therapies, Inc. Produit de recombinaison d'adn permettant d'effectuer une recombinaison homologue et utilisations de ce produit
US5505697A (en) 1994-01-14 1996-04-09 Mckinnon, Jr.; Charles N. Electrically powered jet injector
US5580859A (en) 1989-03-21 1996-12-03 Vical Incorporated Delivery of exogenous DNA sequences in a mammal
US5585362A (en) 1989-08-22 1996-12-17 The Regents Of The University Of Michigan Adenovirus vectors for gene therapy
US5676646A (en) 1992-04-08 1997-10-14 Genetronics, Inc. Flow through electroporation apparatus
US5679647A (en) 1993-08-26 1997-10-21 The Regents Of The University Of California Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides
US5702359A (en) 1995-06-06 1997-12-30 Genetronics, Inc. Needle electrodes for mediated delivery of drugs and genes
US5733761A (en) 1991-11-05 1998-03-31 Transkaryotic Therapies, Inc. Protein production and protein delivery
US6009347A (en) 1998-01-27 1999-12-28 Genetronics, Inc. Electroporation apparatus with connective electrode template
US6068650A (en) 1997-08-01 2000-05-30 Gentronics Inc. Method of Selectively applying needle array configurations
US6096020A (en) 1996-09-09 2000-08-01 Genetronics, Inc. Electroporation employing user-configured pulsing scheme
US6110161A (en) 1997-04-03 2000-08-29 Electrofect As Method for introducing pharmaceutical drugs and nucleic acids into skeletal muscle
US6120493A (en) 1998-01-27 2000-09-19 Genetronics, Inc. Method for the introduction of therapeutic agents utilizing an electroporation apparatus
US6150148A (en) 1998-10-21 2000-11-21 Genetronics, Inc. Electroporation apparatus for control of temperature during the process
US6192270B1 (en) 1998-08-14 2001-02-20 Genetronics, Inc. Apparatus and method for the delivery of drugs and genes into tissue
US6208893B1 (en) 1998-01-27 2001-03-27 Genetronics, Inc. Electroporation apparatus with connective electrode template
US6216034B1 (en) 1997-08-01 2001-04-10 Genetronics, Inc. Method of programming an array of needle electrodes for electroporation therapy of tissue
US6241701B1 (en) 1997-08-01 2001-06-05 Genetronics, Inc. Apparatus for electroporation mediated delivery of drugs and genes
US6302874B1 (en) 1998-07-13 2001-10-16 Genetronics, Inc. Method and apparatus for electrically assisted topical delivery of agents for cosmetic applications
US6489306B2 (en) 1998-02-23 2002-12-03 University Of South Florida Method of intranasal gene transfer for protection against respiratory infection
US6520950B1 (en) 1999-05-10 2003-02-18 Genetronics, Inc. Method of electroporation-enhanced delivery of active agents
US6697669B2 (en) 1998-07-13 2004-02-24 Genetronics, Inc. Skin and muscle-targeted gene therapy by pulsed electrical field
US6763264B2 (en) 1993-04-01 2004-07-13 Genetronics, Inc. Method of treatment using electroporation mediated delivery of drugs and genes
US20050052630A1 (en) 2002-03-07 2005-03-10 Advisys, Inc. Constant current electroporation device and methods of use
US6939862B2 (en) 1997-06-30 2005-09-06 Aventis Pharma S.A. Method for transferring nucleic acid into striated muscles
US6958060B2 (en) 1997-04-03 2005-10-25 Genetronics, Inc. Method for muscle delivery of drugs, nucleic acids and other compounds
US20060078558A1 (en) 2003-11-12 2006-04-13 Whitsett Jeffrey A Diagnosis, prognosis and treatment of pulmonary diseases
US7171264B1 (en) 1999-05-10 2007-01-30 Genetronics, Inc. Intradermal delivery of active agents by needle-free injection and electroporation
US7245963B2 (en) 2002-03-07 2007-07-17 Advisys, Inc. Electrode assembly for constant-current electroporation and use
US7328064B2 (en) 2002-07-04 2008-02-05 Inovio As Electroporation device and injection apparatus
US20080070858A1 (en) 2002-09-06 2008-03-20 Mohapatra Shyam S Materials and Methods for Treatment of Allergic Diseases
US20090099066A1 (en) 2007-06-29 2009-04-16 Avi Biopharma, Inc. Tissue specific peptide conjugates and methods
US20090156503A1 (en) 2005-12-06 2009-06-18 Centre National De La Recherche Scient Cell penetrating peptides for intracellular delivery of molecules
US20100279918A1 (en) 2006-03-20 2010-11-04 Burnham Institute For Medical Research Chimeric Constructs Between Cancer-Homing Peptides and Cell-Penetrating Peptides Coupled to Anticancer Drugs and/or Diagnostic Agent/Agents
US9001515B2 (en) 2012-04-20 2015-04-07 Cisco Technology, Inc. Universal pull tab release for modules including fiber optic and cable accessibilities
US20150313924A1 (en) 2014-05-05 2015-11-05 University Of Iowa Research Foundation Methods of improving rnai in well-differentiated airway epithelia
US9452285B2 (en) 2006-10-17 2016-09-27 Vgx Pharmaceuticals, Inc. Electroporation devices and methods of using same for electroporation of cells in mammals
US20160317671A1 (en) 2013-08-29 2016-11-03 City Of Hope Cell penetrating conjugates and methods of use thereof
US20180008667A1 (en) 2015-01-16 2018-01-11 City Of Hope Cell penetrating antibodies
US20180230237A1 (en) 2015-08-06 2018-08-16 City Of Hope Cell penetrating protein-antibody conjugates and methods of use
US20180243436A1 (en) 2015-08-06 2018-08-30 City Of Hope Therapeutic cell internalizing conjugates
US20180298057A1 (en) 2017-04-14 2018-10-18 Emory University Compositions and Methods for Managing Respiratory Conditions
US20180344816A1 (en) 2012-12-27 2018-12-06 Sierra Sciences, Llc Enhancing Health in Mammals Using Telomerase Reverse Transcriptase Gene Therapy
WO2019014648A1 (fr) 2017-07-13 2019-01-17 City Of Hope Peptides conjugués à un phosphorothioate et leurs méthodes d'utilisation
US20190119259A1 (en) 2015-12-10 2019-04-25 City Of Hope Cell penetrating cyanine-coupled antibodies
US20190365905A1 (en) 2018-06-01 2019-12-05 City Of Hope PHOSPHOROTHIOATE-CONJUGATED miRNAs AND METHODS OF USING THE SAME
WO2020150300A1 (fr) 2019-01-16 2020-07-23 University Of Rochester Amélioration de la fonction de la barrière épithéliale ou endothéliale

Patent Citations (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3805783A (en) 1971-02-12 1974-04-23 A Ismach Hand powered hypodermic jet injector gun
US4342310A (en) 1980-07-08 1982-08-03 Istvan Lindmayer Hydro-pneumatic jet injector
US4447223A (en) 1982-04-16 1984-05-08 Cct Associates Medicament implant applicator
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
WO1990011354A1 (fr) 1989-03-20 1990-10-04 Institut Pasteur Procede de remplacement specifique d'une copie d'un gene present dans le genome receveur par l'integration d'un gene different de celui ou se fait l'integration
US5580859A (en) 1989-03-21 1996-12-03 Vical Incorporated Delivery of exogenous DNA sequences in a mammal
US5703055A (en) 1989-03-21 1997-12-30 Wisconsin Alumni Research Foundation Generation of antibodies through lipid mediated DNA delivery
US5585362A (en) 1989-08-22 1996-12-17 The Regents Of The University Of Michigan Adenovirus vectors for gene therapy
WO1991006667A1 (fr) 1989-11-06 1991-05-16 Cell Genesys, Inc. Production de proteines par recombinaison homologue
WO1991009955A1 (fr) 1989-12-22 1991-07-11 Applied Research Systems Ars Holding N.V. Modification de l'expression de genes endogenes a l'aide d'un element regulateur
US5733761A (en) 1991-11-05 1998-03-31 Transkaryotic Therapies, Inc. Protein production and protein delivery
WO1993009222A2 (fr) 1991-11-05 1993-05-13 Transkaryotic Therapies, Inc. Transfection de cellules de vertebres, par exemple par recombinaison homologue
US5641670A (en) 1991-11-05 1997-06-24 Transkaryotic Therapies, Inc. Protein production and protein delivery
US5676646A (en) 1992-04-08 1997-10-14 Genetronics, Inc. Flow through electroporation apparatus
US5273525A (en) 1992-08-13 1993-12-28 Btx Inc. Injection and electroporation apparatus for drug and gene delivery
US5350674A (en) 1992-09-04 1994-09-27 Becton, Dickinson And Company Intrinsic factor - horse peroxidase conjugates and a method for increasing the stability thereof
WO1994012650A2 (fr) 1992-12-03 1994-06-09 Transkaryotic Therapies, Inc. Activation d'expression et d'amplification d'un gene endogene par recombinaison homologue
US6763264B2 (en) 1993-04-01 2004-07-13 Genetronics, Inc. Method of treatment using electroporation mediated delivery of drugs and genes
US5679647A (en) 1993-08-26 1997-10-21 The Regents Of The University Of California Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides
US5505697A (en) 1994-01-14 1996-04-09 Mckinnon, Jr.; Charles N. Electrically powered jet injector
WO1995031560A1 (fr) 1994-05-13 1995-11-23 Transkaryotic Therapies, Inc. Produit de recombinaison d'adn permettant d'effectuer une recombinaison homologue et utilisations de ce produit
US5702359A (en) 1995-06-06 1997-12-30 Genetronics, Inc. Needle electrodes for mediated delivery of drugs and genes
US6096020A (en) 1996-09-09 2000-08-01 Genetronics, Inc. Electroporation employing user-configured pulsing scheme
US6958060B2 (en) 1997-04-03 2005-10-25 Genetronics, Inc. Method for muscle delivery of drugs, nucleic acids and other compounds
US6110161A (en) 1997-04-03 2000-08-29 Electrofect As Method for introducing pharmaceutical drugs and nucleic acids into skeletal muscle
US6939862B2 (en) 1997-06-30 2005-09-06 Aventis Pharma S.A. Method for transferring nucleic acid into striated muscles
US6233482B1 (en) 1997-08-01 2001-05-15 Genetronics, Inc. Method of electroporation mediated delivery of drugs and genes
US6068650A (en) 1997-08-01 2000-05-30 Gentronics Inc. Method of Selectively applying needle array configurations
US6216034B1 (en) 1997-08-01 2001-04-10 Genetronics, Inc. Method of programming an array of needle electrodes for electroporation therapy of tissue
US6181964B1 (en) 1997-08-01 2001-01-30 Genetronics, Inc. Minimally invasive apparatus and method to electroporate drugs and genes into tissue
US6241701B1 (en) 1997-08-01 2001-06-05 Genetronics, Inc. Apparatus for electroporation mediated delivery of drugs and genes
US6208893B1 (en) 1998-01-27 2001-03-27 Genetronics, Inc. Electroporation apparatus with connective electrode template
US6009347A (en) 1998-01-27 1999-12-28 Genetronics, Inc. Electroporation apparatus with connective electrode template
US6120493A (en) 1998-01-27 2000-09-19 Genetronics, Inc. Method for the introduction of therapeutic agents utilizing an electroporation apparatus
US6489306B2 (en) 1998-02-23 2002-12-03 University Of South Florida Method of intranasal gene transfer for protection against respiratory infection
US6302874B1 (en) 1998-07-13 2001-10-16 Genetronics, Inc. Method and apparatus for electrically assisted topical delivery of agents for cosmetic applications
US6697669B2 (en) 1998-07-13 2004-02-24 Genetronics, Inc. Skin and muscle-targeted gene therapy by pulsed electrical field
US6192270B1 (en) 1998-08-14 2001-02-20 Genetronics, Inc. Apparatus and method for the delivery of drugs and genes into tissue
US6150148A (en) 1998-10-21 2000-11-21 Genetronics, Inc. Electroporation apparatus for control of temperature during the process
US6520950B1 (en) 1999-05-10 2003-02-18 Genetronics, Inc. Method of electroporation-enhanced delivery of active agents
US7171264B1 (en) 1999-05-10 2007-01-30 Genetronics, Inc. Intradermal delivery of active agents by needle-free injection and electroporation
US20050052630A1 (en) 2002-03-07 2005-03-10 Advisys, Inc. Constant current electroporation device and methods of use
US7664545B2 (en) 2002-03-07 2010-02-16 Vgx Pharmaceuticals, Inc. Electrode assembly for constant-current electroporation and use
US7245963B2 (en) 2002-03-07 2007-07-17 Advisys, Inc. Electrode assembly for constant-current electroporation and use
US7328064B2 (en) 2002-07-04 2008-02-05 Inovio As Electroporation device and injection apparatus
US20080234655A1 (en) 2002-07-04 2008-09-25 Inovio As Electroporation device and injection apparatus
US20080070858A1 (en) 2002-09-06 2008-03-20 Mohapatra Shyam S Materials and Methods for Treatment of Allergic Diseases
US20060078558A1 (en) 2003-11-12 2006-04-13 Whitsett Jeffrey A Diagnosis, prognosis and treatment of pulmonary diseases
US20090156503A1 (en) 2005-12-06 2009-06-18 Centre National De La Recherche Scient Cell penetrating peptides for intracellular delivery of molecules
US20100279918A1 (en) 2006-03-20 2010-11-04 Burnham Institute For Medical Research Chimeric Constructs Between Cancer-Homing Peptides and Cell-Penetrating Peptides Coupled to Anticancer Drugs and/or Diagnostic Agent/Agents
US9452285B2 (en) 2006-10-17 2016-09-27 Vgx Pharmaceuticals, Inc. Electroporation devices and methods of using same for electroporation of cells in mammals
US20090099066A1 (en) 2007-06-29 2009-04-16 Avi Biopharma, Inc. Tissue specific peptide conjugates and methods
US9001515B2 (en) 2012-04-20 2015-04-07 Cisco Technology, Inc. Universal pull tab release for modules including fiber optic and cable accessibilities
US20180344816A1 (en) 2012-12-27 2018-12-06 Sierra Sciences, Llc Enhancing Health in Mammals Using Telomerase Reverse Transcriptase Gene Therapy
US20160317671A1 (en) 2013-08-29 2016-11-03 City Of Hope Cell penetrating conjugates and methods of use thereof
US20150313924A1 (en) 2014-05-05 2015-11-05 University Of Iowa Research Foundation Methods of improving rnai in well-differentiated airway epithelia
US20180008667A1 (en) 2015-01-16 2018-01-11 City Of Hope Cell penetrating antibodies
US20180230237A1 (en) 2015-08-06 2018-08-16 City Of Hope Cell penetrating protein-antibody conjugates and methods of use
US20180243436A1 (en) 2015-08-06 2018-08-30 City Of Hope Therapeutic cell internalizing conjugates
US20190119259A1 (en) 2015-12-10 2019-04-25 City Of Hope Cell penetrating cyanine-coupled antibodies
US20180298057A1 (en) 2017-04-14 2018-10-18 Emory University Compositions and Methods for Managing Respiratory Conditions
WO2019014648A1 (fr) 2017-07-13 2019-01-17 City Of Hope Peptides conjugués à un phosphorothioate et leurs méthodes d'utilisation
US20190365905A1 (en) 2018-06-01 2019-12-05 City Of Hope PHOSPHOROTHIOATE-CONJUGATED miRNAs AND METHODS OF USING THE SAME
WO2020150300A1 (fr) 2019-01-16 2020-07-23 University Of Rochester Amélioration de la fonction de la barrière épithéliale ou endothéliale

Non-Patent Citations (49)

* Cited by examiner, † Cited by third party
Title
"Oligonucleotide Synthesis", 1984, IRL PRESS
ABU-FARSAKH, S.T. WUA. LALONDEJ. SUNZ. ZHOU: "High expression of the leaky protein claudin-2 in esophageal carcinoma and precancerous lesions is significantly associated with the bile salt receptors VDR and TGR5", BMC GASTROENTEROLOGY, 2017
ALTSCHUL S FGISH WMILLER WMYERS E WLIPMAN D J: "Basic local alignment search too", J MOL BIOL, vol. 215, no. 3, 1990, pages 403 - 410, XP002949123, DOI: 10.1006/jmbi.1990.9999
AUSUBEL ET AL., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY AND SHORT PROTOCOLS IN MOLECULAR BIOLOGY, 2002
BAI HAIQING ET AL: "The Na+ , K+ -ATPase [beta]1 subunit regulates epithelial tight junctions via MRCK[alpha]", JCI INSIGHT, 28 January 2021 (2021-01-28), pages 1 - 14, XP093145774, ISSN: 2379-3708, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7934944/pdf/jciinsight-6-134881.pdf> DOI: 10.1172/jci.insight.134881 *
BHAT, S., H.G. COLEMAN, F. YOUSEF, B.T. JOHNSTON, D.T. MCMANUS, A.T. GAVIN, L.J. MURRAY.: "Risk of malignant progression in Barrett's esophagus patients: result from a large population-based study", J NATL CANCER INST, vol. 103, 2011, pages 1049 - 57
BJORKMAN, E.V.A. EDEBOM. OLTEANA. CASSELBRANT: "Esophageal barrier function and tight junction expression in healthy subjects and patients with gastroesophageal reflux disease: functionality of esophageal mucosa exposed to bile salt and trypsin in vitro", SCAND J GASTROENTEROL, vol. 48, 2013, pages 1118 - 26
CREIGHTON: "Proteins: Structures and Molecular Principles", 1983, W.H. FREEMAN & CO.
DE GIORGI, F.M. PALMIEROI. ESPOSITOF. MOSCAR. CUOMO: "Pathophysiology of gastro-oesophageal reflux disease", ACTA OTORHINOLARYNGOL ITAL, vol. 26, 2006, pages 241 - 6
DEAN, D.A.D. MACHADO-ARANDAK. BLAIR-PARKSA.V. YELDANDIJ.L. YOUNG: "Electroporation as a method for high-level non-viral gene transfer to the lung", GENE THER, vol. 10, 2003, pages 1608 - 1615
DONNELLY ET AL., ANN. REV. IMMUNOL., vol. 15, 1997, pages 617 - 648
DOULAMI, G.S. TRIANTAFYLLOUM. NATOUDIK. ALBANOPOULOSE. LEANDROSG. ZOGRAFOSD. THEODOROU: "GERD-Related Questionnaires and Obese Population: Can They Really Reflect the Severity of the Disease and the Impact of GERD on Quality of Patients' Life?", OBES SURG, vol. 25, 2015, pages 1882 - 5, XP035540973, DOI: 10.1007/s11695-015-1614-x
E. MEYERSW. MILLER, COMPUT. APPL. BIOSCI., vol. 4, 1988, pages 11 - 17
ECKSTEIN: "A Practical Approach", OXFORD UNIVERSITY PRESS, article "Oligonucleotides and Analogues"
EL-SERAG, H.B.S. SWEETC.C. WINCHESTERJ. DENT: "Update on the epidemiology of gastro-oesophageal reflux disease: a systematic review", GUT, vol. 63, 2014, pages 871 - 80
EMR, B.M.S. ROYM. KOLLISCH-SINGULEL.A. GATTOM. BARRAVECCHIAX. LINJ.L. YOUNGG. WANGJ. LIUJ. SATALIN: "Electroporation-mediated gene delivery of Na+,K+ -ATPase, and ENaC subunits to the lung attenuates acute respiratory distress syndrome in a two-hit porcine model", SHOCK, vol. 43, 2015, pages 16 - 23
FARRE, R.H. VAN MALENSTEINR. DE VOSK. GEBOESI. DEPOORTEREP. VANDEN BERGHEF. FORNARIK. BLONDEAUV. MERTENSJ. TACK: "Short exposure of oesophageal mucosa to bile acids, both in acidic and weakly acidic conditions, can impair mucosal integrity and provoke dilated intercellular spaces", GUT, vol. 57, 2008, pages 1366 - 74
FARRE, R.K. BLONDEAUD. CLEMENTM. VICARIOL. CARDOZOM. VIETHV. MERTENSA. PAUWELSJ. SILNYM. JIMENEZ: "Evaluation of oesophageal mucosa integrity by the intraluminal impedance technique", GUT, vol. 60, 2011, pages 885 - 92
FLEGAL, K.M.M.D. CARROLLB.K. KITC.L. OGDEN: "Prevalence of obesity and trends in the distribution of body mass index among US adults, 1999-2010", JAMA, vol. 307, 2012, pages 491 - 7
G.R. LOCKEG.A. PRASAD: "Epidemiology and natural history of intestinal metaplasia of the gastroesophageal junction and Barrett's esophagus: a population-based study", AM J GASTROENTEROL, vol. 106, 2011, pages 1447 - 55
GALMICHE, J.P.S. BRULEY DES VARANNES: "Symptoms and disease severity in gastro-oesophageal reflux disease", SCAND J GASTROENTEROL, 1994, pages 62 - 8
GHOSH ET AL., GLYCOBIOLOGY, vol. 5, 1991, pages 505 - 10
GREGORIADIS, LIPOSOME TECHNOLOGY, 1993
GYORFFY, H.A. HOLCZBAUERP. NAGYZ. SZABOP. KUPCSULIKC. PASKAJ. PAPPZ. SCHAFFA. KISS: "Claudin expression in Barrett's esophagus and adenocarcinoma", VIRCHOWS ARCH, vol. 447, 2005, pages 961 - 8, XP019344845, DOI: 10.1007/s00428-005-0045-9
HERRMANN ET AL., JCI INSIGHT, 2019
HORN, J: "The proton-pump inhibitors: similarities and differences", CLIN THER, vol. 22, 2000, pages 266 - 80
HVID-JENSEN, F.L. PEDERSENA.M. DREWESH.T. SORENSENP. FUNCH-JENSEN: "Incidence of adenocarcinoma among patients with Barrett's esophagus", N ENGL J MED, vol. 365, 2011, pages 1375 - 83
JIANG, M.H. LIY. ZHANGY. YANGR. LUK. LIUS. LINX. LANH. WANGH. WU: "Transitional basal cells at the squamous-columnar junction generate Barrett's oesophagus", NATURE, 2017
KATZ, P.O.L.B. GERSONM.F. VELA: "Guidelines for the diagnosis and management of gastroesophageal reflux disease", AM J GASTROENTEROL, vol. 108, 2013, pages 308 - 28
KYUNO DAISUKE ET AL: "Role of tight junctions in the epithelial-to-mesenchymal transition of cancer cells", BIOCHIMICA ET BIOPHYSICA ACTA, ELSEVIER, AMSTERDAM, NL, vol. 1863, no. 3, 13 November 2020 (2020-11-13), XP086453855, ISSN: 0005-2736, [retrieved on 20201113], DOI: 10.1016/J.BBAMEM.2020.183503 *
LIN, X.M. BARRAVECCHIAP. KOTHARIJ.L. YOUNGD.A. DEAN: "betal-Na(+),K(+)-ATPase gene therapy upregulates tight junctions to rescue lipopolysaccharide-induced acute lung injury", GENE THER, vol. 23, 2016, pages 489 - 99
LIN, XD.A. DEAN: "Gene therapy for ALI/ARDS", CRIT CARE CLIN, vol. 27, 2011, pages 705 - 18
LIPMAN, D JPEARSON, W R: "Rapid and sensitive protein similarity searches", SCIENCE, vol. 227, no. 4693, 1985, pages 1435 - 41, XP000941106, Retrieved from the Internet <URL:http://fasta.bioch.virginia.edu/fastawww2/fastalist2.shtml> DOI: 10.1126/science.2983426
LOZANO, R: "Adverse Effects of Proton Pump Inhibitors in Chronic Kidney Disease", JAMA INTERN MED, vol. 176, 2016, pages 866 - 7
MACHADO-ARANDA, D.Y. ADIRJ.L. YOUNGA. BRIVAG.R.S. BUDINGERA. YELDANDIJ.I. SZNAJDERD.A. DEAN: "Gene transfer of the Na+,K+-ATPase b1 subunit using electroporation increases lung liquid clearance in rats", AM J RESPIR CRIT CARE MED, vol. 171, 2005, pages 204 - 211
MARTIN E W: "Remington's Pharmaceutical Sciences", 1995, MACK PUBLISHING COMPANY
MUTLU, G.M.D. MACHADO-ARANDAJ.E. NORTONA. BELLMEYERD. URICHR. ZHOUD.A. DEAN: "Electroporation-mediated gene transfer of the Na+,K+-ATPase rescues endotoxin-induced lung injury", AM J RESPIR CRIT CARE MED, vol. 176, 2007, pages 582 - 590
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453
ORLANDO, L.AR.C. ORLANDO: "Dilated intercellular spaces as a marker of GERD", CURR GASTROENTEROL REP, vol. 11, 2009, pages 190 - 4
ORLANDO, R.C.: "The integrity of the esophageal mucosa. Balance between offensive and defensive mechanisms", BEST PRACT RES CLIN GASTROENTEROL, vol. 24, 2010, pages 873 - 82, XP027523765
OSHIMA TADAYUKI ET AL: "Gastrointestinal mucosal barrier function and diseases", JOURNAL OF GASTROENTERLOGY, SPRINGER JAPAN KK, JP, vol. 51, no. 8, 5 April 2016 (2016-04-05), pages 768 - 778, XP036011654, ISSN: 0944-1174, [retrieved on 20160405], DOI: 10.1007/S00535-016-1207-Z *
POHL, H.B. SIROVICHH.G. WELCH: "Esophageal adenocarcinoma incidence: are we reaching the peak?", CANCER EPIDEMIOL BIOMARKERS PREV, vol. 197, 2010, pages 1468 - 70
SCHMID RM ET AL.: "Liposome mediated gene transfer into the rat oesophagus", GUT, vol. 41, 1997, pages 549 - 56
SHAH, N.H.P. LEPENDUA. BAUER-MEHRENY.T. GHEBREMARIAMS.V. IYERJ. MARCUSK.T. NEADJ.P. COOKEN.J. LEEPER: "Proton Pump Inhibitor Usage and the Risk of Myocardial Infarction in the General Population", PLOS ONE, vol. 10, 2015, pages e0124653
SOUZA, R.F.: "From Reflux Esophagitis to Esophageal Adenocarcinoma", DIG DIS, vol. 34, 2016, pages 483 - 90
TACHIKAWA ET AL., PNAS, vol. 101, no. 42, 2004, pages 15225 - 15230
TARHINI AA ET AL.: "A phase I study of concurrent chemotherapy (paclitaxel and carboplatin) and thoracic radiotherapy with swallowed manganese superoxide dismutase plasmid liposome protection in patients with locally advanced stage III non-small-cell lung cancer", HUM GENE THER, vol. 22, 2011, pages 336 - 42, XP055329027, DOI: 10.1089/hum.2010.078
TERAISHI ET AL.: "A novel method for gene delivery and expression in esophageal epithelium with fibrin glues containing replication-deficient adenovirus vector", SURG ENDOSC, vol. 17, 2003, pages 1845 - 8, XP002377593
WHITEMAN, D.C.S. SADEGHIN. PANDEYAB.M. SMITHERSD.C. GOTLEYC.J. BAINP.M. WEBBA.C. GREENS. AUSTRALIAN CANCE: "Combined effects of obesity, acid reflux and smoking on the risk of adenocarcinomas of the oesophagus", GUT, vol. 57, 2008, pages 173 - 80

Similar Documents

Publication Publication Date Title
JP4213201B2 (ja) 固型腫瘍、乳頭腫および疣贅の遺伝子治療
AU2010286511B2 (en) SDF-1 delivery for treating ischemic tissue
US8178504B2 (en) Gene therapy expression of GHRH for increasing RBC count in subjects
US20110130444A1 (en) Methods and compositions for targeted delivery of gene therapeutic vectors
BR112014010091B1 (pt) Ácido nucleico, vetor viral, preparação farmacêutica, uso destes, método para produção de uma proteína rdcvf, e método in vitro ou ex vivo de secreção de uma proteína rdcvf a partir de uma célula
Pohl et al. Gene therapy of pain: emerging strategies and future directions
US7041654B2 (en) Methods and compositions for inducing tumor-specific cytotoxicity
AU2019304569B2 (en) Treatment of neuropathy with DNA constructs expressing IGF-1 isoforms
WO2024129459A1 (fr) Réparation d&#39;un dysfonctionnement de la barrière dans l&#39;œsophage
US11434501B2 (en) Sprr1A as a genetic target for treating neurodegenerative diseases
DK3003359T3 (en) APOBEC3A AS AN ANTITUMOR AGENT
EP1133567A1 (fr) Therapie genique de methioninase pour le traitement des tumeurs
EP1077728A1 (fr) PROTECTION PAR THERAPIE GENIQUE $i(IN VIVO) CONTRE LES DEGATS OCCASIONNES PAR UNE EXPOSITION A UN RAYONNEMENT IONISANT OU PAR UN MEDICAMENT CHIMIOTHERAPIQUE
WO2000040272A2 (fr) Therapie genique 2
KR20160005021A (ko) 허혈 조직 처리를 위한 sdf-1의 전달
WO1998020906A2 (fr) Traitement du diabete avec un gene de facteur de transcription
Shaaban et al. Gene therapy: Its applications in dermatology
WO2001076641A1 (fr) Mort ciblee de cellules cancereuses
US20040002149A1 (en) Control of the ratio of LAP to LIP
Juan Nonviral gene transfer by chitosan polymer-based nanotechnology
JP2004033217A (ja) Ｌｉｐに対するｌａｐの比率の調節

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23841416

Country of ref document: EP

Kind code of ref document: A1