CN112439067B - Application of SGLT2 inhibitor in preparation of product for improving sensitivity of antitumor drugs - Google Patents

Abstract

The invention discloses application of an SGLT2 inhibitor in preparation of a product for improving sensitivity of an antitumor drug. The invention discovers that the SGLT2 inhibitor Canagliflozin can inhibit the expression and the function of P-glycoprotein in tumor cells and inhibit the autophagy phenomenon of stress protection of the tumor cells in the face of chemotherapy drug treatment, thereby improving the sensitivity of the tumor cells to the chemotherapy drugs and enhancing the treatment effect of the drugs. The inhibitor can exist in the form of liquid, dry powder or extract, can be prepared into various dosage forms with health care or medicinal efficacy such as capsules, tablets, injection, pills, granules, powder and the like with various conventional auxiliary materials, and can be combined with other chemotherapeutic drugs for treating malignant tumors.

Description

Application of SGLT2 inhibitor in preparation of product for improving sensitivity of antitumor drugs

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of an SGLT2 inhibitor in preparation of products for improving sensitivity of antitumor drugs, enhancing treatment effect of antitumor drugs and treating tumors.

Background

Malignant tumor is cancer cell developed due to genetic and environmental carcinogenic factors, which results in the loss of normal regulation of local tissue cells in human body at gene level and has the characteristics of unlimited proliferation, metastasis and transformation. Malignant tumors not only seriously harm the health of human beings, but also greatly affect the lives of patients, and also form great medical burden on families and society. The number of cases of malignant tumor and the number of death cases are at the first place in the world in China, are the most serious public health problem at present, and are not favorable for social stability and economic development.

Currently, malignant tumors are mainly treated by surgical resection, chemotherapy, radiotherapy and the like, wherein chemotherapy is one of the most effective methods for controlling the spread of cancerous cells in vivo. However, chemotherapy often has the disadvantages of great side effects and easy generation of drug resistance by tumor cells. Drug resistance is the most important cellular defense mechanism when tumor cells are attacked by chemotherapeutic drugs, relates to various antitumor drugs commonly used in clinical practice, and is one of the most serious obstacles to successful chemotherapy of tumors.

Drug resistance of tumors is associated with multiple factors, of which the mechanism of multidrug resistance mediated by P-glycoprotein (P-glycoprotein) is one of the key breakthrough. The P-glycoprotein is glycoprotein encoded by multidrug resistance gene (MDR 1) and has the molecular weight of 170KD, has the function of drug pump, releases energy after combining ATP to discharge chemotherapy drug molecules in cells to the outside of the cells, changes the drug concentration in the cells, and reduces the sensitivity of tumor cells to drugs.

Autophagy is a ubiquitous phenomenon in eukaryotic cells and is capable of renewing the metabolism and energy of cells, thereby facilitating the maintenance of cellular homeostasis. However, autophagy is bilateral to tumors and plays an important role in the development and treatment of tumors. Inducing autophagy in some cases can inhibit tumor growth and cause autophagy-related cell death. However, most often, in the face of conditions that are not conducive to survival, such as hypoxia, nutrient deficiency, DNA damage, etc., autophagy can be regulated by scavenging oxygen free radicals, damaging mitochondria, etc., to provide stress protection for tumor cells.

Canagliflozin (CAN for short) is an SGLT2 inhibitor, and is a class of diabetes drugs on the market. The CAN has the action mechanism of selectively inhibiting sodium-glucose cotransporter SGLT2 on the proximal convoluted tubule and inhibiting the absorption of glucose by the proximal convoluted tubule, thereby reducing the blood sugar. Both safety and efficacy have been subject to clinical evaluation.

Disclosure of Invention

The invention aims to provide application of an SGLT2 inhibitor in preparation of products for improving the sensitivity of antitumor drugs, enhancing the treatment effect of antitumor drugs and treating tumors.

The invention firstly protects the new application of the SGLT2 inhibitor or the pharmaceutically acceptable salt and ester thereof.

The invention protects the application of SGLT2 inhibitor or pharmaceutically acceptable salt and ester thereof in any one of A1) to A8) as follows:

a1 Preparing a product for preventing and/or treating tumors;

a2 Preparing a product for enhancing the treatment effect of the antitumor drug or the chemotherapeutic drug;

a3 Preparing a product for inhibiting tumor drug resistance;

a4 Preparing a product for improving the sensitivity of tumor cells to anti-tumor drugs or chemotherapeutic drugs;

a5 Preparing a product for promoting the accumulation of the antitumor drug or the chemotherapeutic drug in tumor cells;

a6 Preparing a product that reduces the expression level of P-glycoprotein in tumor cells;

a7 Preparing a product for inhibiting autophagy induced by an antitumor drug or a chemotherapeutic drug or an autophagy inducer;

a8 To prepare a product for inhibiting tumor growth.

The invention also protects a product, the active ingredient of which is SGLT2 inhibitor or pharmaceutically acceptable salt and ester thereof;

the function of the product is any one of the following B1) -B8):

b1 ) preventing and/or treating tumors;

b2 To enhance the therapeutic effect of the anti-tumor or chemotherapeutic agent;

b3 Inhibiting tumor resistance;

b4 Improving the sensitivity of tumor cells to anti-tumor drugs or chemotherapeutic drugs;

b5 Promoting the accumulation of the antitumor drug or the chemotherapeutic drug in the tumor cells;

b6 Reducing the expression level of P-glycoprotein in tumor cells;

b7 Inhibiting autophagy induced by antineoplastic agents or chemotherapeutic agents or autophagy inducing agents;

b8 Inhibit tumor growth.

The invention also provides an anti-tumor composition, which consists of the SGLT2 inhibitor or pharmaceutically acceptable salt and ester thereof and an anti-tumor medicament or a chemotherapeutic medicament;

the function of the anti-tumor composition is any one of the following B1) to B8):

b1 ) preventing and/or treating tumors;

b2 To enhance the therapeutic effect of an anti-tumor drug or chemotherapeutic drug;

b3 Inhibiting tumor resistance;

b4 Improving the sensitivity of tumor cells to anti-tumor drugs or chemotherapeutic drugs;

b5 Promoting the accumulation of the antitumor drug or the chemotherapeutic drug in the tumor cells;

b6 Reducing the expression level of P-glycoprotein in tumor cells;

b7 Inhibiting autophagy induced by antineoplastic or chemotherapeutic drugs or autophagy inducing agents;

b8 Inhibit tumor growth.

In any of the above applications or products or anti-tumor compositions, the reduction of the expression level of the P-glycoprotein in the tumor cells is the reduction of the protein expression level of the P-glycoprotein in the tumor cells; further, the reduction of the protein expression level of the P-glycoprotein in the tumor cells is realized by enhancing the degradation of the P-glycoprotein in the tumor cells; furthermore, the enhancement of the degradation of the tumor cell P-glycoprotein is realized by a proteasome degradation pathway.

In any of the above applications or products or anti-tumor compositions, the inhibition of autophagy induced by the anti-tumor drug or chemotherapeutic drug or autophagy inducer is characterized by decreasing the LC3 ii/LC 3 i ratio and/or increasing the p62 expression level; the autophagy induced by the anti-tumor drug or the chemotherapeutic drug or the autophagy inducer blocks autophagy by activating p-ULK1 (Ser 757).

In any of the uses or products or anti-tumor compositions described above, the inhibition of tumor growth is manifested by a reduction in tumor cell volume and/or a reduction in tumor cell weight.

In any of the above applications or products or anti-tumor compositions, the SGLT2 inhibitor is Canagliflozin (CAN for short), has CAS accession number 842133-18-0 and molecular formula C ₂₄ H ₂₅ FO ₅ S, molecular weight 444.52. The structural formula is shown as formula I.

In any of the above applications or products or anti-tumor compositions, the anti-tumor drug or chemotherapeutic drug may be an antibiotic anti-tumor drug or chemotherapeutic drug. In a specific embodiment of the present invention, the antibiotic anti-tumor drug or chemotherapeutic drug is Doxorubicin (Doxorubicin, doxo for short), CAS number is 23214-92-8, and molecular formula is C ₂₇ H ₂₉ NO ₁₁ And the molecular weight is 543.52. The structural formula is shown as a formula II.

In any of the above applications or products or anti-tumor compositions, the tumor can be a common tumor in the prior art, such as liver cancer, colon cancer or breast cancer; the tumor cell can be a common tumor cell in the prior art, such as a liver cancer cell (e.g., a human liver cancer cell HepG2, an adriamycin-resistant human liver cancer cell HepG 2-ADR), a colon cancer cell (e.g., a human colon cancer cell HCT 116) or a breast cancer cell (e.g., a human breast cancer cell MCF 7).

In any of the above applications or products or anti-tumor compositions, the product may be a medicament and the anti-tumor composition may be an anti-tumor pharmaceutical composition. The product (medicament) or the antitumor composition (antitumor medicament composition) can be used for treating malignant tumors by combining with other antitumor medicaments or chemotherapeutic medicaments. When needed, one or more pharmaceutically acceptable carriers can be added into the product (medicament) or the anti-tumor composition (anti-tumor medicament composition); the carrier includes diluent, excipient, filler, binder, wetting agent, disintegrating agent, absorption enhancer, surfactant, adsorption carrier, lubricant, etc. which are conventional in the pharmaceutical field.

The product (medicine) or antitumor composition (antitumor medicine composition) can be made into injection, tablet, powder, granule, capsule, oral liquid, paste, cream, etc.; the medicaments in various dosage forms can be prepared according to the conventional method in the pharmaceutical field.

The above product (drug) or antitumor composition (antitumor drug composition) can be introduced into body such as muscle, intradermal, subcutaneous, vein, mucosal tissue by injection, spray, nasal drop, eye drop, penetration, absorption, physical or chemical mediated method; or mixed or coated with other materials and introduced into body.

The invention discovers that the SGLT2 inhibitor Canagliflozin can be used as a new drug in research: can inhibit the expression and function of P-glycoprotein in tumor cells and inhibit the autophagy phenomenon of stress protection of the tumor cells in the face of chemotherapy drug treatment, thereby improving the sensitivity of the tumor cells to the chemotherapy drugs and enhancing the treatment effect of the drugs. The inhibitor can exist in the form of liquid, dry powder or extract, can be prepared into various dosage forms with health care or medicinal efficacy such as capsules, tablets, injection, pills, granules, powder and the like with various conventional auxiliary materials, and can also be combined with other chemotherapeutic drugs for treating malignant tumors. And the SGLT2 inhibitor Canagliflozin has been subjected to clinical safety tests and is therefore relatively safe.

Drawings

FIG. 1 is a graph showing that CAN enhances the anti-tumor effect of Doxorubicin in different tumor cell lines. The final concentration of CAN is 40 MuM, and the final concentration of Doxorubicin is 0.175-4.2 MuM; data are expressed as mean ± standard deviation (n = 3), ap <0.05, aa P-straw 0.01vs negative control (Nor); b P <0.05, bb P-s-Ap-0.01vs CAN-alone control (CAN 40); c P <0.05, cc P-s-woven 0.01vs correspond to the same concentration Doxo group.

FIG. 2 is a graph of the accumulation of Doxorubicin in different tumor cell lines. The final concentration of the Doxorubicin is 0.35 mu M; data are expressed as mean ± standard deviation (n = 3).

FIG. 3 is a graph showing the effect of CAN on the accumulation of Doxorubicin in different tumor cell lines. The final concentration of CAN is 40 mu M, and the final concentration of Doxorubicin is 0.35 mu M; data are expressed as mean ± standard deviation (n = 3); P <0.001vs Doxorubicin alone control group (Doxo).

FIG. 4 is a graph showing the effect of CAN and Doxorubicin on P-glycoprotein expression at protein level and mRNA level. Nor, normal control; CAN, the administration concentration of the CAN is 40 mu M; doxo, doxorubicin was administered at a concentration of 0.35. Mu.M. Data are expressed as mean ± standard deviation (n = 3). + P <0.05vs Nor.

FIG. 5 shows the mechanism of the effect of CAN and Doxorubicin on P-glycoprotein. The concentration of CAN administration is 40 μ M, the concentration of Doxorubicin administration is 0.35 μ M, the concentration of MG132 administration is 5 μ M, and the concentration of Bafilomycin A1 administration is 10nM.

FIG. 6 is a graph showing that CAN inhibits autophagy in HepG2 cells stimulated by Doxorubicin. The final concentration of CAN was 40. Mu.M, and the final concentration of Doxorubicin was 0.35. Mu.M.

FIG. 7 shows the early stage of CAN inhibition of HepG2 cell autophagy development. The final concentration of CAN was 40. Mu.M, the final concentration of Rapamycin was 0.5. Mu.M, and the final concentration of Bafilomycin A1 was 10nM.

FIG. 8 shows CAN activation of ULK-Ser757 phosphorylation sites. The final concentration of CAN was 40. Mu.M, and the final concentration of Doxorubicin was 0.35. Mu.M.

FIG. 9 is a graph showing the effect of CAN and Doxorubicin on tumor volume in nude mice. N =6-8, P <0.05vs Nor.

FIG. 10 shows the effect of CAN and Doxorubicin on pathological changes of tumor tissues in nude mice. The magnification of the picture is 40 x, and the area indicated by the arrow in the lower right corner of the picture is magnified to 200 x.

Detailed Description

The following examples are intended to facilitate a better understanding of the invention, but are not intended to limit the invention thereto. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Half maximal Inhibitory Concentrations (IC) in the following examples ₅₀ ) Refers to the concentration at which the Doxorubicin drug induces apoptosis in 50% of tumor cells.

Example 1 detection of synergistic Effect of CAN and antitumor drug Doxorubicin

1. Experimental Material

1. A compound: canagliflozin (CAN) and Doxorubicin (Doxorubicin, doxo) are products of MedChemExpress (MCE). The Kancogl stock number is HY-10451, and the Adriamycin stock number is HY-15142A.

2. Cell source: human liver cancer cells (HepG 2), human colon cancer cells (HCT 116) and human breast cancer cells (MCF 7) are all products of Shanghai cell bank of Chinese academy of sciences, and doxorubicin-resistant human liver cancer cells (HepG 2-ADR) are products of Shanghai Egyi Biotech Co.

3. Cell biological reagents: DMEM high-sugar powder medium (CP 2205) and pancreatin (Trypsin, R001100) are all products of ThermoFisher Scientific company; fetal bovine serum (FBS, P30-3302) is a product of Pan Biotech. Thiazole blue reagent (MTT, 97062-378) is a product of Amreso corporation.

4. Experiment consumables: cell culture plates of 10cm, 6-well and 12-well plates for cell culture, 24-well plates, pipettes, and centrifuge tubes are all products of Biofil corporation.

5. An experimental instrument: the microplate reader (Epoch) is a product of Biotek corporation, usa, and the flow cytometer (BD Accuri C6) is a product of BD corporation, usa.

2. Experimental methods

1. The cytotoxicity test of the combined effect of CAN and Doxorubicin was carried out as follows:

(1) MTT was formulated into a working solution at a concentration of 5mg/mL in sterile PBS and filter sterilized through a 0.22 μm filter.

(2) Cells with good growth state (human liver cancer cell (HepG 2), human breast cancer cell (MCF 7) or adriamycin-resistant human liver cancer cell (HepG 2-ADR)) are cultured at 4 × 10 ³ The density of individual cells/well was seeded into 96-well plates in DMEM cell culture medium containing 10% fetal bovine serum. The cells are treated by administration of CAN and/or Doxorubicin with the final concentration of Doxorubicin ranging from 0.0 μ M to 2.8 μ M and the final concentration of CAN ranging from 40 μ M according to different administration doses in different experimental groups. Three replicate wells were set for each group, and 200 μ Ι _ of PBS solution was added to the wells around the 96-well plate to prevent evaporation of the medium. The administration doses of the control group and each experimental group are respectively as follows:

nor: the final concentration of CAN is 0.0 mu M; the final concentration of Doxorubicin is 0.0 μ M;

CAN40: the final concentration of CAN is 40 MuM; the final concentration of Doxorubicin is 0.0 μ M;

doxo0.025: the final concentration of CAN is 0.0 mu M; the final concentration of Doxorubicin is 0.025 mu M;

doxo0.05: the final concentration of CAN is 0.0 mu M; the final concentration of Doxorubicin is 0.05. Mu.M;

doxo0.175: the final concentration of CAN is 0.0 mu M; the final concentration of Doxorubicin is 0.175. Mu.M;

doxo0.35: the final concentration of CAN is 0.0 mu M; the final concentration of Doxorubicin is 0.35. Mu.M;

doxo0.7: the final concentration of CAN is 0.0 mu M; the final concentration of Doxorubicin is 0.7 mu M;

doxo1.4: the final concentration of CAN is 0.0 mu M; the final concentration of Doxorubicin is 1.4. Mu.M;

doxo2.8: the final concentration of CAN is 0.0 mu M; the final concentration of Doxorubicin is 2.8 μ M;

CAN40+ doxo0.025: the final concentration of CAN is 40 MuM; the final concentration of Doxorubicin is 0.025 mu M;

CAN40+ doxo0.05: the final concentration of CAN is 40 MuM; the final concentration of Doxorubicin is 0.05. Mu.M;

CAN40+ doxo0.175: the final concentration of CAN is 40 MuM; the final concentration of Doxorubicin is 0.175. Mu.M;

CAN40+ doxo0.35: the final concentration of CAN is 40 MuM; the final concentration of Doxorubicin is 0.35. Mu.M;

CAN40+ doxo0.7: the final concentration of CAN is 40 MuM; the final concentration of Doxorubicin is 0.7. Mu.M;

CAN40+ doxo1.4: the final concentration of CAN is 40 MuM; the final concentration of Doxorubicin is 1.4. Mu.M;

CAN40+ doxo2.8: the final concentration of CAN is 40 MuM; the final concentration of Doxorubicin was 2.8. Mu.M.

(3) After 48 hours of incubation, 10 μ L of MTT solution was added to each well, and after 4 hours of incubation, the medium was aspirated and 100 μ L DMSO was added to each well to dissolve the blue-violet formazan crystals in each well. The measurement was performed by microplate spectrophotometry at a wavelength of 490nm, and the half-maximal Inhibitory Concentration (IC) was calculated ₅₀ )。

2. In order to search for a mechanism of synergistic action between CAN and Doxorubicin, the characteristic that Doxorubicin has fluorescence per se is utilized, and the content of adriamycin in cells is detected by a flow cytometry method so as to observe whether CAN improves drug accumulation in tumor cells to increase cytotoxicity of the tumor cells. The method comprises the following specific steps:

1) Sensitivity of different tumor cells to Doxorubicin: MCF-7 cells, hepG2 cells and HepG2-ADR cells were divided into two groups: nor group and Doxo group. Doxo was cultured at a final concentration of 0.35. Mu.M for 12 hours.

2) Accumulation of Doxorubicin drug: hepG2 and HepG2-ADR cells were divided into three groups: nor group, doxo group and CAN + Doxo group. The final concentration of CAN and Doxo were 40. Mu.M and 0.7. Mu.M, respectively, and the culture was performed for 12 hours.

Each group of cells was trypsinized into single cells, harvested by centrifugation and washed twice with PBS to exclude residual Doxorubicin in the medium from interfering with subsequent measurements. And (4) resuspending the cells with PBS and detecting on a machine. Since Doxorubicin can emit red fluorescence under excitation of green laser (around 535 nm) with a peak around 620nm, the mean fluorescence intensity in cells can be measured by setting FL2 channel to assess accumulation of Doxorubicin.

3. Results of the experiment

1. The combination of CAN and Doxorubicin CAN enhance the effect of chemotherapy

To determine the effect of CAN on tumor cells, cytotoxicity assays for CAN and Doxorubicin were performed on three tumor cells, human liver cancer cell (HepG 2), human breast cancer cell (MCF 7) or Doxorubicin-resistant human liver cancer cell (HepG 2-ADR).

The results are shown in FIG. 1. The results show that: for all three types of tumor cells, the combination showed a stronger cytotoxic effect than Doxorubicin alone at the same dose in each combination. IC of all three cells after combination compared to the same dose of Doxorubicin alone ₅₀ Are all significantly reduced, wherein the IC of HepG2 cells ₅₀ IC of HepG2-ADR cells decreased from 0.871. Mu.M to 0.265. Mu.M ₅₀ From 1.743. Mu.M to 0.894. Mu.M.

2. CAN CAN increase drug accumulation of Doxorubicin in tumor cells

The accumulation of Doxorubicin by different tumor cells under normal conditions is shown in fig. 2. The results show that: the maximum concentration of the drug in the Doxorubicin in MCF-7 cells, the second highest in the HepG2 cells and the lowest in the HepG2-ADR cells indicate that the degree of absorption of Doxorubicin by different tumor cell lines is different, which may be related to the difference in the expression of P-glycoprotein in different cell lines.

The accumulation of Doxorubicin by different tumor cells with the addition of CAN is shown in fig. 3. The results show that: for HepG2 cells and HepG2-ADR cells, the intracellular fluorescence intensity of the CAN + Doxo combined treatment group is obviously higher than that of the individual Doxo group, and is respectively increased by 23.5% and 53.1%, which indicates that the CAN CAN promote the accumulation of the Doxorubicin in tumor cells.

Example 2 Effect of CAN on P-glycoprotein expression level and mechanism study

1. Experimental materials

1. Biochemical reagents: p-gp (ab 170904) is a product of Abcam corporation; p62 (# 88588) is a product of Cell Signal Technology; LC3 (L7543) is a product of Sigma company; the β -actin antibody (A1978) is a product of Sigma Co; the proteasome inhibitor MG132 (HY-13259) is a product of MedChemexpress; the autophagy inhibitor BafA1 (HY-100558) is a product of MedChemexpress.

2. Molecular biology reagents: siRNA is a product of acute bio-technology ltd, guangzhou; trizol is a product of Invitrogen corporation (15596-026); oligo dT, RNase inhibitor (RRI), dNTP (10 mM) M-MLV reverse transcriptase, M-MLV 5 XBuffer, SYBR Green are all products of Takara corporation; primers were synthesized by Invitrogen, and the primer sequences are shown in Table 1.

TABLE 1 primer sequences

Primer and method for producing the same	Forward sequence (Forward)	Reverse sequence (Reverse)	Sequence number of NCBI	Length of
					Human P-gp	TTGCTGCTTACATTCAGGTTTCA	AGCCTATCTCCTGTCGCATTA	NM_000927		105
Human P62	GCACCCCAATGTGATCTGC	CGCTACACAAGTCGTAGTCTGG	NM_001142299	93
					Human Actin	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT	NM_001101	250

3. An experimental instrument: vertical electrophoresis tank/vertical membrane transfer tank (Tanon) is a product of shanghai sky energy technology limited. The real-time fluorescent quantitative PCR instrument (Qtower2.2) is a product of analytical jena, germany.

The other reagents were the same as in example 1.

2. Experimental methods

1. Western Blotting detection of protein expression level of P-glycoprotein in different tumor cell lines

The expression level of P-glycoprotein in different tumor cell lines is detected, and the specific steps are as follows:

1) Collecting a protein sample: cells with good growth state are divided into 4X 10 cells ³ The density of each cell/well was inoculated into a 96-well plate of DMEM cell culture medium containing 10% fetal bovine serum, and the cells were subjected to drug administration treatment using CAN and/or Doxorubicin, and cultured after the drug administration treatment. The well plates plated, dosed, and cultured for a specified time were taken out from the cells and placed on ice. And (4) absorbing the culture medium, slightly adding a proper amount of PBS (phosphate buffer solution) to each hole along the hole wall, washing twice, and removing the residual culture medium. Adding a proper amount of cell lysis solution according to the number of cells, and standing for 5-10 minutes on ice. And fully blowing and beating the cells in the hole, collecting cell lysate into an EP tube, placing the EP tube into a refrigerated centrifuge for 10 minutes at 4 ℃, and centrifuging at 12000rpm, wherein the supernatant is the collected protein sample.

2) Protein concentration determination: and (3) adding 2 mu L of protein sample into each hole of a 96-well plate, adding 200 mu L of Coomassie brilliant blue G, uniformly mixing, and detecting the absorbance at 595nm by using an enzyme-linked immunosorbent assay. The absorbance of a series of BSA standards of known concentration was measured in the same manner, and a standard curve of concentration versus absorbance was plotted to calculate the concentration of the unknown protein sample.

3) Preparing an electrophoresis sample and performing gel electrophoresis: according to the results of the concentration measurement in the previous step, each sample was leveled into an electrophoresis sample having the same protein content and the same volume, and 5 Xloading buffer was added to denature the protein by a metal bath at 100 ℃ for 10 minutes. And (3) placing the prepared rubber plate in an electrophoresis tank, adding electrophoresis liquid, spotting, adding protein marker, and then starting rubber running. First run at constant voltage 80V for 30 minutes, after running the upper layer of concentrated gel, run at constant voltage 120V until the completion of electrophoresis.

4) Film transferring: and taking out the gel after electrophoresis, assembling a membrane transferring clamp from the negative electrode to the positive electrode according to the sandwich structure of the sponge, the filter paper, the gel, the NC membrane, the filter paper and the sponge, placing the membrane transferring clamp in a membrane transferring groove, pouring membrane transferring liquid, and transferring the membrane for 1.5 hours at constant voltage of 80V.

5) And (3) sealing: 5% skimmed milk (TBST) is prepared as a sealing liquid, the NC membrane after the membrane transfer is taken out, washed for 3 minutes by TBST and then placed in the sealing liquid, and sealed for 1-2 hours at 40 rpm.

6) Incubating the primary antibody: the primary antibody to the desired target protein was prepared in advance, and diluted with 3% BSA (TBST mix). The blocking solution was removed, the desired band of interest was cut off according to the size of the protein of interest, primary antibody was added, and the mixture was incubated overnight at 4 ℃.

7) Washing the membrane: primary antibody was recovered and TBST was added to wash the membrane for 10 min at 120rpm, repeated 4 times.

8) Incubation of secondary antibody: the secondary antibodies of mice, rabbits and goats were incubated according to the source of the primary antibody, diluted with 2.5% skim milk (TBST mix) and shaken at 40rpm for 1-2 hours at room temperature.

9) Washing the membrane: the secondary antibody was recovered and TBST was added to wash the membrane at 120rpm for 10 minutes, which was repeated 5 times.

10 Incubation substrate): the film was carefully removed from the TBST, gently washed in ultrapure water, and drained slightly on absorbent paper. And uniformly dripping the prepared ECL substrate onto the protein film, reacting for 2 minutes, and then placing the film into an exposure clamp to enter a dark room for development.

11 Development): and (3) placing the film into the exposure clamp, exposing for a plurality of minutes, and adjusting the tabletting time according to the depth of the film strip. And taking out the film, sequentially placing the film in a developing solution and a fixing solution, washing the film by using clear water, and drying the film.

12 Analysis results of): marking the developed film, scanning the film into a gray mode picture, and analyzing the result.

2. RT-qPCR detection of P-glycoprotein mRNA expression level

(1) Extraction of Total RNA

1) Cells with good growth state are divided into 1.5X 10 cells ⁵ The density of each cell/well was inoculated into a 6-well plate of DMEM cell culture medium containing 10% fetal bovine serum, and the cells were subjected to drug administration treatment using CAN and/or Doxorubicin, and cultured after the drug administration treatment. The well plates after plating, dosing, incubation for a specified time were removed from the cells and placed on ice. The medium was discarded and 1mL of PBS solution was added to each well for 2 washes and 1mL of RNAioso Plus was added. The cells were lysed on ice and placed on a shaker at 120rpm for 5 minutes and collected in a 1.5mL centrifuge tube.

2) 200 mu L of chloroform is added into each tube of sample, and the mixture is placed on a shaking instrument to be vigorously shaken and emulsified, and then is kept stand for 10 minutes on ice until delamination.

3) The tube was transferred to a refrigerated centrifuge and centrifuged at 12000rpm for 10 minutes at 4 ℃ to see that the liquid in the tube was divided into three layers, and the uppermost clear liquid was aspirated into a new tube, taking care not to aspirate the lower white liquid. Adding isopropanol with the same volume, slightly reversing the upper part and the lower part, mixing evenly, and standing on ice for 10 minutes.

4) The tubes were transferred to a refrigerated centrifuge and centrifuged at 12000rpm for 10 minutes at 4 ℃ to see a small amount of white precipitate at the bottom of the tube, the supernatant was discarded and 1mL of 75% ethanol (DEPC in water) was added to each tube. The tube wall was washed by gently inverting the top and bottom, centrifuged at 12000rpm at 4 ℃ for 5 minutes, and the supernatant was discarded.

5) After repeated washing 2 times, the supernatant was discarded, the tube was emptied and centrifuged for 5 minutes, and the residual liquid was carefully aspirated off with a micropipette.

6) The centrifuge tube cap was opened and air dried for 8 minutes, and 20. Mu.L of DEPC water was added to each tube to dissolve the precipitate. RNA concentration was measured using Nanodrop and leveled with DEPC water according to concentration. If no further reverse transcription is to be performed, the sample is stored at-80 ℃.

(2) Reverse transcription of mRNA

1) Preparing an RNA sample according to the previous step, placing the RNA sample on ice, and preparing a reverse transcription system according to the following formula: 1. Mu.L of RNA template, 1. Mu.L of Oligo dT, 1. Mu.L of M-MLV Reverse Transcriptase, 4. Mu.L of 5 XM-MLV buffer, 1. Mu.L of RRI, 1. Mu.L of 10Mm dNTP, and 11. Mu.L of DEPC water.

2) And (2) fully and uniformly mixing the system prepared in the step 1) to avoid bubbles, and carrying out reverse transcription on a PCR instrument. The setting procedure is as follows: 40 ℃,1 hour → 70 ℃,15 minutes → 4 ℃ for a period of time.

(3) mRNA real-time fluorescent quantitative PCR

1) Preparing a qPCR reaction system from a cDNA sample obtained by reverse transcription according to the following formula: 0.5. Mu.L of cDNA, 0.5. Mu.L of Forward primer, 0.5. Mu.L of Reverse primer, 5. Mu.L of SYBR Green, and 3.5. Mu.L of DEPC water.

2) And (2) subpackaging the prepared sample in the step 1) into 8 connecting pipes, and fully and uniformly mixing to avoid bubbles. qPCR reactions were performed according to the following procedure: the signal was collected at 90 ℃,1 min, 95 ℃,15 sec, 60 ℃,45 sec, 40 cycles.

3) And (3) making three multiple holes for each sample, counting the experimental results, and comparing the ratio of the target gene and the reference gene of each sample. The sequences of the target gene and the reference gene are shown in Table 1.

3. Results of the experiment

1. Effect of CAN and Doxorubicin on P-glycoprotein expression levels

The expression level of P-glycoprotein in different tumor cell lines was measured and the results are shown in FIG. 4. The results show that: the expression of P-glycoprotein was differentiated in different tumor cell lines, with the highest P-glycoprotein content in HepG2-ADR cells, and the next in HepG2 cells, little P-glycoprotein expression in MCF-7 cells and HCT116 cells (FIG. 4A). The results are consistent with the accumulation of Doxorubicin in each cell line in example 1, indicating that cells with high P-glycoprotein expression have strong efflux ability for Doxorubicin, and can effectively reduce the concentration of Doxorubicin in the cells.

In order to deeply search the action mechanism of CAN, hepG2 cells are selected to carry out subsequent experiments. HepG2 cells were treated with CAN and/or Doxorubicin at the doses shown in FIGS. 4B and 4D. The results show that: when CAN or Doxorubicin was used alone, CAN reduced the P-glycoprotein expression level in HepG2 cells, whereas Doxorubicin increased the P-glycoprotein expression level in HepG2 cells in a dose-dependent relationship (FIG. 4B). When both CAN and Doxorubicin were used in combination, the protein expression level of P-glycoprotein was significantly reduced compared to Doxorubicin alone (FIG. 4D).

To investigate whether reduction of the protein expression level of P-glycoprotein by CAN was involved in affecting the gene expression of P-glycoprotein, the P-glycoprotein mRNA expression levels in each group (Nor group, CAN group, doxo group and CAN + Doxo group) after 12h and 24h of the administration treatment were measured by RT-qPCR, respectively, and the results are shown in FIG. 4C. The results show that: there was no significant difference in mRNA expression levels of the P-glycoproteins of each group (fig. 4C).

2. Mechanism of influence of CAN and Doxorubicin on P-glycoprotein

From the above experiments, it was found that the effect of CAN on P-glycoprotein expression in HepG2 cells was not due to increased gene expression, and thus it was verified whether CAN decreased protein content by enhancing P-glycoprotein degradation.

Tumor cells HepG2 cells were treated with CAN or Doxorubicin in combination with a proteasome inhibitor MG132 or an autophagy inhibitor BafA1, respectively, at the administration concentrations and for the culture time shown in FIG. 5, and the protein expression level of P-glycoprotein was measured by Western Blotting after the treatment.

The results show that: the degradation enhancement of the P-glycoprotein by the CAN is mainly realized by a proteasome degradation way; the reason why Doxorubicin increased the P-glycoprotein content was that gene expression was stimulated by administration (FIG. 5).

Example 3 study of the Effect of CAN and Doxorubicin on HepG2 autophagy

1. Experimental materials

1. Biochemical reagents: p62 (# 88588) is a product of Cell Signal Technology; LC3 (L7543) is a product of Sigma, ULK1 (# 8054) is a product of Cell Signal Technology, P-ULK1 (# 6888P) is a product of Cell Signal Technology, mTOR (# 2983) is a product of Cell Signal Technology, P-mTOR (# 5536) is a product of Cell Signal Technology, and β -actin antibody (A1978) is a product of Sigma; EBSS (14155-063) is a product of Gibco; rapamycin (HY-10219) is a product of MedChemexpress; the autophagy inhibitor Bafilomycin A1 (HY-100558) is a product of MedChemexpress.

2. An experimental instrument: the same apparatus as in example 2.

3. Other reagents: the same reagents as in example 1.

2. Experimental methods

The procedure is as in example 2.

3. Results of the experiment

1. CAN CAN inhibit autophagy of HepG2 cell caused by Doxorubicin stimulation

HepG2 cells were treated with CAN and/or Doxorubicin at a final CAN concentration of 40. Mu.M and a final Doxorubicin concentration of 0.35. Mu.M, and the level of autophagy was evaluated after various periods of treatment (3 h, 6h, 12h, 24h, 48 h).

The results are shown in FIG. 6. The results show that: after Doxorubicin acts on HepG2 cells, the expression level of p62 is reduced, the ratio of LC3 II to LC 3I is increased, and autophagy is promoted. The tumor cell is a stress protection mechanism generated by the response of the tumor cell to the stress of the drug, and the induction of autophagy can help to remove damaged organelles and the like, thereby being beneficial to the survival of the cell. After the CAN is added, the LC3 II/LC 3I ratio CAN be obviously reduced, and meanwhile, the expression level of p62 is improved, which shows that the CAN CAN effectively inhibit autophagy induced by Doxorubicin.

2. Early stage of CAN inhibition HepG2 cell autophagy

To further determine the effect of CAN on HepG2 autophagy levels, hepG2 autophagy levels were tested using different doses of CAN (0 μ M, 10 μ M, 20 μ M, 40 μ M) and 40 μ M CAN at different time points in culture (0 h, 6h, 12h, 24 h).

The results are shown in FIGS. 7A and 7B. The results show that: CAN effectively inhibit autophagy levels, and has a dose-dependent and time-dependent relationship.

The level of autophagy was assessed using CAN in combination with the autophagy inducer EBSS, rapamycin and the autophagy inhibitor Bafilomycin A1.

The results are shown in fig. 7C, 7D and 7E. The results show that: CAN CAN inhibit autophagy induced by autophagy inducer EBSS or Rapamycin, and the LC3 II/LC 3I ratio is reduced.

3. CAN activates ULK-Ser757 phosphorylation site, and inhibits autophagy activation

Related studies have shown that, under nutritionally sufficient conditions, high activity mTOR phosphorylates the Unc-51-like kinase 1 (ULK 1) Ser757, which blocks ULK1 activation, disrupting the interaction between ULK1 and adenosine5' -phosphate-activated protein kinase (AMPK), and blocking the inhibition of autophagy activation by ULK1, the molecular mass 200kD focal adhesion kinase family interacting protein of 200kd, fip200, and the ATG13 complex together.

HepG2 cells were treated with CAN and/or Doxorubicin at a final concentration of 40. Mu.M for CAN and 0.35. Mu.M for Doxorubicin, and p-ULK1 (S757) of HepG2 cells was assayed 24 hours after treatment.

The results are shown in FIG. 8. The results show that: ULK1 under CAN treatment showed increased phosphorylation at 757, while Doxorubicin treatment showed the opposite, whereas the level of phosphorylation of mTOR did not change significantly, indicating that CAN blocked autophagy by activating p-ULK1 (Ser 757).

Example 4 nude mouse subcutaneous transplantation tumor model establishment and drug efficacy evaluation of CAN and Doxorubicin

1. Experimental materials

1. Experimental animals and food: the male nude mouse (BALB/cSlc-nu/nu) of four-week old is a product of the Guangdong province medical experimental animal center (SPF grade, license number: guangdong invigilation word, SCXK (Guangdong) 2013-0002). SPF grade food is a product of the medical laboratory animal center in guangdong province.

2. Chemical reagents: 10% formalin: 50mL of 40% formalin, naH ₂ PO ₄ ·2H ₂ O 1.75g，Na ₂ HPO ₄ ·12H ₂ O3.25 g and deionized water to 500mL. Anesthetic agent: 10% of urethane injection.

2. Experimental method

1. Establishment of tumor-bearing animal model

HepG2 cells were cultured conventionally until the logarithmic phase, digested with trypsin and counted, and after centrifugation, the number of cells was adjusted to 10 using serum-free DMEM medium ⁷ And adding 10% matrigel, and injecting liver cancer cells at the right thigh part or the armpit of the nude mouse by a subcutaneous injection method. The injection amount is 1 × 10 per nude mouse ⁶ One cell, 1 week after injection, was observed for tumor growth, excluding non-tumorigenic mice.

2. Group administration

After the tumor is inoculated, the long diameter and the short diameter of the tumor of the mouse are measured by a vernier caliper every day, and after 10 days, the tumor-bearing nude mice are randomly divided into 4 groups when the maximum diameter of the tumor is 5-7 mm, and 5 mice in each group. The administration is carried out in groups. Each group was dosed as follows:

nor: gavage 0.5% sodium carboxymethylcellulose once a day; sterilized PBS solution was injected intraperitoneally every two days.

CAN: dissolving CAN with 0.5% sodium carboxymethylcellulose, and administering in a dosage of 50mg/kg by intragastric administration once a day; injecting sterilized PBS solution into abdominal cavity once every two days; the treatment was given for a total of 25 days.

Doxo (DOX): gavage 0.5% sodium carboxymethylcellulose once a day; the Doxorubicin is prepared by a sterilized PBS solution, the administration dosage is 2.5mg/kg, and the administration mode is intraperitoneal injection once every two days; the treatment was given for a total of 25 days.

CAN + Doxo (CAN + DOX): dissolving CAN with 0.5% sodium carboxymethylcellulose, and administering by intragastric administration once a day at dosage of 50 mg/kg; the Doxorubicin is prepared by a sterilized PBS solution, the administration dosage is 2.5mg/kg, and the administration mode is intraperitoneal injection; the treatment was given for a total of 25 days.

3. Observation index

1) Body weight change in nude mice: and recording the weight change of the animals every day in the test process, drawing a weight change curve, and observing the influence of the medicament on the weight of the animals.

2) Survival time and number of surviving nude mice: and recording the death condition of the animals at any time in the test process, calculating the survival time and survival number of the nude mice after the test is finished, and drawing a survival time curve graph.

3) Volume change and tumor growth inhibition rate of tumor: observing the growth condition of the tumor every day in the test process, and calculating the tumor volume according to a formula; after the experiment was completed, the animals were sacrificed, the tumor tissue was removed, and the tumor growth inhibition rate was calculated by weighing according to the formula. Tumor volume = L × W ² (L, W represent the longest and shortest tumor diameters, respectively); tumor growth inhibition rate = [ (A-B)/A)]X 100% (a and B are tumor weight of control and treatment groups, respectively).

4) Taking out tumor tissues, fixing the tumor tissues by using a PB solution containing 40g/L paraformaldehyde overnight, dehydrating the tumor tissues by using a 300g/L sucrose solution for 24 hours, carrying out frozen section with the thickness of 25 mu m, carrying out HE staining, and observing the tumorigenesis condition of HepG2 cells in nude mice.

3. Results of the experiment

1. Effect of CAN and Doxorubixin on tumor volume in nude mice

The results of the tumor volume and tumor weight changes after the treatment of each group of mice are shown in FIG. 9. The results show that: andcompared with the Nor group, the growth rate of the tumors in the CAN group is slightly reduced, while the tumors in the Doxo (DOX) group are obviously reduced, but the effect of the CAN + Doxo (CAN + DOX) group is most remarkable. On day 25 post-dose, mean tumor volume in the Nor group reached 545.4mm ³ The CAN + Doxo (CAN + DOX) group is only 171.3mm ³ . After the dosing treatment, nude mice were sacrificed and tumor tissue was removed and weighed. The mean tumor weight for the Nor group was 0.34g, the mean tumor weight for the CAN + Doxo (CAN + DOX) group was 0.15g, showing significant differences (FIG. 9).

2. Effect of CAN and Doxorubixin on pathological changes of tumor tissues of nude mice

After the administration, each group of tumor tissues was sectioned and HE stained.

The results are shown in FIG. 10. The results show that: in the Nor group, the tumor tissue without any drug treatment is composed of tumor parenchyma and a small amount of interstitium, and pathological nuclear division is much, which indicates that the tumor malignancy degree is high. Cells treated by CAN show small-area necrosis, large tumor cell necrosis appears after treatment of Doxo (DOX) group, tumor tissues of CAN + Doxo (CAN + DOX) group are basically completely necrotic, and tissues in tumors are in amorphous red stain and have no formed cell nucleuses. In vivo experiments show that the combination of CAN and Doxorubicin CAN effectively kill HepG2 cells and inhibit tumor growth (figure 10).

The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, it is possible to make various improvements and modifications without departing from the technical principle of the present invention, and these improvements and modifications should also be considered as the protection scope of the present invention.

Claims (1)

1. Use of an sglt2 inhibitor or a pharmaceutically acceptable salt thereof in any one of A1) to A4) as follows:

   a1 Preparing a drug for enhancing the therapeutic effect of the antitumor drug or the chemotherapeutic drug;

   a2 Preparing a drug for inhibiting the drug resistance of the liver cancer;

   a3 Preparing a drug for improving the sensitivity of tumor cells to anti-tumor drugs or chemotherapeutic drugs;

   a4 Preparing a drug for promoting the accumulation of the antitumor drug or the chemotherapeutic drug in the tumor cells;

   the SGLT2 inhibitor is Canagliflozin;

   the anti-tumor drug or the chemotherapeutic drug is adriamycin Doxorubicin;

   the tumor is liver cancer or breast cancer;

   the tumor cell is liver cancer cell or breast cancer cell.

Images