WO2024106647A1 - Anticancer adjuvant containing pentadecanoic acid as active ingredient, and uses thereof - Google Patents

Anticancer adjuvant containing pentadecanoic acid as active ingredient, and uses thereof Download PDF

Info

Publication number
WO2024106647A1
WO2024106647A1 PCT/KR2023/006815 KR2023006815W WO2024106647A1 WO 2024106647 A1 WO2024106647 A1 WO 2024106647A1 KR 2023006815 W KR2023006815 W KR 2023006815W WO 2024106647 A1 WO2024106647 A1 WO 2024106647A1
Authority
WO
WIPO (PCT)
Prior art keywords
tamoxifen
cancer
pentadecanoic acid
cells
mcf
Prior art date
Application number
PCT/KR2023/006815
Other languages
French (fr)
Korean (ko)
Inventor
김소미
놉 토우바오
Original Assignee
제주대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 제주대학교 산학협력단 filed Critical 제주대학교 산학협력단
Publication of WO2024106647A1 publication Critical patent/WO2024106647A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/20—Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
    • A61K31/138—Aryloxyalkylamines, e.g. propranolol, tamoxifen, phenoxybenzamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention relates to an anticancer adjuvant containing pentadecanoic acid as an active ingredient and its use. More specifically, when tamoxifen-resistant breast cancer cells are treated with pentadecanoic acid in combination with tamoxifen, tamoxifen is treated alone. It was confirmed that it can significantly enhance apoptosis of tamoxifen-resistant breast cancer cells.
  • Breast cancer is the most commonly diagnosed cancer in women, and its heterogeneity and various subtypes reduce the effectiveness of breast cancer treatment. Identifying the breast cancer subtype in a patient is one of the basic steps in selecting an appropriate treatment strategy. In addition to histopathological characteristics, breast cancer is classified based on the presence of estrogen receptor (ER), progesterone receptor, and human epidermal growth factor receptor-2 positivity (ERBB2/HER2+). Among the types of breast cancer, ER- ⁇ positive breast cancer is the most frequently discovered, accounting for nearly 75% of all breast cancers. ER expression has a significant impact on the success of hormonal therapy, the mainstay of treatment for ER-positive breast cancer patients. In fact, loss of ER expression in ER-negative breast cancer patients results in failure to respond to conventional hormonal treatment.
  • ER estrogen receptor
  • progesterone receptor progesterone receptor
  • ERBB2/HER2+ human epidermal growth factor receptor-2 positivity
  • ER- ⁇ positive breast cancer is the most frequently discovered, accounting for nearly 75% of all breast cancers.
  • Tamoxifen an antineoplastic nonsteroidal selective estrogen receptor modulator
  • ER-positive breast cancer is one of the most popular chemotherapeutics for treating ER-positive breast cancer.
  • the development of resistance to tamoxifen has emerged as a major clinical problem, and loss of ER- ⁇ expression has been reported to be associated with tamoxifen resistance. Therefore, re-expression of ER- ⁇ in ER- ⁇ -negative breast cancer tumors may help overcome resistance to tamoxifen and other hormonal treatments.
  • combination therapy using ligustilide or epigallocatechin-3-gallate (EGCG) has been reported as a promising strategy to overcome tamoxifen resistance (Ma, H. et al., Oncotarget (2017) 8 :29328; Sulaiman, A. et al., Cell Death Dis (2016) 9:815; Li, Y. et al., 7:9345.
  • Korean Patent Publication No. 1995-0000642 discloses 'pentanoic acid derivatives' for preventing and/or treating neurodegenerative diseases and neurological dysfunction caused by seizures or trauma, but 'pentadecanoic acid' of the present invention is disclosed. There is no description regarding ‘anti-cancer adjuvants included as active ingredients and their uses’.
  • the present invention was developed in response to the above-mentioned needs, and the present invention sought to provide an anticancer adjuvant that can improve the effect of endocrine therapy for tamoxifen-resistant breast cancer cells.
  • the present inventor investigated whether anticancer drug-resistant breast cancer cells could be re-sensitized to an anticancer drug (tamoxifen) by treating pentadecanoic acid, which has an effect of suppressing breast cancer metastasis, in combination with tamoxifen, and found that the combined treatment of tamoxifen and pentadecanoic acid resulted in apoptosis. And the effect on epithelial-mesenchymal transition was also investigated.
  • ER- ⁇ expression and apoptosis levels of tamoxifen-resistant breast cancer cells were significantly increased under the conditions of combined treatment with tamoxifen or pentadecanoic acid compared to treatment alone, and the effect of inhibiting epithelial-mesenchymal transition was also excellent, confirming the present invention. Completed.
  • the present invention provides a composition for enhancing anticancer drug susceptibility of anticancer drug-resistant cancer, containing pentadecanoic acid as an active ingredient.
  • the present invention provides an anticancer adjuvant for anticancer drug-resistant cancer containing pentadecanoic acid as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating tamoxifen-resistant breast cancer, comprising a mixture of pentadecanoic acid and tamoxifen as an active ingredient.
  • the present invention provides a method of treating tamoxifen-resistant cancer in a mammalian subject, comprising administering a pharmaceutically effective amount of the pharmaceutical composition to a mammalian subject with cancer resistant to tamoxifen.
  • Pentadecanoic acid of the present invention can improve the anticancer drug sensitivity of tamoxifen-resistant breast cancer due to insufficient expression of estrogen receptors, and thus can improve the effect of endocrine therapy in the treatment of tamoxifen-resistant breast cancer cells.
  • the side effects of the anticancer drug itself can be reduced by reducing the dose of tamoxifen used in combination.
  • Figure 1 shows the characteristics of drug-resistant human breast cancer cells MCF-7/SC.
  • A is the cell image of MCF-7 and MCF-7/SC
  • B and (C) are the results of comparing the colony formation levels of MCF-7 and MCF-7/SC cells
  • D is the result of comparing the invasion ability of MCF-7 and MCF-7/SC cells
  • F is the Western blot result for drug resistance marker analysis
  • G is the Western blot result of (F). This is a quantified graph.
  • * means p ⁇ 0.05 compared to the control group.
  • Figure 2 relates to tamoxifen resistance of MCF-7/SC cells
  • A) and B show cell survival rates 24 hours and 48 hours after tamoxifen treatment, respectively
  • C) and (D) show These are the results of comparing the level of colony formation according to tamoxifen treatment
  • E) and (F) are the results of comparing cell migration ability according to tamoxifen treatment
  • G) and (H) are the results of comparing cell invasion ability according to tamoxifen treatment. This is the result of comparison.
  • * means p ⁇ 0.05 compared to the control group.
  • Figure 3 shows the tamoxifen resistance of MCF-7/SC cells.
  • A) and (B) are flow cytometry results detecting apoptotic populations after tamoxifen treatment
  • (C) and (D) are cells after tamoxifen exposure. This is the result of analyzing the expression level of death markers by Western blot. * means p ⁇ 0.05 compared to the control group.
  • Figure 4 confirms the additive effect of the combined treatment of pentadecanoic acid (PDCN) and tamoxifen (TAM).
  • PDCN pentadecanoic acid
  • TAM tamoxifen
  • A) and B) are the effects of pentadecanoic acid alone or pentadecanoic acid and tamoxifen, respectively.
  • Cell viability after 24 and 48 hours of combination treatment (C) and (D) are the results of analyzing CI (combination index) values after 24 and 48 hours of combination treatment, respectively, and (E) and (F) are 5. This is the result of analyzing the level of colony formation 24 hours after treatment with 10 ⁇ M tamoxifen and various concentrations of pentadecanoic acid.
  • Figure 5 confirms apoptosis following the combined treatment of pentadecanoic acid (PDCN) and tamoxifen (Tam), and (A) and (B) show flow cytometric analysis of the apoptotic population using Annexin V/PI staining. This is the result confirmed by , and (C) and (D) are the results of confirming the expression level of the apoptosis marker by Western blot.
  • * means p ⁇ 0.05 compared to the control group
  • # means that the combination treatment group is significant at the p ⁇ 0.05 level compared to the single treatment group.
  • Figure 6 shows that the combined treatment of pentadecanoic acid (PDCN) and tamoxifen has an effect of suppressing epithelial-mesenchymal transition
  • (A) and (B) show cell migration by performing a wound healing assay in MCF-7/SC.
  • (C) and (D) are the results of analyzing cell invasion ability 48 hours after combined treatment
  • (E) and (F) are the results of epithelial-mesenchymal transition (EMT) markers confirmed by Western blot.
  • * means p ⁇ 0.05 compared to the control group
  • # means that the combination treatment group is significant at the p ⁇ 0.05 level compared to the single treatment group.
  • Figure 7 confirms that the combined treatment of pentadecanoic acid (PDCN) and tamoxifen (Tam) can induce the expression of estrogen receptor (ER- ⁇ ) in MCF-7/SC.
  • PDCN pentadecanoic acid
  • Tam tamoxifen
  • A shows 48 hours of combined treatment.
  • B) and C) are the results of confirming the protein level of ER- ⁇ by Western blot, and
  • (D) is the result of confirming the gene expression level of ER- ⁇ after 48 hours of combined treatment. This is the result of confirming the expression level.
  • the present invention provides a composition for enhancing anticancer drug susceptibility of anticancer drug resistant cancer containing pentadecanoic acid as an active ingredient.
  • anticancer drug sensitivity refers to the sensitivity of response to the use of an anticancer drug, and refers to a characteristic that can maximize the effect on an individual when an anticancer drug is administered. Increasing anticancer drug sensitivity can increase the therapeutic effect of anticancer drugs by ensuring that the drug effects work smoothly.
  • the anticancer agent may be tamoxifen, but is not limited thereto, and any anticancer agent that can inhibit the action of estrogen by competitively binding to the estrogen receptor can be used without limitation. .
  • the anticancer drug-resistant cancer may preferably be breast cancer that is resistant to anticancer drugs, and more specifically, may be breast cancer that is resistant to tamoxifen, but is not limited thereto. Breast cancer that is resistant to tamoxifen is characterized by low expression of estrogen receptors.
  • the composition for enhancing sensitivity to anticancer drugs can significantly improve the sensitivity enhancing effect by further including other types of anticancer agents.
  • the type of anticancer agent that may be further included is not particularly limited, but for example, cisplatin, nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, and vandetanib.
  • nirotinib semasanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cetuximab, Viscum album, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamycin, ibritumomab tuxetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtu Zumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methot
  • Busil mitolactol, leucovorin, tretonin, exemestane, aminoglutethimide, anagrelide, navelvin, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, boro It may include, but is not limited to, one or more selected from the group consisting of sol, bicalutamide, lomustine, and carmustine.
  • the composition for enhancing anticancer drug sensitivity targets breast cancer with loss or reduced estrogen receptor expression that is resistant to tamoxifen, an anticancer drug.
  • the present invention also provides an anticancer adjuvant for anticancer drug-resistant cancer containing pentadecanoic acid as an active ingredient.
  • anticancer adjuvant refers to an agent that can improve, enhance, or increase the anticancer effect of an anticancer agent.
  • the anticancer adjuvant can be used as an anticancer agent or an anticancer adjuvant depending on the treatment concentration, and can improve sensitivity to the anticancer agent.
  • the anti-cancer adjuvant can be administered in combination with a known compound that has the effect of preventing, improving, or treating cancer.
  • the anti-cancer adjuvant according to the present invention may be used in combination with tamoxifen for breast cancer that has lost or reduced expression of estrogen receptors that is resistant to the anti-cancer drug tamoxifen, but is not limited thereto.
  • the present invention also provides a pharmaceutical composition for preventing or treating tamoxifen-resistant breast cancer, comprising a mixture of pentadecanoic acid and tamoxifen as an active ingredient.
  • the mixture of pentadecanoic acid and tamoxifen increases the expression level of estrogen receptors in breast cancer cells, increases apoptosis, and inhibits epithelial-mesenchymal transition. It is characterized by
  • the pharmaceutical composition may be in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage, and the pharmaceutical composition may be intended for human subjects.
  • the pharmaceutical composition is not limited to these, but can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods.
  • the pentadecanoic acid may be formulated by mixing with tamoxifen in advance, or may be formulated separately.
  • the pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavorings, etc. for oral administration.
  • buffers, preservatives, and analgesics can be used.
  • Topics, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used.
  • the dosage form of the pharmaceutical composition according to the present invention can be prepared in various ways by mixing it with a pharmaceutically acceptable carrier as described above.
  • the oral administration it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be manufactured in the form of unit dosage ampoules or multiple dosage forms. there is.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.
  • examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used.
  • fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be additionally included.
  • the route of administration of the pharmaceutical composition according to the present invention is not limited to these, but is oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, Includes sublingual or rectal areas. Oral or parenteral administration is preferred. As used herein, the term “parenteral” includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention can also be administered in the form of a suppository for rectal administration.
  • the pharmaceutical composition of the present invention varies depending on several factors, including the activity of the specific compound used, age, body weight, general health, gender, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route and period, but may be appropriately selected by a person skilled in the art.
  • the present invention also provides a method of treating tamoxifen-resistant cancer in a mammalian subject, comprising administering a pharmaceutically effective amount of the pharmaceutical composition to a mammalian subject with cancer resistant to tamoxifen.
  • the mammalian subject may preferably be a mammalian subject other than a human, but is not limited thereto.
  • the tamoxifen-resistant cancer may preferably be tamoxifen-resistant breast cancer, but is not limited thereto.
  • the term "pharmaceutically effective amount” refers to an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type and severity of the individual, age, gender, and activity of the drug. , can be determined based on factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the field of medicine.
  • the pharmaceutical composition of the present invention can be administered at a dosage of 0.1 mg/kg to 1 g/kg, and more preferably at a dosage of 1 mg/kg to 500 mg/kg. Meanwhile, the dosage can be appropriately adjusted depending on the patient's age, gender, and condition.
  • MCF-7 human estrogen receptor positive breast cancer cells
  • MCF-7/SC breast cancer stem cell-like cells
  • MCF-7/SC breast cancer stem cell-like cells
  • MCF-7 cells were cultured in DMEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 g/mL streptomycin according to instructions from ATCC.
  • MCF-7/SC cells were generated from parental MCF-7 by sorting the CD44+/CD24-/dim cell population (To, N.B. et al., Nutrients (2020) 12:1663), 10% FBS, 100 U/mL penicillin. and RPMI 1640 supplemented with 100 g/mL streptomycin.
  • the proliferation of MCF-7 and MCF-7/SC is approximately 29 and 25 hours, respectively.
  • MTT test cells (4 ⁇ 10 3 cells/well) were seeded in 96-well plates using the indicated culture medium and cultured at 37°C. After incubation, they were treated with various concentrations of pentadecanoic acid, tamoxifen, or their combination for 48 hours. After 24 or 48 hours of treatment, MTT assay was performed to determine cell viability (To, NB et al., 2020).
  • MCF-7 and MCF-7/SC cells (4 ⁇ 10 2 cells/culture dish) were cultured for 24 hours and then treated with pentadecanoic acid, tamoxifen, or a combination thereof. After culturing for 10 days, each colony was fixed with 4% paraformaldehyde and stained with 2% crystal violet. Stained colonies were manually counted and expressed as percentage compared to untreated controls for each concentration of treated substance.
  • MCF-7 and MCF-7/SC cells (1 ⁇ 105 cells/well) were cultured in 6-well plates until they formed a monolayer.
  • the tightly grown cell monolayer was scratched uniformly using a sterile pipette tip and washed with PBS. Afterwards, each cell was treated with pentadecanoic acid, tamoxifen, or a combination thereof and reacted for 24 and 48 hours, and the width of the scratch was measured using a phase contrast microscope ( ⁇ 100).
  • the cell invasion assay used a 24-well transwell system (pore size 0.2 ⁇ m, Corning, USA) as previously reported (Nobili, S. et al., Pharmacol. Res. (2009) 59:365-378). . Pentadecanoic acid and tamoxifen, alone or in combination, were added to the upper chamber under serum-free medium conditions, and medium supplemented with 10% FBS was added to the lower chamber. After 48 hours of culture, cells were fixed with 4% paraformaldehyde and stained with 2% crystal violet. Infiltrating cells were observed under phase contrast microscopy ( ⁇ 100).
  • Annexin V-FITC apoptosis detection kit (BD Biosciences) was used to detect apoptosis, cell cycle analysis was performed by an ACSCalibur flow cytometer (Becton Dickinson), and the proportion of each population in the cell cycle was calculated using GraphPad Prism 7. It was analyzed and graphed using .
  • RIPA Radioimunoopination assay
  • MCF-7 or MCF-7/S cells 3 ⁇ 10 5 cells/culture dish
  • protein A BCA assay Thermo Fisher Scientific
  • SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
  • Membrane transfer, blocking, primary and secondary antibody reactions, and protein detection procedures were performed in the same manner as in a previous study (Nobili, S. et al., 2009).
  • Antibody dilution was performed according to the manufacturer's instructions, and information on the antibodies used in Western blot is shown in Table 1.
  • MCF-7/SC cells (1 ⁇ 10 6 cells/culture dish) were cultured overnight and then treated with pentadecanoic acid and tamoxifen alone or in combination for 48 hours. After drug treatment, total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific), and the extracted total RNA was used for cDNA synthesis. Then, real-time PCR was performed with a 20 ⁇ l reaction mixture consisting of 1 ⁇ l of cDNA, 2 ⁇ l of primers (1 ⁇ l of each primer), 10 ⁇ l of master mix (Takara), and 7 ⁇ l of RNA-free water.
  • TRIzol reagent Invitrogen; Thermo Fisher Scientific
  • Real-time PCR consisted of initial denaturation at 95°C for 15 minutes, followed by 40 cycles of 10 seconds at 95°C and 30 seconds at 60°C, followed by 15 seconds at 95°C and 30 seconds at 60°C to generate a dissociation curve, and 95°C. The temperature was gradually increased for 15 seconds.
  • Primer sequences of target genes are shown in Table 2, and gene expression was quantified using the 2 - ⁇ Cq method (Livak, KJ Schmittgen, TD Methods (2001) 25:402-408).
  • Primer information used in the present invention Gene Sequence information (5' ⁇ 3') sequence number BCL2 F TCCCTCGCTGCACAAATACTC One R ACGACCCGATGGCCATAGA 2 CA12 F TGGCATTCTTGGCATCTGTA 3 R TTGGTGGCTGGCTTGTAAAAT 4 XBP1 F GGCGCTCCACGCACCTG 5 R GCTGCTACTCTGTTTTTCAGTTTCC 6 GREB1 F CAAAGAATAACCTTGTTGGCCCTGC 7 R GACATGCCTGCGCCTCTCATACTTA 8 FOS F CGTCTTCCTTCACC 9 R GTCAGAGGAAGGCTCATTGC 10 NRIP1 F TCGCACTCACCACAGAAAAC 11 R AGCCAAGCTCTTCTCCATGT 12 RARA F CGCTGCTGGAGGCGCTAAAG 13 R GCGCTGATGCTTCGCAGGTC 14 TFF1 F GTGTCAGCCCTCCCAGT 15 R GGACCCCACGAACGGTG 16
  • ((Dx)1 and (Dx)2 in the denominator represent the concentrations that can inhibit x% of the first drug (Drug1) and the second drug (Drug2) alone, respectively.
  • D1 and D2 in the numerator correspond to the corresponding values in the denominator, respectively. It represents the portion of the first drug and the second drug in the combination (D1+D2) that has the same effect (x% inhibition) as the concentration of the drug.)
  • the present inventors performed RNA sequencing in MCF-7 and MCF-7/SC cells and identified differentially expressed genes (DEGs) between MCF-7 and MCF-7/SC cells. According to the transcriptome analysis results, a distinct gene profile and significant increase in DEGs related to drug resistance were confirmed in MCF-7/SC cells.
  • DEGs differentially expressed genes
  • MCF-7/SC cells were further characterized. Microscopic analysis revealed clear morphological differences between MCF-7 and MCF-7/SC cells. MCF-7 cells showed a round or irregular epithelial-like shape, but MCF-7/SC cells had a more luminal and elongated shape and increased intercellular distance (Figure 1A). Additionally, the clonogenic ability of MCF-7/SC cells was confirmed to be higher than that of parental MCF-7 cells ( Figure 1B, C). In addition, the results of transwell analysis showed that the invasion ability of MCF-7/SC cells was improved ( Figures 1D, E).
  • the present inventors performed Western blot to analyze the expression levels of several proteins involved in tumor drug resistance, and the results showed that MCF-7/SC cells expressed snail, Bcl-2, STAT3, and p-STAT3 compared to parental MCF-7 cells. It was expressed at a high level, and the expression level of tumor suppressor proteins such as Rb, p-Rb, E-cad, and p21 was confirmed to be reduced (Figure 1F, G). In particular, we observed that the mRNA and protein expression levels of ER- ⁇ in MCF-7/SC cells were significantly lower than those in MCF-7 cells ( Figures 1F, G). These results implied that loss of ER- ⁇ may play an important role in drug resistance of MCF-7/SC cells.
  • tamoxifen Because the therapeutic effects of tamoxifen are primarily ER-mediated, loss of ER expression in breast cancer cells is highly associated with tamoxifen resistance. MTT assay was performed to determine whether MCF-7/SC cells were resistant to tamoxifen. As a result, tamoxifen showed lower cytotoxicity in MCF-7/SC compared to MCF-7 ( Figures 2A, B). In addition, tamoxifen showed stronger colony formation inhibitory activity in MCF-7 cells than in MCF-7/SC cells. Under 10 ⁇ M tamoxifen treatment conditions, the number of colonies in MCF-7 cells was reduced by more than 90% compared to the untreated control group.
  • the present inventors analyzed the effect of combination therapy of pentadecanoic acid and tamoxifen on tamoxifen-resistant MCF-7/SC cells.
  • the survival rate of MCF-7/SC cells was higher in the group treated with the combination of pentadecanoic acid and tamoxifen compared to treatment with pentadecanoic acid alone. It was confirmed that it was falling (Figure 4A, B).
  • Example 4 Effect of combined treatment of pentadecanoic acid and tamoxifen on apoptosis of MCF-7/SC cells
  • the present inventors analyzed the effect of combined treatment of pentadecanoic acid and tamoxifen on apoptosis of MCF-7/SC cells. As confirmed through Annexin V/PI staining, treatment with 10 ⁇ M tamoxifen alone did not appear to affect apoptosis of MCF-7/SC cells, but combining 10 ⁇ M tamoxifen with 50 or 100 ⁇ M pentadecanoic acid It was found that apoptosis was significantly increased in treated cells (Figure 5A, B).
  • Example 5 Effect of combined treatment of pentadecanoic acid and tamoxifen on epithelial-mesenchymal transition (EMT)

Landscapes

  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

The present invention relates to an anticancer adjuvant containing pentadecanoic acid as an active ingredient, and uses thereof, and, specifically, to: a composition for enhancing anticancer agent sensitivity of anticancer-agent-resistant cancer, containing pentadecanoic acid as an active ingredient; a pharmaceutical composition for preventing or treating tamoxifen-resistant breast cancer, containing, as an active ingredient, a mixture of pentadecanoic acid and tamoxifen; and a method for treating tamoxifen-resistant cancer of a mammalian subject by using the pharmaceutical composition.

Description

펜타데칸산을 유효성분으로 포함하는 항암 보조제 및 이의 용도Anti-cancer adjuvant containing pentadecanoic acid as an active ingredient and its use
본 발명은 펜타데칸산(pentadecanoic acid)을 유효성분으로 포함하는 항암 보조제 및 이의 용도에 관한 것으로, 보다 상세하게는 타목시펜(tamoxifen) 내성 유방암 세포에 펜타데칸산을 타목시펜과 병용 처리할 경우 타목시펜 단독 처리 대비 타목시펜 내성 유방암 세포의 세포사멸을 현저히 증진시킬 수 있음을 확인한 것이다.The present invention relates to an anticancer adjuvant containing pentadecanoic acid as an active ingredient and its use. More specifically, when tamoxifen-resistant breast cancer cells are treated with pentadecanoic acid in combination with tamoxifen, tamoxifen is treated alone. It was confirmed that it can significantly enhance apoptosis of tamoxifen-resistant breast cancer cells.
본 결과물은 한국연구재단의 개인기초연구(과기정통부) 및 이공학학술연구기반구축 사업의 지원을 받아 연구되었습니다(과제번호: 2020R1A2C1004349 및 2016R1A6A1A03012862).This research was conducted with support from the National Research Foundation of Korea's Individual Basic Research (Ministry of Science and ICT) and Science and Engineering Academic Research Base Construction Project (Project Numbers: 2020R1A2C1004349 and 2016R1A6A1A03012862).
유방암은 여성에게 가장 흔하게 진단되는 암으로, 유방암의 이질성(heterogeneity)과 다양한 아형은 유방암 치료의 효과를 감소시킨다. 환자에게서 유방암 하위 유형을 식별하는 것은 적절한 치료 전략을 선택하는 기본 단계 중 하나이다. 유방암은 조직병리학적 특성 외에도 에스트로겐 수용체(estrogen receptor, ER), 프로게스테론 수용체, 인간 표피성장인자 수용체-2 양성(ERBB2/HER2+)의 존재에 따라 분류된다. 유방암의 종류 중 ER-α 양성 유방암이 가장 많이 발견돼 전체 유방암의 75%에 육박한다. ER 발현은 ER 양성 유방암 환자의 치료의 주축인 호르몬 요법의 성공에 큰 영향을 미친다. 실제로 ER 음성 유방암 환자에서 ER 발현 상실은 기존 호르몬 치료에 대한 반응 실패를 초래한다.Breast cancer is the most commonly diagnosed cancer in women, and its heterogeneity and various subtypes reduce the effectiveness of breast cancer treatment. Identifying the breast cancer subtype in a patient is one of the basic steps in selecting an appropriate treatment strategy. In addition to histopathological characteristics, breast cancer is classified based on the presence of estrogen receptor (ER), progesterone receptor, and human epidermal growth factor receptor-2 positivity (ERBB2/HER2+). Among the types of breast cancer, ER-α positive breast cancer is the most frequently discovered, accounting for nearly 75% of all breast cancers. ER expression has a significant impact on the success of hormonal therapy, the mainstay of treatment for ER-positive breast cancer patients. In fact, loss of ER expression in ER-negative breast cancer patients results in failure to respond to conventional hormonal treatment.
항종양성 비스테로이드 선택적 에스트로겐 수용체 조절제인 타목시펜(tamoxifen)은 ER 양성 유방암을 치료하기 위한 가장 인기 있는 화학 치료제 중 하나이다. 그러나 타목시펜에 대한 내성의 발달이 주요 임상 문제로 대두되었고, ER-α의 발현 상실이 타목시펜 내성과 관련이 있는 것으로 보고되었다. 따라서 ER-α 음성 유방암 종양에서 ER-α의 재발현은 타목시펜과 다른 호르몬 치료에 대한 저항성을 극복하는 데 도움이 될 수 있다. 또한, 리구스틸라이드(ligustilide) 또는 EGCG(epigallocatechin-3-gallate) 등을 이용한 병용 치료법이 타목시펜 내성을 극복하기 위한 유망한 전략으로 보고된 바 있다(Ma, H. et al., Oncotarget (2017) 8:29328; Sulaiman, A. et al., Cell Death Dis. (2018) 9:815; Li, Y. et al., Sci. Rep. (2017) 7:9345).Tamoxifen, an antineoplastic nonsteroidal selective estrogen receptor modulator, is one of the most popular chemotherapeutics for treating ER-positive breast cancer. However, the development of resistance to tamoxifen has emerged as a major clinical problem, and loss of ER-α expression has been reported to be associated with tamoxifen resistance. Therefore, re-expression of ER-α in ER-α-negative breast cancer tumors may help overcome resistance to tamoxifen and other hormonal treatments. In addition, combination therapy using ligustilide or epigallocatechin-3-gallate (EGCG) has been reported as a promising strategy to overcome tamoxifen resistance (Ma, H. et al., Oncotarget (2017) 8 :29328; Sulaiman, A. et al., Cell Death Dis (2018) 9:815; Li, Y. et al., 7:9345.
한편, 한국공개특허 제1995-0000642호에는 신경 변성 질환 및 발작 또는 외상에 의한 신경 기능 부전등을 예방 및/또는 치료하기 위한 '펜탄산 유도체'가 개시되어 있으나, 본 발명의 '펜타데칸산을 유효성분으로 포함하는 항암 보조제 및 이의 용도'에 대해서는 기재된 바가 없다.Meanwhile, Korean Patent Publication No. 1995-0000642 discloses 'pentanoic acid derivatives' for preventing and/or treating neurodegenerative diseases and neurological dysfunction caused by seizures or trauma, but 'pentadecanoic acid' of the present invention is disclosed. There is no description regarding ‘anti-cancer adjuvants included as active ingredients and their uses’.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명에서는 타목시펜 내성 유방암 세포의 내분비 치료요법 효과를 향상시킬 수 있는 항암 보조제를 제공하고자 하였다.The present invention was developed in response to the above-mentioned needs, and the present invention sought to provide an anticancer adjuvant that can improve the effect of endocrine therapy for tamoxifen-resistant breast cancer cells.
본 발명자는 유방암 전이 억제 효과가 있는 펜타데칸산을 타목시펜과 병용 처리하여 항암제 내성 유방암 세포를 항암제(타목시펜)로 재감작시킬 수 있는지 조사하였으며, 타목시펜과 펜타데칸산의 병용 처리가 세포사멸(apoptosis) 및 상피간엽이행(epithelial-mesenchymal transition)에 미치는 영향도 조사하였다.The present inventor investigated whether anticancer drug-resistant breast cancer cells could be re-sensitized to an anticancer drug (tamoxifen) by treating pentadecanoic acid, which has an effect of suppressing breast cancer metastasis, in combination with tamoxifen, and found that the combined treatment of tamoxifen and pentadecanoic acid resulted in apoptosis. And the effect on epithelial-mesenchymal transition was also investigated.
분석 결과, 타목시펜 또는 펜타데칸산의 단독 처리 대비 이들의 병용 처리 조건에서 타목시펜 내성 유방암 세포의 ER-α 발현 및 세포사멸 수준이 현저히 증가되었으며, 상피간엽이행 억제 효과 또한 우수한 것을 확인함으로써, 본 발명을 완성하였다.As a result of the analysis, ER-α expression and apoptosis levels of tamoxifen-resistant breast cancer cells were significantly increased under the conditions of combined treatment with tamoxifen or pentadecanoic acid compared to treatment alone, and the effect of inhibiting epithelial-mesenchymal transition was also excellent, confirming the present invention. Completed.
상기 과제를 해결하기 위해, 본 발명은 펜타데칸산(pentadecanoic acid)을 유효성분으로 포함하는 항암제 내성 암의 항암제 감수성 증진용 조성물을 제공한다.In order to solve the above problems, the present invention provides a composition for enhancing anticancer drug susceptibility of anticancer drug-resistant cancer, containing pentadecanoic acid as an active ingredient.
또한, 본 발명은 펜타데칸산을 유효성분으로 포함하는 항암제 내성암의 항암 보조제를 제공한다.Additionally, the present invention provides an anticancer adjuvant for anticancer drug-resistant cancer containing pentadecanoic acid as an active ingredient.
또한, 본 발명은 펜타데칸산 및 타목시펜(tamoxifen)의 혼합물을 유효성분으로 포함하는, 타목시펜 내성 유방암의 예방 또는 치료용 약학 조성물을 제공한다.Additionally, the present invention provides a pharmaceutical composition for preventing or treating tamoxifen-resistant breast cancer, comprising a mixture of pentadecanoic acid and tamoxifen as an active ingredient.
또한, 본 발명은 약학적으로 유효한 양의 상기 약학 조성물을 타목시펜에 내성을 보이는 암에 걸린 포유동물 개체에 투여하는 단계를 포함하는, 포유동물 개체의 타목시펜 내성암 치료 방법을 제공한다.Additionally, the present invention provides a method of treating tamoxifen-resistant cancer in a mammalian subject, comprising administering a pharmaceutically effective amount of the pharmaceutical composition to a mammalian subject with cancer resistant to tamoxifen.
본 발명의 펜타데칸산(pentadecanoic acid)은 에스트로겐 수용체 발현 부족으로 인한 타목시펜 내성 유방암의 항암제 감수성을 증진시킬 수 있으므로, 타목시펜 내성 유방암 세포의 치료에서 내분비 요법의 효과를 향상시킬 수 있을 것이다. 또한, 병용으로 사용하는 타목시펜의 용량을 줄일 수 있게 함으로써 항암제 자체의 부작용도 감소시킬 수 있을 것으로 기대된다.Pentadecanoic acid of the present invention can improve the anticancer drug sensitivity of tamoxifen-resistant breast cancer due to insufficient expression of estrogen receptors, and thus can improve the effect of endocrine therapy in the treatment of tamoxifen-resistant breast cancer cells. In addition, it is expected that the side effects of the anticancer drug itself can be reduced by reducing the dose of tamoxifen used in combination.
도 1은 약물 내성 인간 유방암 세포 MCF-7/SC의 특성을 보여준다. (A)는 MCF-7과 MCF-7/SC의 세포 이미지이고, (B) 및 (C)는 MCF-7과 MCF-7/SC 세포의 콜로니 형성 수준을 비교한 결과이고, (D) 및 (E)는 MCF-7과 MCF-7/SC 세포의 침윤능을 비교한 결과이고, (F)는 약물 저항성 마커 분석을 위한 웨스턴 블랏 결과이며, (G)는 (F)의 웨스턴 블랏 결과를 정량화한 그래프이다. *는 대조군 대비 p<0.05를 의미한다.Figure 1 shows the characteristics of drug-resistant human breast cancer cells MCF-7/SC. (A) is the cell image of MCF-7 and MCF-7/SC, (B) and (C) are the results of comparing the colony formation levels of MCF-7 and MCF-7/SC cells, (D) and (E) is the result of comparing the invasion ability of MCF-7 and MCF-7/SC cells, (F) is the Western blot result for drug resistance marker analysis, and (G) is the Western blot result of (F). This is a quantified graph. * means p<0.05 compared to the control group.
도 2는 MCF-7/SC 세포의 타목시펜(tamoxifen) 저항성에 관한 것으로, (A)와 (B)는 각각 타목시펜 처리 후 24시간 및 48시간 후의 세포 생존율을 나타내며, (C) 및 (D)는 타목시펜 처리에 따른 콜로니 형성 수준을 비교한 결과이고, (E) 및 (F)는 타목시펜 처리에 따른 세포 이동능을 비교한 결과이고, (G) 및 (H)는 타목시펜 처리에 따른 세포 침윤능을 비교한 결과이다. *는 대조군 대비 p<0.05를 의미한다.Figure 2 relates to tamoxifen resistance of MCF-7/SC cells, (A) and (B) show cell survival rates 24 hours and 48 hours after tamoxifen treatment, respectively, (C) and (D) show These are the results of comparing the level of colony formation according to tamoxifen treatment, (E) and (F) are the results of comparing cell migration ability according to tamoxifen treatment, and (G) and (H) are the results of comparing cell invasion ability according to tamoxifen treatment. This is the result of comparison. * means p<0.05 compared to the control group.
도 3은 MCF-7/SC 세포의 타목시펜 저항성을 보여주는 것으로, (A) 및 (B)는 타목시펜 처리 후 세포사멸 집단을 검출한 유세포분석 결과이고, (C) 및 (D)는 타목시펜 노출 후 세포사멸 마커의 발현 수준을 웨스턴 블랏으로 분석한 결과이다. *는 대조군 대비 p<0.05를 의미한다.Figure 3 shows the tamoxifen resistance of MCF-7/SC cells. (A) and (B) are flow cytometry results detecting apoptotic populations after tamoxifen treatment, and (C) and (D) are cells after tamoxifen exposure. This is the result of analyzing the expression level of death markers by Western blot. * means p<0.05 compared to the control group.
도 4는 펜타데칸산(pentadecanoic acid, PDCN)과 타목시펜(tamoxifen, TAM)의 병용 처리에 따른 상가적 효과를 확인한 것으로, (A)와 (B)는 각각 펜타데칸산 단독 또는 펜타데칸산과 타목시펜의 병용 처리 24시간 및 48시간 후의 세포 생존율이고, (C)와 (D)는 각각 병용 처리 24시간 및 48시간 후의 CI(combination index) 값을 분석한 결과이고, (E)와 (F)는 5 μM의 타목시펜에 다양한 농도의 펜타데칸산을 조합하여 처리하고 24시간 후의 콜로니 형성 수준을 분석한 결과이며, (G)와 (H)는 10 μM의 타목시펜에 다양한 농도의 펜타데칸산을 조합하여 처리하고 24시간 후의 콜로니 형성 수준을 분석한 결과이다. *는 대조군 대비 p<0.05를 의미하며, #는 단독 처리군과 대비하여 병용 처리군이 p<0.05 수준에서 유의함을 의미한다.Figure 4 confirms the additive effect of the combined treatment of pentadecanoic acid (PDCN) and tamoxifen (TAM). (A) and (B) are the effects of pentadecanoic acid alone or pentadecanoic acid and tamoxifen, respectively. Cell viability after 24 and 48 hours of combination treatment, (C) and (D) are the results of analyzing CI (combination index) values after 24 and 48 hours of combination treatment, respectively, and (E) and (F) are 5. This is the result of analyzing the level of colony formation 24 hours after treatment with 10 μM tamoxifen and various concentrations of pentadecanoic acid. (G) and (H) are results of treatment with 10 μM tamoxifen and various concentrations of pentadecanoic acid. This is the result of analyzing the colony formation level after 24 hours. * means p<0.05 compared to the control group, and # means that the combination treatment group is significant at the p<0.05 level compared to the single treatment group.
도 5는 펜타데칸산(PDCN)과 타목시펜(Tam)의 병용 처리에 따른 세포사멸(apoptosis)을 확인한 것으로, (A) 및 (B)는 Annexin V/PI 염색을 이용하여 세포사멸 집단을 유세포분석으로 확인한 결과이고, (C) 및 (D)는 세포사멸 마커의 발현 수준을 웨스턴 블랏으로 확인한 결과이다. *는 대조군 대비 p<0.05를 의미하며, #는 단독 처리군과 대비하여 병용 처리군이 p<0.05 수준에서 유의함을 의미한다.Figure 5 confirms apoptosis following the combined treatment of pentadecanoic acid (PDCN) and tamoxifen (Tam), and (A) and (B) show flow cytometric analysis of the apoptotic population using Annexin V/PI staining. This is the result confirmed by , and (C) and (D) are the results of confirming the expression level of the apoptosis marker by Western blot. * means p<0.05 compared to the control group, and # means that the combination treatment group is significant at the p<0.05 level compared to the single treatment group.
도 6은 펜타데칸산(PDCN)과 타목시펜의 병용 처리가 상피간엽이행을 억제하는 효과가 있음을 보여주는 것으로, (A) 및 (B)는 MCF-7/SC에서 상처 치유 분석을 수행하여 세포 이동을 평가한 결과이고, (C) 및 (D)는 병용 처리 48시간 후의 세포 침윤능을 분석한 결과이고, (E) 및 (F)는 상피간엽이행(EMT) 마커를 웨스턴 블랏으로 확인한 결과이다. *는 대조군 대비 p<0.05를 의미하며, #는 단독 처리군과 대비하여 병용 처리군이 p<0.05 수준에서 유의함을 의미한다.Figure 6 shows that the combined treatment of pentadecanoic acid (PDCN) and tamoxifen has an effect of suppressing epithelial-mesenchymal transition, and (A) and (B) show cell migration by performing a wound healing assay in MCF-7/SC. (C) and (D) are the results of analyzing cell invasion ability 48 hours after combined treatment, and (E) and (F) are the results of epithelial-mesenchymal transition (EMT) markers confirmed by Western blot. . * means p<0.05 compared to the control group, and # means that the combination treatment group is significant at the p<0.05 level compared to the single treatment group.
도 7은 펜타데칸산(PDCN)과 타목시펜(Tam)의 병용 처리가 MCF-7/SC에서 에스트로겐 수용체(ER-α)의 발현을 유도할 수 있음을 확인한 것으로, (A)는 병용 처리 48시간 후 ER-α의 유전자 발현 수준을 확인한 결과이고, (B) 및 (C)는 ER-α의 단백질 수준을 웨스턴 블랏으로 확인한 결과이며, (D)는 병용 처리 48시간 후 ER-α 관련 유전자의 발현 수준을 확인한 결과이다.Figure 7 confirms that the combined treatment of pentadecanoic acid (PDCN) and tamoxifen (Tam) can induce the expression of estrogen receptor (ER-α) in MCF-7/SC. (A) shows 48 hours of combined treatment. (B) and (C) are the results of confirming the protein level of ER-α by Western blot, and (D) is the result of confirming the gene expression level of ER-α after 48 hours of combined treatment. This is the result of confirming the expression level.
본 발명의 목적을 달성하기 위하여, 본 발명은 펜타데칸산(pentadecanoic acid)을 유효성분으로 포함하는 항암제 내성 암의 항암제 감수성 증진용 조성물을 제공한다.In order to achieve the object of the present invention, the present invention provides a composition for enhancing anticancer drug susceptibility of anticancer drug resistant cancer containing pentadecanoic acid as an active ingredient.
본 발명에 있어서, 용어 "항암제 감수성(sensitivity)"이란 항암제 사용에 대한 반응 민감도를 의미하는 것으로, 항암제의 투여 시 개체에 작용하는 효과를 극대화시킬 수 있는 특성을 말한다. 항암제 감수성을 증가시키는 경우 약물 효과가 원활하게 작용하도록 함으로써 항암제의 치료 효과를 증대시킬 수 있다.In the present invention, the term "anticancer drug sensitivity" refers to the sensitivity of response to the use of an anticancer drug, and refers to a characteristic that can maximize the effect on an individual when an anticancer drug is administered. Increasing anticancer drug sensitivity can increase the therapeutic effect of anticancer drugs by ensuring that the drug effects work smoothly.
본 발명에 따른 항암제 감수성 증진용 조성물에 있어서, 상기 항암제는 타목시펜(tamoxifen)일 수 있으나, 이로 한정되는 것은 아니며, 에스트로겐 수용체와 경쟁적으로 결합하여 에스트로겐 작용을 억제할 수 있는 항암제이면 제한없이 사용가능하다.In the composition for enhancing anticancer drug sensitivity according to the present invention, the anticancer agent may be tamoxifen, but is not limited thereto, and any anticancer agent that can inhibit the action of estrogen by competitively binding to the estrogen receptor can be used without limitation. .
또한, 본 발명에 있어서, 상기 항암제 내성 암은 바람직하게는 항암제에 내성을 보이는 유방암일 수 있고, 보다 구체적으로는 타목시펜에 내성을 보이는 유방암일 수 있으나, 이에 제한되지 않는다. 상기 타목시펜에 내성을 보이는 유방암은 에스트로겐 수용체가 저발현된 것이 특징이다.In addition, in the present invention, the anticancer drug-resistant cancer may preferably be breast cancer that is resistant to anticancer drugs, and more specifically, may be breast cancer that is resistant to tamoxifen, but is not limited thereto. Breast cancer that is resistant to tamoxifen is characterized by low expression of estrogen receptors.
또한, 본 발명에서 상기 항암제 감수성 증진용 조성물은 추가로 다른 종류의 항암제를 더 포함함으로써, 감수성 증진 효과를 현저히 향상시킬 수 있다. 여기서, 추가로 더 포함될 수 있는 항암제의 종류는 특별히 제한하지 않으나, 예를 들면, 시스플라틴, 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1 종 이상을 포함할 수 있으나, 이에 제한되지 않는다.In addition, in the present invention, the composition for enhancing sensitivity to anticancer drugs can significantly improve the sensitivity enhancing effect by further including other types of anticancer agents. Here, the type of anticancer agent that may be further included is not particularly limited, but for example, cisplatin, nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, and vandetanib. , nirotinib, semasanib, bosutinib, axitinib, cediranib, lestaurtinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cetuximab, Viscum album, asparaginase, tretinoin, hydroxycarbamide, dasatinib, estramustine, gemtuzumab ozogamycin, ibritumomab tuxetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtu Zumab, procarbazine, alprostadil, holmium nitrate chitosan, gemcitabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, Cytarabine, fluorouracil, fludagabine, enocitabine, flutamide, decitabine, mercaptopurine, thioguanine, cladribine, carmophor, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topo Tecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyra Rubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melphalan, altretmin, dacarbazine, thiotepa, nimustine, chloram. Busil, mitolactol, leucovorin, tretonin, exemestane, aminoglutethimide, anagrelide, navelvin, fadrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, boro It may include, but is not limited to, one or more selected from the group consisting of sol, bicalutamide, lomustine, and carmustine.
본 발명의 일 구현 예에 있어서, 상기 항암제 감수성 증진용 조성물은 항암제인 타목시펜에 내성을 보이는 에스트로겐 수용체 발현이 상실된 또는 감소된 유방암을 표적으로 하는 것을 특징으로 한다.In one embodiment of the present invention, the composition for enhancing anticancer drug sensitivity targets breast cancer with loss or reduced estrogen receptor expression that is resistant to tamoxifen, an anticancer drug.
본 발명은 또한, 펜타데칸산(pentadecanoic acid)을 유효성분으로 포함하는 항암제 내성암의 항암 보조제를 제공한다.The present invention also provides an anticancer adjuvant for anticancer drug-resistant cancer containing pentadecanoic acid as an active ingredient.
본 발명에 있어서, 용어 "항암 보조제"는 항암제의 항암 효과를 개선, 향상 또는 증대시킬 수 있는 제제를 의미한다.In the present invention, the term “anticancer adjuvant” refers to an agent that can improve, enhance, or increase the anticancer effect of an anticancer agent.
본 발명에 있어서, 상기 항암 보조제는 처리농도에 따라 항암제 또는 항암보조제로서 사용할 수 있으며, 항암제의 감수성을 증진시킬 수 있다.In the present invention, the anticancer adjuvant can be used as an anticancer agent or an anticancer adjuvant depending on the treatment concentration, and can improve sensitivity to the anticancer agent.
본 발명에 있어서, 상기 항암 보조제는 암을 예방, 개선 또는 치료하는 효과를 가지는 공지의 화합물과 병용하여 투여될 수 있다.In the present invention, the anti-cancer adjuvant can be administered in combination with a known compound that has the effect of preventing, improving, or treating cancer.
본 발명에 따른 항암 보조제는, 바람직하게는 항암제인 타목시펜에 내성을 보이는 에스트로겐 수용체 발현이 상실된 또는 감소된 유방암에 타목시펜과 병용으로 처리되어 사용되는 것일 수 있으나, 이에 제한되지 않는다.The anti-cancer adjuvant according to the present invention may be used in combination with tamoxifen for breast cancer that has lost or reduced expression of estrogen receptors that is resistant to the anti-cancer drug tamoxifen, but is not limited thereto.
본 발명은 또한, 펜타데칸산(pentadecanoic acid) 및 타목시펜(tamoxifen)의 혼합물을 유효성분으로 포함하는, 타목시펜 내성 유방암의 예방 또는 치료용 약학 조성물을 제공한다.The present invention also provides a pharmaceutical composition for preventing or treating tamoxifen-resistant breast cancer, comprising a mixture of pentadecanoic acid and tamoxifen as an active ingredient.
본 발명에 따른 약학 조성물에 있어서, 상기 펜타데칸산과 타목시펜의 혼합물은 유방암 세포의 에스트로겐 수용체 발현 수준을 증가시키고, 세포사멸(apoptosis)을 증가시키며, 상피간엽이행(epithelial-mesenchymal transition)을 억제하는 것을 특징으로 한다.In the pharmaceutical composition according to the present invention, the mixture of pentadecanoic acid and tamoxifen increases the expression level of estrogen receptors in breast cancer cells, increases apoptosis, and inhibits epithelial-mesenchymal transition. It is characterized by
본 발명에 있어서 상기 약학 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. 상기 약학 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.In the present invention, the pharmaceutical composition may be in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage, and the pharmaceutical composition may be intended for human subjects. The pharmaceutical composition is not limited to these, but can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods.
본 발명의 일 구현 예에 따른 약학 조성물에 있어서, 상기 펜타데칸산은 타목시펜과 사전에 혼합되어 제형화되거나, 별도로 제형화될 수 있다.In the pharmaceutical composition according to one embodiment of the present invention, the pentadecanoic acid may be formulated by mixing with tamoxifen in advance, or may be formulated separately.
본 발명에 따른 약학 조성물은 약제학적으로 허용가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구투여시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명에 따른 약학 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구투여 시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화할 수 있다.The pharmaceutical composition according to the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavorings, etc. for oral administration. For injections, buffers, preservatives, and analgesics can be used. Topics, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used. The dosage form of the pharmaceutical composition according to the present invention can be prepared in various ways by mixing it with a pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be manufactured in the form of unit dosage ampoules or multiple dosage forms. there is. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.Meanwhile, examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used. In addition, fillers, anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, etc. may be additionally included.
본 발명에 따른 약학 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. 본 발명에 사용된 용어 "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.The route of administration of the pharmaceutical composition according to the present invention is not limited to these, but is oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, Includes sublingual or rectal areas. Oral or parenteral administration is preferred. As used herein, the term “parenteral” includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention can also be administered in the form of a suppository for rectal administration.
본 발명의 약학 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있다.The pharmaceutical composition of the present invention varies depending on several factors, including the activity of the specific compound used, age, body weight, general health, gender, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route and period, but may be appropriately selected by a person skilled in the art.
본 발명은 또한, 약학적으로 유효한 양의 상기 약학 조성물을 타목시펜에 내성을 보이는 암에 걸린 포유동물 개체에 투여하는 단계를 포함하는, 포유동물 개체의 타목시펜 내성암 치료 방법을 제공한다.The present invention also provides a method of treating tamoxifen-resistant cancer in a mammalian subject, comprising administering a pharmaceutically effective amount of the pharmaceutical composition to a mammalian subject with cancer resistant to tamoxifen.
본 발명에 따른 항암제 내성암 치료 방법에 있어서, 상기 포유동물 개체는 바람직하게는 인간을 제외한 포유동물 개체일 수 있으나, 이에 제한되지 않는다.In the method for treating anticancer drug-resistant cancer according to the present invention, the mammalian subject may preferably be a mammalian subject other than a human, but is not limited thereto.
또한, 상기 타목시펜 내성암은 바람직하게는 타목시펜 내성 유방암일 수 있으나, 이에 제한되지 않는다.Additionally, the tamoxifen-resistant cancer may preferably be tamoxifen-resistant breast cancer, but is not limited thereto.
본 발명에서 용어 "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료 기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 약학 조성물은 0.1 mg/kg 내지 1 g/kg의 용량으로 투여될 수 있으며, 더 바람직하게는 1 mg/kg 내지 500 mg/kg의 투여량으로 투여된다. 한편, 상기 투여량은 환자의 나이, 성별 및 상태에 따라 적절히 조절될 수 있다.In the present invention, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type and severity of the individual, age, gender, and activity of the drug. , can be determined based on factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the field of medicine. The pharmaceutical composition of the present invention can be administered at a dosage of 0.1 mg/kg to 1 g/kg, and more preferably at a dosage of 1 mg/kg to 500 mg/kg. Meanwhile, the dosage can be appropriately adjusted depending on the patient's age, gender, and condition.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.
재료 및 방법Materials and Methods
1. 세포주 및 배양 방법1. Cell lines and culture methods
본 발명에서는 인간 에스트로겐 수용체 양성 유방암 세포(MCF-7)와 유방암 줄기세포-유사 세포(MCF-7/SC)를 사용하였다. MCF-7 세포는 ATCC의 지시에 따라 10% FBS, 100 U/mL 페니실린 및 100 g/mL 스트렙토마이신이 보충된 DMEM에서 배양되었다. MCF-7/SC 세포는 CD44+/CD24-/dim 세포군을 정렬하여 모세포 MCF-7로부터 생성되었으며(To, N.B. et al., Nutrients (2020) 12:1663), 10% FBS, 100 U/mL 페니실린 및 100 g/mL 스트렙토마이신으로 보충된 RPMI 1640을 사용하여 배양하였다. MCF-7과 MCF-7/SC의 증식은 각각 약 29시간 및 25시간이다.In the present invention, human estrogen receptor positive breast cancer cells (MCF-7) and breast cancer stem cell-like cells (MCF-7/SC) were used. MCF-7 cells were cultured in DMEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 g/mL streptomycin according to instructions from ATCC. MCF-7/SC cells were generated from parental MCF-7 by sorting the CD44+/CD24-/dim cell population (To, N.B. et al., Nutrients (2020) 12:1663), 10% FBS, 100 U/mL penicillin. and RPMI 1640 supplemented with 100 g/mL streptomycin. The proliferation of MCF-7 and MCF-7/SC is approximately 29 and 25 hours, respectively.
2. 세포 생존율 분석2. Cell viability analysis
MTT 검사를 위해 세포(4×103 세포/웰)는 표시된 배양 배지를 사용하여 96-웰 플레이트에 분주하고 37℃에서 배양되었다. 배양 후, 다양한 농도의 펜타데칸산, 타목시펜 또는 이들의 조합으로 48시간 동안 처리되었다. 처리 24시간 또는 48시간 후, MTT 분석을 실시하여 세포 생존율을 판단하였다(To, N.B. et al., 2020).For the MTT test, cells (4 × 10 3 cells/well) were seeded in 96-well plates using the indicated culture medium and cultured at 37°C. After incubation, they were treated with various concentrations of pentadecanoic acid, tamoxifen, or their combination for 48 hours. After 24 or 48 hours of treatment, MTT assay was performed to determine cell viability (To, NB et al., 2020).
3. 콜로니 형성 분석3. Colony formation assay
MCF-7 및 MCF-7/SC 세포(4×102 세포/배양접시)를 24시간 배양한 후, 펜타데칸산, 타목시펜 또는 이들의 조합을 처리하였다. 10일 동안 배양한 후, 각 콜로니는 4% 파라포름알데히드로 고정하고 2% 크리스탈 바이올렛으로 염색시켰다. 염색된 콜로니는 처리된 각 물질의 농도에 대해 처리되지 않은 대조군과 비교하여 수동으로 계산하였고 백분율로 표시하였다.MCF-7 and MCF-7/SC cells (4×10 2 cells/culture dish) were cultured for 24 hours and then treated with pentadecanoic acid, tamoxifen, or a combination thereof. After culturing for 10 days, each colony was fixed with 4% paraformaldehyde and stained with 2% crystal violet. Stained colonies were manually counted and expressed as percentage compared to untreated controls for each concentration of treated substance.
4. 상처 치유 분석4. Wound healing analysis
MCF-7 및 MCF-7/SC 세포(1×105 세포/웰)는 단층을 형성할 때까지 6-웰 플레이트에서 배양되었다. 무균 피펫 팁을 사용하여 꽉 자란 세포 단층을 균일하게 스크래칭하고, PBS로 세척하였다. 그 후, 각 세포에 펜타데칸산, 타목시펜 또는 이들의 조합을 처리하고 24시간 및 48시간 동안 반응시켰으며, 위상차현미경(×100)을 사용하여 스크래치의 폭을 측정하였다.MCF-7 and MCF-7/SC cells (1× 105 cells/well) were cultured in 6-well plates until they formed a monolayer. The tightly grown cell monolayer was scratched uniformly using a sterile pipette tip and washed with PBS. Afterwards, each cell was treated with pentadecanoic acid, tamoxifen, or a combination thereof and reacted for 24 and 48 hours, and the width of the scratch was measured using a phase contrast microscope (×100).
5. 세포 침윤 분석5. Cell invasion assay
세포 침윤 분석은 이전의 보고(Nobili, S. et al., Pharmacol. Res. (2009) 59:365-378)와 같이 24-웰 트랜스웰 시스템(공극 크기 0.2 ㎛, Corning, USA)을 사용하였다. 펜타데칸산과 타목시펜은 단독으로 또는 조합하여 혈청이 없는 배지 조건의 상부 챔버에 첨가되었으며, 10% FBS가 보충된 배지는 하부 챔버에 추가되었다. 48시간 배양 후, 세포는 4% 파라포름알데히드로 고정시켰고 2% 크리스탈 바이올렛으로 염색하였다. 침윤 세포는 위상차현미경(×100)에서 관찰되었다.The cell invasion assay used a 24-well transwell system (pore size 0.2 μm, Corning, USA) as previously reported (Nobili, S. et al., Pharmacol. Res. (2009) 59:365-378). . Pentadecanoic acid and tamoxifen, alone or in combination, were added to the upper chamber under serum-free medium conditions, and medium supplemented with 10% FBS was added to the lower chamber. After 48 hours of culture, cells were fixed with 4% paraformaldehyde and stained with 2% crystal violet. Infiltrating cells were observed under phase contrast microscopy (×100).
6. 유세포분석6. Flow cytometry
펜타데칸산, 타목시펜 또는 이들의 조합 처리에 따른 세포주기와 세포사멸에 대한 영향은 이전의 보고(Nobili, S. et al., 2009)에 따라 유세포분석으로 확인하였다. 세포(1×105 세포/배양접시)는 48시간 동안 단독으로 또는 조합하여 펜타데칸산과 타목시펜에 처리되었다. BD FACSDiva™소프트웨어를 사용하여 세포사멸(apoptosis) 집단을 분석하였다. 세포사멸을 검출하기 위해 아넥신 V-FITC 세포사멸 검출 키트(BD Biosciences)를 사용하였으며, 세포주기 분석은 ACSCalibur 유세포 분석기(Becton Dickinson)에 의해 수행되었으며, 세포주기 내 각 집단의 비율은 GraphPad Prism 7을 이용하여 분석 및 그래프화하였다.The effects of treatment with pentadecanoic acid, tamoxifen, or their combination on cell cycle and apoptosis were confirmed by flow cytometry according to a previous report (Nobili, S. et al., 2009). Cells (1 × 10 5 cells/culture dish) were treated with pentadecanoic acid and tamoxifen alone or in combination for 48 hours. Apoptosis populations were analyzed using BD FACSDiva™ software. Annexin V-FITC apoptosis detection kit (BD Biosciences) was used to detect apoptosis, cell cycle analysis was performed by an ACSCalibur flow cytometer (Becton Dickinson), and the proportion of each population in the cell cycle was calculated using GraphPad Prism 7. It was analyzed and graphed using .
7. 웨스턴 블롯팅7. Western blotting
펜타데칸산, 타목시펜 또는 이들의 조합 처리 후 MCF-7 또는 MCF-7/S 세포(3×105 세포/배양접시)로부터 세포 용해물을 제조하기 위해 RIPA (Radioimunoopination assay) 버퍼를 사용하였고, 단백질량을 결정하기 위해 BCA 검정(Thermo Fisher Scientific)을 수행하였다. 시료 준비 후, SDS-PAGE(sodium dodecyl sulfate-polyacrylamide gel electrophoresis)를 이용하여 단백질을 분리하였다. 막 트랜스퍼, 블록킹, 1차 항체 및 2차 항체 반응, 단백질 검출 절차는 선행연구(Nobili, S. et al., 2009)와 동일하게 수행하였다. 제조사의 지침에 따라 항체 희석을 수행했하였으며, 웨스턴 블랏에 사용된 항체 정보는 표 1과 같다.RIPA (Radioimunoopination assay) buffer was used to prepare cell lysates from MCF-7 or MCF-7/S cells (3 × 10 5 cells/culture dish) after treatment with pentadecanoic acid, tamoxifen, or their combination, and protein A BCA assay (Thermo Fisher Scientific) was performed to determine the amount. After sample preparation, proteins were separated using SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). Membrane transfer, blocking, primary and secondary antibody reactions, and protein detection procedures were performed in the same manner as in a previous study (Nobili, S. et al., 2009). Antibody dilution was performed according to the manufacturer's instructions, and information on the antibodies used in Western blot is shown in Table 1.
Figure PCTKR2023006815-appb-img-000001
Figure PCTKR2023006815-appb-img-000001
8. qRT-PCR(quantitative reverse transcription PCR)8. qRT-PCR (quantitative reverse transcription PCR)
MCF-7/SC 세포(1×106 세포/배양접시)를 밤새 배양한 후 펜타데칸산과 타목시펜을 48시간 동안 단독 또는 조합하여 처리하였다. 약물 처리 후 TRIzol 시약(Invitrogen; Thermo Fisher Scientific)을 사용하여 총 RNA를 추출하였고, 추출한 총 RNA는 cDNA 합성에 사용되었다. 이어서 cDNA 1 ㎕, 프라이머 2 ㎕(각 프라이머 1 ㎕), 마스터 믹스(Takara) 10 ㎕, RNA-free 물 7 ㎕로 구성된 20 ㎕ 반응물로 실시간 PCR을 수행하였다. 실시간 PCR은 95℃에서 15분간 초기 변성, 95℃에서 10초 및 60℃에서 30초 과정을 40회 실시한 후, 95℃에서 15초, 60℃에서 30초를 통해 해리 곡선을 생성하였으며, 95℃까지 15초 동안 온도를 점진적으로 상승시켰다. 표적 유전자의 프라이머 서열은 표 2에 나타내었으며, 유전자 발현은 2-△△Cq 방법(Livak, K.J. Schmittgen, T.D. Methods (2001) 25:402-408)을 사용하여 정량화하였다.MCF-7/SC cells (1×10 6 cells/culture dish) were cultured overnight and then treated with pentadecanoic acid and tamoxifen alone or in combination for 48 hours. After drug treatment, total RNA was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific), and the extracted total RNA was used for cDNA synthesis. Then, real-time PCR was performed with a 20 μl reaction mixture consisting of 1 μl of cDNA, 2 μl of primers (1 μl of each primer), 10 μl of master mix (Takara), and 7 μl of RNA-free water. Real-time PCR consisted of initial denaturation at 95°C for 15 minutes, followed by 40 cycles of 10 seconds at 95°C and 30 seconds at 60°C, followed by 15 seconds at 95°C and 30 seconds at 60°C to generate a dissociation curve, and 95°C. The temperature was gradually increased for 15 seconds. Primer sequences of target genes are shown in Table 2, and gene expression was quantified using the 2 -ΔΔCq method (Livak, KJ Schmittgen, TD Methods (2001) 25:402-408).
본 발명에 사용된 프라이머 정보Primer information used in the present invention
GeneGene 서열정보 (5'→3')Sequence information (5'→3') 서열번호sequence number
BCL2BCL2 FF TCCCTCGCTGCACAAATACTCTCCCTCGCTGCACAAATACTC 1 One
RR
ACGACCCGATGGCCATAGAACGACCCGATGGCCATAGA 22
CA12CA12 FF TGGCATTCTTGGCATCTGTATGGCATTCTTGGCATCTGTA 33
RR TTGGTGGCTGGCTTGTAAATTTGGTGGCTGGCTTGTAAAAT 44
XBP1XBP1 FF GCGCCTCACGCACCTGGGCGCTCCACGCACCTG 55
RR GCTGCTACTCTGTTTTTCAGTTTCCGCTGCTACTCTGTTTTTCAGTTTCC 66
GREB1GREB1 FF CAAAGAATAACCTGTTGGCCCTGCCAAAGAATAACCTTGTTGGCCCTGC 7 7
RR
GACATGCCTGCGCTCTCATACTTAGACATGCCTGCGCCTCTCATACTTA 88
FOSFOS FF CGTCTTCCTTCGTCTTCACCCGTCTTCCTTCGTCTTCACC 9 9
RR
GTCAGAGGAAGGCTCATTGCGTCAGAGGAAGGCTCATTGC 1010
NRIP1NRIP1 FF TCGCACTCACCACAGAAAACTCGCACTCACCACAGAAAAC 1111
RR AGCCAAGCTCTTCTCCATGTAGCCAAGCTCTTCTCCATGT 1212
RARARARA FF CGCTGCTGGAGGCGCTAAAGCGCTGCTGGAGGCGCTAAAG 1313
RR GCGCTGATGCTTCGCAGGTCGCGCTGATGCTTCGCAGGTC 1414
TFF1TFF1 FF GTGTCACGCCCTCCCAGTGTGTCAGCCCTCCCAGT 1515
RR GGACCCCACGAACGGTGGGACCCCACGAACGGTG 1616
9. CI(combination index) 값 산출9. Calculate CI (combination index) value
약물 상호작용에 있어서 펜타데칸산과 타목시펜의 효과를 계산하였으며, 이를 CI로 표현하였다. Median-effect 원리에 기반하여 CI 값을 계산하기 위해 하기 공식을 사용하였다.The effects of pentadecanoic acid and tamoxifen on drug interactions were calculated and expressed as CI. The following formula was used to calculate the CI value based on the median-effect principle.
CI = D1/(Dx)1 + D2/(Dx)2CI = D1/(Dx)1 + D2/(Dx)2
(분모의 (Dx)1 및 (Dx)2는 각각 첫 번째 약물(Drug1)과 두 번째 약물(Drug2)이 단독으로 x% 억제할 수 있는 농도를 나타낸다. 분자에서 D1과 D2는 각각 분모에서 해당 약물의 농도와 동일한 효과(x% 억제)를 갖는 조합(D1+D2)에서 첫 번째 약물과 두 번째 약물의 부분을 나타낸다.)((Dx)1 and (Dx)2 in the denominator represent the concentrations that can inhibit x% of the first drug (Drug1) and the second drug (Drug2) alone, respectively. D1 and D2 in the numerator correspond to the corresponding values in the denominator, respectively. It represents the portion of the first drug and the second drug in the combination (D1+D2) that has the same effect (x% inhibition) as the concentration of the drug.)
CompuSyn 소프트웨어를 사용하여 Chou-Talalalay 모델에 따른 CI 값을 계산하였다(Chou, T.-C. Cancer Res. (2010) 70:440-446). 부가적 영향(additive impact), 상가작용(synergism) 및 길항작용(antagonism)의 지표는 각각 CI = 1, 1, >1이다.CI values according to the Chou-Talalalay model were calculated using CompuSyn software (Chou, T.-C. Cancer Res. (2010) 70:440-446). Indicators of additive impact, synergism, and antagonism are CI = 1, 1, and >1, respectively.
10. 통계분석10. Statistical analysis
통계적 분석은 GraphPad Prism 7을 사용하여 수행되었다. 세 가지 독립 실험의 평균과 표준 편차는 결과를 나타내기 위해 사용되었다. 그룹 비교를 위해 Dunnett의 사후 검정을 사용한 일원 분산 분석을 사용했으며 p < 0.05는 통계적으로 유의한 것으로 간주되었다.Statistical analysis was performed using GraphPad Prism 7. The mean and standard deviation of three independent experiments were used to represent the results. One-way analysis of variance with Dunnett's post hoc test was used for group comparisons, and p < 0.05 was considered statistically significant.
실시예 1. 약물 내성 인간 유방암 MCF-7/SC의 특성 분석Example 1. Characterization of drug-resistant human breast cancer MCF-7/SC
본 발명자는 최근 연구에서, MCF-7과 MCF-7/SC 세포에서 RNA 시퀀싱을 수행하고 MCF-7과 MCF-7/SC 세포 사이에서 다르게 발현되는 유전자(differentially expressed genes, DEGs)를 확인하였다. 전사체 분석 결과에 따르면 MCF-7/SC 세포에서 약물 내성과 관련된 DEGs의 뚜렷한 유전자 프로파일과 유의미한 증가를 확인할 수 있었다.In a recent study, the present inventors performed RNA sequencing in MCF-7 and MCF-7/SC cells and identified differentially expressed genes (DEGs) between MCF-7 and MCF-7/SC cells. According to the transcriptome analysis results, a distinct gene profile and significant increase in DEGs related to drug resistance were confirmed in MCF-7/SC cells.
전사체 분석 결과를 확인하기 위해, MCF-7/SC 세포의 특징을 추가로 규명하였다. 현미경 분석 결과 MCF-7과 MCF-7/SC 세포 사이에 분명한 형태학적 차이가 나타났다. MCF-7 세포는 원형 또는 불규칙한 상피 유사 형태를 보였으나, MCF-7/SC 세포는 더 내강적이고 길쭉한 형태와 세포간 거리가 증가한 것을 관찰할 수 있었다(도 1A). 또한, MCF-7/SC 세포의 클론 생성 능력은 모세포 MCF-7의 클론 생성 능력보다 높은 것으로 확인되었다(도 1B, C). 또한, 트랜스웰 분석 결과 MCF-7/SC 세포의 침습 능력이 향상된 것을 알 수 있었다(도 1D, E). 본 발명자는 종양 약물 내성에 관련된 여러 단백질의 발현 수준을 분석하기 위해 웨스턴 블랏을 수행하였고, 그 결과 MCF-7/SC 세포는 모세포 MCF-7에 비해 snail, Bcl-2, STAT3 및 p-STAT3를 높은 수준으로 발현하였고 Rb, p-Rb, E-cad 및 p21과 같은 종양 억제 단백질의 발현 수준은 감소된 것을 확인할 수 있었다(도 1F, G). 특히, MCF-7/SC 세포에서 ER-α의 mRNA와 단백질 발현 수준이 MCF-7 세포보다 유의하게 낮은 것을 관찰하였다(도 1F, G). 이러한 결과는 ER-α의 상실이 MCF-7/SC 세포의 약물 내성에 중요한 역할을 할 수 있음을 의미하였다.To confirm the transcriptome analysis results, the characteristics of MCF-7/SC cells were further characterized. Microscopic analysis revealed clear morphological differences between MCF-7 and MCF-7/SC cells. MCF-7 cells showed a round or irregular epithelial-like shape, but MCF-7/SC cells had a more luminal and elongated shape and increased intercellular distance (Figure 1A). Additionally, the clonogenic ability of MCF-7/SC cells was confirmed to be higher than that of parental MCF-7 cells (Figure 1B, C). In addition, the results of transwell analysis showed that the invasion ability of MCF-7/SC cells was improved (Figures 1D, E). The present inventors performed Western blot to analyze the expression levels of several proteins involved in tumor drug resistance, and the results showed that MCF-7/SC cells expressed snail, Bcl-2, STAT3, and p-STAT3 compared to parental MCF-7 cells. It was expressed at a high level, and the expression level of tumor suppressor proteins such as Rb, p-Rb, E-cad, and p21 was confirmed to be reduced (Figure 1F, G). In particular, we observed that the mRNA and protein expression levels of ER-α in MCF-7/SC cells were significantly lower than those in MCF-7 cells (Figures 1F, G). These results implied that loss of ER-α may play an important role in drug resistance of MCF-7/SC cells.
실시예 2. MCF-7/SC 세포의 타목시펜(tamoxifen) 저항성 분석Example 2. Tamoxifen resistance analysis of MCF-7/SC cells
타목시펜의 치료적 효과는 ER 매개가 주요하므로, 유방암 세포에서 ER 발현의 상실은 타목시펜 내성과 매우 연관되어 있다. MCF-7/SC 세포가 타목시펜에 내성을 보이는지 확인하기 위해 MTT 분석을 수행하였다. 그 결과, 타목시펜은 MCF-7에 비해 MCF-7/SC에서 낮은 세포독성을 나타냈다(도 2A, B). 또한, 타목시펜은 MCF-7/SC 세포보다 MCF-7 세포에서 콜로니 형성 억제 활성이 강하게 나타났는데, 10 μM의 타목시펜 처리 조건에서 MCF-7 세포의 경우 무처리 대조군 대비 콜로니의 수가 90% 이상 감소되었으나, MCF-7/SC 세포의 경우 무처리 대조군 대비 콜로니의 수가 40% 정도 감소되어, MCF-7/SC 세포가 타목시펜에 저항성을 보임을 알 수 있었다(도 2 C,D). 타목시펜의 세포 이동 억제 및 침윤 억제 효과 또한 모세포인 MCF-7 세포에서 현저히 크게 나타났다(도 2E 내지 H). 또한, 모세포인 MCF-7에서는 타목시펜의 농도 의존적으로 세포사멸(apoptosis)이 증가하는 것으로 관찰되었으나, MCF-7/SC 세포에서는 무처리 대조군과 비교하여 타목시펜 처리군에서 세포사멸이 증가하지 않는 것으로 확인되었다(도 3A, B). 세포사멸 마커 단백질의 발현 수준을 분석한 웨스턴 블랏 결과에서도 MCF-7 세포는 타목시펜 처리에 의해 전장의 caspase-7 및 caspase-9의 단백질 수준이 감소하는 것으로 나타났으나, MCF-7/SC 세포의 경우 단백질 수준에 변화가 없는 것으로 확인되었다(도 3C, D).Because the therapeutic effects of tamoxifen are primarily ER-mediated, loss of ER expression in breast cancer cells is highly associated with tamoxifen resistance. MTT assay was performed to determine whether MCF-7/SC cells were resistant to tamoxifen. As a result, tamoxifen showed lower cytotoxicity in MCF-7/SC compared to MCF-7 (Figures 2A, B). In addition, tamoxifen showed stronger colony formation inhibitory activity in MCF-7 cells than in MCF-7/SC cells. Under 10 μM tamoxifen treatment conditions, the number of colonies in MCF-7 cells was reduced by more than 90% compared to the untreated control group. , in the case of MCF-7/SC cells, the number of colonies was reduced by about 40% compared to the untreated control group, showing that MCF-7/SC cells showed resistance to tamoxifen (Figure 2 C,D). The cell migration and invasion inhibition effects of tamoxifen were also significantly greater in the parental MCF-7 cells (Figures 2E to H). In addition, it was observed that apoptosis increased in a tamoxifen concentration-dependent manner in MCF-7 parent cells, but in MCF-7/SC cells, it was confirmed that apoptosis did not increase in the tamoxifen-treated group compared to the untreated control group. (Figure 3A, B). Western blot results analyzing the expression levels of apoptosis marker proteins also showed that the protein levels of full-length caspase-7 and caspase-9 in MCF-7 cells were decreased by tamoxifen treatment, but in MCF-7/SC cells, In this case, it was confirmed that there was no change in protein level (Figure 3C, D).
실시예 3. 펜타데칸산(pentadecanoic acid)과 타목시펜의 병용 처리 효과 분석Example 3. Analysis of the effect of combined treatment of pentadecanoic acid and tamoxifen
본 발명자는 타목시펜에 내성을 보이는 MCF-7/SC 세포에 펜타데칸산과 타목시펜의 병용(combination) 요법의 영향을 분석하였다. 펜타데칸산과 타목시펜을 조합하여 처리한 후 MCF-7/SC 세포의 생존율을 MTT 검정으로 분석한 결과, 펜타데칸산 단독 처리 대비 펜타데칸산과 타목시펜의 조합 처리군에서 MCF-7/SC 세포의 생존율이 떨어지는 것을 확인하였다(도 4A, B). 또한, 펜타데칸산과 타목시펜의 다양한 처리 농도 조합에 따른 CI 값을 계산한 결과, 펜타데칸산/타목시펜(μM) 25/5 및 50/5의 조건은 24시간 및 48시간째 모두 상가적 효과(CI < 1)가 있음을 알 수 있었으며, 펜타데칸산/타목시펜 100/5의 조건은 24시간째에, 펜타데칸산/타목시펜 50/10, 75/10 및 100/10의 조건은 48시간째 상가적 효과가 있음을 알 수 있었다(도 4C, D). 콜로니 형성 검정에서도 펜타데칸산과 타목시펜의 병용 처리가 펜타데칸산과 타목시펜의 개별 처리 대비 현저히 우수한 저해 효과를 나타내었다(도 4E 내지 H). 이상의 결과를 통해 펜타데칸산이 효과적으로 MCF-7/SC 세포를 타목시펜에 재감작시킴을 알 수 있었다.The present inventors analyzed the effect of combination therapy of pentadecanoic acid and tamoxifen on tamoxifen-resistant MCF-7/SC cells. As a result of analyzing the survival rate of MCF-7/SC cells using the MTT assay after treatment with a combination of pentadecanoic acid and tamoxifen, the survival rate of MCF-7/SC cells was higher in the group treated with the combination of pentadecanoic acid and tamoxifen compared to treatment with pentadecanoic acid alone. It was confirmed that it was falling (Figure 4A, B). In addition, as a result of calculating the CI values according to various treatment concentration combinations of pentadecanoic acid and tamoxifen, the conditions of pentadecanoic acid/tamoxifen (μM) 25/5 and 50/5 showed an additive effect (CI) at both 24 and 48 hours. < 1), and the conditions of pentadecanoic acid/tamoxifen 100/5 were additive at 24 hours, and the conditions of pentadecanoic acid/tamoxifen 50/10, 75/10, and 100/10 were additive at 48 hours. It was found to be effective (Figure 4C, D). In the colony formation assay, the combined treatment of pentadecanoic acid and tamoxifen showed a significantly superior inhibitory effect compared to the individual treatment of pentadecanoic acid and tamoxifen (Figures 4E to H). The above results showed that pentadecanoic acid effectively re-sensitized MCF-7/SC cells to tamoxifen.
실시예 4. 펜타데칸산과 타목시펜의 병용 처리가 MCF-7/SC 세포의 세포사멸에 미치는 영향Example 4. Effect of combined treatment of pentadecanoic acid and tamoxifen on apoptosis of MCF-7/SC cells
본 발명자는 펜타데칸산과 타목시펜의 병용 처리가 MCF-7/SC 세포의 세포사멸에 미치는 영향을 분석하였다. Annexin V/PI 염색을 통해 확인한 결과, 10 μM 타목시펜 단독 처리는 MCF-7/SC 세포의 세포사멸에 영향을 미치지 않는 것으로 나타났으나, 10 μM의 타목시펜에 50 또는 100 μM의 펜타데칸산을 조합하여 처리한 세포에서는 세포사멸이 현저히 증가되었음을 알 수 있었다(도 5A, B). 세포사멸 마커 단백질의 발현 수준을 확인한 웨스턴 블랏 결과에서도 펜타데칸산과 타목시펜의 병용 처리가 펜타데칸산 또는 타목시펜 개별 처리 대비 caspase-3, -7, -9 단백질의 발현을 현저히 감소시킴을 알 수 있었다(도 5C, D).The present inventors analyzed the effect of combined treatment of pentadecanoic acid and tamoxifen on apoptosis of MCF-7/SC cells. As confirmed through Annexin V/PI staining, treatment with 10 μM tamoxifen alone did not appear to affect apoptosis of MCF-7/SC cells, but combining 10 μM tamoxifen with 50 or 100 μM pentadecanoic acid It was found that apoptosis was significantly increased in treated cells (Figure 5A, B). Western blot results confirming the expression levels of apoptosis marker proteins also showed that the combined treatment of pentadecanoic acid and tamoxifen significantly reduced the expression of caspase-3, -7, and -9 proteins compared to individual treatments of pentadecanoic acid or tamoxifen ( Figure 5C,D).
실시예 5. 펜타데칸산과 타목시펜의 병용 처리가 상피간엽이행(epithelial-mesenchymal transition, EMT)에 미치는 영향Example 5. Effect of combined treatment of pentadecanoic acid and tamoxifen on epithelial-mesenchymal transition (EMT)
이전의 연구들은 암세포 전이와 약물 저항에서 EMT의 중요한 역할을 보고하였다. 따라서 세포 이동 분석, 침윤능 분석, 웨스턴 블랏을 이용하여 EMT에 대한 펜타데칸산과 타목시펜 조합의 영향을 평가하였다. 50 μM 펜타데칸산과 10 μM 타목시펜을 함께 처리할 경우 MCF-7/SC 세포의 이동능 및 침윤능이 유의하게 억제되는 것을 확인하였다(도 6A 내지 D). 이러한 사실은 Snail, Slug, matrix metalloproteinase 9 (MMP9) 및 vimentin과 같은 EMT 관련 마커에 대한 웨스턴 블랏 결과를 통해 추가로 확인되었다. 타목시펜 또는 펜타데칸산을 개별 처리한 조건에서는 상기 단백질들의 발현에 유의미한 억제 효과가 관찰되지 않았으나(도 6E-F), 병용 처리는 MCF-7/SC 세포에서 EMT 관련 단백질의 발현을 크게 감소시켰다. 이상의 결과는 펜타데칸산과 타목시펜의 병용 처리가 MCF-7/SC 세포에서 세포의 이동 및 침윤능을 효과적으로 억제하고 EMT 관련 마커의 발현을 감소시킬 수 있음을 보여주었다.Previous studies have reported the important role of EMT in cancer cell metastasis and drug resistance. Therefore, the effect of pentadecanoic acid and tamoxifen combination on EMT was evaluated using cell migration assay, invasion ability assay, and Western blot. It was confirmed that when 50 μM pentadecanoic acid and 10 μM tamoxifen were treated together, the migration and invasion abilities of MCF-7/SC cells were significantly inhibited (Figures 6A to D). These facts were further confirmed through Western blot results for EMT-related markers such as Snail, Slug, matrix metalloproteinase 9 (MMP9), and vimentin. No significant inhibitory effect was observed on the expression of these proteins under conditions of individual treatment with tamoxifen or pentadecanoic acid (Figure 6E-F), but combined treatment significantly reduced the expression of EMT-related proteins in MCF-7/SC cells. The above results showed that the combined treatment of pentadecanoic acid and tamoxifen could effectively inhibit cell migration and invasion ability in MCF-7/SC cells and reduce the expression of EMT-related markers.
실시예 6. 펜타데칸산과 타목시펜의 병용 처리에 의한 에스트로겐 수용체 발현 변화Example 6. Changes in estrogen receptor expression by combined treatment of pentadecanoic acid and tamoxifen
본 발명자는 펜타데칸산과 타목시펜의 조합이 MCF-7/SC 세포에서 ER-α 발현을 유도할 수 있다는 가설을 세웠다. 이를 조사하기 위해 먼저 펜타데칸산(50 또는 100 μM)을 단독으로 또는 10 μM 타목시펜과 함께 MCF-7/SC 세포에 처리하였고, ER-α 발현을 조사하였다. 그 결과, 펜타데칸산은 100 μM 단독 처리 조건에서, 그리고 타목시펜과 병용 처리한 모든 조건에서 ER-a의 mRNA 및 단백질 발현 수준을 모두 증가시켰다(도 7A 내지 C). 펜타데칸산과 타목시펜의 병용 처리가 ER-α 관련 유전자에 영향을 미치는지 여부를 추가로 조사하였다. 그 결과, 고농도의 펜타데칸산 단독 또는 타목시펜과의 병용 처리가 CA12, XBP1, GREB1, FOS, NRIP1, RARA, BCL2 및 TFF1을 포함하는 ER-α 관련 유전자의 발현을 유도할 수 있음을 확인하였다(도 7D). 이상의 결과는 ER-α의 펜타데칸산 단독 또는 타목시펜과의 조합에 의한 ER-α의 재발현이 MCF-7/SC 유방암 세포에서 타목시펜에 대한 감수성의 회복에 기여함을 나타낸다.We hypothesized that the combination of pentadecanoic acid and tamoxifen could induce ER-α expression in MCF-7/SC cells. To investigate this, MCF-7/SC cells were first treated with pentadecanoic acid (50 or 100 μM) alone or together with 10 μM tamoxifen, and ER-α expression was examined. As a result, pentadecanoic acid increased both the mRNA and protein expression levels of ER-a in all conditions of treatment alone at 100 μM and in combination with tamoxifen (Figures 7A to C). We further investigated whether the combined treatment of pentadecanoic acid and tamoxifen affects ER-α-related genes. As a result, it was confirmed that treatment with high concentration of pentadecanoic acid alone or in combination with tamoxifen can induce the expression of ER-α-related genes including CA12, XBP1, GREB1, FOS, NRIP1, RARA, BCL2 , and TFF1 ( Figure 7D). The above results indicate that re-expression of ER-α by pentadecanoic acid alone or in combination with tamoxifen contributes to restoration of sensitivity to tamoxifen in MCF-7/SC breast cancer cells.

Claims (8)

  1. 펜타데칸산(pentadecanoic acid)을 유효성분으로 포함하는 항암제 내성 암의 항암제 감수성 증진용 조성물.A composition for enhancing anticancer drug susceptibility in anticancer drug-resistant cancer, comprising pentadecanoic acid as an active ingredient.
  2. 제1항에 있어서, 상기 항암제 내성 암은 타목시펜(tamoxifen) 내성 유방암인 것을 특징으로 하는 항암제 감수성 증진용 조성물.The composition for enhancing anticancer drug susceptibility according to claim 1, wherein the anticancer drug-resistant cancer is tamoxifen-resistant breast cancer.
  3. 펜타데칸산(pentadecanoic acid)을 유효성분으로 포함하는 항암제 내성암의 항암 보조제.An anticancer supplement for anticancer drug-resistant cancer containing pentadecanoic acid as an active ingredient.
  4. 제3항에 있어서, 상기 항암 보조제는 항암제와 병용 투여용인 것을 특징으로 하는 항암 보조제.The anti-cancer adjuvant according to claim 3, wherein the anti-cancer adjuvant is used in combination with an anti-cancer agent.
  5. 제3항에 있어서, 상기 항암제 내성암은 타목시펜(tamoxifen) 내성 유방암인 것을 특징으로 하는 항암 보조제.The anti-cancer adjuvant according to claim 3, wherein the anti-cancer drug-resistant cancer is tamoxifen-resistant breast cancer.
  6. 펜타데칸산(pentadecanoic acid) 및 타목시펜(tamoxifen)의 혼합물을 유효성분으로 포함하는, 타목시펜 내성 유방암의 예방 또는 치료용 약학 조성물.A pharmaceutical composition for preventing or treating tamoxifen-resistant breast cancer, comprising a mixture of pentadecanoic acid and tamoxifen as active ingredients.
  7. 제6항에 있어서, 상기 펜타데칸산과 타목시펜의 혼합물은 암 세포의 에스트로겐 수용체 발현 수준을 증가시키고, 세포사멸(apoptosis)을 증가시키며 상피간엽이행(epithelial-mesenchymal transition)을 억제하는 것을 특징으로 하는 약학 조성물.The pharmaceutical composition of claim 6, wherein the mixture of pentadecanoic acid and tamoxifen increases the expression level of estrogen receptors in cancer cells, increases apoptosis, and inhibits epithelial-mesenchymal transition. Composition.
  8. 약학적으로 유효한 양의 제6항의 약학 조성물을 타목시펜에 내성을 보이는 암에 걸린 포유동물 개체에 투여하는 단계를 포함하는, 포유동물 개체의 타목시펜 내성암 치료 방법.A method of treating tamoxifen-resistant cancer in a mammalian subject, comprising administering a pharmaceutically effective amount of the pharmaceutical composition of claim 6 to a mammalian subject with cancer resistant to tamoxifen.
PCT/KR2023/006815 2022-11-15 2023-05-19 Anticancer adjuvant containing pentadecanoic acid as active ingredient, and uses thereof WO2024106647A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220152816A KR20240072366A (en) 2022-11-15 2022-11-15 Anti-cancer adjuvant comprising pentadecanoic acid as effective component and uses thereof
KR10-2022-0152816 2022-11-15

Publications (1)

Publication Number Publication Date
WO2024106647A1 true WO2024106647A1 (en) 2024-05-23

Family

ID=91084917

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/006815 WO2024106647A1 (en) 2022-11-15 2023-05-19 Anticancer adjuvant containing pentadecanoic acid as active ingredient, and uses thereof

Country Status (2)

Country Link
KR (1) KR20240072366A (en)
WO (1) WO2024106647A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1251296A (en) * 1998-10-16 2000-04-26 杨振华 Use of anticancer material and production method of said anti-cancer material
KR20150003111A (en) * 2014-11-12 2015-01-08 고려대학교 산학협력단 Composition for prevention or treating recurrent or metastatic cancer having immunoresistance
KR102395453B1 (en) * 2020-11-11 2022-05-09 제주대학교 산학협력단 Composition for inhibiting breast cancer metastasis comprising odd long chain fatty acid as effective component
KR20220097306A (en) * 2020-12-30 2022-07-07 한국과학기술원 Composition for inhibiting cancer metastasis and enhancing sensitivity to anticancer agent

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1251296A (en) * 1998-10-16 2000-04-26 杨振华 Use of anticancer material and production method of said anti-cancer material
KR20150003111A (en) * 2014-11-12 2015-01-08 고려대학교 산학협력단 Composition for prevention or treating recurrent or metastatic cancer having immunoresistance
KR102395453B1 (en) * 2020-11-11 2022-05-09 제주대학교 산학협력단 Composition for inhibiting breast cancer metastasis comprising odd long chain fatty acid as effective component
KR20220097306A (en) * 2020-12-30 2022-07-07 한국과학기술원 Composition for inhibiting cancer metastasis and enhancing sensitivity to anticancer agent

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TO NGOC BAO, TRUONG VI NGUYEN-PHUONG; EDIRIWEERA MERAN KESHAWA; CHO SOMI KIM: "Effects of Combined Pentadecanoic Acid and Tamoxifen Treatment on Tamoxifen Resistance in MCF−7/SC Breast Cancer Cells", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, MOLECULAR DIVERSITY PRESERVATION INTERNATIONAL (MDPI), BASEL, CH, vol. 23, no. 19, 26 September 2022 (2022-09-26), Basel, CH , pages 11340, XP093170195, ISSN: 1422-0067, DOI: 10.3390/ijms231911340 *

Also Published As

Publication number Publication date
KR20240072366A (en) 2024-05-24

Similar Documents

Publication Publication Date Title
TWI334350B (en) Cancer treatment
KR101765575B1 (en) Pharmaceutical composition for inhibiting a growth of cancer stem cells comprising aldehyde inhibitor and biguanide compounds
EP3177595B1 (en) Asymmetric bisaminoquinolines and bisaminoquinolines with varied linkers as autophagy inhibitors for cancer and other therapy
US11065258B2 (en) Calmodulin inhibitors for the treatment of ribosomal disorders and ribosomapathies
TW202128616A (en) Methods of treating lsd1-related diseases and disorders with lsd1 inhibitors
UA125892C2 (en) An aurora a kinase inhibitor for use in the treatment of neuroblastoma
WO2022055285A1 (en) Pharmaceutical composition for killing cancer progenitor cells
WO2024106647A1 (en) Anticancer adjuvant containing pentadecanoic acid as active ingredient, and uses thereof
KR102018841B1 (en) Pharmaceutical composition for preventing or treating brain cancer
US20230137849A1 (en) Use of a compound of the diuretics class for treating cancer
WO2016126073A2 (en) Pharmaceutical composition for inhibiting growth of cancer stem cells, containing aldehyde inhibitor and biguanide-based compound
WO2022186608A1 (en) Anticancer use of extract from stichopus japonicus gonads or compounds derived therefrom
CN112439067B (en) Application of SGLT2 inhibitor in preparation of product for improving sensitivity of antitumor drugs
WO2020213939A1 (en) Pharmaceutical composition for co-administration of anticancer drug
WO2021112541A1 (en) Pharmaceutical composition for prevention and treatment of secondary cancer, comprising aldehyde inhibitor and biguanide-based compound
WO2018194419A2 (en) Method for preparing cancer stemness cell line through metabolic stress, and cancer cell prepared through same
EP1469858B1 (en) Non-nucleosidic inhibitors of reverse transcriptase as antagonists of cell proliferation and inducers of cell differentiation
US10688086B2 (en) Method for treating cancer with dihydropyridine calcium antagonist
KR102656587B1 (en) Pharmaceutical composition for the death of cancer origin cell
CN107260752B (en) Synergistic anti-pancreatic cancer pharmaceutical composition
WO2019124601A1 (en) Composition for preventing or treating cataracts, containing inhibitor of binding between nfat5 and nf-κb as active ingredient
WO2024000812A1 (en) Use of steroid taccoside a in preparing tumor immunotherapy drug
WO2021080363A1 (en) Composition for preventing or treating cancer
CN113908148B (en) Application of nobiletin in preparation of anti-cholangiocarcinoma drugs
RU2784809C2 (en) Combined product containing dicycloplatin and method for its production and use