WO2024080509A1 - Igf-1 수용체 결합 압타머 및 이의 용도 - Google Patents

Igf-1 수용체 결합 압타머 및 이의 용도 Download PDF

Info

Publication number
WO2024080509A1
WO2024080509A1 PCT/KR2023/010497 KR2023010497W WO2024080509A1 WO 2024080509 A1 WO2024080509 A1 WO 2024080509A1 KR 2023010497 W KR2023010497 W KR 2023010497W WO 2024080509 A1 WO2024080509 A1 WO 2024080509A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
igf
diabetes
receptor
aptamer
Prior art date
Application number
PCT/KR2023/010497
Other languages
English (en)
French (fr)
Inventor
윤나오
류성호
박성은
박만근
오은주
Original Assignee
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단 filed Critical 포항공과대학교 산학협력단
Publication of WO2024080509A1 publication Critical patent/WO2024080509A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers

Definitions

  • the present invention relates to IGF-1 receptor binding aptamers and uses thereof.
  • Diabetes is a metabolic disease that persists for a long time with high blood sugar levels. If it worsens severely, it can lead to death due to complications such as cardiovascular disease, stroke, and chronic renal failure.
  • Insulin therapy is an external supply of insulin needed by diabetic patients. It is used not only for patients with type 1 diabetes who have problems with insulin production, but also for patients with type 2 diabetes, which develops due to insulin resistance but gradually loses beta cell function. It is an essential treatment that serves as the last resort.
  • Insulin is a hormone that promotes anabolism and activates the synthesis and storage of neutral fat in the liver and adipose tissue. Therefore, insulin administration significantly increases the patient's weight, which adversely affects the patient's ability to control blood sugar and vascular complications. In addition, because insulin has a very narrow therapeutic index, even a slight overdose easily causes hypoglycemic shock. Hypoglycemia reduces the patient's brain function, causing mental abnormalities, and in severe cases, it can lead to coma or death. Despite its importance, the use of insulin therapy is sometimes limited due to the two major side effects mentioned above.
  • IGF-1 receptor and insulin receptor are derived from the same ancestral gene and have high homology in protein sequence ( ⁇ 60% homology) and structure. In terms of physiological function, both receptors are simultaneously responsible for regulating metabolism and cell growth and differentiation. Insulin shows stronger activity in glucose and lipid metabolism, whereas IGF-1 shows stronger activity than insulin in cell division, growth, and differentiation.
  • IGF-1 receptors Blood sugar control through the IGF-1 receptor has several advantages over the insulin receptor. Because the potency and efficacy of increasing glucose absorption through the IGF-1 receptor are lower than those of the insulin receptor, administration of IGF-1 rarely causes hypoglycemic shock caused by insulin administration. In addition, IGF-1 receptors are expressed only in muscles and do not exist in liver and adipose tissue, so administration of IGF-1 selectively increases glucose absorption by muscles and does not affect fat synthesis and storage. Therefore, administration of IGF-1 does not increase body weight.
  • IGF-1 is a powerful growth factor that greatly promotes cell division, growth, and differentiation.
  • IGF-1 cases of worsening diabetic retinopathy were observed. This is presumed to be caused by IGF-1 administration causing abnormal proliferation of retinal blood vessels.
  • safety against increased cancer incidence during long-term administration of IGF-1 has not been secured.
  • IGF-1 receptor is known to play an important role in the development of cancer such as breast cancer, lung cancer, and ovarian cancer.
  • the present inventor developed an IGF-1 receptor aptamer as a biased agonist, which is a ligand that selectively activates only a specific function or signaling pathway of the IGF-1 receptor, and the aptamer has a metabolic function ( As it was confirmed that the IGF-1 receptor aptamer selectively activates (glucose uptake) but does not promote cell division, it is believed that the IGF-1 receptor aptamer can solve the side effects of IGF-1 and the safety problems with long-term administration that appeared through previous clinical trials. and completed the present invention.
  • One object of the present invention is to provide an IGF-1 receptor aptamer that specifically binds to the IGF-1 receptor and promotes phosphorylation of the IGF-1 receptor.
  • Another object of the present invention is to provide an IGF-1 receptor agonist containing an IGF-1 receptor aptamer.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating metabolic diseases or cancer containing the IGF-1 receptor aptamer as an active ingredient.
  • Another object of the present invention is to provide a composition for diagnosing diabetes or diabetic complications containing the IGF-1 receptor aptamer as an active ingredient.
  • the present invention provides an IGF-1 receptor aptamer that specifically binds to the IGF-1 receptor and promotes phosphorylation of the IGF-1 receptor.
  • an IGF-1 receptor aptamer that specifically binds to the IGF-1 receptor comprising SEQ ID NO: 1 or SEQ ID NO: 2 is provided.
  • “Aptamer” is 15-40 single-stranded oligonucleotides that form a specific three-dimensional formation, has a stem loop structure, and has the property of specifically binding to a specific molecule. Aptamers are compounds that are easy to chemically synthesize, are easy to chemically modify, are heat stable, and have very high specificity for the target.
  • Aptamer sequences can be discovered using a method called SELEX (selective evolution of ligands by exponential enrichment), and hundreds of aptamer sequences have already been disclosed.
  • Aptamers are often compared to antibodies in that they specifically bind to targets, but they do not cause an immune response.
  • Aptamers are often compared to single antibodies due to their inherent high affinity (usually at the pM level) and the ability to bind to target molecules with specificity, and as they are especially called 'chemical antibodies', their potential as alternative antibodies is very high.
  • Aptamers have very high stability compared to antibodies. Protein or antibody drugs cannot be stored or transported at room temperature, but aptamers can and can maintain their function even after sterilization.
  • IGF-1 receptor aptamer refers to an aptamer that can bind to the IGF-1 receptor with specific affinity.
  • the IGF-1 receptor may be derived from human IGF-1 receptor protein, but is not limited thereto.
  • the aptamer is characterized by binding specifically to the IGF-1 receptor, and may include a base modified by replacing the 5th position of the nucleotide base included in the aptamer with a hydrophobic functional group.
  • bases used in the aptamer of the present invention other than the modified bases are selected from the group consisting of A, G, C, T, and deoxy forms thereof, and include modifications thereof. This is mentioned in detail.
  • position 5 of the base of the nucleotide included in the aptamer may be substituted with a hydrophobic functional group.
  • deoxyribose uracil modified by replacing the 5th position of the thymine base in the variable region with a hydrophobic functional group, such as 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine (NapdU) or Contains 8 or 9 5-(N-benzylcarboxyamide)-2'-deoxyuridine in the variable region.
  • the hydrophobic functional group may include a naphthyl group, benzyl group, pyrrolebenzyl group, isobutyl group, or tryptophan, and more preferably, the hydrophobic functional group is a naphthyl group or a benzyl group.
  • Deoxyribose uracil modified by substitution with a naphthyl group is shown in Formula 1 below, and deoxyribose uracil modified by substitution with a benzyl group is shown in Formula 2 below.
  • the aptamer may include SEQ ID NO: 1 or 2.
  • it may be an aptamer that essentially includes SEQ ID NO: 1 or 2 and additionally includes consecutive nucleotides on both sides.
  • Figure 1 shows aptamers having the sequences of SEQ ID NO: 1 (IGF1R-038) and SEQ ID NO: 2 (IGF1R-062) according to the present invention.
  • N may be 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine or 5-(N-benzyl)carboxamide]-2'-deoxyuridine. That is, N is a modified base and may have either a naphthyl group or a benzyl group as a hydrophobic functional group, as mentioned in Formula 1 or 2 above.
  • it is 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine, and may be SEQ ID NO: 3 or 4 below.
  • C, A, and G may be modified or unmodified bases, and may be substituted with a C3 propyl spacer.
  • modified C introduces a methoxy group (2-O-Me, 2-O-Methoxy-DNA) at the second carbon position of the nucleotide;
  • modification may include the introduction of fluorine (2-F, 2-Fluorine-DNA) at the second carbon position of the nucleotide.
  • the modified G introduces a methoxy group (2-O-Me, 2-O-Methoxy-DNA) at the second carbon position of the nucleotide;
  • the modification may include the introduction of fluorine (2-F, 2-Fluorine-DNA) at the second carbon position of the nucleotide.
  • modified A introduces a methoxy group (2-O-Me, 2-O-Methoxy-DNA) at the second carbon position of the nucleotide;
  • the modification may include the introduction of fluorine (2-F, 2-Fluorine-DNA) at the second carbon position of the nucleotide.
  • the aptamer may form a stem-loop structure composed of internal nucleotides.
  • the aptamer according to the present invention essentially includes the sequences of SEQ ID NO: 1 and/or 2 mentioned above. More specifically, it may consist of, consist essentially of, or include SEQ ID NOs: 1 and 2.
  • sequence may include a base sequence having a homology of 70% or more, 80% or more, 85% or more, or 90% or more.
  • sequence may be approximately at least 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 consecutive sequences.
  • it may be SEQ ID NO: 5 or 6 below.
  • N may be 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine or 5-(N-benzyl)carboxamide]-2'-deoxyuridine. That is, N is a modified base and may have either a naphthyl group or a benzyl group as a hydrophobic functional group, as mentioned in Formula 1 or 2 above.
  • it is 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine, and may be SEQ ID NO: 7 or 8 below.
  • including a sequence may mean including a sequence, may mean consisting essentially of these, or may mean consisting of these.
  • any base located in the middle or at both ends may be modified.
  • the modification includes PEG (polyethylene glycol), biotin, idT (inverted deoxythymidine), LNA (Locked Nucleic Acid), 2'-methoxy nucleoside, and 2'-amino at the 5' end, 3' end, middle or both ends. It may be modified by combining one or more types selected from the group consisting of nucleosides, 2'F-nucleosides, amine linkers, thiol linkers, and cholesterol.
  • 2'-methoxy nucleoside, 2'-amino nucleoside, or 2'F-nucleoside binds to the base contained in the aptamer and provides a modified base, thereby imparting nuclease resistance. do.
  • a modified base may be further included to ensure nuclease resistance and stability when administered in the human body.
  • Such modified bases may preferably be substitutions of 2'-OMe (methoxy) and/or 2'-F (fluorine) for any of the bases A, C, T, or G. That is, it has at least one modified base substitution of 2'-OMe (methoxy) or 2'-F (fluorine) for the base A, C, T or G of SEQ ID NO: 1 and/or SEQ ID NO: 2. It may be.
  • the present inventors performed SELEX using the IGF-1 receptor protein and selected a new aptamer that binds more strongly to the IGF-1 receptor.
  • the two aptamers selected in this way are IGF1R-038 (SEQ ID NO: 3) and IGF1R-062 aptamer (SEQ ID NO: 4) described above.
  • the aptamer according to the present invention promotes phosphorylation of the IGF-1 receptor. Specifically, it preferentially phosphorylates the tyrosine at position 1135 (Y1135) in the amino acid sequence of the IGF-1 receptor and then phosphorylates the serine at position 473 of AKT (AKT S473). It can promote absorption of glucose.
  • the aptamer according to the present invention does not promote cell division.
  • IGF-1 Unlike insulin administration, IGF-1 rarely causes hypoglycemic shock and does not increase body weight. However, as IGF-1 is a powerful growth factor that greatly promotes cell division, growth, and differentiation, cases of worsening diabetic retinopathy have been observed, including breast cancer, lung cancer, and ovarian cancer. It is known to play an important role in the development of cancer.
  • the present inventors have confirmed through an example that the aptamer increases cellular glucose uptake to a level comparable to insulin but does not promote cell division.
  • the aptamer according to the present invention has side effects that existing insulin and IGF-1 have. It can be useful in controlling blood sugar levels without causing any symptoms.
  • Two or more aptamers according to the present invention may be connected and exist as a dimer or multimer.
  • dimer or multimer The formation of a dimer or multimer is achieved by combining two or more aptamers through complementary nucleic acid sequences to form a dimer or multimer and/or by combining two or more aptamers through a spacer sequence. Implement a single-stranded form by implementing .
  • Linker sequence refers to a chemical moiety that connects two molecules or moieties.
  • the linker sequence of the present invention corresponds to, for example, a nucleic acid linker, and forms a double bond through complementary base sequences to form a dimer. Additionally, if necessary, a multimer may be formed by further including two or more linker sequences.
  • Linker sequences having the above complementary sequences can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60 sequences. Preferably, it may have 5 to 30 base sequences, 10 to 30 base sequences, approximately 15 to 25 base sequences, and more preferably about 20 base sequences.
  • the linker sequence may further include modified bases to ensure nuclease resistance and stability when administered in the human body.
  • modified bases may preferably be substitutions of 2'-OMe (methoxy) and/or 2'-F (fluorine) for any of the bases of A, C, T, or G, and may be used as L-form DNA Or it may be LNA (Locked DNA). That is, the base sequence of the linker sequence may have at least one modified base substitution of 2'-OMe (methoxy) or 2'-F (fluorine) for the bases A, C, T or G,
  • the linker sequence can be in the form of L-form DNA or LNA (Locked DNA).
  • a spacer sequence may be additionally included to provide an appropriate space between this linker sequence and the sequences of SEQ ID NO: 1 and/or 2.
  • the sequence for providing space between the linker and the aptamer sequence forming this complementary bond is preferably polyT, for example, and has approximately 0, 1, 2, 3, 4, 5, 6 It can be included between the linker and the insulin receptor at the dog level.
  • Spacer sequences include poly A fragment, poly T fragment, poly G fragment, poly C fragment, Phosphoramidite fragment, random oligonucleotide sequence without interference with aptamer sequence, ethylene glycol fragment and profile ( propyl) fragment can be used.
  • the length of this fragment may vary as known to those skilled in the art. Preferably 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, It may be a poly T fragment sequence of 26, 27, 28, 29, or 30.
  • the spacer sequence may further include modified bases to ensure nuclease resistance and stability when administered in the human body.
  • modified bases preferably have a 3'-propyl spacer, 2'-OMe (methoxy) and/or 2'-F (fluorine) for any of the bases A, C, T, or G. It may be a substitution of , and may be L-form DNA or LNA (Locked DNA). That is, the base sequence of the linker sequence may have at least one modified base substitution of 2'-OMe (methoxy) or 2'-F (fluorine) for the bases A, C, T or G,
  • the linker sequence can be in the form of L-form DNA or LNA (Locked DNA).
  • the present invention provides an IGF-1 receptor agonist comprising the aptamer described above.
  • IGF-1 receptor agonist refers to a pharmaceutically acceptable agent that selectively binds to the IGF-1 receptor.
  • IGF-1 receptor agonists represent a new type of diabetes treatment agent developed to effectively control blood sugar.
  • the IGF-1 receptor agonist of the present invention not only specifically binds to the IGF-1 receptor, but also has the characteristic of having no side effects such as diabetic retinopathy or cancer.
  • the IGF-1 receptor agonist can be used for diagnosis or treatment of various diseases related to insulin, especially metabolic diseases.
  • the present invention provides, in another form, a pharmaceutical composition for preventing or treating metabolic diseases or cancer, including the aptamer described above.
  • metabolic diseases include diabetes mellitus (T1D and/or T2DM, such as prediabetes), idiopathic type 1 diabetes (T1D (type 1b)), latent autoimmune diabetes in adults (LADA), and early-onset type 2 diabetes (T2DM).
  • T1D and/or T2DM such as prediabetes
  • T1D type 1b
  • LADA latent autoimmune diabetes in adults
  • T2DM early-onset type 2 diabetes
  • EOD youth-onset atypical diabetes
  • MODY adult-onset diabetes
  • malnutrition-related diabetes gestational diabetes, hyperglycemia, insulin resistance, hepatic insulin resistance, impaired glucose tolerance, diabetic neuropathy, diabetic Nephropathy, kidney disease (e.g., acute kidney failure, tubular dysfunction, proinflammatory changes to the proximal tubules), diabetic retinopathy, adipocyte dysfunction, visceral fat accumulation, sleep apnea, obesity (e.g., hypothalamic obesity and -genetic obesity) and related comorbidities (e.g., osteoarthritis and urinary incontinence), eating disorders (e.g., binge eating syndrome, bulimia nervosa, and syndromic obesity, such as Prader-Willi syndrome and Bardet-Biddle) (Bardet-Biedl) syndrome), weight gain due to the use of other medications (e.g., from the use of steroids and antipsychotics),
  • other medications e
  • the cancers include Ewing sarcoma, rhabdomyosarcoma, multiple myeloma, lymphoma, leukemia, breast cancer, lung cancer, prostate cancer, pancreatic cancer, rectal cancer, colon cancer, and large intestine. It may be any one selected from the group consisting of cancer, cervical cancer, and biliary tract cancer.
  • the aptamer of the present invention inhibits the activity (expression) of the IGF-1 receptor (IGF-1R), thereby providing an anticancer effect against cancers with high expression of the IGF receptor.
  • IGF-1R IGF-1 receptor
  • IGF receptors may be a cancer with high expression of IGF receptors.
  • Cancers with high expression of these IGF receptors include Ewing sarcoma, rhabdomyosarcoma, multiple myeloma, lymphoma, leukemia, breast cancer, lung cancer, prostate cancer, pancreatic cancer, rectal cancer, It may be any one selected from the group consisting of colon cancer, colon cancer, cervical cancer, and biliary tract cancer.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the patient's sexually transmitted disease, age, type of disease, severity, drug, etc. activity, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field.
  • the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. Additionally, the pharmaceutical composition of the present invention can be administered singly or multiple times. Considering all of the above factors, it is important to administer an amount that can achieve maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art.
  • the pharmaceutical composition according to the present invention may be administered alone or in combination with insulin.
  • the pharmaceutical composition according to the present invention can reduce the side effects experienced by patients with severe diabetes by lowering the amount of insulin used through concurrent administration or replacement with insulin.
  • subject of the present invention includes animals or humans whose symptoms can be improved by administration of the pharmaceutical composition according to the present invention.
  • administration of the pharmaceutical composition according to the present invention By administering the therapeutic composition according to the present invention to an individual, metabolic diseases or cancer can be effectively prevented and treated.
  • administration means introducing a predetermined substance into a human or animal by any appropriate method, and the route of administration of the therapeutic composition according to the present invention is through any general route as long as it can reach the target tissue. It may be administered orally or parenterally. Additionally, the therapeutic composition according to the present invention can be administered by any device that can move the active ingredient to target cells.
  • the preferred dosage of the pharmaceutical composition according to the present invention varies depending on the patient's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art.
  • the pharmaceutical composition may be formulated into various oral or parenteral dosage forms.
  • it can be in any dosage form for oral administration, such as tablets, pills, hard/soft capsules, solutions, suspensions, emulsifiers, syrups, granules, and elixirs.
  • These formulations for oral administration may contain, in addition to the above active ingredients, diluents such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine, silica, and talc, depending on the typical composition of each formulation. , stearic acid and its magnesium or calcium salts, and/or lubricants such as polyethylene glycol.
  • the dosage form for oral administration when it is a tablet, it may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidine. Depending on the condition, it may also contain a disintegrant such as starch, agar, alginic acid or its sodium salt, a boiling mixture and/or an absorbent, a colorant, a flavoring agent, or a sweetener.
  • a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidine.
  • a disintegrant such as starch, agar, alginic acid or its sodium salt, a boiling mixture and/or an absorbent, a colorant, a flavoring agent, or a sweetener.
  • examples include solutions, gels, cleansing compositions, tablets for insertion, suppository forms, topical administration such as creams, ointments, dressing solutions, sprays, and other coating agents, solution forms, suspension forms, etc.
  • It may be a liquid formulation such as an emulsion type, and may be a sterilized aqueous solution, non-aqueous solvent, suspension, emulsion, freeze-dried formulation, suppository, cream, ointment, jelly, foam, detergent or insert, preferably a liquid or gel formulation.
  • cleansing compositions, and external skin preparations such as tablets for insertion may be included.
  • the formulation can be prepared by adding solubilizers, emulsifiers, buffers for pH adjustment, etc. to sterilized water.
  • the non-aqueous solvent or suspension may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • aptamers are prepared in colloidal drug delivery systems (e.g. liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or macroemulsions, for example by coacervation techniques or interfacial polymerization.
  • colloidal drug delivery systems e.g. liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • macroemulsions for example by coacervation techniques or interfacial polymerization.
  • microcapsules such as hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacrylate) microcapsules, respectively. These techniques are known in the art.
  • the pharmaceutical composition according to the present invention can be administered in a pharmaceutically effective amount.
  • “Pharmaceutically effective amount” means an amount sufficient to prevent or treat a disease with a reasonable benefit/risk ratio applicable to medical treatment.
  • the effective dose level can be variously selected by a person skilled in the art depending on factors such as formulation method, patient's condition and weight, patient's gender, age, degree of disease, drug form, administration route and period, excretion rate, reaction sensitivity, etc. there is.
  • the effective amount may vary depending on the route of processing, the use of excipients and the possibility of use with other agents, as will be appreciated by those skilled in the art.
  • the composition of the present invention is generally administered to adults at 0.0001 to 100 mg/kg per day, preferably 0.001 to 100 mg/kg per kg of body weight per day.
  • the above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition may be formulated in a parenteral administration form, in which case it is administered by parenteral administration methods such as subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection.
  • parenteral administration methods such as subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection.
  • the active ingredient i.e., a derivative of Formula I or a pharmaceutically acceptable salt thereof, is mixed in water with a stabilizer or buffer to prepare a solution or suspension.
  • these solutions or suspensions may be prepared in unit dosage form in ampoules or vials.
  • the pharmaceutical composition may be sterilized or may further contain auxiliaries such as preservatives, stabilizers, wetting agents or emulsification accelerators, salts and/or buffers for adjusting osmotic pressure, and may further contain other therapeutically useful substances.
  • auxiliaries such as preservatives, stabilizers, wetting agents or emulsification accelerators, salts and/or buffers for adjusting osmotic pressure, and may further contain other therapeutically useful substances.
  • the subject of administration of the pharmaceutical composition of the present invention may be a mammal, including humans, and preferably may be a rodent or a human.
  • the present invention can additionally provide a hypoglycemic agent containing the above-mentioned aptamer as an active ingredient in another form.
  • hypoglycemic agent can be administered through subcutaneous injection to provide an immediate effect.
  • the present invention provides a method for preventing or treating metabolic disease or cancer, comprising administering the above-described aptamer to a subject in need thereof.
  • the present invention provides a composition comprising the above-mentioned aptamers for use in the prevention or treatment of metabolic diseases or cancer.
  • the present invention provides the use of the above-mentioned aptamers in the preparation of medicaments for the treatment of metabolic diseases or cancer.
  • the present invention provides a composition for diagnosing diabetes or diabetic complications containing the above-described aptamer as an active ingredient.
  • the diagnostic composition according to the present invention can be used by reacting with a biological sample. Through this reaction, the aptamer according to the present invention binds to the IGF-1 receptor in the biological sample. In this case, if the binding degree of the aptamer according to the present invention is higher than that of the normal sample, diabetes or diabetic complications may be diagnosed. .
  • the degree of binding of the aptamer according to the present invention in the biological sample can be performed using DNA aptamer binding measurement technology commonly used in the related art, for example, by labeling the end of the aptamer with a fluorescent or radioactive substance to show fluorescence or Methods such as measuring radioactive intensity or observing by imaging may be used, but are not limited thereto.
  • the aptamer according to the present invention can function as a biased agonist that increases glucose absorption by promoting phosphorylation of the IGF-1 receptor and selectively induces only the metabolic function of the IGF-1 receptor. In addition, since it does not promote cell division, it can eliminate the occurrence of diabetic retinopathy or cancer caused by excessive cell division caused by existing IGF-1 administration.
  • Figure 1 shows the sequences of IGF1R-038 and IGF1R-062 aptamers according to the present invention.
  • Figure 2 shows the results of confirming IGF-1 receptor phosphorylation by IGF1R-038 and IGF1R-062 aptamers according to the present invention.
  • Figure 3 shows the results of confirming the phosphorylation of IGF-1 receptor, AKT, and ERK by the IGF1R-038 aptamer according to the present invention.
  • Figure 4 shows the results confirming the inhibitory effect of IGF-1 activity by the IGF1R-038 aptamer according to the present invention.
  • Figure 5 shows the results of confirming glucose absorption according to the concentration of the IGF1R-038 aptamer according to the present invention.
  • Figure 6 shows the results confirming the effect on cell growth when MCF-7 cells were treated individually with IGF-1 and IGF1R-038 according to the present invention.
  • Human IGF-1 receptor protein was purchased from R&D systems (Minneapolie, MN). The aptamer used was synthesized through Aptamer Science Co., Ltd. Antibodies used for Western blot were as follows: Anti-phosphor-IGF-1R (Y1135), Anti-IGF-1R, Anti-phosphor-ERK (T202/Y204), Anti-phosphor-AKT (S473), Anti-phosphor -AKT (T308) and anti-actin were purchased from Cell signaling (Beverly, MA). Anti-phosphor-IGF-1R (Y1135/Y1136) was purchased from Invitrogen (Carlsbad, CA).
  • CHO cells, MCF-7 cells, and L6 myoblast cells were purchased from American Type Culture Collection (Manassas, VA, USA). 293F cells were purchased from Thermo scientific. MCF-7, 293F, and Rat-1/hIR were cultured at 37°C in DMEM (Dulbecco's modified Eagle's medium, Lonza) supplemented with 10% FBS (fetal bovine serum, Gibco), penicillin 100 units/ml, and streptomycin 100 units/ml. and cultured under 5% CO 2 conditions. L6 myoblasts were cultured at 37°C and 5% CO 2 in Alpha MEM (WELGEN) supplemented with 10% bovine serum (Gibco), 100 units/ml of penicillin, and 100 units/ml of streptomycin.
  • DMEM Dulbecco's modified Eagle's medium, Lonza
  • FBS fetal bovine serum, Gibco
  • penicillin 100 units/ml fetal bovine serum
  • streptomycin
  • SELEX Single-stranded DNA library (SEQ ID NO: 3) consisting of a 40-mer variable sequence and a 20-mer constant sequence on each side.
  • an antisense library (SEQ ID NO: 3) with biotin bound to the 5' side was synthesized.
  • the antisense library was mixed with 0.5 mM dNTP (ATP, GTP, CTP, Bz-dU), 0.25 U/ ⁇ l KOD XL (Invitrogen), and 10X extension buffer (1.2M Tris-HCl pH7.8, 100 mM KCl, 60 mM ( Double-stranded DNA was prepared by reacting with 50 ⁇ M of reverse primer (SEQ ID NO: 4) on NH4) 2 SO 4 , 70 mM MgSO 4 , 1% TritonX-100, 1 mg/ml BSA) at 70°C for 1 hour.
  • the single-strand modified DNA library was eluted using 20 mM NaOH and then neutralized with HCL solution.
  • the prepared DNA library was concentrated using Amicon ultra-15 (Millipore) and then quantified using a UV spectrophotometer
  • 1nM of the synthesized library was added to selection buffer (200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl2 ) and reacted at 95°C, 70°C, 48°C, and 37°C for 5 minutes each.
  • 10 ⁇ l of 10X protein competition buffer (10 ⁇ M prothrombin, 10 ⁇ M casein, 0.1% (w/v) HSA (human serum albumin, SIGMA) was mixed, and the supernatant It was added to the removed Dynabeads® MyOneTM Streptavidin C1 (SA bead) (50% (v/v) slurry, 10 mg/ml Invitrogen) and reacted at 37°C for 10 minutes.
  • 10X protein competition buffer 10 ⁇ M prothrombin, 10 ⁇ M casein, 0.1% (w/v) HSA (human serum albumin, SIGMA) was mixed, and the supernatant It was added to the removed Dynabeads® MyOneTM Streptavidin C1 (SA bead) (50% (v/v) slurry, 10 mg/ml Invitrogen) and reacted at 37°C for 10 minutes.
  • SA human serum albumin
  • Dynabead TALON bound to DNA and IGF-1 receptor were washed five times with 100 ⁇ l of selection buffer (200mM HEPES, 510mM NaCl, 25mM KCl, 25mM MgCl2 ). For the fifth wash, it was transferred to a new plate and washed. The library binding to the target was eluted by adding 85 ⁇ l of 2mM NaOH solution and then neutralized with 20 ⁇ l of 8mM HCl solution.
  • Library DNA binding to the target was amplified using QPCR (quantitative PCR, IQ5 multicolor real time PCR detection system, Bio-rad).
  • the reverse primer (SEQ ID NO: 4) and the antisense library (SEQ ID NO: 3) previously used for library preparation were respectively 5 ⁇ M (5 science), 25 mM MgCl 2 , 5
  • a double-stranded library was prepared by repeating the process 30 times at °C 1 minute.
  • eDNA is enzymatic DNA, which refers to an aptamer produced using a DNA template and polymerase.
  • the DNA library created through the QPCR was fixed to 25 ⁇ l Myone SA beads (Invitrogen) by mixing at room temperature for 10 minutes. At this time, the amount of mixed DNA was 60 ⁇ l as QPCR product. A 20mM NaOH solution was added to make single-stranded DNA. Then, DNA containing the modified nucleic acid was synthesized in the same manner as the library preparation in Example 1.1 and used in the next round.
  • the SELEX round was performed a total of 8 times, and for more selective binding, DNA and protein (Integrin ⁇ V ⁇ 3) complexes were mixed in 10mM DxSO 4 (sigma) solution from 4 to 6 times and from 7 to 8 times, respectively, at 1/200 and 1/ DNA aptamers were selected by diluting to 400.
  • aptamer treatment Before aptamer treatment, cells were treated in DMEM without FBS for 3 hours for serum starvation. All aptamers were heated at 95°C for 5 minutes and slowly cooled to room temperature to form accurate secondary structures. Aptamers were treated with cells in Krebs-Ringer HEPES buffer [25mM HEPES (pH 7.4), 120mM NaCl, 5mM KCl, 1.2mM MgSO 4 , 1.3mM CaCl 2 , and 1.3mM KH 2 PO 4 ] for 1 hour. did.
  • Krebs-Ringer HEPES buffer 25mM HEPES (pH 7.4), 120mM NaCl, 5mM KCl, 1.2mM MgSO 4 , 1.3mM CaCl 2 , and 1.3mM KH 2 PO 4 ] for 1 hour. did.
  • Cells after aptamer treatment were lysed in lysis buffer [50mM Tris-HCl (pH 7.4), 150mM NaCl, 1mM EDTA, 20mM NaF, 10mM ⁇ -glycerophosphate, 2mM Na 3VO 4 , 1mM PMSF, Cells were lysed in [10% glycerol, 1% Triton-X, and protease inhibitor cocktails]. Cell lysates were centrifuged at 95°C at 14,000 rpm for 15 minutes to separate proteins.
  • the prepared cell lysate was electrophoresed on 6% to 16% SDS-PAGE and transferred to a nitrocellulose membrane. After the primary antibody was reacted on the membrane at 4°C for 12 hours, the secondary antibody coupled to IRDye800CW (LI-COR) was reacted at room temperature for 1 hour. The presence and phosphorylation level of the protein were measured using an infrared fluorescence system (Odyssey, LI-COR).
  • IGF- 1 The degree of receptor phosphorylation was observed using the Western blotting method described above.
  • the IGF1R-062 aptamer has one more base added compared to the IGF1R-038 aptamer, but since no difference in activity was confirmed between the two aptamers, the two aptamers have similar actions. I think it will be done. Therefore, in the following, additional experiments were conducted only on the representative IGF1R-038 aptamer.
  • the IGF1R-038 aptamer activated signaling comparable to IGF-1.
  • IGF-1 10 nM
  • phosphorylation of proteins such as IGF-1 receptor and AKT and ERK increased rapidly for 5 minutes and gradually decreased over time.
  • IGF1R-038 aptamer 250 nM
  • IGF1R-038 aptamer 250 nM
  • IGF1R-038 aptamer 250 nM
  • IGF1R-038 aptamer had no effect on phosphorylation of ERK.
  • the IGF1R-038 aptamer activates signaling of the IGF-1 receptor, but has significantly different characteristics from signaling by IGF-1.
  • aptamer treatment Before aptamer treatment, cells were treated in DMEM without FBS for 3 hours for serum starvation. All aptamers were heated at 95°C for 5 minutes and slowly cooled to room temperature to form accurate secondary structures. 400 nM of IGF1R-038 aptamer was mixed with IGF-1 for 10 minutes in Krebs-Ringer HEPES buffer [25mM HEPES (pH 7.4), 120mM NaCl, 5mM KCl, 1.2mM MgSO 4 , 1.3mM CaCl 2 , and Cells were treated under [1.3 mM KH 2 PO 4 ] conditions.
  • Cells after aptamer treatment were lysed in lysis buffer [50mM Tris-HCl (pH 7.4), 150mM NaCl, 1mM EDTA, 20mM NaF, 10mM ⁇ -glycerophosphate, 2mM Na 3VO 4 , 1mM PMSF, Cells were lysed in [10% glycerol, 1% Triton-X, and protease inhibitor cocktails]. Cell lysates were centrifuged at 95°C at 14,000 rpm for 15 minutes to separate proteins.
  • the prepared cell lysate was electrophoresed on 6% to 16% SDS-PAGE and transferred to a nitrocellulose membrane. After the primary antibody was reacted on the membrane at 4°C for 12 hours, the secondary antibody coupled to IRDye800CW (LI-COR) was reacted at room temperature for 1 hour. The presence and phosphorylation level of the protein were measured using an infrared fluorescence system (Odyssey, LI-COR).
  • the IGF1R-038 aptamer increased the phosphorylation of AKT (S473) through Experimental Example 2, the activity of the IGF1R-038 aptamer on glucose uptake was sought to be confirmed in L6 myogenic cells.
  • L6 myoblasts were treated with DMEM without FBS for 1 hour for serum starvation and then treated with Krebs-Ringer HEPES buffer for 1 hour.
  • IGF-1 or aptamer at different concentrations (IGF-1: 0.73 nM, 3.12 nM, 12.5 nM, 50 nM, 200 nM; IGF1R-038: 25 nM, 50 nM, 100 nM, 200 nM)
  • 2-deoxy[14C]glucose (0.1 ⁇ Ci/ml) was treated for 10 minutes.
  • the cells were washed three times with PBS containing 20 mM glucose, and the cells were lysed with a solution containing 0.5 N NaOH and 1% SDS.
  • the amount of glucose (2-Deoxy-D-glucose) absorbed into cells was observed using a liquid scintillation counter.
  • the IGF1R-038 aptamer showed a level of glucose absorption comparable to that of the insulin and IGF-1 administered group.
  • the group treated with 100 nM or more of IGF1R-038 aptamer showed a higher level of glucose absorption compared to the group treated with 200 nM insulin, and it was determined that IGF1R-038 aptamer was suitable for use for lowering blood sugar.
  • the effect of the IGF1R-038 aptamer on cell division was investigated using the MCF-7 cancer cell line, which is widely used to test the ability of the IGF-1 receptor to induce cell division.
  • MCF-7 cells were distributed at 10,000 per well in a 24-well plate and cultured for 24 hours, and for serum starvation, they were cultured in 0.5% FBS DMEM for an additional 24 hours.
  • the cells were treated with IGF-1 and IGF1R-038 alone for 72 hours, and the medium was replaced every 24 hours. After treatment, the cells were fixed for 30 minutes at room temperature using PBS containing 4% paraformaldehyde. Afterwards, the DNA contained in the cells was stained with PBS containing 1 ⁇ M SYTO60 fluorescent dye, and the amount of cells was quantified by measuring fluorescence using a LI-COR Odyssey scanner.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Diabetes (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Emergency Medicine (AREA)
  • Endocrinology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 IGF-1 수용체 결합 압타머 및 이의 용도에 관한 것이다. 본 발명에 따른 압타머는 IGF-1 수용체의 인산화를 촉진시켜 포도당 흡수를 증가시키면서도 IGF-1 수용체의 대사 기능만을 선택적으로 유도하는 Biased Agonist로서 기능할 수 있다. 또한, 세포분열을 촉진하지 않아 기존 IGF-1 투여에 의한 과도한 세포분열에 따른 당뇨성 망막병증의 유발 또는 암 발생을 해소할 수 있다.

Description

IGF-1 수용체 결합 압타머 및 이의 용도
본 발명은 IGF-1 수용체 결합 압타머 및 이의 용도에 관한 것이다.
당뇨병은 혈당 수치가 높은 상태로 장기간 지속되는 대사성 질환으로, 심하게 악화될 경우 심혈관질환, 뇌졸중, 만성신부전 등의 합병증으로 인해 사망에 이르게 된다.
식생활의 서구화로 인해 우리나라에서도 당뇨병 인구가 꾸준히 증가해 왔으며, 현재 30세 이상 성인 7명 중 한 명(14.4%)은 당뇨병 환자로 진단받고 있어, 당뇨병 치료제 개발에 대한 수요는 앞으로 계속 증가할 예정이다. 특히, 주사용 인슐린 제제는 당뇨병 치료제 시장의 37%에 해당하는 높은 점유율을 가진다.
인슐린 요법은 당뇨병 환자에게 필요한 인슐린을 외부에서 공급해주는 것으로, 인슐린 생산에 문제가 생기는 제1형 당뇨병 환자뿐만 아니라, 인슐린 저항성으로 인해 발병하지만 점차 베타세포의 기능이 상실되는 제2형 당뇨병 환자 모두에게 최후의 보루가 되는 필수적 치료법이다.
인슐린은 동화작용(anabolism)을 촉진시키는 호르몬이며 간과 지방조직에서 중성지방의 합성과 저장을 활성화시킨다. 따라서, 인슐린 투여는 환자의 체중을 크게 증가시키며, 이는 환자의 혈당 조절 능력 및 실혈관계 합병증에 악영향을 미친다. 또한, 인슐린은 치료 유효량(therapeutic index)의 폭이 매우 좁은 특성 때문에 약간의 과다투여로도 쉽게 저혈당 쇼크를 일으킨다. 저혈당은 환자의 뇌기능을 떨어뜨려 정신적 이상 증세를 유발하며, 심한 경우 혼수상태에 빠지거나 사망에 이를 수도 있다. 인슐린 요법은 그 중요성에도 불구하고, 상기한 두 가지 대표적 부작용 때문에 사용이 제한되기도 한다.
상기한 부작용은 인슐린 수용체의 태생적 특성에 의한 것으로 근본적 해결이 어려워, 아직 인슐린 제제의 부작용에 대한 미충족 수요를 해소할 수 있는 뚜렷한 개선책은 없는 실정이다.
다만, 이를 해결하기 위한 다양한 대안 중 하나로 IGF-1 수용체를 통한 혈당 조절이 제시되기도 하였다. IGF-1 수용체와 인슐린 수용체는 동일한 선조유전자에서 유래되어 단백질의 서열(~60% homology)과 구조에서 높은 상동성을 가진다. 생리적 기능 역시 양쪽 수용체 모두 대사 조절과 세포의 성장 및 분화 조절을 동시에 담당한다. 인슐린은 포도당 및 지질 대사에 보다 강한 활성을 보이는 반면, 반대로 IGF-1은 세포의 분열, 성장 및 분화 등에서 인슐린보다 강한 활성을 보인다.
IGF-1 수용체를 통한 혈당 조절은 인슐린 수용체에 비해 몇 가지 장점을 가진다. IGF-1 수용체를 통한 포도당 흡수 증가는 효력(potency)과 효능(efficacy)이 인슐린 수용체에 비해 낮기 때문에, IGF-1의 투여는 인슐린 투여에 의한 저혈당 쇼크를 거의 일으키지 않는다. 또한, IGF-1 수용체는 근육에만 발현되어 있으며 간과 지방 조직에는 존재하지 않아 IGF-1의 투여는 근육에 의한 포도당 흡수만을 선택적으로 증가시키며, 지방의 합성과 저장에는 영향을 미치지 않는다. 따라서, IGF-1의 투여는 체중을 증가시키지 않는다.
특히, 제1형 및 제2형 당뇨병 환자에게 IGF-1을 투여한 임상실험에서 인슐린과 비교할 만한 유의미한 수준의 혈당 감소 및 혈중 인슐린 농도 감소가 관찰되었다. 단기간 동안에 관찰된 IGF-1의 혈당 조절 능력은 인슐린을 대체할 수 있을 만한 충분한 효과를 보였으며, 인슐린 요법과 같은 부작용은 거의 관찰되지 않았다.
그러나 IGF-1을 당뇨치료제로 활용하려 했던 임상실험은 최종적으로 실패했다. 이는 IGF-1의 과도한 세포분열 촉진 때문이다. IGF-1은 강력한 성장인자(growth factor)로 세포의 분열, 성장 및 분화를 크게 촉진시킨다. IGF-1의 임상실험에서 당뇨병성 망막병증(diabetic retinopathy)을 악화시키는 사례가 관찰되었다. 이는 IGF-1 투여가 망막 혈관을 비정상적으로 증식시킨 것이 원인으로 추측된다. 또한, IGF-1의 장기 투여 시 암 발생률 증가에 대한 안정성도 확보되지 않았다. IGF-1 수용체는 유방암, 폐암, 난소암 등의 암발생에서 중요한 역할을 하는 것으로 알려졌다.
이에, 본 발명자는 IGF-1 수용체의 특정 기능 혹은 신호전달 경로만을 선택적으로 활성화시키는 리간드(ligand)인 편향 활성제(biased agonist)로 IGF-1 수용체 압타머를 개발하고, 해당 압타머가 대사적 기능(포도당 흡수)을 선택적으로 활성화시키면서 세포분열은 촉진시키지 않음을 확인함에 따라, IGF-1 수용체 압타머가 종래 임상실험을 통해 나타났던 IGF-1의 부작용과 장기투여에 대한 안정성 문제를 해결할 수 있을 것으로 판단하고 본 발명을 완성하였다.
본 발명의 하나의 목적은 IGF-1 수용체에 특이적으로 결합하고, IGF-1 수용체의 인산화를 촉진시키는 IGF-1 수용체 압타머(aptamer)를 제공하는 것이다.
본 발명의 또 하나의 목적은 IGF-1 수용체 압타머를 포함하는 IGF-1 수용체 작용체(agonist)를 제공하는 것이다.
본 발명의 또 다른 목적은 IGF-1 수용체 압타머를 유효 성분으로 함유하는 대사성 질환 또는 암의 예방 또는 치료용 약학 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 IGF-1 수용체 압타머를 유효 성분으로 함유하는 당뇨병 또는 당뇨 합병증 진단용 조성물을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 IGF-1 수용체에 특이적으로 결합하고, IGF-1 수용체의 인산화를 촉진시키는 IGF-1 수용체 압타머(aptamer)를 제공한다.
보다 구체적으로, 서열번호 1 또는 서열번호 2를 포함하는 IGF-1 수용체에 특이적으로 결합하는 IGF-1 수용체 압타머(aptamer)를 제공한다.
"압타머(aptamer)"란, 특이적 3차원 형성을 형성하는 15-40개의 단일가닥 올리고뉴클레오티드로서, 스템 루프(stem loop) 구조를 가지며, 특정 분자에 특이적으로 결합하는 성질이 있다. 압타머는 화학적으로 합성이 용이하며, 화학적 변형이 쉽고 열에 안정적이면서 타겟에 대한 특이도가 매우 높은 화합물이다.
압타머의 서열은 SELEX(selective evolution of ligands by exponential enrichment)란 방법으로 발굴할 수 있으며, 이미 수백 종의 압타머 서열이 공개되어 있다. 압타머는 특이적으로 타겟과 결합한다는 점에서 흔히 항체와 비교되기도 하지만, 면역반응이 없다. 저분자 유기물, 펩타이드, 막 단백질까지 다양한 표적분자에 결합할 수 있는 많은 압타머들이 계속 해서 발굴되어 왔다. 압타머는 고유의 높은 친화성(보통 pM 수준)과 특이성으로 표적분자에 결합할 수 있다는 특성 때문에 자주 단일 항체와 비교가 되고, 특별히 'chemical antibody'라 불리는 만큼 대체항체로서의 가능성도 매우 높다. 압타머는 항체에 비해 안정성이 매우 높다. 단백질이나 항체 의약품의 경우 실온에서 보관이나 운반이 불가능하지만 압타머는 가능하고, 심지어 멸균 후에도 기능을 유지할 수 있다.
본 명세서에서 IGF-1 수용체 압타머란 IGF-1 수용체에 특이적인 친화도로 결합할 수 있는 압타머를 의미한다. 상기 IGF-1 수용체는 인간 IGF-1 수용체 단백질에서 유래하는 것일 수 있으나 이에 한정되지 않는다.
상기 압타머는 IGF-1 수용체에 특이적으로 결합하는 것을 특징으로 하고, 압타머에 포함된 뉴클레오타이드 염기의 5번 위치가 소수성 작용기로 치환되어 변형된 염기를 포함할 수 있다.
상기 변형된 염기 이외의 본 발명의 압타머에 사용되는 염기는 특별한 언급이 없는 한, A, G, C, T, 및 이들의 deoxy 형태의 염기들로 이루어진 군에서 선택된 것이며, 이의 변형의 포함에 대해서는 이를 구체적 기재로 언급한다.
상기 압타머의 결합력과 특이성을 높이기 위하여, 상기 압타머에 포함된 뉴클레오타이드의 염기의 5번 위치가 소수성 작용기로 치환된 것일 수 있다. 예를 들면 가변영역의 티민(Thymine)염기의 5번 위치가 소수성 작용기로 치환되어 변형된 데옥시리보스 우라실, 예컨대 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine (NapdU) 또는 5-(N-벤질카복시아미드)-2'-데옥시우리딘을 가변영역에 8개 또는 9개 포함한다. 상기 소수성 작용기는 나프틸기, 벤질기, 피롤벤질기, 이소부틸기, 또는 트립토판을 포함할 수 있고, 더욱 바람직하게는 상기 소수성 작용기는 나프틸기 또는 벤질기이다. 상기 나프틸기로 치환되어 변형된 데옥시리보스 우라실을 아래 화학식 1에, 벤질기로 치환되어 변형된 데옥시리보스 우라실을 아래 화학식 2에 표시하였다.
[화학식 1]
Figure PCTKR2023010497-appb-img-000001
.
[화학식 2]
Figure PCTKR2023010497-appb-img-000002
.
바람직하게, 상기 압타머는 서열번호 1 또는 2를 포함할 수 있다. 바람직하게는 상기 서열번호 1 또는 2를 필수적으로 포함하고 양 옆으로 연속하는 뉴클레오타이드를 추가로 포함하는 압타머일 수 있다. 도 1에는 본 발명에 따른 서열번호 1(IGF1R-038) 및 서열번호 2(IGF1R-062)의 서열을 갖는 압타머를 나타내었다.
서열번호 명칭 서열 (5'→3')
1 IGF1R-038' CGCGAAGGCCA N ACCGGC N CA N GCA NNNN A N CGAGCG
2 IGF1R-062' CGCGAAGGCCA N ACCGGC N CA NN GCA NNNN A N CGAGCG
N : 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine 또는 5-(N- benzyl)carboxamide]-2'-deoxyuridine
상기 화학식 1에서 위 N은 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine 또는 5-(N- benzyl)carboxamide]-2'-deoxyuridine일 수 있다. 즉, N은 변형된 염기로, 상기 화학식 1 또는 2로 언급된 바와 같이 소수성 작용기를 나프틸기 또는 벤질기 중 어느 하나를 가질 수 있다.
바람직하게, 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine이며, 이에 하기 서열번호 3 또는 4일 수 있다.
서열번호 명칭 서열 (5'→3')
3 IGF1R-038 CGCGAAGGCCA N' ACCGGC N' CA N' GCA N'N'N'N' A N' CGAGCG
4 IGF1R-062 CGCGAAGGCCA N' ACCGGC N' CA N'N' GCA N'N'N'N' A N' CGAGCG
N' : 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine
상기 언급된, C, A, G는 변형되거나 비변형된 염기일 수 있으며, C3 프로필 스페이서(propyl spacer)로 치환된 것일 수 있다.
예를 들어, 변형된 C는 뉴클레오티드의 2번째 탄소 위치에 메톡시기(2-O-Me, 2-O-Methoxy-DNA) 도입; 또는 뉴클레오티드의 2번째 탄소 위치에 불소(2-F, 2-Fluorine-DNA)가 도입의 변형을 포함할 수 있다.
구체적으로, 변형된 G는 뉴클레오티드의 2번째 탄소 위치에 메톡시기(2-O-Me, 2-O-Methoxy-DNA) 도입; 또는 뉴클레오티드의 2번째 탄소 위치에 불소(2-F, 2-Fluorine-DNA)가 도입의 변형을 포함할 수 있다.
구체적으로, 변형된 A는 뉴클레오티드의 2번째 탄소 위치에 메톡시기(2-O-Me, 2-O-Methoxy-DNA) 도입; 또는 뉴클레오티드의 2번째 탄소 위치에 불소(2-F, 2-Fluorine-DNA)가 도입의 변형을 포함할 수 있다.
바람직하게는 상기 압타머는 내부의 뉴클레오타이드로 구성된 스템-루프 구조를 형성할 수 있다.
본 발명에 따른 상기 압타머는 앞서 언급된 서열번호 1 및/또는 2의 서열을 필수적으로 포함한다. 보다 구체적으로, 서열번호 1, 2로 이루어지거나, 이를 필수적으로 구성되거나, 이를 포함하는 것일 수 있다.
보다 구체적으로, 상기 서열은 상동성이 70% 이상, 80% 이상, 85% 이상 또는 90% 이상인 염기서열을 포함할 수 있다.
또한, 상기 서열은 대략적으로 적어도 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50개의 연속된 서열일 수 있다.
일 예로써, 하기 서열번호 5 또는 6일 수 있다.
서열번호 명칭 서열 (5'→3')
5 IGF1R-038'' TATCGAGCGTCCTGCCTTTGAACGCGAAGGCCA N ACCGGC N CA N GCA NNNN A N CGAGCGACACCGACAGCCACCCAGAAA
6 IGF1R-062'' TATCGAGCGTCCTGCCTTTGAACGCGAAGGCCA N ACCGGC N CA NN GCA NNNN A N CGAGCGACACCGACAGCCACCCAGAAA
N : 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine 또는 5-(N- benzyl)carboxamide]-2'-deoxyuridine
상기 화학식 1에서 위 N은 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine 또는 5-(N- benzyl)carboxamide]-2'-deoxyuridine일 수 있다. 즉, N은 변형된 염기로, 상기 화학식 1 또는 2로 언급된 바와 같이 소수성 작용기를 나프틸기 또는 벤질기 중 어느 하나를 가질 수 있다.
바람직한 일 예시로써, 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine이며, 이에 하기 서열번호 7 또는 8일 수 있다.
서열번호 명칭 서열 (5'→3')
7 IGF1R-038''' TATCGAGCGTCCTGCCTTTGAACGCGAAGGCCA N' ACCGGC N' CA N' GCA N'N'N'N' A N' CGAGCGACACCGACAGCCACCCAGAAA
8 IGF1R-062''' TATCGAGCGTCCTGCCTTTGAACGCGAAGGCCA N' ACCGGC N' CA N'N' GCA N'N'N'N' A N' CGAGCGACACCGACAGCCACCCAGAAA
N' : 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine
본 발명에서 서열을 포함하는 것은 서열을 포함하는 것을 의미할 수 있고, 이들로 필수적으로 이루어진 것을 의미할 수도 있으며, 이들로 이루어지는 것을 의미할 수 있다.
또한, 상기 서열번호 1 및/또는 서열번호 2의 N의 위치 이외의 임의의 염기 서열에서, 혈청 내 안정성을 증진시키거나 신장 클리어런스(renal clearance)를 조절하기 위하여, 5' 말단, 3' 말단, 중간 또는 양 말단에 위치한 염기를 적어도 하나 이상 변형시킬 수 있다. 상기 변형은 5' 말단, 3' 말단, 중간 또는 양 말단에 PEG(polyethylene glycol), 비오틴, idT(inverted deoxythymidine), LNA(Locked Nucleic Acid), 2'-메톡시 뉴클레오사이드, 2'-아미노 뉴클레오사이드, 2'F-뉴클레오사이드, 아민 링커, 티올 링커, 및 콜레스테롤 등으로 이루어진 군에서 선택된 1종 이상이 결합되어 변형된 것일 수 있다. 2'-메톡시 뉴클레오사이드, 2'-아미노 뉴클레오사이드 또는 2'F-뉴클레오사이드는 압타머에 포함된 염기에 결합하여 변형된 염기를 제공함으로써 뉴클레이즈 저항성(nuclease resistance)을 부여한다.
바람직하게, 뉴클라아제 저항성을 확보하고 인체 내 투여 시 안정성을 위하여 변형된 염기를 더 포함할 수 있다. 이러한 변형된 염기는 바람직하게, 임의의 A, C, T, 또는 G의 염기에 대하여 2'-OMe(메톡시) 및/또는 2'-F(플루오르)의 치환일 수 있다. 즉, 상기 서열번호 1 및/또는 서열번호 2의 A, C, T 또는 G의 염기에 대하여 적어도 하나 이상의 2'-OMe(메톡시) 또는 2'-F(플루오르)의 변형된 염기 치환을 가지는 것일 수 있다.
본 발명자는 IGF-1 수용체 단백질을 사용하여 SELEX를 진행하였고, IGF-1 수용체에 보다 강하게 결합하는 압타머를 새롭게 선별하였다. 이렇게 선별한 2종의 압타머가 상기 기재한 IGF1R-038(서열번호 3) 및 IGF1R-062 압타머(서열번호 4)이다.
본 발명에 따른 압타머는 IGF-1 수용체의 인산화를 촉진하며, 구체적으로 IGF-1 수용체의 아미노산 서열 중 1135번째 티로신(Y1135)을 우선적으로 인산화하고 이후 AKT의 473번째 세린(AKT S473)의 인산화를 촉진시켜 포도당을 흡수할 수 있다.
또한, 본 발명에 따른 압타머는 IGF-1과 달리, 세포분열을 촉진하지 않는다.
IGF-1은 인슐린 투여와 달리 저혈당 쇼크를 거의 일으키지 않고, 체중을 증가시키지 않는다. 다만, IGF-1은 강력한 성장인자(growth factor)로 세포의 분열, 성장 및 분화를 크게 촉진시킴에 따라 당뇨병성 망막병증(diabetic retinopathy)을 악화시키는 사례가 관찰되었고, 유방암, 폐암, 난소암 등의 암발생에서 중요한 역할을 하는 것으로 알려졌다.
본 발명자들은 상기 압타머가 인슐린에 비견할 수 있을 정도로 세포의 포도당 흡수를 증가시키면서도 세포분열을 촉진하지 않음을 일 실시예를 통해 확인한 바, 본 발명에 따른 압타머는 기존 인슐린 및 IGF-1이 갖는 부작용을 나타내지 않으면서 혈당조절을 하는데 유용하게 사용될 수 있다.
본 발명에 의한 2 이상의 압타머가 연결되어 이량체(dimer) 또는 다량체(multimer)로 존재할 수 있다.
이량체 또는 다량체의 형성은 상보적 핵산 서열을 통하여 2개 이상의 압타머를 결합시킨 형태를 구현하여 이량체 또는 다량체 형태를 구현 및/또는 스페이서 서열을 통하여 2개 이상의 압타머를 결합시킨 형태를 구현하여 단일 가닥 형태를 구현한다.
"링커 서열"은 2개의 분자 또는 모이어티를 연결하는 화학적 모이어티를 지칭한다. 본 발명의 링커 서열은 예컨대, 핵산 링커에 해당하며, 서로의 상보적으로 작용하는 염기 서열을 통하여 이중 결합을 형성하여 이량체를 구성한다. 또한, 필요에 따라 2 이상의 링커 서열을 더 포함하여 다량체를 형성할 수도 있다.
위 상보적 서열을 가지는 링커 서열은 예를 들어, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60 개의 서열일 수 있으며, 바람직하게, 5 내지 30 개, 10개 내지 30개, 대략 15 내지 25개의 염기 서열, 보다 바람직하게 약 20여개의 염기 서열을 가질 수 있다.
링커 서열은 뉴클라아제 저항성을 확보하고 인체 내 투여 시 안정성을 위하여 변형된 염기를 더 포함할 수 있다. 이러한 변형된 염기는 바람직하게, 임의의 A, C, T, 또는 G의 염기에 대하여 2'-OMe(메톡시) 및/또는 2'-F(플루오르)의 치환일 수 있으며, L-form DNA 또는 LNA (Locked DNA)일 수 있다. 즉, 상기 링커 서열의 염기서열은 A, C, T 또는 G의 염기에 대하여 적어도 하나 이상의 2'-OMe(메톡시) 또는 2'-F(플루오르)의 변형된 염기 치환을 가지는 것일 수 있으며, 링커 서열의 L-form DNA 또는 LNA (Locked DNA)의 형태를 이용할 수 있다.
또한, 필요에 따라 이러한 링커 서열과 서열번호 1 및/또는 2의 서열 사이에 적절 공간을 제공하기 위한 스페이서 서열을 추가로 포함할 수 있다. 이러한 상보적 결합을 형성하는 링커와 압타머 서열 사이에 공간을 제공하기 위한 서열은 예를 들어 폴리T가 바람직하며, 대략 0개, 1개, 2개, 3개, 4개, 5개, 6개 수준으로 링커와 인슐린 수용체 사이에 포함될 수 있다.
스페이서 서열은 폴리 A 단편, 폴리 T 단편, 폴리 G 단편, 폴리 C 단편, 포스포라미디트(Phosphoramidite) 단편, 압타머 서열에 간섭이 없는 랜덤 올리고뉴클레오티드 서열, 에틸렌 글리콜(ethylene glycol) 단편 및 프로필(propyl) 단편이 활용될 수 있다. 이 단편의 길이는 관련 기술분야의 통상의 기술자에게 공지된 바와 같이 달라질 수 있다. 바람직하게 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30개의 폴리 T단편 서열일 수 있다.
스페이서 서열은 뉴클라아제 저항성을 확보하고 인체 내 투여 시 안정성을 위하여 변형된 염기를 더 포함할 수 있다. 이러한 변형된 염기는 바람직하게, 임의의 A, C, T, 또는 G의 염기에 대하여 3'-프로필 스페이서(propyl spacer), 2'-OMe(메톡시) 및/또는 2'-F(플루오르)의 치환일 수 있으며, L-form DNA 또는 LNA (Locked DNA)일 수 있다. 즉, 상기 링커 서열의 염기서열은 A, C, T 또는 G의 염기에 대하여 적어도 하나 이상의 2'-OMe(메톡시) 또는 2'-F(플루오르)의 변형된 염기 치환을 가지는 것일 수 있으며, 링커 서열의 L-form DNA 또는 LNA (Locked DNA)의 형태를 이용할 수 있다.
본 발명은 상기한 압타머를 포함하는, IGF-1 수용체 작용체(agonist)를 제공한다.
본 발명에서 용어 "IGF-1 수용체 작용체"는 IGF-1 수용체에 선택적으로 결합하는 약학적으로 허용 가능한 제제를 나타낸다. 통상적으로 IGF-1 수용체 작용체는 효과적으로 혈당을 조절하기 위하여 개발된 새로운 종류의 당뇨병 치료제를 나타낸다. 본 발명의 IGF-1 수용체 작용체는 IGF-1 수용체에 특이적으로 결합할 뿐 아니라 당뇨병성 망막병증 및 암 발생의 부작용이 없는 특징이 있다.
따라서, 상기 IGF-1 수용체 작용체는 인슐린과 관련한 다양한 질병, 특히 대사성 질환의 진단 또는 치료 용도로 사용될 수 있다.
이에, 본 발명은 또 다른 형태로써 상기한 압타머를 포함하는 대사성 질환 또는 암의 예방 또는 치료용 약학 조성물을 제공한다.
예를 들어, 대사성 질환은 당뇨병(T1D 및/또는 T2DM, 예컨대 전당뇨병), 특발성 1형 당뇨병(T1D(유형 1b)), 성인에서 잠복성 자가면역 당뇨병(LADA), 조기 발병 2형 당뇨병(T2DM(EOD)), 연소자 발병 비정형 당뇨병(YOAD), 연소자의 성인 발병 당뇨병(MODY), 영양실조-관련된 당뇨병, 임신성 당뇨병, 고혈당증, 인슐린 내성, 간 인슐린 내성, 내당능 장애, 당뇨병성 신경병증, 당뇨병성 신증, 신장 질환(예컨대, 급성 신장 장애, 관형 기능장애, 근위 세뇨관에 대한 전염증 변화), 당뇨병성 망막증, 지방세포 기능장애, 내장 지방 축적, 수면 무호흡증, 비만(예컨대, 시상하부성 비만 및 단일-유전자성 비만) 및 관련 동반질환(예컨대, 골관절염 및 요실금), 섭식 장애(예컨대, 폭식 증후군, 신경성 식욕 항진증, 및 증후군성 비만, 예컨대 프레더-윌리(Prader-Willi) 증후군 및 바르데-비들(Bardet-Biedl) 증후군), 다른 약제의 사용으로 인한 체중 증가(예컨대, 스테로이드 및 항정신병약의 사용으로부터), 과도한 당 섭취욕, 이상지질혈증(고지혈증, 고중성지질혈증, 총 콜레스테롤 증가, 고LDL 콜레스테롤, 및 저 HDL 콜레스테롤 포함), 비알코올성 지방간질환(NAFLD)(관련 질환, 예컨대 지방증, 비알코올성 지방간염(NASH), 섬유증, 간경변, 및 간세포 암종 포함)일 수 있다.
구체적으로, 상기 암은 유잉육종(Ewing sarcoma), 횡문근육종(Rhabdomyosarcoma), 다발성 골수종(multiple myeloma), 임파종(lymphoma), 백혈병(leukemia), 유방암, 폐암, 전립선암, 췌장암, 직장암, 결장암, 대장암, 자궁경부암 및 담도암으로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
특히, 본 발명의 압타머는 IGF-1 수용체(IGF-1R)의 활성(발현)을 저해함에 따라, IGF 수용체의 발현이 높은 암에 대한 항암효과를 부여한다.
보다 구체적으로 IGF 수용체의 발현이 높은 암일 수 있다. 이러한 IGF 수용체의 발현이 높은 암은 유잉육종(Ewing sarcoma), 횡문근육종(Rhabdomyosarcoma), 다발성 골수종(multiple myeloma), 임파종(lymphoma), 백혈병(leukemia), 유방암, 폐암, 전립선암, 췌장암, 직장암, 결장암, 대장암, 자궁경부암 및 담도암으로 이루어진 군으로부터 선택되는 어느 하나일 수 있다.
본 발명에서 "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자의 성병, 연령, 질병의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명의 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와 순차적으로 또는 동시에 투여될 수 있다. 또한 본 발명의 약학적 조성물은 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
더욱 바람직하게 본 발명에 따른 약학적 조성물은 단독투여 또는 인슐린과 함께 병용투여되는 것일 수 있다. 본 발명에 따른 약학 조성물은 인슐린과 병용 투여 혹은 대체를 통해 인슐린의 사용량을 낮춤으로써 중증 당뇨 환자가 겪는 부작용을 감소시킬 수 있다.
본 발명의 용어 "대상체"는 본 발명에 따른 약학적 조성물의 투여에 의해 증상이 호전될 수 있는 동물 또는 인간을 포함한다. 본 발명에 따른 치료용 조성물을 개체에게 투여함으로써, 대사성 질환 또는 암을 효과적으로 예방 및 치료할 수 있다.
본 발명의 용어 "투여"는 어떠한 적절한 방법으로 인간 또는 동물에게 소정의 물질을 도입하는 것을 의미하며, 본 발명에 따른 치료용 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 경구 또는 비경구 투여될 수 있다. 또한, 본 발명에 따른 치료용 조성물은 유효성분이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
본 발명에 따른 약학적 조성물의 바람직한 투여량은 환자의 상태 및 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다.
상기 약학 조성물은 다양한 경구 투여 형태 또는 비경구 투여 형태로 제형화될 수 있다. 예를 들어, 정제, 환제, 경/연질 캅셀제, 액제, 현탁제, 유화제, 시럽제, 과립제, 엘릭서제(elixirs) 등의 임의의 경구 투여용 제형으로 될 수 있다. 이러한 경구 투여용 제형은 각 제형의 통상적인 구성에 따라 상기 유효 성분 외에, 예를 들어, 락토즈, 덱스트로즈, 수크로즈, 만니톨, 솔비톨, 셀룰로즈 및/또는 글리신 등의 희석제나, 실리카, 탈크, 스테아르산 및 그의 마그네슘 또는 칼슘염 및/또는 폴리에틸렌 글리콜 등의 활택제 등의 제약상 허용 가능한 담체를 포함할 수 있다.
또한, 상기 경구 투여용 제형이 정제인 경우, 마그네슘 알루미늄 실리케이트, 전분 페이스트, 젤라틴, 트라가칸스, 메틸셀룰로즈, 나트륨 카복시메틸셀룰로즈 및/또는 폴리비닐피롤리딘 등의 결합제를 포함할 수 있고, 경우에 따라, 전분, 한천, 알긴산 또는 그의 나트륨 염과 같은 붕해제나, 비등 혼합물 및/또는 흡수제, 착색제, 향미제 또는 감미제 등을 포함할 수도 있다.
비경구용으로 제공하는 경우, 일 예로 액제, 겔(gel)제, 세정 조성물, 삽입용 정제, 좌제 형태, 크림, 연고, 드레싱 용액, 분무제, 기타 도포제등의 국소 투여제, 용액형, 현탁형, 유제형 등의 액상제형일 수 있으며, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제, 크림, 연고, 젤리, 거품, 세척제 또는 삽입물, 바람직하게는 액제, 겔 (gel)제, 세정 조성물, 삽입용 정제 등의 피부 외용제가 포함될 수 있다. 상기 제형은 일 예로 멸균수에 용해보조제, 유화제, pH 조절을 위한 완충제 등을 첨가하여 제조할 수 있다. 상기 비수성용제 또는 현탁용제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌글리콜 (polyethylene glycol), 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
필요에 따라, 압타머는 콜로이드성 약물 전달 시스템 (예를 들면, 리포솜, 알부민 마이크로구체, 마이크로에멀젼, 나노-입자 및 나노캡슐) 또는 마크로에멀젼 내의, 예를 들어 코아세르베이션 기술 또는 계면 중합에 의해 제조된 마이크로캡슐, 예를 들어 히드록시메틸셀룰로스 또는 젤라틴-마이크로캡슐 및 폴리-(메틸메타크릴레이트) 마이크로캡슐 각각 내에 포획될 수 있다. 이러한 기술은 관련 기술분야에 공지되어 있다.
본 발명에 따른 약학 조성물의 투여는 약제학적으로 유효한 양을 투여할 수 있다. "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 예방 또는 치료하기에 충분한 양을 의미한다. 유효 용량 수준은 제제화 방법, 환자의 상태 및 체중, 환자의 성별, 연령, 질환의 정도, 약물형태, 투여경로 및 기간, 배설 속도, 반응 감응성 등과 같은 요인들에 따라 당업자에 의해 다양하게 선택될 수 있다. 유효량은 당업자에게 인식되어 있듯이 처리의 경로, 부형제의 사용 및 다른 약제와 함께 사용할 수 있는 가능성에 따라 변할 수 있다. 그러나, 바람직한 효과를 위해서, 경구 투여제의 경우 일반적으로 성인에게 1일에 체중 1 kg당 본 발명의 조성물을 1일 0.0001 내지 100 ㎎/㎏으로, 바람직하게는 0.001 내지 100 ㎎/㎏으로 투여할 수 있으나, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
그리고 상기 약학 조성물은 비경구 투여 형태로 제형화될 수도 있는데, 이러한 경우 피하주사, 정맥주사, 근육 내 주사 또는 흉부 내 주사 등의 비경구 투여 방법에 의해 투여된다. 이때, 상기 비경구 투여용 제형으로 제제화하기 위하여, 상기 약학 조성물은 유효 성분, 즉, 화학식 I의 유도체 또는 이의 약학적으로 허용 가능한 염이 안정제 또는 완충제와 함께 물에서 혼합되어 용액 또는 현탁액으로 제조되고, 이러한 용액 또는 현탁액이 앰플 또는 바이알의 단위 투여형으로 제조될 수 있다.
또한, 상기 약학 조성물은 멸균되거나, 방부제, 안정화제, 수화제 또는 유화 촉진제, 삼투압 조절을 위한 염 및/또는 완충제 등의 보조제를 더 포함할 수도 있고, 기타 치료적으로 유용한 물질을 더 포함할 수도 있으며, 혼합, 과립화 또는 코팅의 통상적인 방법에 따라 제제화될 수 있다.
본 발명의 약학 조성물의 투여 대상은 인간을 포함하는 포유류일 수 있으며, 바람직하게는 설치류, 또는 인간일 수 있다.
한편, 본 발명에 따른 압타머는 포도당을 효과적으로 흡수할 수 있는 바, 본 발명은 또 다른 형태로써 상기한 압타머를 유효 성분으로 포함하는 혈당 강하제를 추가로 제공할 수 있다.
이때, 더욱 바람직하게는 상기 혈당 강하제는 즉각적인 효과를 부여하기 위하여 피하주사(Subcutaneous injection)를 통해 투여될 수 있다.
본 발명은 상기한 압타머를 이를 필요로 하는 대상체에게 투여하는 단계를 포함하는 대사성 질환 또는 암에 대한 예방 또는 치료방법을 제공한다.
본 발명은 대사성 질환 또는 암의 예방 또는 치료에 사용하기 위한 상기 언급된 압타머를 포함하는 조성물을 제공한다.
본 발명은 대사성 질환 또는 암의 치료를 위한 약제의 제조에 있어 상기 언급한 압타머의 용도를 제공한다.
또 다른 측면에서, 본 발명은 상기한 압타머를 유효 성분으로 함유하는 당뇨병 또는 당뇨 합병증 진단용 조성물을 제공한다.
본 발명에 따른 진단용 조성물은 생물학적 시료와 반응함으로써 이용될 수 있다. 해당 반응에 의해 생물학적 시료에 본 발명에 따른 압타머가 IGF-1 수용체에 결합하게 되는데, 이때 본 발명에 따른 압타머의 결합 정도가 정상 시료에 비해 높은 경우, 당뇨병 또는 당뇨 합병증인 것으로 진단될 수 있다.
상기 생물학적 시료에서 본 발명에 따른 압타머의 결합 정도는 관련 기술분야에서 통상적으로 사용되는 DNA 압타머 결합 측정 기술을 이용하여 수행될 수 있으며, 예컨대 압타머 말단에 형광 또는 방사성 물질을 표지하여 형광 또는 방사성 세기를 측정하거나, 이미지화하여 관찰하는 방법 등을 이용할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 따른 압타머는 IGF-1 수용체의 인산화를 촉진시켜 포도당 흡수를 증가시키면서도 IGF-1 수용체의 대사 기능만을 선택적으로 유도하는 Biased Agonist로서 기능할 수 있다. 또한, 세포분열을 촉진하지 않아 기존 IGF-1 투여에 의한 과도한 세포분열에 따른 당뇨성 망막병증의 유발 또는 암 발생을 해소할 수 있다.
도 1은 본 발명에 따른 IGF1R-038 및 IGF1R-062 압타머의 서열을 나타낸 것이다.
도 2는 본 발명에 따른 IGF1R-038 및 IGF1R-062 압타머에 의한 IGF-1 수용체 인산화 여부를 확인한 결과이다.
도 3은 본 발명에 따른 IGF1R-038 압타머에 의한 IGF-1 수용체, AKT 및 ERK의 인산화 여부를 확인한 결과이다.
도 4는 본 발명에 따른 IGF1R-038 압타머에 의한 IGF-1의 활성 저해 효과를 확인한 결과이다.
도 5는 본 발명에 따른 IGF1R-038 압타머의 농도에 따른 포도당 흡수를 확인한 결과이다.
도 6은 MCF-7 세포에 IGF-1 및 본 발명에 따른 IGF1R-038 각각을 단독으로 처리하였을 때 세포 성장에 미치는 영향을 확인한 결과이다.
본 발명의 이해를 돕기 위하여 실시예를 제시한다. 하기의 실시예, 실험예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
항체 및 시약의 준비
인간 IGF-1 수용체 단백질은 R&D system (Minneapolie, MN)에서 구입해서 사용하였다. 사용된 압타머는 ㈜압타머사이언스을 통해 합성되었다. 웨스턴 블랏시 사용한 항체는 다음과 같다: Anti-phosphor-IGF-1R (Y1135), Anti-IGF-1R, Anti-phosphor-ERK (T202/Y204), Anti-phosphor-AKT (S473), Anti-phosphor-AKT (T308), Anti-actin은 셀 시그날링 (Cell signaling; Beverly, MA)에서 구입하였다. Anti-phosphor-IGF-1R (Y1135/Y1136)은 인비트로젠 (Invitrogen; Carlsbad, CA)에서 구입하였다.
세포 배양
CHO 세포, MCF-7 세포, L6 근원세포(myoblast cell)는 아메리칸 타입 컬튜어 콜렉션 (American Type Culture Collection; Manassas, VA, USA)로부터 구입하였다. 293F 세포는 터모 사이언티픽 (Thermo scientific)으로부터 구입하였다. MCF-7와 293F, Rat-1/hIR은 10% FBS(fetal bovine serum, Gibco), 페니실린 100 units/㎖ 및 스트렙토마이신 100 units/㎖가 보충된 DMEM(Dulbecco's modified Eagle's medium, Lonza)에서 37℃ 및 5% CO2조건하에서 배양하였다. L6 근원세포는 10% 소 혈청 (Gibco), 페니실린 100 units/㎖ 및 스트렙토마이신 100 units/㎖가 보충된 Alpha MEM(WELGEN)에서 37℃ 및 5% CO2조건하에서 배양하였다.
실시예 1. IGF-1 수용체 압타머 발굴
SELEX를 사용해 인슐린 수용체의 세포외 영역에 결합하는 압타머들을 발굴하였다. 40mer의 가변서열과 양쪽에 20mer씩 존재하는 불가변 서열로 구성된 단일가닥의 DNA 라이브러리(서열번호 3)를 사용하여 SELEX를 진행하였다.
1.1 변형 핵산 라이브러리 합성
SELEX에 필요한 단일 사슬 변형 DNA 라이브러리를 제조하기 위하여 5'에 바이오틴(biotin)이 결합된 안티센스 라이브러리 (서열번호 3)를 합성하였다. 안티센스 라이브러리를 0.5 mM의 dNTP(ATP, GTP, CTP, Bz-dU), 0.25U/㎕의 KOD XL(Invitrogen), 10X extension buffer(1.2M Tris-HCl pH7.8, 100 mM KCl, 60 mM (NH4)2SO4, 70 mM MgSO4, 1% TritonX-100, 1㎎/㎖ BSA)상에서 70℃ 1시간 동안 50μM의 역방향 프라이머 (서열번호 4)와 반응시켜 이중 나선 DNA를 제조하였다. 여기에 20 mM NaOH를 이용하여 단일 사슬 변형 DNA 라이브러리를 용출한 뒤 HCL 용액으로 중화하였다. 제조된 DNA 라이브러리는 Amicon ultra-15(Millipore)를 이용하여 농축한 뒤 UV 분광광도계(spectrophotometer)로 정량하였다.
1.2 IGF-1 수용체와 결합
상기 합성된 라이브러리 1nM을 선택 완충액(selection buffer)(200 mM HEPES, 510 mM NaCl, 25 mM KCl, 25 mM MgCl2)에 넣고 95℃, 70℃, 48℃, 37℃에서 각각 5분간 반응시킨 후, 음성 선택(Negative selection)을 위하여 10X 단백질 경쟁 완충액(protein competition buffer)(10μM prothrombin, 10μM casein, 0.1%(w/v) HSA (human serum albumin, SIGMA) 10㎕를 혼합한 뒤, 상층액이 제거된 Dynabeads® MyOne™ Streptavidin C1(SA bead)(50%(v/v) slurry, 10 ㎎/㎖ Invitrogen)에 첨가하여 37℃에서 10분간 반응시켰다.
음성 선택 반응 후, 상층 액만을 취하여 새로운 튜브에 옮긴 후, 히스 태그(His tag)가 결합된 IGF-1 수용체 단백질과 결합시킨 Dynabead TALON에 37℃에서 1시간 동안 반응시켰다. 100㎕으로 선택 완충액(200 mM HEPES, 510 mM NaCl, 25 mM KCl, 25 mM MgCl2) DNA와 IGF-1 수용체와 결합한 Dynabeads TALON를 5번 세척하였다. 5번째 세척 시에는 새로운 플레이트에 옮겨 세척하였다. 2 mM NaOH 용액 85㎕를 첨가하여 표적에 결합하는 라이브러리를 용출한 뒤 8 mM HCl 용액 20㎕로 중화하였다.
1.3 증폭
표적에 결합하는 라이브러리 DNA를 QPCR(quantitative PCR, IQ5 multicolor real time PCR detection system, Bio-rad)을 이용하여 증폭하였다. 앞서 라이브러리 제조에 사용된 역방향 프라이머 (서열번호 4)와 안티센스 라이브러리 (서열번호 3)를 각각 5 μM (5 X QPCR master Mix, Novagen), 0.075 U/㎕ KOD(Novagen), 1 mM dNTP(Roche Applied science), 25 mM MgCl2, 5X SYBRgreenⅠ(Invitrogen)의 총 부피가 125㎕가 되도록 혼합하여, 96℃ 15초, 55℃ 10초, 68℃ 30분 조건으로 1회, 그리고 96℃ 15초, 72℃ 1분 조건으로 30회 반복하여 이중 가닥 라이브러리를 제조하였다.
1.4 eDNA 제조
eDNA는 enzymatic DNA로 DNA 주형과 폴리머라제를 이용해 생산한 압타머를 의미한다. 상기 QPCR을 통하여 만들어진 DNA 라이브러리를 25㎕ Myone SA bead(Invitrogen)에 상온에서 10분간 혼합하여 고정하였다. 이때 혼합된 DNA 양은 QPCR product로 60㎕로 하였다. 20 mM NaOH 용액을 첨가하여 단일 가닥 DNA로 만들어주었다. 그리고 실시예 1.1의 라이브러리 제조와 같은 방법으로 변형된 핵산을 포함하는 DNA를 합성하여 다음 회차에 사용하였다. SELEX round는 총 8회 수행하였고 보다 선택적인 결합을 위하여 4회부터 6회까지 그리고 7회부터 8회까지 각각 DNA와 단백질 (IntegrinαVβ3) 복합체를 10mM DxSO4(sigma)용액에 1/200, 1/400로 희석하여 DNA 압타머를 선별하였다.
1.5 압타머 염기서열 분석
8번의 SELEX round를 거친 후 그 결과물을 QPCR 방법으로 이중 가닥 DNA로 증폭한 뒤, QIAquick PCR Purification Kit (QIAGEN)으로 정제하였다. Illumina NextSeq500을 사용하여 150 Paired end read 형식으로 DNA 서열을 분석하였다.
실험예 1. IGF-1 수용체 압타머의 인산화 평가
1.1 웨스턴 블롯
압타머를 처리하기 전, 혈청 결핍을 위해 세포를 FBS가 없는 DMEM에 3시간 동안 처리하였다. 모든 압타머는 정확한 2차구조 형성을 위해 95℃에서 5분 동안 가열하여 상온서 천천히 식히는 과정을 거쳤다. 압타머는 1시간 동안 Krebs-Ringer HEPES buffer [25 mM HEPES (pH 7.4), 120 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 1.3 mM CaCl2, and 1.3 mM KH2PO4] 조건에서 세포에 처리하였다.
압타머 처리가 끝난 세포는 용해완충용액[50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 20 mM NaF, 10 mM β-glycerophosphate, 2 mM Na3VO4, 1 mM PMSF, 10% glycerol, 1% Triton-X, and protease inhibitor cocktails]에 세포를 용해시켰다. 세포 용해물은 95℃에서 14,000 rpm으로 15분 동안 원심 분리하여 단백질을 분리해 내었다.
준비된 세포 용해물은 6%~16% SDS-PAGE 상에서 전기영동하였고, 니트로셀룰로오스 막(Nitrocellulose membrane)에 옮겨졌다. 막에 1차 항체를 4℃에서 12시간 동안 반응시킨 후, IRDye800CW(LI-COR)가 결합된 2차 항체를 상온에서 1시간 동안 반응시켰다. 단백질의 존재 및 인산화 정도는 Infrared fluorescence system(Odyssey, LI-COR)를 이용해 측정되었다.
1.2 IGF-1 수용체 인산화
실시예 1의 IGF1R-038 압타머 및 IGF1R-062 압타머가 IGF-1 수용체의 인산화에 미치는 영향을 알아보기 위하여, IGF-1, IGF1R-038 압타머 및 IGF1R-062 압타머를 처리할 경우 IGF-1 수용체의 인산화 정도를 상기 기재된 웨스턴 블롯팅법을 이용하여 관찰하였다.
도 2에 나타낸 바와 같이, IGF-1 수용체 카이네이즈 영역의 Y1135/Y1136에서의 인산화는 IGF1R-038 및 IGF1R-062 압타머 처리군 모두에서 증가한 것으로 나타났다.
본 실험 결과를 통해 확인할 수 있는 바와 같이, IGF1R-062 압타머는 IGF1R-038 압타머에 비해 1개의 염기가 더 추가되었으나 활성에는 두 개의 압타머 간에 차이가 확인되지 않은 관계로 두 압타머는 유사한 작용을 할 것이라 판단된다. 따라서, 하기에서는 대표적으로 IGF1R-038 압타머에 대해서만 추가실험을 진행하였다.
1.3 신호전달 단백질의 인산화
실시예 1의 IGF1R-038 압타머에 의한 Y1135 인산화가 IGF-1 신호전달에 어떠한 영향을 미치는지 IGF-1과 비교하였다.
도 3에 나타낸 바와 같이, IGF1R-038 압타머는 IGF-1에 비견할 만한 신호전달을 활성화시켰다. IGF-1(10 nM)이 처리된 293F 세포에서 IGF-1 수용체와 AKT, ERK 등의 단백질의 인산화는 5분 동안 빠르게 증가하였고, 시간이 지남에 따라 점차 감소하였다. IGF-1과는 대조적으로 IGF1R-038 압타머(250 nM)는 AKT(S473)의 인산화를 1시간에 걸쳐 천천히 증가시켰고, 인산화는 1시간 동안 지속되었다. 또한, IGF1R-038 압타머(250 nM)는 ERK의 인산화에는 아무런 영향을 미치지 않았다. 이와 같이, IGF1R-038 압타머는 IGF-1 수용체의 신호전달을 활성화하지만, IGF-1에 의한 신호전달과는 확연히 다른 특성을 가진다.
실험예 2. IGF-1 수용체 압타머의 IGF-1 활성 저해 평가
압타머를 처리하기 전, 혈청 결핍을 위해 세포를 FBS가 없는 DMEM에 3시간 동안 처리하였다. 모든 압타머는 정확한 2차구조 형성을 위해 95℃에서 5분 동안 가열하여 상온서 천천히 식히는 과정을 거쳤다. 400 nM의 IGF1R-038 압타머를 IGF-1과 함께 10분 동안 Krebs-Ringer HEPES buffer [25 mM HEPES (pH 7.4), 120 mM NaCl, 5 mM KCl, 1.2 mM MgSO4, 1.3 mM CaCl2, and 1.3 mM KH2PO4] 조건에서 세포에 처리하였다.
압타머 처리가 끝난 세포는 용해완충용액[50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 20 mM NaF, 10 mM β-glycerophosphate, 2 mM Na3VO4, 1 mM PMSF, 10% glycerol, 1% Triton-X, and protease inhibitor cocktails]에 세포를 용해시켰다. 세포 용해물은 95℃에서 14,000 rpm으로 15분 동안 원심 분리하여 단백질을 분리해 내었다.
준비된 세포 용해물은 6%~16% SDS-PAGE 상에서 전기영동하였고, 니트로 셀룰로오스 막(Nitrocellulose membrane)에 옮겨졌다. 막에 1차 항체를 4℃에서 12시간 동안 반응시킨 후, IRDye800CW(LI-COR)가 결합된 2차 항체를 상온에서 1시간 동안 반응시켰다. 단백질의 존재 및 인산화 정도는 Infrared fluorescence system(Odyssey, LI-COR)를 이용해 측정되었다.
도 4에 나타낸 바와 같이, IGF1R-038 압타머를 IGF-1과 혼합하여 처리한 경우, IGF-1의 효과를 저해하였음을 확인하였다. 이는 IGF1R-038 압타머가 IGF-1과 경쟁적으로 결합함에 따른 결과로 판단된다. 이러한 결과는, IGF1R-038 압타머는 IGF-1의 활성을 저해하면서, 압타머 자체적 효과를 유지하는 것으로써 IGF1R-038 압타머가 편향적 저해제로 작용하였음을 보여주는 결과인 것이다.
실험예 3. IGF-1 수용체 압타머의 포도당 흡수 평가
상기 실험예 2를 통해 IGF1R-038 압타머가 AKT(S473)의 인산화를 증가시켰으므로 포도당 흡수에 대한 IGF1R-038 압타머의 활성을 L6 근원세포에서 확인하고자 하였다.
이를 위하여, L6 근원세포에서 혈청 결핍을 위해 FBS가 없는 DMEM에 1시간 동안 처리한 후, 1시간 동안 Krebs-Ringer HEPES 완충용액으로 처리하였다. IGF-1 혹은 압타머를 농도별(IGF-1: 0.73 nM, 3.12 nM, 12.5 nM, 50 nM, 200 nM; IGF1R-038: 25 nM, 50 nM, 100 nM, 200 nM)로 처리한 후, 2-deoxy[14C]glucose(0.1 μCi/ml)를 10분 동안 처리하였다. 20 mM 포도당이 첨가된 PBS로 3번을 씻어내고 0.5 N NaOH과 1% SDS가 포함된 용액으로 세포를 녹여내었다. 액체 섬광 계수기(Liquid scintillation counter)를 사용하여 세포내로 흡수된 포도당(2-Deoxy-D-glucose)의 양을 관찰하였다.
도 5에 나타낸 바와 같이, IGF1R-038 압타머는 인슐린 및 IGF-1 투여군과 비견될 정도의 포도당 흡수 정도를 나타냈다. 특히, IGF1R-038 압타머 100 nM 이상의 처리군에서는 인슐린 200nM 처리군과 비교하여 더 높은 수준의 포도당 흡수 정도를 나타냄을 확인한바, IGF1R-038 압타머가 혈당 강하를 위한 이용목적에 적합한 것으로 판단되었다.
실험예 4. 암세포 성장 유도 여부
IGF-1 수용체에 의한 세포 분열 유도 능력을 실험하는 데 폭넓게 사용되는 MCF-7 암세포주를 이용하여 IGF1R-038 압타머가 세포 분열에 미치는 영향을 조사하였다.
이를 위하여, MCF-7 세포를 24-well plate에 well당 10,000개씩 분주한 후 24시간 동안 배양하였으며, 혈청 결핍을 위하여 0.5% FBS DMEM에서 추가적으로 24시간 동안 배양하였다. 상기 세포에 IGF-1 및 IGF1R-038을 각각 단독으로 72시간 동안 처리하였으며 24시간마다 배지를 새롭게 교체해주었다. 처리가 끝난 다음에는 세포를 4% paraformaldehyde가 포함된 PBS를 이용하여 상온에서 30분 동안 고정시켰다. 이후, 세포가 가진 DNA를 1μM SYTO60 형광색소가 포함된 PBS로 염색시키고 LI-COR Odyssey 스캐너를 이용하여 형광을 측정함으로써 세포의 양을 정량하였다.
도 6에 나타낸 바와 같이, MCF-7 세포에 IGF-1을 처리한 경우에는 세포 분열이 1.85배 증가하였지만, IGF1R-038을 처리한 경우에는 세포 성장이 억제되었다. 이는 IGF1R-038의 신호 전달이 IGF-1 수용체에 의한 세포 분열 유도에 영향을 미치지 않음을 의미한다. 즉, IGF1R-038 압타머의 처리를 통해 세포 분열에 대한 부작용이나 문제 없이 치료 효능을 나타낼 수 있음을 확인하였다. 또한, 암세포 성장 또한 억제하여 암 치료제로 활용 가능성이 있음을 확인하였다.

Claims (21)

  1. 서열번호 1 또는 서열번호 2를 포함하는 IGF-1 수용체에 특이적으로 결합하는 IGF-1 수용체 압타머(aptamer).
  2. 제1항에 있어서, 상기 압타머는 IGF-1 수용체의 Y1135 또는 AKT S473을 인산화하는 것인, IGF-1 수용체 압타머(aptamer).
  3. 제1항에 있어서, 서열번호 1 또는 서열번호 2로 이루어진 IGF-1 수용체에 특이적으로 결합하는 IGF-1 수용체 압타머(aptamer).
  4. 제1항에 있어서, 서열번호 1의 N기는 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine인 IGF-1 수용체에 특이적으로 결합하는 IGF-1 수용체 압타머(aptamer).
  5. 제1항에 있어서, 서열번호 2의 N기는 5-[N-(1-naphthylmethyl)carboxamide]-2'-deoxyuridine인 IGF-1 수용체에 특이적으로 결합하는 IGF-1 수용체 압타머(aptamer).
  6. 제1항에 있어서 서열번호 1 또는 서열번호 2의 서열은 서열번호 3 또는 서열번호 4인 IGF-1 수용체에 특이적으로 결합하는 IGF-1 수용체 압타머(aptamer).
  7. 제1항에 있어서, 상기 압타머는 이량체(dimer) 또는 다량체(multicmer)로 존재하는 것인, IGF-1 수용체 압타머(aptamer).
  8. 제1항 내지 제7항으로 이루어진 군으로부터 선택되는 어느 한 항의 압타머를 포함하는 IGF-1 수용체 작용체(agonist).
  9. 제1항 내지 제7항으로 이루어진 군으로부터 선택되는 어느 한 항의 압타머를 포함하는 대사성 질환 또는 암의 예방 또는 치료용 약학 조성물.
  10. 제9항에 있어서, 상기 대사성 질환은 당뇨병, 특발성 1형 당뇨병, 성인에서 잠복성 자가면역 당뇨병, 조기 발병 2형 당뇨병, 연소자 발병 비정형 당뇨병, 연소자의 성인 발병 당뇨병, 영양실조-관련된 당뇨병, 임신성 당뇨병, 고혈당증, 인슐린 내성, 간 인슐린 내성, 내당능 장애, 당뇨병성 신경병증, 당뇨병성 신증, 신장 질환, 당뇨병성 망막증, 지방세포 기능장애, 내장 지방 축적, 수면 무호흡증, 비만, 섭식 장애, 이상지질혈증 및 비알코올성 지방간질환 중 선택되는 어느 하나인, 약학 조성물.
  11. 제9항에 있어서, 상기 암은, IGF 수용체의 발현이 높은 암인, 약학 조성물.
  12. 제9항에 있어서, 상기 암은, 유잉육종(Ewing sarcoma), 횡문근육종(Rhabdomyosarcoma), 다발성 골수종(multiple myeloma), 임파종(lymphoma), 백혈병(leukemia), 유방암, 폐암, 전립선암, 췌장암, 직장암, 결장암, 대장암, 자궁경부암 및 담도암으로 이루어진 군으로부터 선택되는 어느 하나인, 약학 조성물.
  13. 치료학적으로 유효한 양의 서열번호 1 또는 서열번호 2를 포함하는 IGF-1 수용체 압타머(aptamer)를 이를 필요로 하는 개체에게 투여하는 단계를 포함하는 대사성 질환 또는 암의 예방 또는 치료 방법.
  14. 제13항에 있어서, 상기 대사성 질환은 당뇨병, 특발성 1형 당뇨병, 성인에서 잠복성 자가면역 당뇨병, 조기 발병 2형 당뇨병, 연소자 발병 비정형 당뇨병, 연소자의 성인 발병 당뇨병, 영양실조-관련된 당뇨병, 임신성 당뇨병, 고혈당증, 인슐린 내성, 간 인슐린 내성, 내당능 장애, 당뇨병성 신경병증, 당뇨병성 신증, 신장 질환, 당뇨병성 망막증, 지방세포 기능장애, 내장 지방 축적, 수면 무호흡증, 비만, 섭식 장애, 이상지질혈증 및 비알코올성 지방간질환 중 선택되는 어느 하나인, 치료 방법.
  15. 제13항에 있어서, 상기 암은, 유잉육종(Ewing sarcoma), 횡문근육종(Rhabdomyosarcoma), 다발성 골수종(multiple myeloma), 임파종(lymphoma), 백혈병(leukemia), 유방암, 폐암, 전립선암, 췌장암, 직장암, 결장암, 대장암, 자궁경부암 및 담도암으로 이루어진 군으로부터 선택되는 어느 하나인, 치료 방법.
  16. 대사성 질환 또는 암의 예방 또는 치료를 위한 의약을 제조하기 위한 서열번호 1 또는 서열번호 2를 포함하는 IGF-1 수용체에 특이적으로 결합하는 IGF-1 수용체 압타머(aptamer)의 용도.
  17. 제16항에 있어서, 상기 대사성 질환은 당뇨병, 특발성 1형 당뇨병, 성인에서 잠복성 자가면역 당뇨병, 조기 발병 2형 당뇨병, 연소자 발병 비정형 당뇨병, 연소자의 성인 발병 당뇨병, 영양실조-관련된 당뇨병, 임신성 당뇨병, 고혈당증, 인슐린 내성, 간 인슐린 내성, 내당능 장애, 당뇨병성 신경병증, 당뇨병성 신증, 신장 질환, 당뇨병성 망막증, 지방세포 기능장애, 내장 지방 축적, 수면 무호흡증, 비만, 섭식 장애, 이상지질혈증 및 비알코올성 지방간질환 중 선택되는 어느 하나인, 용도.
  18. 제16항에 있어서, 상기 암은, 유잉육종(Ewing sarcoma), 횡문근육종(Rhabdomyosarcoma), 다발성 골수종(multiple myeloma), 임파종(lymphoma), 백혈병(leukemia), 유방암, 폐암, 전립선암, 췌장암, 직장암, 결장암, 대장암, 자궁경부암 및 담도암으로 이루어진 군으로부터 선택되는 어느 하나인, 용도.
  19. 대사성 질환 또는 암의 예방 또는 치료에 사용하기 위한 서열번호 1 또는 서열번호 2를 포함하는 IGF-1 수용체 압타머(aptamer)를 포함하는 약학 조성물.
  20. 제19항에 있어서, 상기 대사성 질환은 당뇨병, 특발성 1형 당뇨병, 성인에서 잠복성 자가면역 당뇨병, 조기 발병 2형 당뇨병, 연소자 발병 비정형 당뇨병, 연소자의 성인 발병 당뇨병, 영양실조-관련된 당뇨병, 임신성 당뇨병, 고혈당증, 인슐린 내성, 간 인슐린 내성, 내당능 장애, 당뇨병성 신경병증, 당뇨병성 신증, 신장 질환, 당뇨병성 망막증, 지방세포 기능장애, 내장 지방 축적, 수면 무호흡증, 비만, 섭식 장애, 이상지질혈증 및 비알코올성 지방간질환 중 선택되는 어느 하나인, 약학 조성물.
  21. 제19항에 있어서, 상기 암은, 유잉육종(Ewing sarcoma), 횡문근육종(Rhabdomyosarcoma), 다발성 골수종(multiple myeloma), 임파종(lymphoma), 백혈병(leukemia), 유방암, 폐암, 전립선암, 췌장암, 직장암, 결장암, 대장암, 자궁경부암 및 담도암으로 이루어진 군으로부터 선택되는 어느 하나인, 약학 조성물.
PCT/KR2023/010497 2022-10-14 2023-07-20 Igf-1 수용체 결합 압타머 및 이의 용도 WO2024080509A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220132552 2022-10-14
KR10-2022-0132552 2022-10-14

Publications (1)

Publication Number Publication Date
WO2024080509A1 true WO2024080509A1 (ko) 2024-04-18

Family

ID=90669338

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/010497 WO2024080509A1 (ko) 2022-10-14 2023-07-20 Igf-1 수용체 결합 압타머 및 이의 용도

Country Status (2)

Country Link
KR (1) KR20240053520A (ko)
WO (1) WO2024080509A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101827332B1 (ko) * 2008-12-12 2018-02-09 베링거 인겔하임 인터내셔날 게엠베하 항-ｉｇｆ 항체
KR101881500B1 (ko) * 2015-07-27 2018-07-24 주식회사 포스코 인슐린 수용체 압타머 및 이를 포함하는 약학적 조성물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101827332B1 (ko) * 2008-12-12 2018-02-09 베링거 인겔하임 인터내셔날 게엠베하 항-ｉｇｆ 항체
KR101881500B1 (ko) * 2015-07-27 2018-07-24 주식회사 포스코 인슐린 수용체 압타머 및 이를 포함하는 약학적 조성물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GUODONG WANG: "Selection and characterization of DNA aptamer against glucagon receptor by cell-SELEX", SCIENTIFIC REPORTS, NATURE PUBLISHING GROUP, US, vol. 7, no. 1, US , XP093158181, ISSN: 2045-2322, DOI: 10.1038/s41598-017-05840-w *
KIM KISEOK; LEE SEUNGJIN; RYU SUNGHO; HAN DONGIL: "Efficient isolation and elution of cellular proteins using aptamer-mediated protein precipitation assay", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ELSEVIER, AMSTERDAM NL, vol. 448, no. 1, 24 April 2014 (2014-04-24), Amsterdam NL , pages 114 - 119, XP029021416, ISSN: 0006-291X, DOI: 10.1016/j.bbrc.2014.04.086 *
NA-OH YUNN, ARA KOH, SEUNGMIN HAN, JONG HUN LIM, SEHOON PARK, JIYOUN LEE, EUI KIM, SUNG KEY JANG, PER-OLOF BERGGREN, SUNG HO RYU: "Agonistic aptamer to the insulin receptor leads to biased signaling and functional selectivity through allosteric modulation", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 43, no. 16, 18 September 2015 (2015-09-18), GB , pages 7688 - 7701, XP055350012, ISSN: 0305-1048, DOI: 10.1093/nar/gkv767 *

Also Published As

Publication number Publication date
KR20240053520A (ko) 2024-04-24

Similar Documents

Publication Publication Date Title
KR101620394B1 (ko) 바이러스 감염증을 치료하기 위한 조성물 및 방법
EP3349580B1 (en) Hepatitis b core protein modulators
CN1972696B (zh) 用于治疗rna依赖性rna病毒感染的核苷氨基磷酸芳基酯
JP6043338B2 (ja) 抗ウイルス治療用の１’−置換ピリミジンｎ−ヌクレオシド類似体
JP6012591B2 (ja) β−ＮＧＦに対するアプタマー及びβ−ＮＧＦ介在疾患及び障害の治療におけるその使用
US20210317457A1 (en) Antisense oligonucleotide (aso) molecules and uses thereof for coronavirus diseases
US20220227776A1 (en) Prodrugs of 1'-substituted carba-nucleoside analogues for antiviral treatment
AU2016213880B2 (en) Combination of cytidine-based antineoplastic drugs with cytidine deaminase inhibitor and use thereof in the treatment of cancer
JP2014040471A (ja) 抗ウイルス処置のための１’−置換カルバ−ヌクレオシドアナログ
KR101881500B1 (ko) 인슐린 수용체 압타머 및 이를 포함하는 약학적 조성물
EP2625184B1 (en) Antidiabetic enolic glucoside of phenylpyruvic acid
WO2014137141A1 (ko) 인터루킨-８ 앱타머 및 이의 용도
CN102058614A (zh) 腺苷受体激动剂在治疗中的用途
WO2024080509A1 (ko) Igf-1 수용체 결합 압타머 및 이의 용도
CN112955216A (zh) 可释放glp-1缀合物
JP2021531277A (ja) Ｓｔｉｎｇアゴニストとしての環状ジヌクレオチド
RU2695358C2 (ru) Соединения для предотвращения и лечения нейродегенеративных заболеваний и боли
WO2020242218A1 (ko) 글루타치온-ｓ-전이효소 및 표적 세포 또는 표적 단백질 결합능을 갖는 단백질을 포함하는 글루타치온 전구체 약물의 전달체 및 이의 용도
JP7402225B2 (ja) ヌクレオシド系逆転写酵素阻害剤を用いて関節障害を処置するための組成物および方法
WO2018190676A1 (ko) 말산-아스파르트산 왕복수송 억제제 및 항암제를 유효성분으로 함유하는 암 예방 및 치료용 약학적 조성물
TW202016302A (zh) 用於調節mir-122之微小rna化合物及方法
WO2013165061A1 (ko) Ｓｃｆ 또는 이의 수용체를 억제하는 물질을 포함하는 혈관 투과성 관련 질환의 치료 또는 예방용 조성물
US20160137685A1 (en) Nucleoside phosphoramidates and phosphoramidites
WO2010064851A2 (ko) 종간 교차활성을 지닌 ｍＴＯＲ을 표적으로 하는 ｓｉＲＮＡ, 이를 포함하는 재조합벡터 및 이를 함유하는 약학조성물
WO2024005240A1 (ko) 인슐린 수용체 결합 압타머 이량체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23877439

Country of ref document: EP

Kind code of ref document: A1