WO2024079662A1 - Constructions d'expression d'upf1 - Google Patents

Constructions d'expression d'upf1 Download PDF

Info

Publication number
WO2024079662A1
WO2024079662A1 PCT/IB2023/060249 IB2023060249W WO2024079662A1 WO 2024079662 A1 WO2024079662 A1 WO 2024079662A1 IB 2023060249 W IB2023060249 W IB 2023060249W WO 2024079662 A1 WO2024079662 A1 WO 2024079662A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence
expression construct
vector
upf1
Prior art date
Application number
PCT/IB2023/060249
Other languages
English (en)
Inventor
Alexandria FORBES
Benjamin C. CAMPBELL
Matthew During
Ce Feng Liu
Alan GRIFFITH
Anastasios GEORGIADIS
Original Assignee
Meiragtx Uk Ii Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Meiragtx Uk Ii Limited filed Critical Meiragtx Uk Ii Limited
Publication of WO2024079662A1 publication Critical patent/WO2024079662A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A01K2267/0318—Animal model for neurodegenerative disease, e.g. non- Alzheimer's
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • RNA metabolism is important for the function and maintenance of neurons and other cell types. RNA binding proteins regulate all aspects of RNA metabolism, including transcription, splicing, transport, translation, and degradation. In keeping with the essential nature of RNA metabolism, deficiencies or abnormalities in RNA binding proteins underlie the neurodegenerative disorders amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).
  • ALS amyotrophic lateral sclerosis
  • FTD frontotemporal dementia
  • the UPF1 (up frameshift 1) gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance.
  • mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon- exon junction, this triggers NMD to degrade mRNAs containing premature stop codons.
  • UPF1 is a RNA helicase involved in NMD.
  • UPF1 was identified through an unbiased screen for proteins that could prevent cell death in a yeast model of ALS/FTD. See Ju et al., A yeast model of FUS/TLS-dependent cytotoxicity. PLoS Biol.
  • UPF1 Docket No.162027.49376 overexpression has been shown to protect against neurodegeneration in animal models of ALS involving TDP-43 and FUS toxicity. See Jackson et al., Preservation of forelimb function by UPF1 gene therapy in a rat model of TDP-43-induced motor paralysis. Gene Ther. 2015 Jan;22(1):20-8. [0006] Accordingly, UPF1 expression constructs with for the treatment of neurogenerative diseases in animals, including humans, are urgently needed.
  • SUMMARY [0007] Provided herein are improved expression constructs for the expression of UPF1, vectors comprising such constructs, and methods of using such constructs and vectors.
  • an expression construct comprising: (a) a promoter; (b) a sequence encoding UPF1, operatively linked to the promoter; and (c) a polyadenylation signal.
  • the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17.
  • the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17.
  • the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs:3-17.
  • the promoter comprises a sequence selected from the group consisting of SEQ ID NOs:3-17. In some embodiments, the promoter comprises a sequence that is at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7. In some embodiments, the promoter comprises a sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7. In some embodiments, the promoter comprises a sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs:5-7. In some embodiments, the promoter comprises a sequence selected from the group consisting of SEQ ID NOs:5-7.
  • the promoter comprises a sequence that is at least 80% identical to SEQ ID NO:7. In some embodiments, the promoter comprises a sequence that is at least 90% identical SEQ ID NO:7. In some embodiments, the promoter comprises the promoter comprises a sequence that is at least 95% identical to SEQ ID NO:7. In one embodiment, the promoter comprises SEQ ID NO:7. [0010] In some embodiments, the sequence encoding the UPF1 protein is codon-optimized. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:19-22.
  • the sequence encoding 2 150336825.1 Docket No.162027.49376 UPF1 comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:19-22. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:19-22. In some embodiments, the sequence encoding UPF1 comprises a sequence selected from the group consisting of any one of SEQ ID NOs:19- 22. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 80% identical to SEQ ID NO:21. In some embodiments, the sequence encoding UPF1 comprises a sequence that is at least 90% identical to SEQ ID NO:21.
  • the sequence encoding UPF1 comprises a sequence that is at least 95% identical to SEQ ID NO:21. In one embodiment, the sequence encoding UPF1 comprises SEQ ID NO:21. [0011] In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 80% identical to SEQ ID NO:38. In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 90% identical to identical to SEQ ID NO:38. In some embodiments, the sequence encoding UPF1 encodes a protein comprising a sequence that is at least 95% identical to identical to SEQ ID NO:38.
  • the sequence encoding UPF1 encodes a protein comprising SEQ ID NO:38.
  • the expression construct further comprises a 5 ⁇ untranslated region (UTR).
  • the 5 ⁇ UTR comprises a sequence that is at least 90% identical to SEQ ID NO:18.
  • the 5 ⁇ UTR comprises a sequence that is at least 95% identical to SEQ ID NO:18.
  • the 5 ⁇ UTR comprises SEQ ID NO:18.
  • the expression construct further comprises a posttranscriptional regulatory element.
  • the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:23-26.
  • the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:23-26. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:23-26. In some embodiments, the posttranscriptional regulatory element comprises any one of SEQ ID NOs:23-26. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:24 or SEQ ID NO:25.
  • the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:24 or SEQ ID NO:25. In some embodiments, wherein the posttranscriptional regulatory element comprises SEQ ID NO:24 or SEQ ID 3 150336825.1 Docket No.162027.49376 NO:25. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 80% identical to SEQ ID NO:24. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 90% identical to SEQ ID NO:24. In some embodiments, the posttranscriptional regulatory element comprises a sequence that is at least 95% identical to SEQ ID NO:24.
  • the posttranscriptional regulatory element comprises SEQ ID NO:24.
  • the expression construct further comprises an miRNA binding site (miRBS) that is at least 80% identical to SEQ ID NO:27.
  • the expression construct comprises an miRBS that is at least 90% identical to SEQ ID NO:27.
  • the expression construct comprises an miRBS that is at least 95% identical to SEQ ID NO:27.
  • the expression construct comprises SEQ ID NO:27.
  • the polyadenylation signal comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:28-30.
  • the polyadenylation signal comprises a sequence that is at least 90% identical to any one of SEQ ID NOs:28-30. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to any one of SEQ ID NOs:28-30. In some embodiments, the polyadenylation signal comprises any one of SEQ ID NOs:28-30. In some embodiments, the polyadenylation signal comprises a sequence that is at least 80% identical to SEQ ID NO:29. In some embodiments, the polyadenylation signal comprises a sequence that is at least 90% identical to SEQ ID NO:29. In some embodiments, the polyadenylation signal comprises a sequence that is at least 95% identical to SEQ ID NO:29.
  • the polyadenylation signal comprises SEQ ID NO:29.
  • the vector is a viral vector.
  • the vector is an AAV vector.
  • the nucleic acid sequence comprises a 5 ⁇ ITR and a 3 ⁇ ITR.
  • the 5 ⁇ ITR and the 3 ⁇ ITR are derived from adeno-associated virus (AAV) serotype AAV2.
  • AAV adeno-associated virus
  • the sequence of the 5 ⁇ ITR is at least 80% identical to any one of SEQ ID NOs:1, 54, or 55. In some embodiments, the sequence of the 5 ⁇ ITR is at least 90% identical to any one of SEQ ID NOs:1, 54, or 55. In some embodiments, the sequence of the 5 ⁇ ITR is at least 95% identical to any one of SEQ ID NOs:1, 54, or 55. In some embodiments, the sequence of the 5 ⁇ ITR comprises any one of SEQ ID NOs:1, 54, or 55. In 4 150336825.1 Docket No.162027.49376 some embodiments, the sequence of the 3 ⁇ ITR is at least 80% identical to SEQ ID NO:2 or SEQ ID NO:56.
  • the sequence of the 3 ⁇ ITR is at least 90% identical to SEQ ID NO:2 or SEQ ID NO:56. In some embodiments, the sequence of the 3 ⁇ ITR is at least 95% identical to SEQ ID NO:2 or SEQ ID NO:56. In some embodiments, the sequence of the 3 ⁇ ITR comprises SEQ ID NO:2 or SEQ ID NO:56. In one embodiment, the 5 ⁇ ITR comprises SEQ ID NO:1 and the 3 ⁇ ITR comprises SEQ ID NO:2. In some embodiments, provided is a vector comprising an expression construct, wherein the vector comprises a sequence that is 80% identical to any one of SEQ ID NOs:32-37.
  • the vector comprises a sequence that is 90% identical to any one of SEQ ID NOs:32-37. In some embodiments, the vector comprises a sequence that is 95% identical to any one of SEQ ID NOs:32-37. In some embodiments, the vector comprises any one of SEQ ID NOs:32-37. In some embodiments, the vector comprises a sequence that is 80% identical to SEQ ID NO:34. In some embodiments, the vector comprises a sequence that is 90% identical to SEQ ID NO:34. In some embodiments, the vector comprises a sequence that is 95% identical to SEQ ID NO:34. In one embodiment, the vector comprises SEQ ID NO:34.
  • the vector comprises a capsid from, or derived from, AAV7m8, AAV9, AAV2-retro, or AAVrh.10. In some embodiments, the vector comprises a capsid comprising capsid proteins from, or derived from, both AAV2- retro and AAVrh.10.
  • a cell comprising an expression construct or a vector disclosed herein.
  • a pharmaceutical composition comprising (i) an expression construct or a vector disclosed herein and (ii) a pharmaceutically acceptable carrier.
  • TDP43 transactive response DNA binding protein 43
  • a method for reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof comprising administering to the subject a vector or a pharmaceutical composition disclosed herein.
  • a method for reducing C9orf72 toxicity in a subject in need thereof comprising administering to the subject a vector or a pharmaceutical composition disclosed herein.
  • FUS/TLS fused in sarcoma/translocated in liposarcoma
  • a method of treating a neurogenerative disease in a subject in need thereof comprising administering to the subject a vector or a pharmaceutical composition disclosed herein.
  • the neurogenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar dementia, Alzheimer’s 5 150336825.1 Docket No.162027.49376 disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam, Huntington’s disease, and myopathy.
  • ALS amyotrophic lateral sclerosis
  • frontotemporal lobar dementia Alzheimer’s 5 150336825.1 Docket No.162027.49376 disease (sporadic and familial)
  • the neurodegenerative diseases is amyotrophic lateral sclerosis (ALS). In one aspect, the neurodegenerative diseases is FTD. In one aspect, provided is a method for treating a neurogenerative disease associated with TDP43 toxicity in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein. In one aspect, provided is a method for treating a neurogenerative disease associated with C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject a vector or a pharmaceutical composition disclosed herein.
  • a method for treating a neurogenerative disease associated with FUS/TLS toxicity in a subject in need thereof comprising administering to the subject a vector or a pharmaceutical composition disclosed herein.
  • a method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof comprising administering to the subject a vector or a pharmaceutical composition disclosed herein.
  • the subject is a human.
  • the vector or the pharmaceutical composition is administered by intra-cisternal administration.
  • TDP43 transactive response DNA binding protein 43
  • a vector or a pharmaceutical composition described herein for use in a method of treating a neurogenerative disease in a subject in need thereof.
  • the neurogenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar dementia, Alzheimer’s disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam, Huntington’s disease, and 6 150336825.1 Docket No.162027.49376 myopathy.
  • ALS amyotrophic lateral sclerosis
  • frontotemporal lobar dementia Alzheimer’s disease (sporadic and familial)
  • dementia with Lewy’s bodies with or without Alzheimer’s disease Down syndrome
  • hippocampal sclerosis dementia familial British dementia
  • the disease is amyotrophic lateral sclerosis (ALS).
  • a vector or a pharmaceutical composition described herein for use in a method of treating a neurogenerative disease associated with TDP43 toxicity in a subject in need thereof.
  • a vector or a pharmaceutical composition described herein for use in a method of treating a neurogenerative disease associated with C9orf72 toxicity in a subject in need thereof.
  • the subject is a human.
  • the vector or the pharmaceutical composition is administered by intra-cisternal administration.
  • a vector or a pharmaceutical composition described herein for the manufacture of a medicament for reducing transactive response DNA binding protein 43 (TDP43) toxicity in a subject in need thereof.
  • TDP43 transactive response DNA binding protein 43
  • a vector or a pharmaceutical composition described herein for the manufacture of a medicament for reducing C9orf72 toxicity in a subject in need thereof.
  • FUS/TLS fused in sarcoma/translocated in liposarcoma
  • the neurogenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal lobar dementia, Alzheimer’s disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam, Huntington’s disease, and myopathy.
  • the neurogenerative disease is amyotrophic lateral sclerosis (ALS).
  • a vector or a pharmaceutical composition described herein for the manufacture of a medicament for treating a neurogenerative disease associated with TDP43 toxicity in a subject in need thereof. 7 150336825.1 Docket No.162027.49376
  • a vector or a pharmaceutical composition described herein for the manufacture of a medicament for treating a neurogenerative disease associated with C9orf72 toxicity in a subject in need thereof.
  • a vector or a pharmaceutical composition described herein for the manufacture of a medicament for treating a neurogenerative disease associated with FUS/TLS toxicity in a subject in need thereof.
  • Figs. 1A and 1B illustrate the expression construct optimization process.
  • Fig. 1A Head-to-head comparison of UPF1 expression levels with different UPF1 construct variants. Western blot data were quantified and plotted relative to the endogenous level. UPF1 expressing constructs were expressed in Neuro2A (N2A) cells for two days by chemical transfection and analyzed by Western blotting. Pop-out frame: y-axis re-plotted to display a subset of samples.
  • N2A Neuro2A
  • Fig. 1B illustrates that the CMVe-JeT (MD)- MVMi promoter (right bars) was more potent than the CAG promoter (left bars) even in the context of other cis-regulatory elements. See Table 1 for more details on the expression constructs shown Figs.1A and 1B. [0027] Figs.2A, 2B, 2C, 2D, 2E, and 2F illustrate the survival of TDP43 M337V iNeurons expressing UPF1 variants at different dose concentrations.
  • TDP43 M337V iNeurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged by semi-automated microscopy. Custom scripts were used to identify neuronal soma and assign a unique identifier to each cell. Neuronal loss was indicated by dissolution or rounding of the cell body, dendritic beading, or loss of fluorescence. The time to death for each cell was used to create cumulative hazard plots displaying the risk of death overtime for neurons in each population. Each line summarizes experiments pooled from 6 technical replicates of at least 4 biological replicates.
  • N number of cells per group, pooled from 6 technical replicates and at least 4 biological replicates.
  • Each line summarizes experiments with an UPF1 variant at a dose concentration and identified by AAV construct number (V), construct name, and multiplicity of infection (MOI) (50, 100, or 250) K.
  • V AAV construct number
  • MOI multiplicity of infection
  • Fig.2A Endpoints from top to bottom: GFP negative control (TDP43 M337V); V3-MeiraA-100 ; V3-MeiraA-250; V1-RKW positive control; GFP healthy control (WT TDP43); V3-MeiraA-50.
  • Fig.2B Endpoints from top to bottom: GFP negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1- RKW positive control; GFP healthy control (WT TDP43); V4-MeiraA-100.
  • Fig.2C GFP negative control
  • V3-MeiraA-100 V3-MeiraA-250
  • V1-RKW positive control GFP healthy control
  • Fig.2C Endpoints from top to bottom: GFP negative control (TDP43 M337V); V4-MeiraB-250; V4-MeiraB-50; V1- RKW positive control; GFP healthy control (WT TDP43); V4-
  • GFP negative control TDP43 M337V
  • V1-RKW positive control V5- UPF1_11-100
  • GFP healthy control WT TDP43
  • V5-UPF1_11-250 V5-UPF1_11-50.
  • Fig. 2D Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6- 50.
  • Fig. 2E Endpoints from top to bottom: GFP negative control (TDP43 M337V); V6-UPF1_6-250; V1-RKW positive control; V6-UPF1_6-100; GFP healthy control (WT TDP43); V6-UPF1_6- 50.
  • 3A, 3B, 3C, 3D, 3E, and 3F illustrate the survival of C9orf72 iNeurons expressing UPF1 variants at different dose concentration.
  • C9orf72 iNeurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged by semi-automated microscopy. Custom scripts were used to identify neuronal soma and assign a unique ID to each cell. Neuronal loss was indicated by dissolution or rounding of the cell body, dendritic beading, or loss of fluorescence. The time to death for each cell was used to create cumulative hazard plots displaying the risk of death overtime for neurons in each population.
  • N number of cells per group, pooled from 6 technical replicates and at least 4 biological replicates.
  • V AAV construct number
  • MOI multiplicity of infection
  • Fig.3A Endpoints from top to bottom: GFP negative control (C9orf72); V3-MeiraA-100; V1-RKW positive control; V3-MeiraA-50; V3- MeiraA-250; GFP healthy control (WT).
  • Fig.3B Endpoints from top to bottom: GFP negative control (C9orf72); V4-MeiraB-100; V1-RKW positive control; V4-MeiraB-250; V4-MeiraB- 50; GFP healthy control (WT).
  • Fig.3C Endpoints from top to bottom: GFP negative control (C9orf72); V5-UPF1_11-250; V1-RKW positive control; V5-UPF1_11-100; V5-UPF1_11-50; GFP healthy control (WT).
  • GFP negative control C9orf72
  • V6-UPF1_6-250 V1-RKW positive control
  • V6-UPF1_6-100 GFP healthy control
  • WT V6-UPF1_6-50.
  • Fig.3E Endpoints from top to bottom: GFP negative control (C9orf72); V7-UPF1_11h-100; V7-UPF1_11h-250; V7-UPF1_11h-50; V1-RKW positive control; GFP healthy control (WT).
  • Fig.3F Endpoints from top to bottom: GFP negative control (C9orf72); V8-UPF1_11i-250; V8-UPF1_11i-100; V1-RKW positive control; V8-UPF1_11i-50; GFP healthy control (WT).
  • Figs. 4A and 4B illustrate the expression of UPF1 variants in patient-derived C9orf72 iPSNs. Fold enrichment of exogenous UPF1 RNA levels in C9Orf72 iPSNs after transduction of each of the UPF1 variant constructs was compared to non-transduced cells, as measured by qRT-PCR. All experiments were conduct with AAV2retro unless specified. Figs.
  • Fig.5. illustrates the expression of UPF1 variants increases motor neuron survival in an FUS-ALS knock-in mouse model.
  • MNs ChAT-positive motor neurons
  • MN-P517L/ ⁇ 14 FUS-ALS knock-in mice
  • ICV intracerebroventricular
  • the expression constructs disclosed herein show enhanced UPF1 expression, thus allowing lower MOIs (multiplicity of infection) of virus to be used clinically.
  • the expression constructs disclosed herein exhibit a decreased size, which allows for improved AAV genome packaging and manufacturing efficiency.
  • an expression construct comprising: (a) a promoter; (b) a sequence encoding UPF1, operatively linked to the promoter; and (c) a polyadenylation signal.
  • operatively linked refers to a first molecule joined to a second molecule, wherein the molecules are so arranged that the first molecule affects the function of the second molecule.
  • the two molecules may or may not be part of a single contiguous molecule and may or may not be adjacent.
  • a promoter is operatively linked to a transcribable polynucleotide molecule if the promoter modulates transcription of the transcribable polynucleotide molecule of interest in a cell.
  • two portions of a transcription regulatory element are operatively linked to one another if they are joined such that the transcription-activating functionality of one portion is not adversely affected by the presence of the other portion.
  • Two transcription regulatory elements may be operatively linked to one another by way of a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operatively linked to one another with no intervening nucleotides present.
  • a linker nucleic acid e.g., an intervening non-coding nucleic acid
  • an expression construct comprising: (a) a promoter; (b) a 5 ⁇ untranslated region (UTR); (c) a sequence encoding UPF1, operatively linked to the promoter; 11 150336825.1 Docket No.162027.49376 (d) a posttranscriptional regulatory element; (e) a miRNA binding site (miRBS); and/or (f) a polyadenylation signal.
  • an expression construct comprising: (a) a promoter; (b) a 5 ⁇ UTR; (c) a sequence encoding UPF1, operatively linked to the promoter; and (d) a polyadenylation signal.
  • an expression construct comprising: (a) a promoter; (b) a sequence encoding UPF1, operatively linked to the promoter; (c) a posttranscriptional regulatory element; and (d) a polyadenylation signal.
  • an expression construct comprising from 5 ⁇ to 3 ⁇ : (a) a promoter; (b) a 5 ⁇ UTR; (c) a sequence encoding UPF1, operatively linked to the promoter; (d) a posttranscriptional regulatory element; (e) a miRBS; and/or (f) a polyadenylation signal.
  • the term “from 5 ⁇ to 3 ⁇ ” refers to the order of the specific genetic elements in a nucleic sequence.
  • the specific genetic elements are linked to one another by way of a linker nucleic acid (e.g., an intervening non-coding nucleic acid).
  • the specific genetic elements are linked to one another with no intervening nucleotides present. In some embodiments, some of the specific genetic elements are linked to one another by way of a linker nucleic acid, while other are linked to one another with no intervening nucleotides present.
  • the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs: 3-17.
  • the expression construct comprises a promoter sequence comprising any one of SEQ ID NOs: 3-17. In some embodiments, the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 12 150336825.1 Docket No.162027.49376 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:5-7. In some embodiments, the expression construct comprises a promoter sequence comprising any one of SEQ ID NOs: 5-7.
  • the expression construct comprises a promoter sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:7.
  • the expression construct comprises a sequence encoding UPF1 that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:19-22.
  • the expression construct comprises any one of SEQ ID NOs:19-22. [0042] In some embodiments, the expression construct comprises a sequence encoding UPF1 that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:21. In some embodiments, the expression construct comprises SEQ ID NO:21.
  • the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:38 or SEQ ID NO:39.
  • the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising SEQ ID NO:38 or SEQ ID NO:39.
  • the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:38.
  • the expression construct comprises a sequence encoding UPF1, wherein the sequence encodes a UPF1 protein comprising SEQ ID NO:38.
  • the expression construct comprises a 5 ⁇ UTR and a 3 ⁇ UTR.
  • the expression construct comprises a 5 ⁇ UTR comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:18.
  • the expression construct comprises a 5 ⁇ UTR comprising SEQ ID NO:18.
  • the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:40-53. In some embodiments, the expression construct comprises any one of SEQ ID NOs:40-53.
  • the expression construct comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:42.
  • the expression construct comprises SEQ ID NO:42.
  • the expression construct comprises a 3 ⁇ UTR comprising a polyadenylation signal and optionally one or more of a posttranscriptional regulatory element and a miRBS.
  • the expression construct comprises a posttranscriptional regulatory element.
  • the expression construct comprises a posttranscriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:23-26.
  • the expression construct comprises a posttranscriptional regulatory element comprising any one of SEQ ID NOs:23-26.
  • the expression construct comprises a posttranscriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:24 or SEQ ID NO:25.
  • the expression construct comprises a posttranscriptional regulatory element comprising SEQ ID NO:24 or SEQ ID NO:25.
  • the expression construct comprises a posttranscriptional regulatory element comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:24.
  • the expression construct comprises a posttranscriptional regulatory element comprising SEQ ID NO:24.
  • the expression construct comprises an miRBS that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:27.
  • the expression construct comprises SEQ ID NO:27.
  • the expression construct comprises a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:28-30.
  • the expression construct comprises a polyadenylation signal comprising any one of SEQ ID NOs:28-30.
  • the expression construct comprises a polyadenylation signal comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:29.
  • the expression construct comprises a polyadenylation signal comprising SEQ ID NO:29.
  • an expression construct comprising from 5 ⁇ to 3 ⁇ : (a) a promoter comprising SEQ ID NO:5; (b) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:21; (c) a posttranscriptional regulatory element comprising SEQ ID NO:25; and (d) a polyadenylation signal comprising SEQ ID NO:28.
  • an expression construct comprising from 5 ⁇ to 3 ⁇ : (a) a promoter comprising SEQ ID NO:5; (b) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:20; (c) a posttranscriptional regulatory element comprising SEQ ID NO:25; and (d) a polyadenylation signal comprising SEQ ID NO:28.
  • an expression construct comprising from 5 ⁇ to 3 ⁇ : (a) a promoter comprising SEQ ID NO:7; (b) a 5 ⁇ UTR comprising SEQ ID NO:18; (c) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:21; (d) a posttranscriptional regulatory element comprising SEQ ID NO:24; and (e) a polyadenylation signal comprising SEQ ID NO:29.
  • an expression construct comprising from 5 ⁇ to 3 ⁇ : (a) a promoter comprising SEQ ID NO:6; (b) a 5 ⁇ UTR comprising SEQ ID NO:18; (c) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:21; 15 150336825.1 Docket No.162027.49376 (d) a posttranscriptional regulatory element comprising SEQ ID NO:24; (e) an miRBS comprising SEQ ID NO:27; and (f) a polyadenylation signal comprising SEQ ID NO:30.
  • an expression construct comprising from 5 ⁇ to 3 ⁇ : (a) a promoter comprising SEQ ID NO:7; (b) a 5 ⁇ UTR comprising SEQ ID NO:18; (c) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:21; (d) a posttranscriptional regulatory element comprising SEQ ID NO:24; and (e) a polyadenylation signal comprising SEQ ID NO:29.
  • an expression construct comprising from 5 ⁇ to 3 ⁇ : (a) a promoter comprising SEQ ID NO:7; (b) a 5 ⁇ UTR comprising SEQ ID NO:18; (c) a sequence encoding UPF1, operatively linked to the promoter, comprising SEQ ID NO:19; (d) a posttranscriptional regulatory element comprising SEQ ID NO:24; and (e) a polyadenylation signal comprising SEQ ID NO:29. [0061] Provided herein are expression constructs comprising the elements recited in Tables 1, 2, 6, and 7.
  • vectors In one aspect, provided are recombinant vectors and their use for the introduction of a transgene or an expression construct into a cell.
  • the recombinant vectors comprise recombinant DNA (or RNA) constructs.
  • the DNA constructs include additional DNA elements, for example, including DNA segments that provide for the replication of the DNA in a host cell and expression of the target gene in target cells at appropriate levels.
  • expression control sequences promoters, enhancers, and the like are selected based on their ability to promote expression of the target gene in the target cell.
  • Vector means a vehicle that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo.
  • vectors include a recombinant plasmid, yeast artificial chromosome (YAC), mini chromosome, DNA mini- circle, or a virus (including virus derived sequences).
  • YAC yeast artificial chromosome
  • a vector may also refer to a virion comprising a nucleic acid to be delivered into a host cell, either in vitro, ex vivo, or in vivo.
  • a vector refers to a virion comprising a recombinant viral genome, wherein the viral genome comprises one or more ITRs and a transgene.
  • the recombinant vector is a viral vector or a combination of multiple viral vectors.
  • a vector comprising any of the expression constructs disclosed herein.
  • Viral vectors for the expression of a target gene in a target cell, tissue, or organism are known in the art and include, for example, an AAV vector, adenovirus vector, lentivirus vector, retrovirus vector, poxvirus vector, baculovirus vector, herpes simplex virus vector, vaccinia virus vector, or a synthetic virus vector (e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and/or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule).
  • AAV vectors [0069] Adeno-associated viruses (AAV) are small, single-stranded DNA viruses which require helper virus to facilitate efficient replication.
  • the 4.7 kb genome of AAV is characterized by two inverted terminal repeats (ITR) and two open reading frames which encode the Rep proteins and Cap proteins, respectively.
  • the Rep reading frame encodes four proteins of molecular weight 78 kD, 68 kD, 52 kD, and 40 kD. These proteins function mainly in regulating AAV replication and rescue and integration of the AAV into a host cell's chromosomes.
  • the Cap reading frame encodes three structural proteins of molecular weight 85 kD (VP1), 72 kD (VP2), and 61 kD (VP3), which form the virion capsid. More than 80% of total proteins in AAV virion comprise VP3.
  • Recombinant adeno-associated virus “rAAV” vectors include any vector derived from any adeno-associated virus serotype. rAAV vectors can have one or more of the AAV wild-type genes deleted in whole or in part, preferably the Rep and/or Cap genes, but retain functional flanking ITR sequences.
  • the viral vector is an rAAV virion, which comprises an rAAV genome and one or more capsid proteins.
  • the rAAV genome comprises an expression construct disclosed herein. 17 150336825.1 Docket No.162027.49376
  • the viral vector disclosed herein comprises a nucleic acid comprising an AAV 5′ ITR and 3′ ITR located 5′ and 3′ of the sequence encoding UPF1 (and the associated 5 ⁇ an 3 ⁇ UTRs), respectively.
  • the nucleic acid may be desirable for the nucleic acid to contain the 5′ ITR and 3′ ITR sequences arranged in tandem, e.g., 5′ to 3′ or a head-to-tail, or in another alternative configuration.
  • the ITRs sequences may be located immediately upstream and/or downstream of the heterologous molecule, or there may be intervening sequences.
  • the ITRs need not be the wild-type nucleotide sequences, and may be altered (e.g., by the insertion, deletion, or substitution of nucleotides) so long as the sequences provide for functional rescue, replication, and packaging.
  • the ITRs may be selected from AAV2, or from among the other AAV serotypes, as described herein.
  • a vector comprising a nucleic acid sequence comprising (i) an expression construct disclosed herein and (ii) one or more inverted terminal repeats (ITR).
  • the nucleic acid sequence comprises a 5 ⁇ ITR and a 3 ⁇ ITR.
  • the 5 ⁇ ITR and a 3 ⁇ ITR are derived from adeno-associated virus (AAV) serotype AAV2.
  • AAV adeno-associated virus
  • the 5′ ITR sequence comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:1, 54, or 55.
  • the 5′ ITR sequence comprises any one of SEQ ID NOs:1, 54, or 55.
  • the 3′ ITR sequence comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:2 or SEQ ID NO:56.
  • the 3′ ITR sequence comprises SEQ ID NO:2 or SEQ ID NO:56.
  • a vector comprising a nucleic acid sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of SEQ ID NOs:32-37.
  • a vector comprising a nucleic acid sequence any one of SEQ ID NOs:32-37.
  • a vector comprising a nucleic acid sequence comprising a sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 18 150336825.1 Docket No.162027.49376 98%, or at least 99% identical to SEQ ID NO:34.
  • a vector comprising a nucleic acid sequence comprising SEQ ID NO:34.
  • the viral vector is an AAV vector, such as an AAV1 (i.e., an AAV containing AAV1 ITRs and AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 ITRs and AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 ITRs and AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 ITRs and AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 ITRs and AAV8 capsid proteins), AAV1 (i.e., an
  • the viral vector is a pseudotyped AAV vector, containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype.
  • the pseudotyped AAV is AAV2/9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins).
  • the pseudotyped AAV is AAV2/10 (i.e., an AAV containing AAV2 ITRs and AAV10 capsid proteins).
  • the pseudotyped AAV is AAV2/7m8 (i.e., an AAV containing AAV2 ITRs and AAV7m8 capsid proteins).
  • the AAV vector contains a recombinant capsid protein, such as a capsid protein containing a chimera of one or more of capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh74, AAVrh.8, or AAVrh.10.
  • the capsid is a variant AAV capsid such as the AAV2 variant rAAV2-retro (SEQ ID NO:44 from WO 2017/218842, incorporated herein by reference in its entirety).
  • the AAV vector contains two or more capsid proteins selected from different serotypes.
  • the AAV vector contains rAAV2- retro and AAVrh.10 capsid proteins. In some embodiments, the AAV vector contains rAAV2- retro and AAVrh.10 capsid proteins respectively, in a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50.
  • the AAV vector contains AAVrh.10 and rAAV2-retro capsid proteins, respectively, in a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50. 19 150336825.1 Docket No.162027.49376 [0082] In some embodiments, a mixture of (1) AAV vectors comprising rAAV2-retro and (2) AAV vectors comprising AAVrh.10 is used.
  • a ratio of the (1) AAV vectors comprising rAAV2-retro and (2) AAV vectors comprising AAVrh.10, respectively, of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50 is used.
  • a ratio of the (1) AAV vectors comprising AAVrh.10 and (2) AAV vectors comprising rAAV2-retro, respectively, of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50 is used.
  • Other viral vectors include adenoviral (AV) vectors, for example, those based on human adenovirus type 2 and human adenovirus type 5 that have been made replication defective through deletions in the E1 and E3 regions.
  • AV adenoviral
  • Adenoviral vectors also include helper-dependent high-capacity adenoviral vectors (also known as high- capacity, “gutless” or “gutted” vectors), which do not contain viral coding sequences. These vectors contain the cis-acting elements needed for viral DNA replication and packaging, mainly the inverted terminal repeat sequences (ITR) and the packaging signal (CY). These helper- dependent AV vector genomes have the potential to carry from a few hundred base pairs up to approximately 36 kb of foreign DNA. [0085] Alternatively, other systems such as lentiviral vectors can be used.
  • Lentiviral-based systems can transduce nondividing as well as dividing cells making them useful for applications targeting, for examples, the nondividing cells of the CNS.
  • Lentiviral vectors are derived from the human immunodeficiency virus and, like that virus, integrate into the host genome providing the potential for very long-term gene expression.
  • Polynucleotides, including plasmids, YACs, minichromosomes and minicircles, carrying the target gene containing the expression cassette can also be introduced into a cell or organism by nonviral vector systems using, for example, cationic lipids, polymers, or both as carriers.
  • Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems can also be used to deliver the vector to cells.
  • Other methods for delivering the vector to cells includes hydrodynamic injection and electroporation and use of ultrasound, both for cell culture and for organisms.
  • the rAAV virions disclosed herein may be constructed and produced using the materials and methods described herein, as well as those known to those of skill in the art. Such engineering methods used to construct any embodiment of this disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, “Molecular Cloning. A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory, New York (1989), and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989); and International Patent Publication No.
  • WO 95/13598 Further, methods suitable for producing a rAAV cassette in an adenoviral capsid have been described in U.S. Pat. Nos. 5,856,152 and 5,871,982. [0089] Briefly, in order to package the rAAV genome into a rAAV virion, a host cell is used that contains sequences necessary to express AAV rep and AAV cap or functional fragments thereof as well as helper genes essential for AAV production. The AAV rep and cap sequences are obtained from an AAV source as identified herein.
  • the AAV rep and cap sequences may be introduced into the host cell in any manner known to one in the art, including, without limitation, transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection, and protoplast fusion.
  • the rep and cap sequences may be transfected into the host cell by one or more nucleic acid molecules and exist stably in the cell as an episome.
  • the rep and cap sequences are stably integrated into the genome of the cell.
  • Another embodiment has the rep and cap sequences transiently expressed in the host cell.
  • a useful nucleic acid molecule for such transfection comprises, from 5′ to 3′, a promoter, an optional spacer interposed between the promoter and the start site of the rep gene sequence, an AAV rep gene sequence, and an AAV cap gene sequence.
  • the rep and cap sequences, along with their expression control sequences, may be supplied on a single vector, or each sequence may be supplied on its own vector.
  • the rep and cap sequences are supplied on the same vector.
  • the rep and cap sequences may be supplied on a vector that contains other DNA sequences that are to be introduced into the host cells.
  • the promoter used in this construct may be any suitable constitutive, inducible or native promoters known to one of skill in the art.
  • the molecule providing the rep and cap proteins may be in any form which transfers these components to the host cell.
  • this molecule is in the form of a plasmid, which may contain other non-viral sequences, such as those for marker genes.
  • This molecule does not contain the AAV ITRs and generally does not contain the AAV packaging sequences.
  • This plasmid is desirably constructed so that it may be stably transfected into a cell.
  • the molecule providing rep and cap may be transiently transfected into the host cell, it is preferred that the host cell be stably transformed with sequences necessary to express functional rep/cap proteins in the host cell, e.g., as an episome or by integration into the chromosome of the host cell. Depending upon the promoter controlling expression of such stably transfected host cell, the rep/cap proteins may be transiently expressed (e.g., through use of an inducible promoter).
  • the methods employed for constructing embodiments of this disclosure are conventional genetic engineering or recombinant engineering techniques such as those described in the references above.
  • the rAAV may be produced utilizing a triple transfection method using either the calcium phosphate method (Clontech) or Effectene reagent (Qiagen, Valencia, Calif.), according to manufacturer’s instructions. See, also, Herzog et al, 1999, Nature Medic., 5(1):56-63, for the method used in the following examples, employing the plasmid with the transgene, a helper plasmid containing AAV rep and cap, and a plasmid supplying adenovirus helper functions of E2A, E4Orf6 and VA.
  • the rAAV virions are then produced by culturing a host cell containing a rAAV virus as described herein which contains a rAAV genome to be packaged into a rAAV virion, an AAV rep sequence and an AAV cap sequence under the control of regulatory sequences directing expression thereof.
  • Suitable viral helper genes e.g., adenovirus E2A, E4Orf6 and VA, among other possible helper genes, may be provided to the culture in a variety of ways known to the art, preferably on a separate plasmid. Thereafter, the recombinant AAV virion which directs expression of the UPF1 transgene is isolated from the cell or cell culture in the absence of contaminating helper virus or wildtype AAV. [0094] Expression of the UPF1 transgene may be measured in ways known in the art. For example, a target cell may be infected in vitro, and the number of copies of the transgene in the cell monitored by Southern blotting or quantitative polymerase chain reaction (PCR).
  • PCR quantitative polymerase chain reaction
  • RNA expression may be monitored by Northern blotting or quantitative reverse transcriptase (RT)-PCR; and the level of protein expression may be monitored by Western blotting, 22 150336825.1 Docket No.162027.49376 immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) or by the specific methods detailed below in the Examples.
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • Formulations of the vectors disclosed herein involve the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels.
  • a pharmaceutically and/or physiologically acceptable vehicle or carrier such as buffered saline or other buffers, e.g., HEPES
  • the vector of the disclosure can be formulated into pharmaceutical compositions. These compositions may comprise, in addition to the vector, a pharmaceutically and/or physiologically acceptable excipient, carrier, buffer, stabilizer, antioxidants, preservative, or other additives well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may be determined by the skilled person according to the route of administration.
  • the pharmaceutical composition is typically in liquid form.
  • Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Additional carriers are provided in International Patent Publication No. WO 00/15822, incorporated herein by reference in its entirety.
  • Physiological saline solution, magnesium chloride, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.
  • a surfactant such as pluronic acid (PF68) 0.001% may be used.
  • Ringer's Injection, Lactated Ringer's Injection, or Hartmann's solution is used.
  • Preservatives, stabilizers, buffers, antioxidants and/or other additives may be included, as required.
  • the vector may be included in a pharmaceutical composition which is formulated for slow release, such as in microcapsules formed from biocompatible polymers or in liposomal carrier systems according to methods known in the art.
  • a pharmaceutical composition which is formulated for slow release, such as in microcapsules formed from biocompatible polymers or in liposomal carrier systems according to methods known in the art.
  • the vector If the vector is to be stored long-term, it may be frozen in the presence of glycerol. 23 150336825.1 Docket No.162027.49376
  • Methods of treatment [0103] Provided herein are methods of treating a disease in a subject in need thereof using expression constructs, vectors, and pharmaceutical compositions disclosed herein.
  • the subject is a mammal.
  • mammal as used herein is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals, include, but are not limited to, a human or non-human mammal, such as a bovine, equine, canine, ovine, or feline, etc. Individuals and patients are also subjects herein.
  • the terms “treat,” “treated,” “treating,” or “treatment” as used herein refer to therapeutic treatment, wherein the object is to slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results.
  • beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (i.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of one or more symptoms of the condition, disorder or disease state; and remission (whether partial or total), or enhancement or improvement of the condition, disorder or disease.
  • Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment.
  • the terms “prevent”, “prevention”, and the like refer to acting prior to overt disease or disorder onset, to prevent the disease or disorder from developing or to minimize the extent of the disease or disorder or slow its course of development.
  • neurological diseases such as amyotrophic lateral sclerosis, frontotemporal lobar dementia, other dementias associated with TDP43 and/or FUS/TLS inclusions, including, but not limited to, Alzheimer’s disease (sporadic and familial), dementia with Lewy’s bodies with or without Alzheimer’s disease, Down syndrome, hippocampal sclerosis dementia, familial British dementia), Parkinsonism (including, but not limited to, Parkinson’s disease with and without dementia, Parkinson’s disease with LRKK2 mutation, Perry syndrome with DCTN1 mutation, ALS Parkinsonism–dementia complex of Guam), polyglutamine diseases like Huntington’s disease, and myopathies.
  • Alzheimer’s disease sporadic and familial
  • dementia with Lewy’s bodies with or without Alzheimer’s disease Down syndrome
  • ALS is a progressive neurodegenerative disease distinguished by a specific loss of motor neurons in the brain, brain stem, and spinal cord. Initial symptoms of loss of motor neuron activity, including distal muscle weakness and wasting, increased muscle tone with 24 150336825.1 Docket No.162027.49376 hyperreflexia, and diaphragmatic and/or bulbar weakness are first noticed at an average age of 55. Death occurs from respiratory failure at an average of 4 years after disease onset. ALS exists as both inherited and random forms. While most forms of ALS are sporadic and idiopathic (sALS), about 10% of cases are inherited in a Mendelian fashion and are designated familial ALS (fALS). The present disclosure provides compositions and methods useful in treating ALS.
  • sALS sporadic and idiopathic
  • fALS familial ALS
  • FUS/TLS is a nucleic acid binding protein that, when mutated, can cause a subset of fALS and can also increase risk for the sporadic disease.
  • FUS/TLS is normally located predominantly in the nucleus, pathogenic mutant forms of FUS/TLS traffic to, and form inclusions in, the cytoplasm of affected spinal motor neurons or glia.
  • An intronic GGGGCC repeat expansion in C9ORF72 is a common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).
  • the repeat expansion reduces C9ORF72 expression and C9ORF72-associated activities, triggering neurodegeneration through two mechanisms. First, glutamate receptors accumulate on motor neurons (MNs) and spinal motor neurons in vivo, leading to glutamate-induced excitotoxicity due to neuronal hyperexcitability.
  • GGGGCC GGGGCC n repeat expansion in the C9ORF72 gene.
  • a method of treating a neurological disease including, but not limited to ALS or frontotemporal dementia, the method comprising administering to a subject in need thereof an expression construct, a vector, or a pharmaceutical composition disclosed herein.
  • a method of treating a subject suffering from a neurological disease including, but not limited to ALS or frontotemporal dementia comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein.
  • a method of preventing a neurological disease including, but not limited to ALS or frontotemporal dementia the method comprising administering to a subject in need thereof an expression construct, a vector, or a pharmaceutical composition disclosed herein.
  • a vector, an expression construct, or a pharmaceutical composition described herein in the manufacture of a medicament for preventing a neurological disease including, but not limited to ALS or frontotemporal dementia in a subject in need thereof.
  • treatment refers to partial or complete alleviation, amelioration, relief, inhibition, delaying onset, reducing severity and/or incidence of neurological impairment in a patient suffering from or susceptible to ALS or FTD.
  • the term “neurological impairment” includes various symptoms associated with impairment of the central nervous system (e.g., the brain and spinal cord).
  • Treatment refers to decreased toxicity of various cells or tissues.
  • treatment refers to decreased neuronal toxicity due to FUS/TLS or TDP-43 in brain target tissues, spinal cord neurons, and/or peripheral target tissues.
  • toxicity is decreased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% or more as compared to a control.
  • toxicity is decreased by at least 1-fold, 2-fold, 26 150336825.1 Docket No.162027.49376 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold or 10-fold as compared to a control.
  • toxicity is measured by tests known to those of ordinary skill in the art including, but not limited to, neuroimaging methods (e.g., CT scans, MRI, functional MRI, etc.) [0116]
  • treatment according to the present disclosure results in a reduction (e.g., about a 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 90%, 95%, 97.5%, 99% or more reduction) or a complete elimination of the presence, or alternatively the accumulation, of one or more pathological, clinical, or biological markers that are associated with ALS.
  • a pharmaceutical composition described herein upon administration to a subject, demonstrates or achieves a reduction in muscle loss, muscle twitching, muscle weakness, spasticity, abnormal tendon reflexes, Babinski sign, breathing problems, facial weakness, slurred speech, loss of perception, loss of reasoning, loss of judgment, and/or loss of imagination.
  • treatment refers to increased survival (e.g., survival time). For example, treatment can result in an increased life expectancy of a patient.
  • treatment results in an increased life expectancy of a patient by more than about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, about 170%, about 175%, about 180%, about 185%, about 190%, about 195%, about 200% or more, as compared to the average life expectancy of one or more control individuals with ALS without treatment.
  • treatment results in an increased life expectancy of a patient by more than about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 12 months, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, about 10 years or more, as compared to the average life expectancy of one or more control individuals with ALS without treatment.
  • treatment results in long term survival of a patient.
  • the term “long term survival” refers to a survival time or life expectancy longer than about 40 years, 45 years, 50 years, 55 years, 60 years, or longer.
  • the subject has the potential to develop a neurological disease including, but not limited to ALS.
  • a subject to be treated is genetically predisposed to developing ALS.
  • a subject to be treated has a mutation in a SOD1 27 150336825.1 Docket No.162027.49376 gene, ALS2 gene, VAPB gene, SETX gene, TDP-43 gene, FUS/TLS gene, C9orf72 gene, and/or OPTN gene.
  • a method of treating ALS comprising administering to a subject in need thereof an expression construct, a vector, or a pharmaceutical composition disclosed herein, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS/TLS gene.
  • an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of treating a neurological disease including, but not limited to ALS or one or more symptoms of ALS in a subject in need thereof, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS/TLS gene.
  • an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for treating a neurological disease including, but not limited to ALS or one or more symptoms of ALS in a subject in need thereof, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS/TLS gene.
  • the subject in need of the methods disclosed herein does not have a mutation in the SOD1 gene.
  • Provided herein is a method of reducing TDP43 toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein.
  • an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of reducing TDP43 toxicity in a subject in need thereof.
  • provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for reducing TDP43 toxicity in a subject in need thereof.
  • Provided herein is a method of reducing FUS/TLS toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, vector, or a pharmaceutical composition disclosed herein.
  • an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of reducing FUS/TLS toxicity in a subject in need thereof.
  • provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for reducing FUS/TLS toxicity in a subject in need thereof.
  • Provided herein is a method of reducing C9orf72 toxicity in a subject in need thereof, the method comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein.
  • a method of preventing or delaying the onset or progression of a neurological disease comprising administering to a subject in need thereof an expression construct, a vector, or a pharmaceutical composition disclosed herein, wherein the subject has a mutation in the SOD1 gene, the TDP-43 gene, or the FUS/TLS gene. In embodiments, the subject does not have a mutation in the SOD1 gene.
  • an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of a neurological disease (including neurological diseases disclosed herein such as ALS or FTD) in a subject in need thereof.
  • a method of preventing or delaying the onset or progression of TDP43 toxicity in a subject in need thereof comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein.
  • an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of TDP43 toxicity in a subject in need thereof.
  • a method of preventing or delaying the onset or progression of FUS/TLS toxicity in a subject in need thereof comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein.
  • an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of preventing or delaying the onset or progression of FUS/TLS toxicity in a subject in need thereof.
  • an expression construct, a vector, or a pharmaceutical composition described 29 150336825.1 Docket No.162027.49376 herein in the manufacture of a medicament for preventing or delaying the onset or progression of FUS/TLS toxicity in a subject in need thereof.
  • a method of preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof comprising administering to the subject an expression construct, a vector, or a pharmaceutical composition disclosed herein.
  • an expression construct, a vector, or a pharmaceutical composition described herein for use in a method of preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof.
  • provided is the use of an expression construct, a vector, or a pharmaceutical composition described herein in the manufacture of a medicament for preventing or delaying the onset or progression of C9orf72 toxicity in a subject in need thereof.
  • Combination Therapy [0128]
  • the expression construct or vector described herein is administered to a subject in combination with one or more additional therapies to treat a neurological disease including, but not limited to ALS or one or more symptoms of ALS.
  • an expression construct or a vector described herein for use in a method of treating a neurological disease including, but not limited to ALS or one or more symptoms of ALS in a subject in need thereof.
  • provided is the use of an expression construct or a vector described herein in the manufacture of a medicament for treating a neurological disease including, but not limited to ALS or one or more symptoms of ALS in a subject in need thereof.
  • the expression construct or vector can be administered in combination with riluzole (Rilutek®, Sanofi-Aventis, Bridgewater, N.J.), baclofen, diazepam, trihexyphenidyl, amitriptyline, or sodium phenylbutyrate/taurursodiol (Relyvrio®).
  • riluzole Rostuzole
  • baclofen diazepam
  • trihexyphenidyl amitriptyline
  • sodium phenylbutyrate/taurursodiol Relyvrio®
  • combined administration of the expression construct or vector and a second agent results in an improvement in ALS or a symptom thereof to an extent that is greater than one produced by either the expression construct or vector or the second agent alone.
  • the difference between the combined effect and the effect of each agent alone can be a statistically significant difference.
  • combined administration of the expression construct or vector and a second agent allows administration of the second agent at a reduced dose, at a reduced number of doses, and/or at a reduced frequency of dosage compared to a standard dosing regimen approved for the second agent.
  • a standard dosing regimen approved for the second agent for example, approved standard regimen for 30 150336825.1 Docket No.162027.49376 Rilutek® is 50 mg every 12 hours.
  • a therapeutically effective amount of Rilutek® can be a dosage of less than about 50 mg and/or a frequency of greater than about every 12 hours.
  • an immunosuppressant agent known to the skilled artisan can be administered to a subject in combination with the expression construct or vector described herein.
  • exemplary immunosuppressant agents include, without limitation, cyclosporine, FK506, rapamycin, CTLA4-Ig, anti-TNF agents (such as etanercept), daclizumab (e.g., ZenapaxTM), anti-CD2 agents, anti-CD4 agents, and anti-CD40 agents.
  • Methods of administration include, but are not limited to, intra-cisternamagna, intracerebroventricular, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal, intravaginal, transdermal, rectal, by inhalation, or topical, particularly to the ears, nose, eyes, or skin.
  • the mode of administration is left to the discretion of the practitioner.
  • the expression constructs or vectors disclosed herein can effectively cross the blood brain barrier and enter the brain.
  • expression construct or vector disclosed herein can be delivered using techniques designed to permit or to enhance the ability of the formulation to cross the blood-brain barrier. Such techniques are known in the art (e.g., WO 89/10134; Cloughesy et al., J. Neurooncol.26:125-132 (1995); and Begley, J. Pharm. Pharmacol.48:136-146 (1996)). Components of a formulation can also be modified (e.g., chemically) using methods known in the art to facilitate their entry into the central nervous system (CNS). For example, physical methods of transporting compositions across the blood-brain barrier include, but are not limited to, circumventing the blood-brain barrier entirely, or by creating openings in the blood-brain barrier.
  • Circumvention methods include, but are not limited to, direct injection into the brain (see e.g., Papanastassiou et al., Gene Therapy 9: 398-406 (2002)) and implanting a delivery device in the brain (see e.g., Gill et al., Nature Med. 9: 589-595 (2003); and Gliadel WafersTM, Guildford Pharmaceutical).
  • Methods of creating openings in the barrier include, but are not limited to, ultrasound (see e.g., U.S. Patent Publication No. 2002/0038086), osmotic pressure (e.g., by administration of hypertonic mannitol (Neuwelt, E.
  • Lipid-based methods can also be used to transport an expression construct or vector disclosed herein across the blood-brain barrier.
  • exemplary, nonlimiting methods include encapsulating an expression construct or vector in liposomes that are coupled to a targeting agent (e.g., an antibody that binds to receptors on vascular endothelium of the blood-brain barrier (see, e.g., U.S. Patent Publ. No. 20020025313).
  • a targeting agent is coated in low-density lipoprotein particles (see, e.g., U.S. Patent Publ. No. 20040204354) or apolipoprotein E (see, e.g., U.S. Patent Publ. No.20040131692).
  • the expression construct or vector described herein is delivered to the CNS of a subject, e.g., by administering into the cerebrospinal fluid (CSF) of a subject in need of treatment.
  • intrathecal administration also referred to as intrathecal injection refers to an injection into the spinal canal (intrathecal space surrounding the spinal cord).
  • Various techniques may be used including, without limitation, lateral cerebroventricular injection through a burr hole or cisternal or lumbar puncture or the like. Exemplary methods are described in Lazorthes et al., Adv. Tech. Stand. Neurosurg. 18:143- 192 (1991), and Omaya, Cancer Drug Deliv.1:169-179 (1984).
  • the expression construct or vector described herein is administered locally. This can be achieved, for example, by local infusion during surgery, topical application (e.g., in a cream or lotion), by injection, by means of a catheter, by means of a suppository or enema, or by means of an implant, said implant being of a porous, non- porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • the expression construct or vector described herein is introduced into the central nervous system, circulatory system or gastrointestinal tract by any suitable route, including intraventricular injection, intrathecal injection, paraspinal injection, epidural injection, enema, and by injection adjacent to a peripheral nerve.
  • compositions described herein can be administered as single administrations or as multiple administrations. Such compositions can be administered at regular intervals, depending on the nature, severity and extent of the subject's condition (e.g., ALS).
  • a therapeutically effective amount of the expression construct or vector is administered intrathecally periodically at regular intervals (e.g., once every year, once every six months, once every five months, once every three months, bimonthly (once every two months), monthly (once every month), biweekly (once every two weeks), or weekly).
  • regular intervals e.g., once every year, once every six months, once every five months, once every three months, bimonthly (once every two months), monthly (once every month), biweekly (once every two weeks), or weekly.
  • an effective amount of an rAAV carrying a nucleic acid sequence encoding UPF1 under the control of the promoter may, for example, range between about 1 ⁇ 10 9 to about 1 x 10 14 rAAV genome particles (vg)/kg body weight.
  • a “genome particle” is defined herein as an AAV capsid that contains a single stranded DNA molecule that can be quantified with a sequence specific method (such as qPCR or ddPCR).
  • the rAAV is administered at about 1 ⁇ 10 12 to about 1 x 10 13 rAAV vg/kg body weight.
  • the rAAV is administered at about 5 x 10 11 to about 5 x 10 12 to vg/mL of cerebrospinal fluid (CSF) volume.
  • CSF cerebrospinal fluid
  • the rAAV is administered at about 7.5 x 10 13 to 7.5 x 10 14 vg total per patient.
  • the rAAV is administered to an animal at about 1 ⁇ 10 11 to about 1 x 10 14 rAAV genome particles (vg)/kg body weight.
  • the rAAV genome particles are provided in a volume of between about 20 uL to about 50 mL. In some embodiments, the rAAV genome particles are provided in a volume of between about 30 uL to about 30 mL. In some embodiments, the rAAV genome particles are provided in a volume of about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 200, about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1000 uL.
  • the rAAV genome particles are provided in a volume of about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about or 50 mL.
  • Still other dosages in these ranges may be selected by the attending physician. It is to be understood that for any particular subject, specific dosage regimens can be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the expression construct of vector and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed disclosure.
  • the expression construct or vector disclosed herein can also be advantageously provided to a cell ex vivo, followed by administration of the living cell to the subject.
  • Methods for treating disease by implanting a cell that has been modified to express a recombinant protein are also well known. See, for example, U.S. Pat. No.5,399,346, disclosing methods for introducing a nucleic acid into a primary human cell for introduction into a human.
  • other cells such as bacterial cells may be implanted in a subject's vasculature, continuously releasing a therapeutic agent. See, for example, U.S. Pat.
  • kits or articles of manufacture for use in the methods described herein.
  • the kits comprise the compositions described herein (e.g., compositions for delivery of a UPF1 encoding transgene) in suitable packaging.
  • suitable packaging for compositions (such as ocular compositions for injection) described herein are known in the art, and include, for example, vials (such as sealed vials), vessels, ampules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like.
  • These articles of manufacture may further be sterilized and/or sealed.
  • kits comprising the compositions described herein. These kits may further comprise instruction(s) on methods of using the composition, such as uses described herein.
  • the kits described herein may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing the administration of the composition or performing any methods described herein.
  • the kit comprises an rAAV for the expression of a UPF1 encoding transgene in target cells, a pharmaceutically acceptable carrier suitable for injection, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing the injections.
  • Example 1 AAV vector engineering and screening
  • Enhanced UPF1 expression constructs were designed by rationally optimizing cis- regulatory elements including: (1) Enhancer (size optimization, tissue specificity, potency), (2) promoter (size optimization, tissue specificity, potency), (3) 5’ UTR (translational regulatory motifs, mRNA stabilizing motifs), (4) UPF1 coding sequence (codon optimization), (5) posttranscriptional regulatory element (translational efficiency, mRNA stability, tissue de- targeting motifs, mRNA translocation enhancement), and (6) polyadenylation signal sequence (RNA stability enhancement).
  • Vector “RK” (Fig. 1B), which has been used in Jackson et al, 2015, was used as a control.
  • Vector development [0156] DNA fragments consisting of enhancer/promoter combinations and cis-regulatory elements such as 5’ UTRs and posttranscriptional regulatory elements (including WPRE) and polyA sequences, were synthesized (VectorBuilder or GenScript). In addition to the wild-type UPF1 codon set, two additional codon sets were synthesized: “opti” and “co2”. The “opti” codon set was optimized based on the Codon Adaptation Index (CAI) with a human codon usage table.
  • CAI Codon Adaptation Index
  • the “co2” codon set was optimized based on minimizing the presence of CpGs and sequences predicted to activate host immunity through Toll-like receptor 9 (TLR9) signaling.
  • TLR9 Toll-like receptor 9
  • the enhancer/promoters, other cis-regulatory elements, and UPF1 coding sequences were cloned in various combinations (Table 1) into AAV expression vectors, with the goal of minimizing construct size and increasing vector potency. See Tables 2 and 6-8 for sequences.
  • SEQ ID NO:49 was not assigned to a sequence. 36 150336825.1 Docket No.162027.49376 Table 1. Composition of expression constructs.
  • UTR untranslated region.
  • PolyA polyadenylation.
  • WPRE Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element.
  • Wt wild-type.
  • the CAG promoter is a synthetic promoter comprising the cytomegalovirus (CMV) early enhancer element, the chicken beta actin promoter, the first exon and the first intron of chicken beta-actin gene, and the splice acceptor of the rabbit beta-globin gene.
  • CMV cytomegalovirus
  • Construct V1 was used in Jackson et al., 2015. Altern: Alternative. Add: Additional.
  • PTR Posttranscription regulatory. Const: Construct Docket No.162027.49376 38 150336825.1 Docket No.162027.49376 39 150336825.1 Docket No.162027.49376 Table 2.
  • Example 2 UPF1 expression constructs protect Induced Neurons (iNeurons) against TDP-43 toxicity
  • the iNeuron model can be used as a model system for neurodegenerative diseases. First, the ability of UPF1 expression constructs to protect against TDP-43 toxicity was examined. Briefly, iPSC-derived neural progenitor cells (NPCs) with WT phenotype or isogenic disease mutation M337V for TDP43 were plated and differentiated into motor neurons. The neurons were transduced with AAV9 containing optimized UPF1 constructs at different dose levels with MOIs of 50, 100 or 250K and then monitored for survival.
  • NPCs iPSC-derived neural progenitor cells
  • iNeuron differentiation and transduction [0169] Day 0. Induced pluripotent stem cells (iPSCs) were washed in PBS and incubated in prewarmed accutase (Sigma A6964) at 37 °C for 8 min. Four volumes of E8 media were added to the plate, and the cells were collected and pelleted at 200 x g for 5 min. The media was aspirated, and the pellet was resuspended in 1 ml of fresh E8 media. Cells were counted using a hemocytometer, diluted, plated at a density of 20,000 cells/ml in E8 media with ROCK inhibitor (Y-27632) and incubated at 37 °C overnight. Day 1.
  • iPSCs Induced pluripotent stem cells
  • N-2 media (1x N-2 Supplement (Gibco 17502-048), 1x NEAA Supplement (Gibco 11140-050), 10 ng/ml BDNF (Peprotech 450-02), 10 ng/ml N-T3 (Peprotech 450-03), 0.2 ⁇ g/ml laminin (Sigma L2020), 2 mg/ml doxycycline (Sigma D3447) in E8 media).
  • N-2 media (1x N-2 Supplement (Gibco 17502-048), 1x NEAA Supplement (Gibco 11140-050), 10 ng/ml BDNF (Peprotech 450-02), 10 ng/ml N-T3 (Peprotech 450-03), 0.2 ⁇ g/ml laminin (Sigma L2020), 2 mg/ml doxycycline (Sigma D3447) in E8 media).
  • B-27TM media (1x B-27TM Supplement (Gibco 17504-044), 1x GlutaMAXTM Supplement (Gibco 35050-061), 10 ng/ml BDNF, 10 ng/ml N-T3, 0.2 ⁇ g/ml laminin, 2 mg/ml doxycycline, and 1x Culture One (Gibco A33202-01) in Neurobasal-A (Gibco 12349-015)).
  • Day 6 Cells were transduced with AAV9 at MOI of 50K, 100K or 250K. Cells were retained in the same media for the remainder of the experiment.
  • Example 3 UPF1 expression constructs protect iNeurons against C9orf72 toxicity
  • C9orf72 iNeurons were transduced with AAV9-UPF1 variants (V1, V3-9) or AAV9-GFP control (V2) and imaged by semi-automated microscopy. Custom scripts were used to identify neuronal soma and assign a unique ID to each cell. Neuronal loss was indicated by dissolution or rounding of the cell body, dendritic beading, or loss of fluorescence.
  • Example 4 Expression of UPF1 variants in patient derived C9orf72 iPSNs
  • Cell culture [0181] iPSCs were grown in 6-well plates on rhLaminin-521 (Thermo Fisher) using Essential 8TM Medium (Gibco) and passaged using Versene (Gibco). Wildtype iPSCs were derived from human neonatal fibroblasts (Lonza) by nucleofecting with OCT3/4, hSK, hUL, and mIR. C9orf72 iPSCs were acquired from NINDS (National Institute of Neurological Disorders and Stroke), cell line ND50000.
  • NINDS National Institute of Neurological Disorders and Stroke
  • Motor neuron differentiation [0183] Motor neurons were derived from iPSCs as per Hall, C.E., et al. Progressive motor neuron pathology and the role of astrocytes in a human stem cell model of VCP-related ALS. Cell Reports 19, 1739-1749 (2017).
  • iPSCs were grown to confluency and neural induction was induced using N-2/B2-7TM medium (equal parts Neurobasal Medium and DMEM/F12+GlutaMAX, plus 1% B-27TM supplement, 0.5% N-2 supplement, 0.5% non- essential amino acids, 1 mM L-glutamine (all from Gibco), and 2.5 ug/ml insulin (Sigma)) supplemented with 1uM Dorsomophin (Millipore), 2 ⁇ M SB431542 (Tocris Bioscience), and 3 ⁇ M CHIR99021 (Miltenyi Biotec).
  • N-2/B2-7TM medium equal parts Neurobasal Medium and DMEM/F12+GlutaMAX, plus 1% B-27TM supplement, 0.5% N-2 supplement, 0.5% non- essential amino acids, 1 mM L-glutamine (all from Gibco), and 2.5 ug/ml insulin (Sigma)
  • 1uM Dorsomophin Meillipore
  • the neuroepithelial layer was dissociated with 1 mg/ml Dispase (Gibco), removed from the underlying cells, and plated onto laminin-coated plates.
  • the neuroepithelium was patterned in N-2/B2-7TM with 0.5 ⁇ M retinoic acid and 1 ⁇ M Purmorphamine until Day 14, at which point it was treated for four days with N-2/B2-7TM + 1 ⁇ M Purmorphamine until terminal differentiation in N-2/B2-7TM + 0.1 ⁇ M Compound E.
  • Transduction [0185] For the UPF1 vector transduction assay, cells were seeded into 12-well plates for terminal differentiation at a density of 200,000 cells/well.
  • UPF1 primers (5’-3’): [0189] Forward primer: TGGTATTCTTAACTATGTTGCTCCT (SEQ ID NO:57) 46 150336825.1 Docket No.162027.49376 [0190] Reverse primer: AAGCCATACGGGAAGCAATAG (SEQ ID NO:58) [0191] Probe: FAM-ACGCTATGTGGATACGCTGCTTT (SEQ ID NO:59) [0192] Results [0193] Fold enrichment of exogenous UPF1 RNA levels in C9Orf72 iPSNs after transduction of each of the UPF1 variant constructs was compared to non-transduced cells, as measured by qRT-PCR.
  • Figs.4A and 4B show the results for two independent experiments.
  • Example 5 Expression of UPF1 variants increases motor neuron survival in FUS-ALS knock-in mouse model
  • Mouse lines and procedures [0196] Mutant FUS knock-in mice were generated as described in Korobeynikov et al., Antisense oligonucleotide silencing of FUS expression as a therapeutic approach in amyotrophic lateral sclerosis, Nat Med.2022 Jan;28(1):104-116.
  • VP1 capsid variant AAV2retro is described in PCT Publication WO2017218842 (SEQ ID NO:44 in WO2017218842), which is hereby incorporated in its entirety.
  • Tissue sections were incubated in primary antibodies (Chicken anti-GFP, Thermo Fisher A10262 at 1:250; Goat anti-ChAT, Millipore AB144P at 1:250; Rabbit anti-Iba1, Wako 019-19741 at 1:250; Rabbit anti-GFAP, Agilent Z0334 at 1:300) diluted in 5% normal donkey serum in Tris-buffered saline with 0.5% Triton X-100 (TBS-T) overnight at 4 °C.
  • primary antibodies Chicken anti-GFP, Thermo Fisher A10262 at 1:250
  • Goat anti-ChAT Millipore AB144P at 1:250
  • Rabbit anti-Iba1, Wako 019-19741 at 1:250
  • Rabbit anti-GFAP Agilent Z0334 at 1:300
  • the sections were then washed in TBS-T three times and incubated with the corresponding secondary antibodies (Alexa 488 anti-chicken, Thermo Fisher at 1:100; Alexa 594 anti-goat, Thermo Fisher A110058 at 1:300; Alexa 647 anti-rabbit, Thermo Fisher A31573 at 1:300) for 1 h.
  • the sections were mounted in aqueous medium (Fluoromount G, Southern Biotech) and imaged using a Leica SP8 confocal microscope. Images were analyzed using LAS X and ImageJ software packages.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des constructions d'expression améliorées pour l'expression d'UPF1 et des vecteurs comprenant de telles constructions. L'invention concerne également des méthodes de traitement de maladies neurodégénératives, comprenant, mais sans y être limitées, la sclérose latérale amyotrophique (SLA).
PCT/IB2023/060249 2022-10-11 2023-10-11 Constructions d'expression d'upf1 WO2024079662A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263379109P 2022-10-11 2022-10-11
US63/379,109 2022-10-11

Publications (1)

Publication Number Publication Date
WO2024079662A1 true WO2024079662A1 (fr) 2024-04-18

Family

ID=88466557

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2023/060249 WO2024079662A1 (fr) 2022-10-11 2023-10-11 Constructions d'expression d'upf1

Country Status (1)

Country Link
WO (1) WO2024079662A1 (fr)

Citations (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4309776A (en) 1980-05-13 1982-01-12 Ramon Berguer Intravascular implantation device and method of using the same
WO1989010134A1 (fr) 1988-04-25 1989-11-02 The Regents Of The University Of California Peptides chimeriques d'administration de neuropeptides a travers la barriere vasculaire du cerveau
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
WO1995013598A1 (fr) 1993-11-11 1995-05-18 Nsm Aktiengesellschaft Machine a sous
US5704910A (en) 1995-06-05 1998-01-06 Nephros Therapeutics, Inc. Implantable device and use therefor
US5856152A (en) 1994-10-28 1999-01-05 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV vector and methods of use therefor
WO2000015822A1 (fr) 1998-09-17 2000-03-23 University Of Florida Methodes de traitement de maladies degeneratives de la retine
US20020025313A1 (en) 1992-07-27 2002-02-28 Micklus Michael J. Targeting of liposomes to the blood-brain barrier
US20020038086A1 (en) 2000-07-27 2002-03-28 Hynynen Kullervo H. Blood-brain barrier opening
US20030083299A1 (en) 2000-11-04 2003-05-01 Ferguson Ian A. Non-invasive delivery of polypeptides through the blood-brain barrier
US20040131692A1 (en) 2001-05-05 2004-07-08 Joerg Kreuter Nanoparticles made of protein with coupled apolipoprotein e for penetration of the blood-brain barrier and methods for the production thereof
US20040204354A1 (en) 2002-12-03 2004-10-14 Thomas Nelson Artificial low-density lipoprotein carriers for transport of substances across the blood-brain barrier
WO2017191274A2 (fr) * 2016-05-04 2017-11-09 Curevac Ag Arn codant pour une protéine thérapeutique
WO2017218842A1 (fr) 2016-06-15 2017-12-21 HWANG, Bum-Yeol Virus adéno-associés variants et procédés d'utilisation
WO2020019002A1 (fr) * 2018-07-20 2020-01-23 University Of Utah Research Foundation Thérapie génique pour la dégénérescence maculaire

Patent Citations (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4309776A (en) 1980-05-13 1982-01-12 Ramon Berguer Intravascular implantation device and method of using the same
WO1989010134A1 (fr) 1988-04-25 1989-11-02 The Regents Of The University Of California Peptides chimeriques d'administration de neuropeptides a travers la barriere vasculaire du cerveau
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
US20020025313A1 (en) 1992-07-27 2002-02-28 Micklus Michael J. Targeting of liposomes to the blood-brain barrier
WO1995013598A1 (fr) 1993-11-11 1995-05-18 Nsm Aktiengesellschaft Machine a sous
US5856152A (en) 1994-10-28 1999-01-05 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV vector and methods of use therefor
US5871982A (en) 1994-10-28 1999-02-16 The Trustees Of The University Of Pennsylvania Hybrid adenovirus-AAV virus and methods of use thereof
US5704910A (en) 1995-06-05 1998-01-06 Nephros Therapeutics, Inc. Implantable device and use therefor
WO2000015822A1 (fr) 1998-09-17 2000-03-23 University Of Florida Methodes de traitement de maladies degeneratives de la retine
US20020038086A1 (en) 2000-07-27 2002-03-28 Hynynen Kullervo H. Blood-brain barrier opening
US20030083299A1 (en) 2000-11-04 2003-05-01 Ferguson Ian A. Non-invasive delivery of polypeptides through the blood-brain barrier
US20040131692A1 (en) 2001-05-05 2004-07-08 Joerg Kreuter Nanoparticles made of protein with coupled apolipoprotein e for penetration of the blood-brain barrier and methods for the production thereof
US20040204354A1 (en) 2002-12-03 2004-10-14 Thomas Nelson Artificial low-density lipoprotein carriers for transport of substances across the blood-brain barrier
WO2017191274A2 (fr) * 2016-05-04 2017-11-09 Curevac Ag Arn codant pour une protéine thérapeutique
WO2017218842A1 (fr) 2016-06-15 2017-12-21 HWANG, Bum-Yeol Virus adéno-associés variants et procédés d'utilisation
WO2020019002A1 (fr) * 2018-07-20 2020-01-23 University Of Utah Research Foundation Thérapie génique pour la dégénérescence maculaire

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
BEGLEY, J. PHARM. PHARMACOL, vol. 48, 1996, pages 136 - 146
CLOUGHESY ET AL., J. NEUROONCOL, vol. 26, 1995, pages 125 - 132
GILL ET AL., NATURE MED, vol. 9, 2003, pages 589 - 595
HALL, C.E. ET AL.: "Progressive motor neuron pathology and the role of astrocytes in a human stem cell model of VCP-related ALS", CELL REPORTS, vol. 19, 2017, pages 1739 - 1749
HERZOG ET AL., NATURE MEDIC., vol. 5, no. 1, 1999, pages 56 - 63
JACKSON ET AL.: "Preservation of forelimb function by UPF1 gene therapy in a rat model of TDP-43-induced motor paralysis", GENE THER, vol. 22, no. 1, January 2015 (2015-01-01), pages 20 - 8, XP036974015, DOI: 10.1038/gt.2014.101
JACKSON K L ET AL: "Preservation of forelimb function by UPF1 gene therapy in a rat model of TDP-43-induced motor paralysis", GENE THERAPY, NATURE PUBLISHING GROUP, LONDON, GB, vol. 22, no. 1, 6 November 2014 (2014-11-06), pages 20 - 28, XP037771804, ISSN: 0969-7128, [retrieved on 20141106], DOI: 10.1038/GT.2014.101 *
JU ET AL.: "A yeast model of FUS/TLS-dependent cytotoxicity", PLOS BIOL, vol. 9, no. 4, April 2011 (2011-04-01), pages e1001052
JU SHULIN ET AL: "A Yeast Model of FUS/TLS-Dependent Cytotoxicity", PLOS BIOLOGY, vol. 9, no. 4, 26 April 2011 (2011-04-26), US, pages e1001052, XP093121107, ISSN: 1545-7885, Retrieved from the Internet <URL:https://journals.plos.org/plosbiology/article/file?id=10.1371/journal.pbio.1001052&type=printable> DOI: 10.1371/journal.pbio.1001052 *
KOROBEYNIKOV ET AL.: "Antisense oligonucleotide silencing of FUS expression as a therapeutic approach in amyotrophic lateral sclerosis", NAT MED, vol. 28, no. 1, January 2022 (2022-01-01), pages 104 - 116, XP037678126, DOI: 10.1038/s41591-021-01615-z
KOROBEYNIKOV VLADISLAV A ET AL: "Antisense oligonucleotide silencing of FUS expression as a therapeutic approach in amyotrophic lateral sclerosis", NATURE MEDICINE, NATURE PUBLISHING GROUP US, NEW YORK, vol. 28, no. 1, 1 January 2022 (2022-01-01), pages 104 - 116, XP037678126, ISSN: 1078-8956, [retrieved on 20220124], DOI: 10.1038/S41591-021-01615-Z *
KWIATKOWSKI ET AL., SCIENCE, vol. 323, 2009, pages 1208 - 1211
LAZORTHES ET AL., ADV. TECH. STAND. NEUROSURG, vol. 18, 1991, pages 143 - 192
MARUYAMA ET AL., NATURE, vol. 465, 2010, pages 223 - 226
NAYEROSSADAT, N ET AL., ADV BIOMED RES, vol. 1, 2012, pages 27
NISHIMURA ET AL., AM. J. HUM. GENET, vol. 74, 2004, pages 1128 - 1135
OMAYA, CANCER DRUG DELIV, vol. 1, 1984, pages 169 - 179
PAPANASTASSIOU ET AL., GENE THERAPY, vol. 9, 2002, pages 398 - 406
ROSEN ET AL., NATURE, vol. 362, 1993, pages 59 - 62
SAMBROOK ET AL.: "Implication of the Blood-Brain Barrier and its Manipulation", vol. 1,2, 1989, COLD SPRING HARBOR LABORATORY
SREEDHARAN ET AL., SCIENCE, vol. 319, 2008, pages 1668 - 1672

Similar Documents

Publication Publication Date Title
JP6941632B2 (ja) Ｃｎｓターゲティングａａｖベクターおよびその使用方法
US20230295663A1 (en) Compositions and methods of treating amyotrophic lateral sclerosis (als)
JP6397391B2 (ja) 神経変性障害のための遺伝子治療
RU2716422C2 (ru) Композиции и способы лечения бокового амиотрофического склероза (als)
US20210069292A1 (en) Recombinant glut1 adeno-associated viral vector constructs and related methods for restoring glut1 expression
ES2826384T3 (es) Terapia génica para trastornos oculares
JP2020519629A (ja) ムコ多糖症ｉｉｉａ型（ｍｐｓ ｉｉｉａ）を処置するための、スルファミダーゼ（ｓｇｓｈ）バリアント、ベクター、組成物並びに方法及び使用
US20230175015A1 (en) Immunosuppressive agents and viral delivery re-dosing methods for gene therapy
CA3190309A1 (fr) Compositions et procedes pour le traitement des troubles neurologiques lies au deficit en glucosylceramidase beta
WO2024079662A1 (fr) Constructions d&#39;expression d&#39;upf1
KR20210132095A (ko) 크라베병의 치료에 유용한 조성물
US20220143217A1 (en) Neuroprotective gene therapy targeting the akt pathway
WO2024079661A1 (fr) Thérapie génique atp7b