WO2024123968A1 - Composés de ciblage d'arn et leurs utilisations - Google Patents

Composés de ciblage d'arn et leurs utilisations Download PDF

Info

Publication number
WO2024123968A1
WO2024123968A1 PCT/US2023/082835 US2023082835W WO2024123968A1 WO 2024123968 A1 WO2024123968 A1 WO 2024123968A1 US 2023082835 W US2023082835 W US 2023082835W WO 2024123968 A1 WO2024123968 A1 WO 2024123968A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
pharmaceutically acceptable
solvate
acceptable salt
heterocycloalkyl
Prior art date
Application number
PCT/US2023/082835
Other languages
English (en)
Inventor
Steven L. Bender
Original Assignee
Ranar Therapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ranar Therapeutics, Inc. filed Critical Ranar Therapeutics, Inc.
Publication of WO2024123968A1 publication Critical patent/WO2024123968A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D473/00—Heterocyclic compounds containing purine ring systems
    • C07D473/02—Heterocyclic compounds containing purine ring systems with oxygen, sulphur, or nitrogen atoms directly attached in positions 2 and 6
    • C07D473/18—Heterocyclic compounds containing purine ring systems with oxygen, sulphur, or nitrogen atoms directly attached in positions 2 and 6 one oxygen and one nitrogen atom, e.g. guanine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D473/00—Heterocyclic compounds containing purine ring systems
    • C07D473/26—Heterocyclic compounds containing purine ring systems with an oxygen, sulphur, or nitrogen atom directly attached in position 2 or 6, but not in both
    • C07D473/32—Nitrogen atom
    • C07D473/34—Nitrogen atom attached in position 6, e.g. adenine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/04—Ortho-condensed systems

Definitions

  • RNA routinely adopts complex and defined tertiary structures and that these structures play a multitude of important regulatory roles in cells, including in pathological states.
  • These stable and meta-stable structures are found not only in mRNA, but also in other transcribed RNAs whose roles in only as regulatory elements, including (but not limited to) miRNA, IncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, ceRNA, and pseudo-genes.
  • Prostate cancer the fifth leading cause of death from cancer in men, arises in the prostate epithelium, and is a hormone-dependent malignancy driven by dysregulated androgen. Consequently, androgen deprivation therapy is the current first-line standard of care therapy for prostate cancer, and when progression occurs to castration-resistant prostate cancer (CRPC), second-generation anti-androgens such as enzalutamide play an important role in slowing disease progression.
  • CRPC castration-resistant prostate cancer
  • AR-V7 a splice variant of the androgen receptor
  • X is N(H);
  • R 1 is selected from hydrogen, C1-6alkyl, C1-6haloalkyl, C3-6cycloalkyl, -CH2-C3- 6cycloalkyl, C 2-9 heterocycloalkyl, -CH 2 -C 2-9 heterocycloalkyl, -CH 2 -C 6-10 aryl,
  • a compound of Formula (I), or a pharmaceutically acceptable salt or solvate thereof Formula (I); wherein: is a 6,6-bicyclic heteroaryl or a 6,5-bicyclic heteroaryl, wherein the 6,5-bicyclic heteroaryl is attached to X through the 6-membered ring of the 6,5-bicyclic heteroaryl, wherein the 6,6-bicyclic heteroaryl contains at least two nitrogen atoms and the 6,5-bicyclic heteroaryl contains at least two heteroatoms selected from N, S, and O; X is N(H); R 1 is selected from hydrogen, C1-6alkyl, C1-6haloalkyl, C3-6cycloalkyl, -CH2-C3- 6cycloalkyl, C 2-9 heterocycloalkyl, -CH 2 -C 2-9 heterocycloalkyl, -CH 2 -C 6-10 aryl, and - CH2-C1-9hetero
  • a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein is a 6,6-bicyclic heteroaryl containing at least two nitrogen atoms.
  • a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein is selected from a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein is a 6,5-bicyclic heteroaryl containing at least two heteroatoms selected from N, S, and O, wherein the 6,5-bicyclic heteroaryl is attached to X through the 6-membered ring of the 6,5-bicyclic heteroaryl.
  • each R 4 is independently selected from halogen, C1-6alkyl, C1-6haloalkyl, C3-6cycloalkyl, and -OR 10 , wherein C1-6alkyl and C3- 6 cycloalkyl are optionally substituted with one, two, or three groups selected from halogen, - CN, C1-6alkyl, C1-6haloalkyl, C3-6cycloalkyl, C2-9heterocycloalkyl, C6-10aryl, C1-9heteroaryl, - OR 10 , and -N(R 10 )(R 11 ).
  • each R 4 is independently selected from halogen, unsubstituted C 1-6 alkyl, C 1-6 haloalkyl, unsubstituted C 3-6 cycloalkyl, and -OR 10 , wherein each R 10 is independently selected from hydrogen and unsubstituted C1-6alkyl.
  • Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein each R 2 is independently selected from C 1-6 alkyl.
  • n is 0.
  • R 3a , R 3b , and R 3c are independently selected from hydrogen, halogen, C1- 6alkyl, C1-6haloalkyl, and -OR 10 , wherein C1-6alkyl is optionally substituted with one, two, or three groups selected from halogen, -CN, C 1-6 alkyl, C 1-6 haloalkyl, C 3-6 cycloalkyl, C 2- 9heterocycloalkyl, C6-10aryl, C1-9heteroaryl, -OR 10 , and -N(R 10 )(R 11 ).
  • a compound of (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein R 3a , R 3b , and R 3c are independently selected from hydrogen, halogen, unsubstituted C1-6alkyl, C1-6haloalkyl, and -OR 10 , wherein each R 10 is independently selected from hydrogen and unsubstituted C 1-6 alkyl.
  • R 3a , R 3b , and R 3c are hydrogen.
  • R 1 is hydrogen.
  • R 1 is C1- 6alkyl optionally substituted with one, two, or three groups selected from halogen, -CN, C1- 6 alkyl, C 1-6 haloalkyl, C 3-6 cycloalkyl, C 2-9 heterocycloalkyl, C 6-10 aryl, C 1-9 heteroaryl, -OR 10 , and -N(R 10 )(R 11 ).
  • a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein R 1 is unsubstituted C1-6alkyl.
  • a pharmaceutical composition comprising a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, and at least one pharmaceutically acceptable excipient.
  • a method of inhibiting miRNA processing in a subject in need thereof comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of treating a disease, disorder, or condition treatable by inhibiting miRNA processing in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • a method of treating a disease, disorder, or condition treatable by inhibiting mRNA function in a subject in need thereof comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • RNA function in another aspect, described herein is a method of treating a disease, disorder, or condition treatable by inhibiting non-coding RNA function in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • a compound of Formula (I’) or (I) in another aspect, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • RNA directly with small molecules Only relatively few examples of targeting RNA directly with small molecules have been demonstrated, largely natural product antibiotic targeting the ribosome, and even fewer have been shown to provide therapeutic benefit through impacting the regulatory function of an RNA implicated in a disease state, largely due to the fact that understanding of how to design small molecules that bind to specific RNA structures in still in its infancy.
  • An alternative approach where the corresponding mRNA associated with the pathogenic but undruggable protein is targeted with a small molecule drug is highly attractive. This would be analogous to what is done with antisense and other oligonucleotide-based therapeutics, but wwld avoid the pitfalls of oligonucleotide chemistry (distribution, cell penetration, toxicities, etc).
  • RNA secondary and tertiary structures occur extensively in mRNAs and are known to frequently regulate the translational output from the message, as well as alternative splicing mechanisms, thus providing discrete molecular targets for therapeutic intervention with small molecules that bind to the regulatory structures.
  • Small molecule therapeutics can be optimized to exhibit excellent absorption from the gut, excellent distribution to target organs, and excellent cell penetration.
  • the present disclosure describes the use of small molecules with favorable drug properties that bind and modulate the activity of a target RNA.
  • a method of identifying a small molecule that binds to and modulates the function of a target RNA comprising the steps of: screening one or more disclosed compounds for binding to the target RNA and analyzing the results by an RNA binding assay disclosed herein.
  • the target RNA is selected from a mRNA or a noncoding RNA.
  • RNA regulatory' elements include, but are not limited to IRES and upstream open reading frames (u()RF) that affect translation efficiency, intronic and exonic sequences that affect splicing efficiency and alternative splicing patterns, 3’ UTR sequences that affect mRNA and protein localization, and elements that control mRNA decay and halflife.
  • splicing can be modulated to allow skip exons containing mutations that introduce stop codons in order to relieve premature termination during translation.
  • RNA elements can have beneficial effects.
  • the present disclosure provides methods of modulating the downstream protein expression associated with a target mRNA with a small molecule, wherein the small molecule is identified according to the screening methods disclosed herein.
  • described herein is a method of producing a small molecule that modulates the downstream protein expression associated with a target mRNA to treat a disease or disorder, comprising the steps of: screening one or more disclosed compounds for binding to the target mRNA; and analyzing the results by an RNA binding assay disclosed herein.
  • the target mRNA is androgen receptor (AR) mRN A.
  • described herein is a method of treating a disease or disorder mediated by mRNA, comprising the step of administering to a patient in need thereof a compound disclosed herein.
  • the present disclosure provides methods of modulating the downstream mRNA expression associated with a target mRNA with a small molecule, wherein the small molecule is identified according to the screening methods disclosed herein.
  • a method of producing a small molecule that modulates the downstream mRNA expression associated with a target mRNA to treat a disease or disorder comprising the steps of: screening one or more disclosed compounds for binding to the target mRNA; and analyzing the results by an RNA binding assay disclosed herein.
  • described herein is a method of treating a disease or disorder mediated by mRNA, comprising the step of administering to a patient in need thereof a compound disclosed herein.
  • RNA that is transcribed but not translated into protein is termed "non-coding RNA”.
  • the many varieties of non-coding RNAs play a wide range of regulatory functions, and thus they represent a large set of potential RNA targets.
  • the term "non-coding RNA,” as used herein, includes but is not limited to micro-RNA (miRN.A), long non-coding RNA (IncRNA), long intergenic non-coding RNA (lincRN.A), Pi wi -interacting RNA (piRNA), competing endogenous RNA (ceRNA), and pseudo-genes. Within each of these sub-categories are a large number of RNA targets with significant therapeutic potential.
  • niiRNAs are short double-strand RNAs that regulate gene expression of many human genes (see Elliott & Ladomery, Molecular Biology of RNA, 2 nd Ed.).
  • miRNAs have been shown to regulate oncogenes and tumor suppressors and themselves can act as oncogenes or tumor suppressors. In the case of oncogenic miRNAs, their inhibition could be an effective anticancer treatment. In the case of tumor suppressor miRN As, restoration of their function could be an effective anticancer treatment.
  • the present disclosure provides a method of producing a small molecule that modulates the activity of a target miRNA to treat a disease or disorder, comprising the steps of: screening one or more disclosed compounds for binding to the target miRN A; and analyzing the results by an RNA binding assay disclosed herein.
  • the miRNA regulates an oncogene or tumor suppressor, or acts as an oncogene or tumor suppressor.
  • the disease is cancer.
  • described herein are methods of treating a disease mediated by non-coding RNA.
  • the disease is caused by a non-coding RNA.
  • described herein is a method of producing a small molecule that modulates the activity of a target non-coding RNA to treat a disease or disorder, comprising the steps of: screening one or more disclosed compounds for binding to the target non-coding RNA; and analyzing the results by an RNA binding assay disclosed herein.
  • X is N(H);
  • R 1 is selected from hydrogen, C1-6alkyl, C1-6haloalkyl, C3-6cycloalkyl, -CH2-C3- 6cycloalkyl, C 2-9 heterocycloalkyl, -CH 2 -C 2-9 heterocycloalkyl, -CH 2 -C 6-10 aryl, and -CH 2 -C 1-9 heteroaryl, wherein C 1-6 alkyl, C 1-6
  • a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein is a 6,6-bicyclic heteroaryl containing at least two nitrogen atoms.
  • Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein selected from In some embodiments is a compound of Formula (F) or
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (I’) or (I),
  • N N ⁇ s ⁇ is a compound of Formula (F) or (I), or a
  • a compound of Formula (F) or (I), or a ceptable salt or solvate thereof wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein is a 6,5-bicyclic heteroaryl containing at least two heteroatoms selected from N, S, and O, wherein the 6,5-bicyclic heteroaryl is attached to X through the 6-membered ring of the 6,5-bicyclic heteroaryl.
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, In some embodiments is a compound of Formula
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of
  • each R 4 is independently selected from halogen, C1-6alkyl, C1-6haloalkyl, C3-6cycloalkyl, and -OR 10 , wherein C1-6alkyl and C3-6cycloalkyl are optionally substituted with one, two, or three groups selected from halogen, -CN, C 1-6 alkyl, C 1-6 haloalkyl, C 3-6 cycloalkyl, C 2-9 heterocycloalkyl, C 6-10 aryl, C 1-9 heteroaryl, -OR 10 , and - N(R 10 )(R 11 ).
  • each R 4 is independently selected from halogen, unsubstituted C 1-6 alkyl, C 1-6 haloalkyl, unsubstituted C 3-6 cycloalkyl, and -OR 10 , wherein each R 10 is independently selected from hydrogen and unsubstituted C1-6alkyl.
  • each R 4 is independently selected from halogen.
  • each R 4 is independently selected from unsubstituted C1-6alkyl.
  • each R 4 is -OR 10 , wherein each R 10 is independently selected from hydrogen and unsubstituted C1- 6alkyl.
  • each R 4 is -OR 10 , wherein each R 10 is hydrogen.
  • each R 4 is -OR 10 , wherein each R 10 is unsubstituted C1-6alkyl.
  • a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein p is 0, 1, or 2.
  • a compound of Formula (F) or (I) or a pharmaceutically embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein . In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein is .
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein .
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein .
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein In some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein is In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein [0028] In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein In some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein In some embodiments is a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein pharmaceutically acceptable salt or solvate thereof, wherein
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein
  • a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein In some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein is
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein is selected from some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein some embodiments is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein some embodiments is a compound of Formula
  • each R 2 is independently selected from Ci-ealkyl.
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein R 1 and R 2 are combined to form a heterocycloalkyl ring.
  • n is 0, 1, or 2.
  • n is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein n is 2.
  • n is a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof, wherein n is 1.
  • n is 0.
  • n is 3.
  • n is 4.
  • R 3a , R 3b , and R 3c are independently selected from hydrogen, halogen, Ci-ealkyl, Ci-ehaloalkyl, and -OR 10 , wherein Ci-ealkyl is optionally substituted with one, two, or three groups selected from halogen, -CN, Ci-ealkyl, Ci- ehaloalkyl, Cs-ecycloalkyl, C2-9heterocycloalkyl, Ce-ioaryl, Ci-gheteroaryl, -OR 10 , and - N(R 10 )(R n ).
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein R 3a , R 3b , and R 3c are independently selected from hydrogen, halogen, unsubstituted Ci-ealkyl, Ci-ehaloalkyl, and - OR 10 , wherein each R 10 is independently selected from hydrogen and unsubstituted Ci-ealkyl.
  • R 3a , R 3b , and R 3c are independently selected from hydrogen, halogen, and unsubstituted Ci-ealkyl.
  • a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein R 3a , R 3b , and R 3c are independently selected from hydrogen and unsubstituted Ci-ealkyl.
  • R 3a , R 3b , and R 3c are hydrogen.
  • a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein R 1 is hydrogen or C1-6alkyl optionally substituted with one, two, or three groups selected from halogen, -CN, C1-6alkyl, C1-6haloalkyl, C3- 6 cycloalkyl, C 2-9 heterocycloalkyl, C 6-10 aryl, C 1-9 heteroaryl, -OR 10 , and -N(R 10 )(R 11 ).
  • R 1 is hydrogen or C1-6alkyl optionally substituted with one, two, or three groups selected from halogen, -CN, C1-6alkyl, C1-6haloalkyl, C3- 6 cycloalkyl, C 2-9 heterocycloalkyl, C 6-10 aryl, C 1-9 heteroaryl, -OR 10 , and -N(R 10 )(R 11 ).
  • R 1 is hydrogen or C1-6alkyl optionally substituted with one, two, or three
  • a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof wherein R 1 is C 1-6 alkyl optionally substituted with one, two, or three groups selected from halogen, -CN, C1-6alkyl, C1-6haloalkyl, C3-6cycloalkyl, C2-9heterocycloalkyl, C6-10aryl, C1-9heteroaryl, -OR 10 , and - N(R 10 )(R 11 ).
  • R 1 is C 1-6 alkyl optionally substituted with one, two, or three groups selected from halogen, -CN, C1-6alkyl, C1-6haloalkyl, C3-6cycloalkyl, C2-9heterocycloalkyl, C6-10aryl, C1-9heteroaryl, -OR 10 , and - N(R 10 )(R 11 ).
  • R 1 is unsubtituted C 1-6 alkyl.
  • compounds described herein are in the form of pharmaceutically acceptable salts.
  • active metabolites of these compounds having the same type of activity are included in the scope of the present disclosure.
  • the compounds described herein can exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like.
  • the solvated forms of the compounds presented herein are also considered to be disclosed herein.
  • “Pharmaceutically acceptable,” as used herein, refers a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively nontoxic, i.e., the material is administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
  • pharmaceutically acceptable salt refers to a form of a therapeutically active agent that consists of a cationic form of the therapeutically active agent in combination with a suitable anion, or in alternative embodiments, an anionic form of the therapeutically active agent in combination with a suitable cation.
  • Handbook of Pharmaceutical Salts Properties, Selection and Use. International Union of Pure and Applied Chemistry, Wiley- VCH 2002. S.M. Berge, L.D. Bighley, D.C. Monkhouse, J. Pharm. Sci. 1977, 66, 1-19. P. H. Stahl and C. G. Wermuth, editors, Handbook of Pharmaceutical Salts: Properties, Selection and Use, Weinheim/Zurich: Wiley-VCH/VHCA, 2002.
  • Pharmaceutical salts typically are more soluble and more rapidly soluble in stomach and intestinal fluids than nonionic species and so are useful in solid dosage forms. Furthermore, because their solubility often is a function of pH, selective dissolution in one or another part of the digestive tract is possible, and this capability can be manipulated as one aspect of delayed and sustained release behaviors. Also, because the salt-forming molecule can be in equilibrium with a neutral form, passage through biological membranes can be adjusted.
  • pharmaceutically acceptable salts are obtained by reacting a compound described herein with an acid to provide a "pharmaceutically acceptable acid addition salt.”
  • the compound described herein i.e. free base form
  • the compound described herein is basic and is reacted with an organic acid or an inorganic acid.
  • Inorganic acids include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and metaphosphoric acid.
  • Organic acids include, but are not limited to, 1 -hydroxyl- naphthoic acid; 2,2-dichloroacetic acid; 2-hydroxyethanesulfonic acid; 2-oxoglutaric acid; 4- acetamidobenzoic acid; 4-aminosalicylic acid; acetic acid; adipic acid; ascorbic acid (L); aspartic acid (L); benzenesulfonic acid; benzoic acid; camphoric acid (+); camphor- 10- sulfonic acid (+); capric acid (decanoic acid); caproic acid (hexanoic acid); caprylic acid (octanoic acid); carbonic acid; cinnamic acid; citric acid; cyclamic acid; dodecylsulfuric acid; ethane- 1,2-disulfonic acid; ethanesulfonic acid; formic acid; fumaric acid; galactaric acid; gentisic acid; glucoheptonic acid (D);
  • a compound described herein is prepared as a chloride salt, sulfate salt, bromide salt, mesylate salt, maleate salt, citrate salt or phosphate salt.
  • pharmaceutically acceptable salts are obtained by reacting a compound described herein with a base to provide a "pharmaceutically acceptable base addition salt.”
  • the compound described herein is acidic and is reacted with a base.
  • an acidic proton of the compound described herein is replaced by a metal ion, e.g., lithium, sodium, potassium, magnesium, calcium, or an aluminum ion.
  • compounds described herein coordinate with an organic base, such as, but not limited to, ethanolamine, diethanolamine, triethanolamine, tromethamine, meglumine, N- methylglucamine, dicyclohexylamine, tris(hydroxymethyl)methylamine.
  • compounds described herein form salts with amino acids such as, but not limited to, arginine, lysine, and the like.
  • Acceptable inorganic bases used to form salts with compounds that include an acidic proton include, but are not limited to, aluminum hydroxide, calcium hydroxide, potassium hydroxide, sodium carbonate, potassium carbonate, sodium hydroxide, lithium hydroxide, and the like.
  • the compounds provided herein are prepared as a sodium salt, calcium salt, potassium salt, magnesium salt, meglumine salt, N- methylglucamine salt or ammonium salt.
  • solvates contain either stoichiometric or non-stoichiometric amounts of a solvent, and are formed during the process of isolating or purifying the compound with pharmaceutically acceptable solvents such as water, ethanol, and the like. Hydrates are formed when the solvent is water, or alcoholates are formed when the solvent is alcohol. Solvates of compounds described herein are conveniently prepared or formed during the processes described herein. In addition, the compounds provided herein optionally exist in unsolvated as well as solvated forms.
  • the methods and formulations described herein include the use of A-oxides (if appropriate), crystalline forms (also known as polymorphs), or pharmaceutically acceptable salts of compounds described herein, as well as active metabolites of these compounds having the same type of activity.
  • sites on the organic groups (e.g., alkyl groups, aromatic rings) of compounds described herein are susceptible to various metabolic reactions. Incorporation of appropriate substituents on the organic groups will reduce, minimize or eliminate this metabolic pathway.
  • the appropriate substituent to decrease or eliminate the susceptibility of the aromatic ring to metabolic reactions is, by way of example only, a halogen, deuterium, an alkyl group, a haloalkyl group, or a deuteroalkyl group.
  • the compounds described herein are labeled isotopically (e.g., with a radioisotope) or by another other means, including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.
  • Compounds described herein include isotopically-labeled compounds, which are identical to those recited in the various formulae and structures presented herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
  • isotopes examples include isotopes of hydrogen, carbon, nitrogen, oxygen, fluorine and chlorine, such as, for example, 2 H, 3 H, 13 C, 14 C, 15 N, 18 O, 17 O, 35 S, 18 F, 36 C1.
  • isotopically-labeled compounds described herein for example those into which radioactive isotopes such as 3 H and 14 C are incorporated, are useful in drug and/or substrate tissue distribution assays.
  • substitution with isotopes such as deuterium affords certain therapeutic advantages resulting from greater metabolic stability, such as, for example, increased in vivo half-life or reduced dosage requirements.
  • one or more hydrogen atoms of the compounds described herein is replaced with deuterium.
  • the compounds described herein possess one or more stereocenters and each stereocenter exists independently in either the R or S configuration.
  • the compounds presented herein include all diastereomeric, enantiomeric, atropisomers, and epimeric forms as well as the appropriate mixtures thereof.
  • the compounds and methods provided herein include all cis, trans, syn, anti,
  • E
  • Z
  • all possible isomers, as well as their racemic and optically pure forms, and all tautomeric forms are also intended to be included.
  • the term “geometric isomer” refers to E or Z geometric isomers (e.g., cis or trans) of an alkene double bond.
  • positional isomer refers to structural isomers around a central ring, such as ortho-, meta-, and para- isomers around a benzene ring.
  • a "tautomer” refers to a molecule wherein a proton shift from one atom of a molecule to another atom of the same molecule is possible.
  • the compounds presented herein exist as tautomers.
  • a chemical equilibrium of the tautomers will exist. The exact ratio of the tautomers depends on several factors, including physical state, temperature, solvent, and pH.
  • stereoisomers are obtained, if desired, by methods such as, stereoselective synthesis and/or the separation of stereoisomers by chiral chromatographic columns.
  • compounds described herein are prepared as their individual stereoisomers by reacting a racemic mixture of the compound with an optically active resolving agent to form a pair of diastereoisomeric compounds/salts, separating the diastereomers and recovering the optically pure enantiomers.
  • resolution of enantiomers is carried out using covalent diastereomeric derivatives of the compounds described herein.
  • diastereomers are separated by separation/resolution techniques based upon differences in solubility.
  • stereoisomers are obtained by stereoselective synthesis.
  • compounds described herein are prepared as prodrugs.
  • a “prodrug” refers to an agent that is converted into the parent drug in vivo. Prodrugs are often useful because, in some situations, they are easier to administer than the parent drug. They are, for instance, bioavailable by oral administration whereas the parent is not.
  • the prodrug may be a substrate for a transporter. Further or alternatively, the prodrug also has improved solubility in pharmaceutical compositions over the parent drug. In some embodiments, the design of a prodrug increases the effective water solubility.
  • An example, without limitation, of a prodrug is a compound described herein, which is administered as an ester (the “prodrug”) but then is metabolically hydrolyzed to provide the active entity.
  • a further example of a prodrug is a short peptide (polyaminoacid) bonded to an acid group where the peptide is metabolized to reveal the active moiety.
  • a prodrug upon in vivo administration, is chemically converted to the biologically, pharmaceutically, or therapeutically active form of the compound.
  • a prodrug is enzymatically metabolized by one or more steps or processes to the biologically, pharmaceutically or therapeutically active form of the compound.
  • Prodrugs of the compounds described herein include, but are not limited to, esters, ethers, carbonates, thiocarbonates, N-acyl derivatives, N-acyloxyalkyl derivatives, quaternary derivatives of tertiary amines, N-Mannich bases, Schiff bases, amino acid conjugates, phosphate esters, and sulfonate esters. See for example Design of Prodrugs, Bundgaard, A. Ed., Elseview, 1985 and Method in Enzymology, Widder, K. et al., Ed.; Academic, 1985, vol. 42, p. 309-396; Bundgaard, H.
  • a hydroxyl group in the compounds disclosed herein is used to form a prodrug, wherein the hydroxyl group is incorporated into an acyloxyalkyl ester, alkoxycarbonyloxyalkyl ester, alkyl ester, aryl ester, phosphate ester, sugar ester, ether, and the like.
  • a hydroxyl group in the compounds disclosed herein is a prodrug wherein the hydroxyl is then metabolized in vivo to provide a carboxylic acid group.
  • a carboxyl group is used to provide an ester or amide (i.e. the prodrug), which is then metabolized in vivo to provide a carboxylic acid group.
  • compounds described herein are prepared as alkyl ester prodrugs.
  • Prodrug forms of the herein described compounds, wherein the prodrug is metabolized in vivo to produce a compound described herein as set forth herein are included within the scope of the claims.
  • some of the herein-described compounds is a prodrug for another derivative or active compound.
  • a prodrug of the compound disclosed herein permits targeted delivery of the compound to a particular region of the gastrointestinal tract. Formation of a pharmacologically active metabolite by the colonic metabolism of drugs is a commonly used “prodrug” approach for the colon-specific drug delivery systems.
  • a prodrug is formed by the formation of a covalent linkage between drug and a carrier in such a manner that upon oral administration the moiety remains intact in the stomach and small intestine.
  • This approach involves the formation of a prodrug, which is a pharmacologically inactive derivative of a parent drug molecule that requires spontaneous or enzymatic transformation in the biological environment to release the active drug.
  • Formation of prodrugs has improved delivery properties over the parent drug molecule.
  • the problem of stability of certain drugs from the adverse environment of the upper gastrointestinal tract can be eliminated by prodrug formation, which is converted into the parent drug molecule once it reaches the colon.
  • Site specific drug delivery through site specific prodrug activation may be accomplished by the utilization of some specific property at the target site, such as altered pH or high activity of certain enzymes relative to the nontarget tissues for the prodrug-drug conversion.
  • the compounds described herein are metabolized upon administration to an organism in need to produce a metabolite that is then used to produce a desired effect, including a desired therapeutic effect.
  • a “metabolite” of a compound disclosed herein is a derivative of that compound that is formed when the compound is metabolized.
  • active metabolite refers to a biologically active derivative of a compound that is formed when the compound is metabolized.
  • metabolized refers to the sum of the processes (including, but not limited to, hydrolysis reactions and reactions catalyzed by enzymes) by which a particular substance is changed by an organism. Thus, enzymes may produce specific structural alterations to a compound.
  • cytochrome P450 catalyzes a variety of oxidative and reductive reactions while uridine diphosphate glucuronyltransferases catalyze the transfer of an activated glucuronic-acid molecule to aromatic alcohols, aliphatic alcohols, carboxylic acids, amines and free sulphydryl groups.
  • Metabolites of the compounds disclosed herein are optionally identified either by administration of compounds to a host and analysis of tissue samples from the host, or by incubation of compounds with hepatic cells in vitro and analysis of the resulting compounds.
  • the compounds are rapidly metabolized in plasma. In additional or further embodiments, the compounds are rapidly metabolized by the intestines. In additional or further embodiments, the compounds are rapidly metabolized by the liver.
  • Suitable reference books and treatise that detail the synthesis of reactants useful in the preparation of compounds described herein, or provide references to articles that describe the preparation include for example, “Synthetic Organic Chemistry", John Wiley & Sons, Inc., New York; S. R. Sandler et al., "Organic Functional Group Preparations,” 2nd Ed., Academic Press, New York, 1983; H. O. House, “Modem Synthetic Reactions", 2nd Ed., W. A. Benjamin, Inc. Menlo Park, Calif. 1972; T. L. Gilchrist, "Heterocyclic Chemistry", 2nd Ed., John Wiley & Sons, New York, 1992; J.
  • compounds are prepared as described in the Examples.
  • Ci-C x includes C1-C2, C1-C3 . . . Ci-C x .
  • a group designated as "C1-C4" indicates that there are one to four carbon atoms in the moiety, i.e. groups containing 1 carbon atom, 2 carbon atoms, 3 carbon atoms or 4 carbon atoms.
  • C1-C4 alkyl indicates that there are one to four carbon atoms in the alkyl group, i.e., the alkyl group is selected from among methyl, ethyl, propyl, iso- propyl, //-butyl, Ao-butyl, .scc-butyl, and /-butyl.
  • alkyl refers to an aliphatic hydrocarbon group.
  • the alkyl group is branched or straight chain.
  • the “alkyl” group has 1 to 10 carbon atoms, i.e. a Ci-Cioalkyl.
  • a numerical range such as “1 to 10” refers to each integer in the given range; e.g., “1 to 10 carbon atoms” means that the alkyl group consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms, 6 carbon atoms, etc., up to and including 10 carbon atoms, although the present definition also covers the occurrence of the term “alkyl” where no numerical range is designated.
  • an alkyl is a Ci-Cealkyl.
  • the alkyl is methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, or t-butyl.
  • Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, secbutyl, tertiary butyl, pentyl, neopentyl, or hexyl.
  • an “alkylene” group refers to a divalent alkyl group. Any of the above mentioned monovalent alkyl groups may be an alkylene by abstraction of a second hydrogen atom from the alkyl.
  • an alkylene is a Ci-Cealkylene.
  • an alkylene is a Ci-C4alkylene.
  • an alkylene comprises one to four carbon atoms (e.g., C1-C4 alkylene).
  • an alkylene comprises one to three carbon atoms (e.g., C1-C3 alkylene).
  • an alkylene comprises one to two carbon atoms (e.g., C1-C2 alkylene).
  • an alkylene comprises one carbon atom (e.g., Ci alkylene). In other embodiments, an alkylene comprises two carbon atoms (e.g., C2 alkylene). In other embodiments, an alkylene comprises two to four carbon atoms (e.g., C2-C4 alkylene).
  • Typical alkylene groups include, but are not limited to, -CH2-, - CH(CH 3 )-, -C(CH 3 ) 2 -, -CH2CH2-, -CH 2 CH(CH 3 )-, -CH 2 C(CH 3 ) 2 -, -CH2CH2CH2-, - CH2CH2CH2CH2-, and the like.
  • Deuteroalkyl refers to an alkyl group where 1 or more hydrogen atoms of an alkyl are replaced with deuterium.
  • alkenyl refers to a type of alkyl group in which at least one carboncarbon double bond is present.
  • R is H or an alkyl.
  • an alkenyl is selected from ethenyl (i.e., vinyl), propenyl (i.e., allyl), butenyl, pentenyl, pentadienyl, and the like.
  • alkynyl refers to a type of alkyl group in which at least one carboncarbon triple bond is present.
  • R is H or an alkyl.
  • an alkynyl is selected from ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like.
  • alkoxy group refers to a (alkyl)O- group, where alkyl is as defined herein.
  • alkylamine refers to the -N(alkyl) x H y group, where x is 0 and y is 2, or where x is 1 and y is 1, or where x is 2 and y is 0.
  • aromatic refers to a planar ring having a delocalized 71-electron system containing 4n+2 71 electrons, where n is an integer.
  • aromatic includes both carbocyclic aryl (“aryl”, e.g., phenyl) and heterocyclic aryl (or “heteroaryl” or “heteroaromatic”) groups (e.g., pyridine).
  • aryl e.g., phenyl
  • heterocyclic aryl or “heteroaryl” or “heteroaromatic” groups
  • pyridine e.g., pyridine
  • the term includes monocyclic or fused-ring polycyclic (i.e., rings which share adjacent pairs of carbon or nitrogen atoms) groups.
  • Carbocyclic refers to a ring or ring system where the atoms forming the backbone of the ring are all carbon atoms. The term thus distinguishes carbocyclic from “heterocyclic” rings or “heterocycles” in which the ring backbone contains at least one atom which is different from carbon. In some embodiments, at least one of the two rings of a bicyclic carbocycle is aromatic. In some embodiments, both rings of a bicyclic carbocycle are aromatic. Carbocycle includes cycloalkyl and aryl.
  • aryl refers to an aromatic ring wherein each of the atoms forming the ring is a carbon atom.
  • aryl is phenyl or a naphthyl.
  • an aryl is a phenyl.
  • an aryl is a Ce-Cioaryl.
  • an aryl group is a monoradical or a diradical (i.e., an arylene group).
  • cycloalkyl refers to a monocyclic or polycyclic aliphatic, non-aromatic group, wherein each of the atoms forming the ring (i.e. skeletal atoms) is a carbon atom.
  • cycloalkyls are spirocyclic or bridged compounds.
  • cycloalkyls are fully saturated.
  • cycloalkyls are partially unsaturated.
  • cycloalkyls are optionally fused with an aromatic ring, and the point of attachment is at a carbon that is not an aromatic ring carbon atom.
  • Cycloalkyl groups include groups having from 3 to 10 ring atoms.
  • cycloalkyl groups are selected from among cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cyclooctyl, spiro[2.2]pentyl, norbornyl and bicyclo[l.l. l]pentyl.
  • a cycloalkyl is a Cs-Cecycloalkyl.
  • a cycloalkyl is a monocyclic cycloalkyl.
  • Monocyclic cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.
  • Polycyclic cycloalkyls include, for example, adamantyl, norbornyl (i.e., bicyclo[2.2.1]heptanyl), norbornenyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like
  • halo or, alternatively, “halogen” or “halide” means fluoro, chloro, bromo or iodo. In some embodiments, halo is fluoro, chloro, or bromo.
  • haloalkyl refers to an alkyl in which one or more hydrogen atoms are replaced by a halogen atom.
  • a fluoroalkyl is a Ci-Cefluoroalkyl.
  • fluoroalkyl refers to an alkyl in which one or more hydrogen atoms are replaced by a fluorine atom.
  • a fluoroalkyl is a Ci-Cefluoroalkyl.
  • a fluoroalkyl is selected from trifluoromethyl, difluoromethyl, fluoromethyl, 2,2,2-trifluoroethyl, l-fluoromethyl-2-fluoroethyl, and the like.
  • heteroalkyl refers to an alkyl group in which one or more skeletal atoms of the alkyl are selected from an atom other than carbon, e.g., oxygen, nitrogen (e.g., -NH-, - N(alkyl)-, sulfur, or combinations thereof.
  • a heteroalkyl is attached to the rest of the molecule at a carbon atom of the heteroalkyl.
  • a heteroalkyl is a Ci- Ceheteroalkyl.
  • heteroalkylene refers to a divalent heteroalkyl group.
  • heterocycle or “heterocyclic” refers to heteroaromatic rings (also known as heteroaryls) and heterocycloalkyl rings (also known as heteroalicyclic groups) containing one to four heteroatoms in the ring(s), where each heteroatom in the ring(s) is selected from O, S and N, wherein each heterocyclic group has from 3 to 10 atoms in its ring system, and with the proviso that any ring does not contain two adjacent O or S atoms.
  • heterocycles are monocyclic, bicyclic, polycyclic, spirocyclic or bridged compounds.
  • Non-aromatic heterocyclic groups include rings having 3 to 10 atoms in its ring system and aromatic heterocyclic groups include rings having 5 to 10 atoms in its ring system.
  • the heterocyclic groups include benzo-fused ring systems.
  • non-aromatic heterocyclic groups are pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothienyl, oxazolidinonyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thioxanyl, piperazinyl, aziridinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxepanyl, thiepanyl, oxazepinyl, diazepinyl, thiazepinyl, 1,2,3,6-tetrahydropyridinyl, pyrrolin-2-yl, pyrrolin-3-yl, indolinyl, 2H-pyranyl, 4H-pyranyl, dioxanyl,
  • aromatic heterocyclic groups are pyridinyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, quinolinyl, isoquinolinyl, indolyl, benzimidazolyl, benzofuranyl, cinnolinyl, indazolyl, indolizinyl, phthalazinyl, pyridazinyl, triazinyl, isoindolyl, pteridinyl, purinyl, oxadiazolyl, thiadiazolyl, furazanyl, benzofurazanyl, benzothiophenyl, benzothiazolyl, benzoxazolyl, quinazolinyl, quinox
  • the foregoing groups are either C-attached (or C-linked) or TV-attached where such is possible.
  • a group derived from pyrrole includes both pyrrol-l-yl (TV-attached) or pyrrol-3-yl (C-attached).
  • a group derived from imidazole includes imidazol-l-yl or imidazol-3-yl (both TV- attached) or imidazol-2-yl, imidazol-4-yl or imidazol-5-yl (all C-attached).
  • the heterocyclic groups include benzo-fused ring systems.
  • at least one of the two rings of a bicyclic heterocycle is aromatic.
  • both rings of a bicyclic heterocycle are aromatic.
  • heteroaryl or, alternatively, “heteroaromatic” refers to an aryl group that includes one or more ring heteroatoms selected from nitrogen, oxygen and sulfur.
  • Illustrative examples of heteroaryl groups include monocyclic heteroaryls and bicyclic heteroaryls.
  • Monocyclic heteroaryls include pyridinyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl, and furazanyl.
  • Bicyclic heteroaryls include indolizine, indole, benzofuran, benzothiophene, indazole, benzimidazole, benzotri azole, purine, quinolizine, quinoline, isoquinoline, cinnoline, phthalazine, quinazoline, quinoxaline, 1,8-naphthyridine, and pteridine.
  • a heteroaryl contains 0-4 N atoms in the ring.
  • a heteroaryl contains 1-4 N atoms in the ring.
  • a heteroaryl contains 0-4 N atoms, 0-1 O atoms, and 0-1 S atoms in the ring. In some embodiments, a heteroaryl contains 1-4 N atoms, 0-1 0 atoms, and 0-1 S atoms in the ring. In some embodiments, heteroaryl is a Ci-Cgheteroaryl. In some embodiments, monocyclic heteroaryl is a Ci-Csheteroaryl. In some embodiments, monocyclic heteroaryl is a 5 -membered or 6-membered heteroaryl. In some embodiments, bicyclic heteroaryl is a Ce-Cgheteroaryl.
  • bicyclic heteroaryl is a 5- membered or 6-membered heteroaryl fused to another 5-membered or 6-membered heteroaryl ring. In some embodiments, bicyclic heteroaryl is a 5-membered or 6-membered heteroaryl fused to a heterocycloalkyl ring. In some embodiments, bicyclic heteroaryl is a 5-membered or 6-membered heteroaryl fused to a phenyl ring.
  • heterocycloalkyl or “heteroalicyclic” group refers to a cycloalkyl group that includes at least one heteroatom selected from nitrogen, oxygen and sulfur.
  • heterocycloalkyls are spirocyclic or bridged compounds.
  • heterocycloalkyls are fully saturated.
  • heterocycloalkyls are partially unsaturated.
  • a heterocycloalkyl is fused with an aryl or heteroaryl.
  • the heterocycloalkyl is oxazolidinonyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, piperidin-2-onyl, pyrrolidine-2, 5-dithionyl, pyrrolidine-2, 5-dionyl, pyrrolidinonyl, imidazolidinyl, imidazolidin-2-onyl, or thiazolidin-2- onyl.
  • heteroalicyclic also includes all ring forms of the carbohydrates, including but not limited to the monosaccharides, the disaccharides and the oligosaccharides.
  • a heterocycloalkyl is a C2-Cioheterocycloalkyl.
  • a heterocycloalkyl is a C4- Cioheterocycloalkyl.
  • a heterocycloalkyl contains 0-2 N atoms in the ring.
  • a heterocycloalkyl contains 0-2 N atoms, 0-2 O atoms and 0-1 S atoms in the ring.
  • bond refers to a chemical bond between two atoms, or two moieties when the atoms joined by the bond are considered to be part of larger substructure. In one aspect, when a group described herein is a bond, the referenced group is absent thereby allowing a bond to be formed between the remaining identified groups.
  • moiety refers to a specific segment or functional group of a molecule. Chemical moieties are often recognized chemical entities embedded in or appended to a molecule.
  • optionally substituted or “substituted” means that the referenced group is optionally substituted with one or more additional group(s).
  • optional substituents are independently selected from D, halogen, -CN, - NH 2 , -OH, -NH(CH 3 ), -N(CH 3 ) 2 , -CH 3 , -CH 2 CH 3 , -CF 3 , -OCH 3 , and -OCF 3 .
  • substituted groups are substituted with one or two of the preceding groups.
  • substituted groups are substituted with one of the preceding groups.
  • module means to interact with a target either directly or indirectly so as to alter the activity of the target, including, by way of example only, to enhance the activity of the target, to inhibit the activity of the target, to limit the activity of the target, or to extend the activity of the target.
  • modulator refers to a molecule that interacts with a target either directly or indirectly.
  • the interactions include, but are not limited to, the interactions of an agonist, partial agonist, an inverse agonist, antagonist, degrader, or combinations thereof.
  • a modulator is an agonist.
  • administer refers to the methods that may be used to enable delivery of compounds or compositions to the desired site of biological action. These methods include, but are not limited to oral routes, intraduodenal routes, parenteral injection (including intravenous, subcutaneous, intraperitoneal, intramuscular, intravascular or infusion), topical and rectal administration. Those of skill in the art are familiar with administration techniques that can be employed with the compounds and methods described herein. In some embodiments, the compounds and compositions described herein are administered orally.
  • co-administration or the like, as used herein, are meant to encompass administration of the selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are administered by the same or different route of administration or at the same or different time.
  • an “effective amount” or “therapeutically effective amount,” as used herein, refer to a sufficient amount of an agent or a compound being administered, which will relieve to some extent one or more of the symptoms of the disease or condition being treated. The result includes reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system.
  • an “effective amount” for therapeutic uses is the amount of the composition comprising a compound as disclosed herein required to provide a clinically significant decrease in disease symptoms.
  • An appropriate “effective” amount in any individual case is optionally determined using techniques, such as a dose escalation study.
  • the terms “enhance” or “enhancing,” as used herein, means to increase or prolong either in potency or duration a desired effect.
  • the term “enhancing” refers to the ability to increase or prolong, either in potency or duration, the effect of other therapeutic agents on a system.
  • An “enhancingeffective amount,” as used herein, refers to an amount adequate to enhance the effect of another therapeutic agent in a desired system.
  • subject or “patient” encompasses mammals.
  • mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like.
  • the mammal is a human.
  • treat include alleviating, abating or ameliorating at least one symptom of a disease or condition, preventing additional symptoms, inhibiting the disease or condition, e.g., arresting the development of the disease or condition, relieving the disease or condition, causing regression of the disease or condition, relieving a condition caused by the disease or condition, or stopping the symptoms of the disease or condition either prophylactically and/or therapeutically.
  • the compounds described herein are formulated into pharmaceutical compositions.
  • Pharmaceutical compositions are formulated in a conventional manner using one or more pharmaceutically acceptable inactive ingredients that facilitate processing of the active compounds into preparations that are used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • a summary of pharmaceutical compositions described herein is found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A.
  • the compounds described herein are administered either alone or in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition.
  • Administration of the compounds and compositions described herein can be affected by any method that enables delivery of the compounds to the site of action.
  • enteral routes including oral, gastric or duodenal feeding tube, rectal suppository and rectal enema
  • parenteral routes injection or infusion, including intraarterial, intracardiac, intradermal, intraduodenal, intramedullary, intramuscular, intraosseous, intraperitoneal, intrathecal, intravascular, intravenous, intravitreal, epidural and subcutaneous), inhalational, transdermal, transmucosal, sublingual, buccal and topical (including epicutaneous, dermal, enema, eye drops, ear drops, intranasal, vaginal) administration, although the most suitable route may depend upon for example the condition and disorder of the recipient.
  • compounds described herein can be administered locally to the area in need of treatment, by for example, local infusion during surgery, topical application such as creams or ointments, injection, catheter, or implant.
  • topical application such as creams or ointments, injection, catheter, or implant.
  • the administration can also be by direct injection at the site of a diseased tissue or organ.
  • compositions suitable for oral administration are presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion.
  • the active ingredient is presented as a bolus, electuary or paste.
  • compositions which can be used orally include tablets, push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. Tablets may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with binders, inert diluents, or lubricating, surface active or dispersing agents. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
  • the tablets are coated or scored and are formulated so as to provide slow or controlled release of the active ingredient therein. All formulations for oral administration should be in dosages suitable for such administration.
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In some embodiments, stabilizers are added. Dragee cores are provided with suitable coatings.
  • concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or Dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions are formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions may be presented in unitdose or multi-dose containers, for example sealed ampoules and vials, and may be stored in powder form or in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or sterile pyrogen-free water, immediately prior to use.
  • sterile liquid carrier for example, saline or sterile pyrogen-free water
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
  • compositions for parenteral administration include aqueous and non-aqueous (oily) sterile injection solutions of the active compounds which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • compositions may also be formulated as a depot preparation. Such long-acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • the compounds may be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • the compositions may take the form of tablets, lozenges, pastilles, or gels formulated in conventional manner. Such compositions may comprise the active ingredient in a flavored basis such as sucrose and acacia or tragacanth.
  • compositions may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter, polyethylene glycol, or other glycerides.
  • compositions may be administered topically, that is by non-systemic administration.
  • non-systemic administration includes the application of a compound of the present invention externally to the epidermis or the buccal cavity and the instillation of such a compound into the ear, eye and nose, such that the compound does not significantly enter the blood stream.
  • systemic administration refers to oral, intravenous, intraperitoneal and intramuscular administration.
  • compositions suitable for topical administration include liquid or semi -liquid preparations suitable for penetration through the skin to the site of inflammation such as gels, liniments, lotions, creams, ointments or pastes, and drops suitable for administration to the eye, ear or nose.
  • the active ingredient may comprise, for topical administration, from 0.001% to 10% w/w, for instance from 1% to 2% by weight of the formulation.
  • compositions for administration by inhalation are conveniently delivered from an insufflator, nebulizer pressurized packs or other convenient means of delivering an aerosol spray.
  • Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • pharmaceutical preparations may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base such as lactose or starch.
  • the powder composition may be presented in unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflator.
  • a compound disclosed herein is formulated to provide a controlled release of the compound.
  • Controlled release refers to the release of the compound described herein from a dosage form in which it is incorporated according to a desired profile over an extended period of time.
  • Controlled release profiles include, for example, sustained release, prolonged release, pulsatile release, and delayed release profiles.
  • immediate release compositions controlled release compositions allow delivery of an agent to a subject over an extended period of time according to a predetermined profile.
  • Such release rates can provide therapeutically effective levels of agent for an extended period of time and thereby provide a longer period of pharmacologic response while minimizing side effects as compared to conventional rapid release dosage forms.
  • Such longer periods of response provide for many inherent benefits that are not achieved with the corresponding short acting, immediate release preparations.
  • pH-sensitive polymers The majority of enteric and colon targeted delivery systems are based on the coating of tablets or pellets, which are filled into conventional hard gelatin capsules. Most commonly used pH-dependent coating polymers are methacrylic acid copolymers, commonly known as Eudragit® S, more specifically Eudragit® L and Eudragit® S. Eudragit® LI 00 and S 100 are copolymers of methacrylic acid and methyl methacrylate. Additional pH-dependent coating polymers include cellulose acetate phthalate (CAP), hydroxypropyl methylcellulose phthalate (HPMCP), polyvinyl acetate phthalate (PVAP) and cellulose acetate trimelliate.
  • CAP cellulose acetate phthalate
  • HPMCP hydroxypropyl methylcellulose phthalate
  • PVAP polyvinyl acetate phthalate
  • Another approach towards colon-targeted drug delivery or controlled-release systems includes embedding the drug in polymer matrices to trap it and release it in the colon. These matrices can be pH-sensitive or biodegradable. Matrix-Based Systems, such as multi-matrix (MMX)-based delayed-release tablets, ensure the drug release in the colon.
  • MMX multi-matrix
  • Additional pharmaceutical approaches to targeted delivery of therapeutics to particular regions of the gastrointestinal tract are known. Chourasia MK, Jain SK, Pharmaceutical approaches to colon targeted drug delivery systems., J Pharm Sci. 2003 Jan- Apr; 6(l):33-66. Patel M, Shah T, Amin A. Therapeutic opportunities in colon-specific drugdelivery systems Crit Rev Ther Drug Carrier Syst.
  • described herein is a method of modulating the function of a RNA in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of modulating the function of a mRNA in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of modulating the function of a non-coding RNA in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of modulating the function of a miRNA in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of inhibiting RNA processing in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of inhibiting mRNA processing in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof. In some embodiments, described herein is a method of inhibiting miRNA processing in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of treating a disease, disorder, or condition treatable by modulating the function of a RNA in a subject in need thereof, comprising administering to the subject a compound of Formula (I’) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of treating a disease, disorder, or condition treatable by modulating the function of a mRNA in a subject in need thereof, comprising administering to the subject a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of treating a disease, disorder, or condition treatable by modulating the function of a miRNA in a subject in need thereof, comprising administering to the subject a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of treating a disease, disorder, or condition treatable by inhibiting RNA function in a subject in need thereof, comprising administering to the subject a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of treating a disease, disorder, or condition treatable by inhibiting mRNA function in a subject in need thereof, comprising administering to the subject a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of treating a disease, disorder, or condition treatable by inhibiting non-coding RNA function in a subject in need thereof, comprising administering to the subject a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • described herein is a method of treating a disease, disorder, or condition treatable by inhibiting miRNA processing in a subject in need thereof, comprising administering to the subject a compound of Formula (F) or (I), or a pharmaceutically acceptable salt or solvate thereof.
  • compositions containing the compound(s) described herein are administered for prophylactic and/or therapeutic treatments.
  • the compositions are administered to a patient already suffering from a disease or condition, in an amount sufficient to cure or at least partially arrest at least one of the symptoms of the disease or condition. Amounts effective for this use depend on the severity and course of the disease or condition, previous therapy, the patient's health status, weight, and response to the drugs, and the judgment of the treating physician.
  • Therapeutically effective amounts are optionally determined by methods including, but not limited to, a dose escalation and/or dose ranging clinical trial.
  • compositions containing the compounds described herein are administered to a patient susceptible to or otherwise at risk of a particular disease, disorder, or condition. Such an amount is defined to be a "prophylactically effective amount or dose.”
  • prophylactically effective amount or dose In this use, the precise amounts also depend on the patient's state of health, weight, and the like. When used in patients, effective amounts for this use will depend on the severity and course of the disease, disorder, or condition, previous therapy, the patient's health status and response to the drugs, and the judgment of the treating physician.
  • prophylactic treatments include administering to a mammal, who previously experienced at least one symptom of the disease being treated and is currently in remission, a pharmaceutical composition comprising a compound described herein in order to prevent a return of the symptoms of the disease or condition.
  • the compounds are administered chronically, that is, for an extended period of time, including throughout the duration of the patient’s life in order to ameliorate or otherwise control or limit the symptoms of the patient’s disease or condition.
  • the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (z.e., a “drug holiday”).
  • the length of the drug holiday is between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or more than 28 days.
  • the dose reduction during a drug holiday is, by way of example only, by 10%-100%, including by way of example only 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%.
  • a maintenance dose is administered if necessary. Subsequently, in specific embodiments, the dosage or the frequency of administration, or both, is reduced, as a function of the symptoms, to a level at which the improved disease, disorder, or condition is retained. In certain embodiments, however, the patient requires intermittent treatment on a long-term basis upon any recurrence of symptoms.
  • the amount of a given agent that corresponds to such an amount varies depending upon factors such as the particular compound, disease condition and its severity, the identity (e.g., weight, sex) of the subject or host in need of treatment, but nevertheless is determined according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, the condition being treated, and the subject or host being treated.
  • doses employed for adult human treatment are typically in the range of 0.01 mg-5000 mg per day. In one aspect, doses employed for adult human treatment are from about 1 mg to about 1000 mg per day. In one embodiment, the desired dose is conveniently presented in a single dose or in divided doses administered simultaneously or at appropriate intervals, for example as two, three, four or more sub-doses per day.
  • the daily dosages appropriate for the compound described herein are from about 0.01 to about 50 mg/kg per body weight. In some embodiments, the daily dosage or the amount of active in the dosage form are lower or higher than the ranges indicated herein, based on a number of variables in regard to an individual treatment regime. In various embodiments, the daily and unit dosages are altered depending on a number of variables including, but not limited to, the activity of the compound used, the disease or condition to be treated, the mode of administration, the requirements of the individual subject, the severity of the disease or condition being treated, and the judgment of the practitioner.
  • Toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 and the ED50.
  • the dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50.
  • the data obtained from cell culture assays and animal studies are used in formulating the therapeutically effective daily dosage range and/or the therapeutically effective unit dosage amount for use in mammals, including humans.
  • the daily dosage amount of the compounds described herein lies within a range of circulating concentrations that include the ED50 with minimal toxicity.
  • the daily dosage range and/or the unit dosage amount varies within this range depending upon the dosage form employed and the route of administration utilized.
  • any of the aforementioned aspects are further embodiments in which the effective amount of the compound described herein is: (a) systemically administered to the mammal; and/or (b) administered orally to the mammal; and/or (c) intravenously administered to the mammal; and/or (d) administered by injection to the mammal; and/or (e) administered topically to the mammal; and/or (f) administered non-systemically or locally to the mammal.
  • the effective amount of the compound described herein is: (a) systemically administered to the mammal; and/or (b) administered orally to the mammal; and/or (c) intravenously administered to the mammal; and/or (d) administered by injection to the mammal; and/or (e) administered topically to the mammal; and/or (f) administered non-systemically or locally to the mammal.
  • the effective amount of the compound described herein is: (a) systemically administered to the mammal; and/or (b) administered or
  • any of the aforementioned aspects are further embodiments comprising multiple administrations of the effective amount of the compound, including further embodiments in which (i) the compound is administered continuously or intermittently: as in a single dose; (ii) the time between multiple administrations is every 6 hours; (iii) the compound is administered to the mammal every 8 hours; (iv) the compound is administered to the mammal every 12 hours; (v) the compound is administered to the mammal every 24 hours.
  • the method comprises a drug holiday, wherein the administration of the compound is temporarily suspended or the dose of the compound being administered is temporarily reduced; at the end of the drug holiday, dosing of the compound is resumed.
  • the length of the drug holiday varies from 2 days to 1 year.
  • the dosage regimen to treat, prevent, or ameliorate the condition(s) for which relief is sought is modified in accordance with a variety of factors (e.g., the disease, disorder, or condition from which the subject suffers; the age, w eight, sex, diet, and medical condition of the subject).
  • the dosage regimen actually employed varies and, in some embodiments, deviates from the dosage regimens set forth herein.
  • the compounds described herein as well as combination therapies are administered before, during or after the occurrence of a disease or condition, and the timing of administering the composition containing a compound varies.
  • the compounds described herein are used as a prophylactic and are administered continuously to subjects with a propensity to develop conditions or diseases in order to prevent the occurrence of the disease or condition.
  • the compounds and compositions are administered to a subject during or as soon as possible after the onset of the symptoms.
  • a compound described herein is administered as soon as is practicable after the onset of a disease or condition is detected or suspected, and for a length of time necessary for the treatment of the disease.
  • the length required for treatment varies, and the treatment length is adjusted to suit the specific needs of each subject.
  • a compound described herein or a formulation containing the compound is administered for at least 2 weeks, about 1 month to about 5 years.
  • Step 1 To a solution of 2-chloroquinoxaline 1 (41.4 mg, 251.48 umol, 1 eq) and tert-butyl 4-(2-aminopyridin-4-yl)piperazine-l -carboxylate 2 (70.0 mg, 251.48 umol, 1 eq) in dioxane (2 mL) was added Pd2(dba)s (23.1 mg, 25.15 umol, 0.1 eq), XPhos (24.0 mg, 50.30 umol, 0.2 eq) and CS2CO3 (164 mg, 502.97 umol, 2 eq). The reaction mixture was stirred at 100 °C for 2 hours under an atmosphere of nitrogen.
  • Step 2 A solution of tert-butyl 4-(2-(quinoxalin-2-ylamino)pyridin-4-yl)piperazine- 1-carboxylate 3 (68.0 mg, 167.29 umol, 1 eq) in HCI/MeOH (2 mL, 4M) was stirred at 25 °C for 12 hours. The reaction mixture was concentrated in vacuum to afford N-(4-(piperazin-l- yl)pyridin-2-yl)quinoxalin-2-amine (53.8 mg, 94% yield, hydrogen chloride salt) as a white solid.
  • Examples 2 through 20 were prepared in an analogous manner.
  • Step 1 To a solution of 2,4-dichloro-5-nitropyrimidine (50.0 g, 257.76 mmol, 1 eq) in tetrahydrofuran (500 mL) was added N-ethyl-N-isopropylpropan-2-amine (33.3 g, 257.76 mmol, 1 eq), methylamine (17.4 g, 257.76 mmol, 1 eq, HC1) at -70 °C under an atmosphere of nitrogen.
  • Step 2 A solution of 2-chloro-N-methyl-5-nitropyrimidin-4-amine (19.3 g, 102.24 mmol, 1 eq), Fe power (28.5 g, 511.21 mmol, 5 eq) and ammonium chloride (54.7 g, 1.02 mol, 10 eq) in ethanol (300 mL) and water (100 mL) was stirred at 80 °C for 3 hours. The mixture was diluted with ethanol (200 mL). The mixture was filtered, the filtrate was concentrated under reduce pressure to give 2-chloro-N4-methylpyrimidine-4,5-diamine (14.2 g, 88% yield) as a yellow solid.
  • 1 H NMR (400 MHz, DMSO-t/ 6 ) 6 7.36 (s, 1H), 6.93 (s, 1H), 4.82 (s, 2H), 2.85 (d, J 4.4 Hz, 3H).
  • Step 3 To a solution of 2-chloro-N4-methylpyrimidine-4,5-diamine (13.2 g, 83.23 mmol, 1 eq) in trimethoxymethane 5 (268 g, 2.53 mol, 30.38 eq) was added cont. HC1 (12.0 M, 13.87 mL, 2 eq) and the mixture was stirred at 100 °C for 2 hours. The mixture was concentrated under reduce pressure. The residue was diluted with water (100 mL), and then extracted with ethyl acetate (100 mLx3). The combined organic layers were dried over anhydrous sodium sulfate, filtered and concentrated in vacuum.
  • Step 4 To a solution of 2-chloro-9-methyl-9H-purine (50.0 mg, 296.59 umol, 1 eq) and tert-butyl 4-(2-aminopyridin-4-yl)piperazine-l -carboxylate 7 (82.6 mg, 296.59 umol, 1 eq) in dioxane (2 mL) was added Pd2(dba)s (27.2 mg, 29.66 umol, 0.1 eq), XPhos (28.3 mg, 59.32 umol 0.2 eq) and cesium carbonate (193 mg, 593.18 umol, 2 eq).
  • reaction mixture was stirred at 100 °C for 2 hours under an atmosphere of nitrogen.
  • the reaction mixture was filtered with silica gel powder and the filtrate was concentrated in vacuum.
  • the residue was purified by Prep-HPLC (Column, Phenomenex Luna C18, 150x25mmx l0um; mobile phase: water (NH4HCO3)-MeCN, B%: 21%-51%; RT: 8 min) to give tert-butyl 4-(2-((9-methyl-9H- purin-2-yl)amino)pyridin-4-yl)piperazine-1-carboxylate (12.4 mg, 9% yield, FA salt) as a white solid.
  • Step 5 A solution of tert-butyl 4-(2-((9-methyl-9H-purin-2-yl)amino)pyridin-4- yl)piperazine-1-carboxylate (7.00 mg, 15.33 umol) in HCl/methanol (2 mL, 4M) was stirred at 25 °C for 1 hour. The reaction mixture was concentrated in vacuum to give 9-methyl-N-(4- (piperazin-1-yl)pyridin-2-yl)-9H-purin-2-amine (Example 21) as a white solid.
  • Step 1 N-(4-(piperazin-1-yl)pyridin-2-yl)-[1,2,4]triazolo[4,3-b]pyridazin-6-amine
  • Step 1 To a solution of 6-chloro-[1,2,4]triazolo[4,3-b]pyridazine (50.0 mg, 323.51 umol, 1 eq) and tert-butyl 4-(2-aminopyridin-4-yl)piperazine-1-carboxylate (90.1 mg, 323.51 umol, 1 eq) in 2-methylpropan-2-ol (2 mL) was added Pd2(dba)3 (29.6 mg, 32.35 umol, 0.1 eq), t-Bu Xphos (27.5 mg, 64.70 umol, 0.2 eq) and potassium phosphate (137 mg, 647.01 umol, 2 eq).
  • reaction mixture was stirred at 100 °C for 2 hours under an atmosphere of nitrogen.
  • the reaction mixture was filtered through silica gel powder and the filtrate were concentrated in vacuum.
  • the residue was treated with methanol (5 mL) and filtered.
  • the filter cake was washed with ethyl acetate (5 mL) and then dried in vacuum to give tert-butyl 4-(2-([1,2,4]triazolo[4,3-b]pyridazin-6-ylamino)pyridin-4-yl)piperazine-1-carboxylate (51.1 mg, 40% yield) as a white solid.
  • Step 2 A solution of tert-butyl 4-(2-([1,2,4]triazolo[4,3-b]pyridazin-6- ylamino)pyridin-4-yl)piperazine-1-carboxylate (20.0 mg, 50.45 umol) in HCl/methanol (2 mL, 4M) was stirred at 25 °C for 12 hours. The reaction mixture was concentrated in vacuum to give 13.7 mg, (81% yield, HCl salt) of N-(4-(piperazin-1-yl)pyridin-2-yl)- [1,2,4]triazolo[4,3-b]pyridazin-6-amine (Example 22) as a white solid.
  • Example 23 7-((4-(piperazin-1-yl)pyridin-2-yl)amino)-1,8-naphthyridin-4(1H)-one
  • Step 1 To a solution of 2,6-dichloronicotinic acid (10.0 g, 52.08 mmol, 1 eq) in dichloromethane (50 mL) was added oxalyl dichloride (8.40 g, 66.15 mmol, 1.27 eq), and N,N-dimethylformamide (76.1 mg, 1.04 mmol, 0.02 eq) at 0 °C under an atmosphere of nitrogen, then it was stirred at 25 °C for 2 hours.
  • Step 2 To a solution of 2,6-dichloronicotinoyl chloride (10.5 g, 49.89 mmol, 1 eq), ethynyltrimethylsilane (5.15 g, 52.39 mmol, 1.05 eq), Pd(PPh 3 ) 2 Cl 2 (700 mg, 997.88 umol, 0.02 eq), and CuI (380 mg, 2.00 mmol, 0.04 eq) in tetrahydrofuran (100 mL) was added triethylamine (5.30 g, 52.39 mmol, 1.05 eq) at 0 °C under an atmosphere of nitrogen.
  • Step 3 To a solution of 1-(2,6-dichloropyridin-3-yl)-3-(trimethylsilyl)prop-2-yn-1- one (8.00 g, 29.39 mmol, 1 eq) and (2,4-dimethoxyphenyl)methanamine (4.91 g, 29.39 mmol, 4.43 mL, 1 eq) in N,N-dimethylformamide (40 mL) was added K2CO3 (8.12 g, 58.78 mmol, 2 eq). The mixture was stirred at 50 °C for 1 hour under an atmosphere of nitrogen. Then it was warmed to 80 °C and stirred for 6 hours.
  • reaction solution was diluted with water (200 mL) and then extracted with ethyl acetate (200 mL x 3). The combined organic layers were washed with brine (200 mL x 2), dried over anhydrous sodium sulfate, filtered and concentrated in vacuum. The residue was purified by flash silica gel chromatography to give 7-chloro-1-(2,4-dimethoxybenzyl)-1,8-naphthyridin-4(1H)-one (3.99 g, 40% yield) as a brown solid.
  • Step 4 To a solution of 7-chloro-1-(2,4-dimethoxybenzyl)-1,8-naphthyridin-4(1H)- one 7 (50 mg, 151.16 umol, 1 eq) and tert-butyl 4-(2-aminopyridin-4-yl)piperazine-1- carboxylate (42.0 mg, 151.16 umol, 1 eq) in dioxane (1.5 mL) was added Pd2(dba)3 (13.8 mg, 15.12 umol, 0.1 eq), XPhos (14.4 mg, 30.23 umol, 0.2 eq), and Cs 2 CO 3 (98.5 mg, 302.33 umol, 2 eq).
  • Example 24 4,8-dimethyl-2-((4-(piperazin-1-yl)pyridin-2-yl)amino)-7,8- dihydropteridin-6(5H)-one hydrochloride
  • Step 1 To a solution of 2,4-dichloro-6-methylpyrimidin-5-amine (3 g, 16.85 mmol, 1 eq) and methylglycine (1.50 g, 16.85 mmol, 1 eq) in ethanol (100 mL) was added sodium hydrogen carbonate (5.10 g, 60.71 mmol, 3.60 eq). The mixture was stirred at 80 °C for 12 hours. The reaction mixture was concentrated in vacuum.
  • Step 2 To a solution of 2-chloro-4,8-dimethyl-7,8-dihydropteridin-6(5H)-one (53.5 mg, 251 umol, 1.0 eq) and tert-butyl 4-(2-aminopyridin-4-yl)piperazine-1-carboxylate (70 mg, 251 umol, 1.0 eq) in dioxane (1 mL) was added XPhos (24.0 mg, 50.3 umol, 0.2 eq), cesium carbonate (164 mg, 503 umol, 2 eq) and Pd2(dba)3 (23.0 mg, 25.1 umol 0.1 eq).
  • reaction mixture was stirred at 100 °C for 2 hours under N2 atmosphere.
  • the reaction mixture was diluted with methanol (5 mL) and then filtered through silica gel. The filtrate was concentrated in vacuum. The residue was triturated with methanol (10 mL) at 20 °C for 12 hours to give tert-butyl 4-(2-((4,8-dimethyl-6-oxo-5,6,7,8-tetrahydropteridin-2- yl)amino)pyridin-4-yl)piperazine-1-carboxylate (70 mg, 59% yield) as a white solid.
  • Step 3 A solution of tert-butyl 4-(2-((4,8-dimethyl-6-oxo-5,6,7,8- tetrahydropteridin-2-yl)amino)pyridin-4-yl)piperazine-1-carboxylate (30 mg, 66 umol, 1 eq) in HCl/MeOH (2 mL, 4M) was stirred at 25 °C for 1 hour.
  • Example 25 2-((4-(piperazin-1-yl)pyridin-2-yl)amino)pyrido[3,4-d]pyrimidin-4(3H)-one [00162]
  • Step 1 To a solution of 2-chloropyrido[3,4-d]pyrimidin-4(3H)-one (50.0 mg, 275.36 umol, 1 eq) and tert-butyl 4-(2-aminopyridin-4-yl)piperazine-1-carboxylate (76.7 mg, 275.36 umol, 1 eq) in dioxane (2 mL) was added Pd 2 (dba) 3 (25.3 mg, 27.54 umol, 0.1 eq), XPhos (26.3 mg, 55.07 umol, 0.2 eq) and t-BuONa (53.0 mg, 550.72 umol, 2 eq).
  • the reaction was stirred at 100 °C for 2 hours under an atmosphere of nitrogen.
  • the reaction mixture was diluted with methanol (5 mL) and then filtered through silica gel.
  • the combined filtrates were concentrated in vacuum.
  • Step 2 A solution of tert-butyl 4-(2-((4-oxo-3,4-dihydropyrido[3,4-d]pyrimidin-2- yl)amino)pyridin-4-yl)piperazine-1-carboxylate (12.0 mg, 28.34 umol, 1 eq) in hydrogen chloride/methanol (1 mL, 4M) was stirred at 20 °C for 12 hours.
  • Example 29 5,8-Dimethyl-2-((4-(piperazin-1-yl)pyridin-2-yl)amino)pyrido[3,2- d]pyrimidin-6(5H)-one [00165] Step 1. To a solution of 2-chloropyrimidin-5-amine (20 g, 154.38 mmol, 1 eq) in dichloromethane (200 mL) was added iron powder (862.1 mg, 15.44 mmol, 0.1 eq). Then a solution of Br2 (29.61 g, 185.26 mmol, 1.2 eq) in dichloromethane (200 mL) was added to the mixture at 0 °C under N 2 atmosphere.
  • 2-chloropyrimidin-5-amine 20 g, 154.38 mmol, 1 eq
  • iron powder 862.1 mg, 15.44 mmol, 0.1 eq
  • Br2 29.61 g, 185.26 mmol, 1.2 eq
  • the reaction mixture was stirred at 25 °C for 12 hours.
  • the reaction mixture was diluted with water (500 mL) and then filtered.
  • the filtrate was standing for layers separation and then the water phase was separated and extracted with ethyl acetate (150 mL x 2).
  • the combined organic phases were washed with brine (200 mL x 2), dried over anhydrous sodium sulfate and then filtered and concentrated in vacuum.
  • the residue was purified by silica gel chromatography to afford 4-bromo-2-chloropyrimidin-5- amine (13.2 g, 41% yield) as a brown solid.
  • the reaction mixture was stirred at 90 °C for 2 hours.
  • the reaction mixture was diluted with water (200 mL) and then extracted with ethyl acetate (100 mL x 3). The combined organic layers were washed with brine (50 mL x 2), dried over anhydrous sodium sulfate, filtered and the filtrate was concentrated in vacuum.
  • the residue was purified by silica gel chromatography to afford ethyl (E)-3-(5-amino-2-chloropyrimidin-4-yl)but-2- enoate (3 g, 52% yield) as a yellow solid.
  • reaction solution was stirred at 100 °C for 1 hour under N2 atmosphere.
  • the reaction mixture was filtered through a pad of celite. The filtrate was concentrated in vacuum. The residue was treated with DMSO (3 mL x 3) at 100 °C. Then the mixture was filtered and the filter cake was dried in vacuum to afford tert-butyl 4-(2-((5,8-dimethyl-6- oxo-5,6-dihydropyrido[3,2-d]pyrimidin-2-yl)amino)pyridin-4-yl)piperazine-1-carboxylate (40 mg, 29% yield) as a yellow solid.
  • Example 30 N-(4-(Piperazin-1-yl)pyridin-2-yl)pyrido[2,3-b]pyrazin-6-amine [00171]
  • Step 1 To a solution of 6-chloropyridine-2,3-diamine (4.5 g, 31.34 mmol, 1 eq) in acetic acid (3.5 mL) and propan-2-ol (35 mL) was added oxalaldehyde (5.46 g, 94.03 mmol, 3 eq) at 25 °C. The mixture was stirred at 60 °C for 4 hours. The reaction mixture was concentrated in vacuum and the residue was diluted with water (60 mL).
  • Step 2 To a solution of 6-chloropyrido[2,3-b]pyrazine (50 mg, 302 umol, 1.0 eq) and tert-butyl 4-(2-aminopyridin-4-yl)piperazine-1-carboxylate (84.1 mg, 302 umol, 1.0 eq) in dioxane (2 mL) was added XPhos (28.8 mg, 60.4 umol, 0.2 eq), cesium carbonate (196 mg, 604 umol, 2 eq) and Pd 2 (dba) 3 (7.7 mg, 30.2 umol 0.1 eq). The reaction mixture was stirred at 100 °C for 2 hours under N2 atmosphere.
  • reaction mixture was filtered with silica gel powder and the filtrate was concentrated in vacuum.
  • the residue was purified by Prep-HPLC (Column: Welch Xtimate C18, 150*25mm*5um; mobile phase: water (NH3H2O)-MeCN, B%: 28%-58%, RT: 8 min) to afford of tert-butyl 4-(2-(pyrido [2,3-b] pyrazin-6-ylamino)pyridin-4-yl)piperazine-1-carboxylate (49.2 mg, 39% yield) as a yellow solid.
  • Step 3 A solution of tert-butyl 4-(2-(pyrido [2,3-b] pyrazin-6-ylamino)pyridin-4- yl)piperazine-1-carboxylate (44 mg, 108 umol, 1 eq) in HCl/MeOH (2 mL, 4M) was stirred at 25 °C for 1 hour. The reaction solution was concentrated in vacuum to afford 27.6 mg (HCl salt) of N-(4-(piperazin-1-yl)pyridin-2-yl)pyrido[2,3-b]pyrazin-6-amine (Example 30) as a white solid.
  • Example 31 1-Methyl-5-((4-(piperazin-1-yl)pyridin-2-yl)amino)-1,3-dihydro-2H- imidazo[4,5-b]pyridin-2-one [00174] Step 1. To a solution of 5-chloro-1-methyl-1H-imidazo[4,5-b]pyridin-2-ol (920 mg, 5.01 mmol, 1 eq) in tetrahydrofuran (10 mL) was added NaH (301 mg, 7.52 mmol, 60% purity, 1.5 eq) at 0 °C.
  • Example 32 N-(4-(Piperazin-1-yl)pyridin-2-yl)-1H-pyrrolo[3,2-b]pyridin-5-amine [00177] Step 1. To a solution of 5-chloro-1H-pyrrolo[3,2-b]pyridine (780 mg, 5.11 mmol, 1 eq) in tetrahydrofuran (15 mL) was added NaH (245 mg, 6.13 mmol, 60% purity, 1.2 eq) at 0 °C under N2. The reaction was stirred at 0 °C for 0.5 hour under N2.
  • the crude product was dissolved in methanol (2 mL) and treated with K2CO3 (92.2 mg, 667.01 umol, 5 eq).
  • the reaction mixture was stirred at 25 °C for 2 hours.
  • the reaction mixture was adjusted to be acidic by progressively adding 12 M HCl aqueous solution. Watrer was added and the mixture was filtered.
  • the filtrate was purified by Prep-HPLC (Column, Phenomenex luna C18, 150 ⁇ 25mm ⁇ 10um; mobile phase: water (formic acid)- acetonitrile, B%: 0%-23%); RT: 10 min) and then purified by Prep-HPLC (Column, Welch Xtimate C18, 150 ⁇ 25mm ⁇ 5um; mobile phase: water (hydrogen chloride) - acetonitrile, B%: 0%-20%, RT: 8 min) to give 5.5 mg (14% yield) of N-(4-(piperazin-1-yl)pyridin-2-yl)-1H-pyrrolo[3,2-b]pyridin-5-amine (Example 32) as a white solid.
  • Step 1 To a solution of 5-chloro-U7-pyrazolo[4,3-Z>]pyridine 1 (0.1 g, 651.17 umol, 1 eq) in tetrahydrofuran (2 mL) was added sodium hydride (31.3 mg, 781.41 umol, 60% purity, 1.2 eq) at 0 °C. (2-(Chloromethoxy)ethyl)trimethylsilane (131 mg, 781.41 umol, 1.2 eq) was then added into the mixture at 0 °C and the mixture was stirred at 20 °C for 1 hour.
  • reaction solution was diluted with aqueous ammonium chloride solution (10 mL) and then extracted with ethyl acetate (10 mL x 3). The combined organic layers were washed with brine (10 mL x 2), dried over anhydrous sodium sulfate, filtered and filtrate was concentrated in vacuum. The residue was purified by flash chromatography on silica gel to give 5-chloro-l-((2-(trimethylsilyl)ethoxy)methyl)-lH-pyrazolo[4,3-b]pyridine (110 mg, 60% yield) as a light yellow oil.
  • Step 2 To a solution of 5-chloro-l-((2-(trimethylsilyl)ethoxy)methyl)-lH- pyrazolo[4,3-b]pyridine (75.0 mg, 264.24 umol, 1 eq) and tert-butyl 4-(2-aminopyridin-4- yl)piperazine-l -carboxylate (73.6 mg, 264.24 umol, 1 eq) in dioxane (2 mL) was added Pd2(dba)s (24.2 mg, 26.42 umol, 0.1 eq), XPhos (25.2 mg, 52.85 umol, 0.2 eq) and CS2CO3 (173 mg, 528.49 umol, 2 eq).
  • Step 3 To a solution of tert-butyl 4-(2-((l-((2-(trimethylsilyl)ethoxy)methyl)-lH- pyrazolo[4,3-b]pyridin-5-yl)amino)pyridin-4-yl)piperazine-l-carboxylate (40.0 mg, 76.09 umol, 1 eq) in di chloromethane (1 mL) was added 2,2,2-trifluoroacetic acid (0.2 mL). The mixture was stirred at 20 °C for 2 hours. The reaction solution was diluted with methanol (10 mL) and concentrated in vacuum.
  • Examples 38 through 40 were prepared in an analogous manner as Example 37.
  • Step 2 To a solution of 2-chloro-4-methoxy-7H-pyrrolo[2,3-d]pyrimidine (3.60 g, 19.61 mmol, 1 eq) in tetrahydrofuran (60 mL) was added NaH (941 mg, 23.53 mmol, 60% purity, 1.2 eq) at 0 °C under an atmosphere of nitrogen. The mixture was stirred at 0 °C for 0.5 hour, and then (2-(chloromethoxy)ethyl)trimethylsilane (3.92 g, 23.53 mmol, 4.16 mL, 1.2 eq) was added at 0 °C.
  • the residue was purified by prep-HPLC (column: Welch Ultimate AQ-C18150 ⁇ 30mm ⁇ 5um; mobile phase: [water (HCl)-MeCN]; B%: 0%-29%, 10min) to give 15 mg (51% yield, HCl salt) 4-methoxy-N-(4-(piperazin-1-yl)pyridin-2-yl)- 7H-pyrrolo[2,3-d]pyrimidin-2-amine (Example 41) as a yellow solid.
  • Example 42 2-((4-(Piperazin-1-yl)pyridin-2-yl)amino)quinazolin-4(3H)-one [00189] Step 1 (Method A). To a stirred solution of 2-chloroquinazolin-4(3H)-one (0.2 g, 1.11 mmol) and tert-butyl 4-(2-aminopyridin-4-yl)piperazine-1-carboxylate (308 mg, 1.11 mmol) in toluene (10 mL), was added caesium carbonate (541 mg, 1.66 mmol). The reaction mixture was purged with argon for 10 minute.
  • Step 1 Other reaction conditions used for Step 1 (Hartwig-Buchwald coupling reaction) are: Method B: Pd(OAc)2, BINAP, Toluene, Cs2CO3, 120 °C; Method C: Brett-Phos Pd-G3, 1,4-dioxane, Cs 2 CO 3 , 110 °C; Method D: Brett-Phos Pd-G3, Toluene, NaO t Bu, 120 °C; Method E: Brett-Phos Pd-G3, DMF, KO t Bu, 120 °C; or Method F: Brett-Phos Pd-G3, Toluene, KO t Bu, 120 °C.
  • Step 2 To a stirred solution of tert-butyl 4-(2-((4-oxo-3,4-dihydroquinazolin-2- yl)amino)pyridin-4-yl)piperazine-1-carboxylate (0.2 g, 473 ⁇ mol) in dichloromethane (3 mL) was added trifluoroacetic acid (0.5 mL) at 0 °C. The reaction was stirred at room temperature for 4 hours. The progress of the reaction was monitored by TLC and LCMS. After completion, the reaction mixture was concentrated under reduced pressure to obtain a yellow oil.
  • Example 43-57 were prepared in a similar fashion as described in example 42.
  • Example 58 N2-[4-(Piperazin-l-yl)pyridin-2-yl]quinazoline-2,4-diamine
  • Step l To a stirred solution of 2-chloroquinazolin-4-amine (0.2 g, 1.11 mmol) in A'A'-di methyl acetamide (10 mL) was treated with tert-butyl 4-(2-aminopyridin-4- yl)piperazine-l -carboxylate (341 mg, 1.1 eq., 1.22 mmol) at room temperature. The resulting reaction mixture was stirred at 150 °C for 16 h. The progress of the reaction was monitored by TLC and LCMS. After completion of the reaction, the reaction mixture was diluted with water (200 mL) and stirred for 10 min.
  • Step 2 To a stirred solution of tert-butyl 4- ⁇ 2-[(4-aminoquinazolin-2- yl)amino]pyridin-4-yl(piperazine-l-carboxylate (150 mg, 356 pmol) in dichloromethane (5 mL), trifluoroacetic acid (0.5 mL) was added at 0 °C and stirred at room temperature for 5 h. After completion of reaction, the reaction mixture is distilled off under reduced pressure to obtain N2-[4-(piperazin-l-yl)pyri din-2 -yl]quinazoline-2,4-diamine as crude, and was further purified by prep HPLC.
  • N4-Methyl-N2-(4-(piperazin-l-yl)pyridin-2-yl)quinazoline-2,4-diamine was prepared in a similar fashion as described in example 58.
  • ES MS m/z 336.30 (M + +l).
  • RNA sample used in the following experiments were synthesized by IDT Technologies as a 5 ’-biotinylated oligonucleotide and had the following sequence: AR RNA: GCCCGUAUUUAGACUGCUACAGUCAACAAUGUCUCUCUUUCAUACUAGAAAAA UUCCGGGU
  • Binding assays are performed in a 5 uL volume in 384-well low volume polypropylene microtiter plate (Greiner Bio-One, Kremsmunster, Austria cat # 784201) at ambient temperature.
  • the assay buffer contains 20 mM sodium phosphate, 5 mM MgC12, and 0.01 mM EDTA at pH 6.5.
  • each biotinylated RNA final concentration 400 nM
  • was added using a Multidrop Combi ThermoScientific, Waltham MA
  • SAMDI MS analysis 2 uL of each mixture is transferred using a 384-channel automated Thermo PlateMate liquid handler to SAMDI biochip arrays functionalized with a Neutravidin-presenting self-assembled monolayer.
  • the SAMDI arrays were incubated for 60 minutes in a humidified chamber to prevent evaporation and allow for specific immobilization of the biotinylated RNA, along with any bound small molecules.
  • the SAMDI arrays were purified by a rapid ⁇ 3 sec gentle wash step with deionized ultra-filtered water (50 uL / spot) and dried with compressed air.
  • the matrix solution comprising 20 mg/mL alpha-cyano cinnamic acid (CHCA) was prepared in 80% acetonitrile-20% aqueous ammonium citrate and 0.3% trifluoroacetic acid and was applied in an automated format using a Combi Nano by dispensing 50 nL to each spot in the array.
  • SAMDI ASMS was performed using the reflector positive mode on an AB Sciex TOF-TOF 5800 System (AB Sciex, Framingham, MA) with 400 shots / spot analyzed by a random raster sampling of the entire spot (20 shots / subspectrum with 20 subspectra pass acceptance), 400 Hz laser frequency, bin size of 1 ns, and detector voltage multiplier of 0.48.
  • a mass window of m/z 230 to m/z 900 was used and a mass threshold of m/z 0.5 applied for peak identification.
  • the AUC of each compound is divided by the sum of that same compound’s AUC and the AUC of the internal comparator.
  • the extent of binding and ionization efficiency are two factors that contribute to the overall RSV.
  • the ratio of RSV calculated for each compound analyzed in the presence of the target over the RSV from the absence of the target provides the signal to background (S/B) value.
  • S/B value informs on the selectivity of the compound that may bind to the surface.
  • Example 61 Small molecule binding to RNA measured by the ligand-detect NMR method
  • a ligand-detected NMR method was used to measure binding of small molecules to RNA.
  • Compounds were first dissolved in pure water or DMSO-d6 at concentrations from 2 to 20 mM, depending on their solubility, then diluted to 40 pM in 588 pL in buffer (20 mM dl9-deuterated bis-Tris buffer at pH 6.5 containing 4.44 pM sodium 4,4-dimethyl-4- silapentane-l-sulfonate, DSA, 9 protons, as chemical shift, and intensity reference, 10% D2O, all dissolved in H2O).
  • the non-binding internal standard DSA was also used as an intensity reference to directly compare the spectra (in the absence or presence of RNA) to identify binding by decreases in the NMR signals of the ligands due to increased rotational correlation time of the ligand when it binds to RNA.
  • the 9 protons on the internal reference also provide a control for ligand concentration.
  • RNA sample used in these experiments were prepared using in vitro transcription on a large scale (typically lOmL).
  • RNA transcription and purification protocols used purified DNA oligonucleotide templates (IDT) and T7 RNA polymerase. Briefly, 1 mL of 8 pM DNA (5’-CTATAGTGAGTCGTATTA-3’), corresponding to the phage T7 RNA polymerase promoter region, was annealed to 80 pL of 100 pM template sequences with 13 mM MgCh, heated to 95 °C for 4 min then allowed to cool to room temperature over 20 min.
  • RNA samples were purified from crude transcriptions by 20% denaturing polyacrylamide gel electrophoresis (PAGE), electroeluted, and concentrated by ethanol precipitation.
  • PAGE denaturing polyacrylamide gel electrophoresis
  • RNA samples were re-dissolved in 12 mL of high salt wash (700 mM NaCl, 200 mM KC1, in 10 mM potassium phosphate at pH 6.5, with 10 pM EDTA to chelate any divalent ions), then concentrated using Centriprep conical concentrators (3,000 kDa MWC, Millipore). The RNA was then slowly exchanged into low salt storage buffer (10 mM potassium phosphate at pH 6.5, with lOmM NaCl and 10 pM EDTA).
  • RNA samples Prior to NMR experiments, all RNA samples were desalted using NAP- 10 gravity columns, lyophilized and re-dissolved in buffer, then annealed by heating for 4 min to 90 °C followed by snap cooling at -20 °C.
  • the RNA has the following sequence: GGG CGU AUU UAG ACU GCU ACA GUC AAC AAU GUC UCU CUU UCA UAC UAG AAA AAU UCC GUC C

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des composés de ciblage d'ARN, des procédés de fabrication de tels composés, des compositions pharmaceutiques et des médicaments comprenant de tels composés, et des méthodes d'utilisation de tels composés dans le traitement d'une maladie.
PCT/US2023/082835 2022-12-09 2023-12-07 Composés de ciblage d'arn et leurs utilisations WO2024123968A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263386869P 2022-12-09 2022-12-09
US63/386,869 2022-12-09

Publications (1)

Publication Number Publication Date
WO2024123968A1 true WO2024123968A1 (fr) 2024-06-13

Family

ID=91380194

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/082835 WO2024123968A1 (fr) 2022-12-09 2023-12-07 Composés de ciblage d'arn et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2024123968A1 (fr)

Similar Documents

Publication Publication Date Title
AU2017204007B2 (en) Heteroaryl compounds and methods of use thereof
US8507676B2 (en) Heterocyclic oxime compounds
US8497368B2 (en) Heterocyclic hydrazone compounds
WO2010086040A1 (fr) Pyrazolo-pyrimidines pour traitement de la myopathie de duchenne
CZ20032946A3 (en) Fused pyrimidines as antagonists of the corticotropin releasing factor (crf)
US9474762B2 (en) Triazolopyridine compounds
EP3140305A1 (fr) Nouvelles compositions, leurs utilisations et leurs procédés de préparation
KR20100049698A (ko) 바이사이클 피리미디논 및 그 용도
US20200361937A1 (en) Novel compositions, uses and methods for making them
WO2022060951A1 (fr) Compositions pour modulation d'épissage
US20230331718A1 (en) Compositions for modulating splicing
EP4221703A1 (fr) Inhibiteurs de hsd17b13 et leurs utilisations
WO2022086920A1 (fr) Inhibiteurs de la protéine de type glutaminyl-peptide cyclotransférase (qpctl) et leurs utilisations
WO2015199418A2 (fr) Nouveau composé hétérocyclique
WO2024123968A1 (fr) Composés de ciblage d'arn et leurs utilisations
WO2012107500A1 (fr) Composés de [1, 2, 4] triazolo [4, 3 -b] pyridazine en tant qu'inhibiteurs de la tyrosine kinase c-met
WO2022060943A1 (fr) Compositions pour moduler l'épissage
CA2294734A1 (fr) Composes
WO2023192375A1 (fr) Inhibiteurs de hsd17b13 et leurs utilisations
CN116813621A (zh) 9h嘌呤类化合物及其药物组合物和用途
CZ284273B6 (cs) 5-(Subst.amino)-8-(fenyl nebo subst.fenyl)-3H,6H-1,4,5a,8a-tetraazaacenaftylen-3-ony, způsob jejich výroby a terapeutické přípravky na jejich bázi