WO2024076173A1 - Composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells, and differentiation method using composition - Google Patents

Composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells, and differentiation method using composition Download PDF

Info

Publication number
WO2024076173A1
WO2024076173A1 PCT/KR2023/015333 KR2023015333W WO2024076173A1 WO 2024076173 A1 WO2024076173 A1 WO 2024076173A1 KR 2023015333 W KR2023015333 W KR 2023015333W WO 2024076173 A1 WO2024076173 A1 WO 2024076173A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
dermal papilla
composition
adipose
derived stem
Prior art date
Application number
PCT/KR2023/015333
Other languages
French (fr)
Korean (ko)
Inventor
심태진
김지훈
홍인기
김종필
이경민
이혜숙
정정일
박예은
황지수
Original Assignee
주식회사 프롬바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 프롬바이오 filed Critical 주식회사 프롬바이오
Publication of WO2024076173A1 publication Critical patent/WO2024076173A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/36—Skin; Hair; Nails; Sebaceous glands; Cerumen; Epidermis; Epithelial cells; Keratinocytes; Langerhans cells; Ectodermal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/14—Drugs for dermatological disorders for baldness or alopecia
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to a composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells and a differentiation method using the composition.
  • a typical human's hair goes through a cycle of hair growth and hair loss, repeating the growth phase (anagen) when the hair actively grows, the catagen phase (catagen) when the hair begins to deteriorate, and the resting phase (telogen) when the hair stops growing or goes into rest.
  • Hair loss is broadly classified into natural hair loss, in which growing hair naturally falls out of the hair follicle through a normal growth cycle, and abnormal hair loss, which occurs due to genetic factors, abnormal hormonal secretion, mental stress, disease, and drug side effects.
  • Dermal papilla cells are a type of dermal fibroblast cell located in the dermal papilla at the bottom of the hair follicle.
  • Capillaries are distributed in the dermal papilla cells, which supply oxygen and nutrients to the hair follicle and IGF-1 (insulinlike growth factor).
  • growth factors such as fator-1), KGF (keratinocyte growth factor), ⁇ -FGF ( ⁇ -fibroblast growth factor), HGF (hepatocyte growth factor), SCF (stem cell factor), and VEGF (vascular endothelial growth factor) It regulates the growth of hair follicle epithelial cells by secreting inhibition factors such as epidermal growth factor (EGF) and transforming growth factor- ⁇ (TGF- ⁇ ).
  • EGF epidermal growth factor
  • TGF- ⁇ transforming growth factor- ⁇
  • the present invention discloses a technology for differentiating human adipose tissue-derived mesenchymal stem cells into dermal papilla cells.
  • the purpose of the present invention is to provide a composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells.
  • Another object of the present invention is to provide a method for differentiating adipose-derived stem cells into dermal papilla cells using the composition.
  • the present invention allows Morroniside to be treated with human adipose-derived stem cells together with factors such as bFGF (Fibroblast Growth Factor-basic) and BMP2 (Bone morphogenetic protein 2). Then, from the stem cells, dermal papilla cells that show similar characteristics in terms of expression of essential genes of dermal papilla cells and commercially sold dermal papilla cells (PromoCell, Human Centered Science, Germany) used as control cells are induced to differentiate, and the differentiation is induced.
  • factors such as bFGF (Fibroblast Growth Factor-basic) and BMP2 (Bone morphogenetic protein 2).
  • the present invention is provided based on the results of these experiments.
  • the present invention is for inducing differentiation of fat-derived (i.e. isolated from human adipose tissue) stem cells containing moroniside as an active ingredient into dermal papilla cells. It can be identified by composition.
  • moroniside acts alone or together with an inactive carrier component as an active ingredient that induces differentiation of human adipose-derived stem cells into dermal papilla cells.
  • the IUPAC name of moroniside is ⁇ methyl (1S,3R,4aS,8S,8aS)-3-hydroxy-1-methyl-8-[(2S,3R,4S,5S,6R)-3,4,5- It is a known compound called ‘trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,3,4,4a,8,8a-hexahydropyrano[3,4-c]pyran-5-carboxylate’ and its CAS number is 25406. It is -64-8, and is a substance known to regulate hair growth through the Wnt/ ⁇ -catenin signaling pathway (Scientific Reports, (2016) 8:13785).
  • composition of the present invention may additionally contain bFGF (Fibroblast Growth Factor-basic) and/or BMP2 (Bone morphogenetic protein 2) to complement or increase the differentiation inducing activity of moroniside.
  • bFGF Fibroblast Growth Factor-basic
  • BMP2 Ben morphogenetic protein 2
  • these factors may be of human origin (meaning that they are isolated from human blood, etc., or manufactured by genetic recombination, and the amino acid sequence is the same as that of humans).
  • composition of the present invention may contain the active ingredient moroniside in the amount necessary to sufficiently differentiate adipose-derived stem cells into dermal papilla cells or to the intended degree. Typically, it will be included in the range of 3 to 20 ⁇ M, especially 5 to 15 ⁇ M.
  • composition of the present invention contains bFGF and/or BMP2, in order to differentiate into dermal papilla cells sufficiently or to the intended extent, bFGF is contained in the range of 3 to 20 ng/ml and BMP2 is contained in the range of 0.3 to 3 ng/ml. It would be desirable.
  • composition of the present invention may include a solvent in addition to the active ingredient moroniside.
  • solvent may be cell culture medium, buffer, isotonic solution, or other suitable solvent such as purified water or dimethyl sulfoxide (DMSO).
  • the cell culture medium in the present invention is not particularly limited and any basic medium used in the art for culturing mammalian cells can be used.
  • the basic medium is for cell growth, proliferation and/or amplification, and basically contains sugars, amino acids, mineral salts, and may optionally contain vitamins, trace elements, antimicrobial agents, growth factors, hormones, buffers, isotonic agents, etc. You can.
  • Saccharides may be monosaccharides, disaccharides, etc., and specifically include glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, or mixtures of one or more of these. can be used
  • Amino acids included in the basic medium are aspartic acid, glutamic acid, asparagine, serine, glutamine, histidine, glycine, threonine, arginine, alanine, tyrosine, cysteine, valine, methionine, norvaline, tryptophan, phenylalanine, isoleucine, leucine, and lysine. , hydroxyproline, sarcosine and/or proline.
  • the amino acid is preferably a synthetic amino acid, and such synthetic amino acid may be in the form of a dipeptide or tripeptide. These dipeptides and tripeptides can be converted to free amino acids in cell cultures containing cells.
  • the basic medium contains inorganic salts such as sodium chloride, potassium chloride, calcium chloride, magnesium sulfate, and sodium dihydrogen phosphate, which help maintain osmotic balance and regulate membrane potential by providing sodium, potassium, and calcium ions. Additional items may be included.
  • the basic medium may optionally contain vitamins. Many vitamins are essential for cell growth and proliferation and cannot be synthesized in sufficient amounts by cells, so they need to be sufficiently supplemented in cell culture media. Vitamins such as vitamin A, B vitamins, vitamin C, and vitamin E may be included in the basic medium. In particular, B vitamins such as thiamine, riboflavin, pyridoxine, cyanocobalamin, biotin, folic acid, pantothenic acid, and nicotinamide are preferably added to promote cell growth.
  • the basic medium may optionally contain trace elements, antibiotics, growth factors, hormones, buffers, isotonic agents, etc. in addition to sugars, amino acids, and vitamins.
  • Trace elements may be added to the basic medium for proper cell growth and to maintain enzyme function.
  • Examples of such trace elements include copper, zinc, selenium, and tricarboxylic acid intermediates.
  • Antimicrobial agents can be added to the basic medium to prevent contamination by external microorganisms, specifically antibiotics such as penicillin, streptomycin, and fungizone, antifungal agents such as amphotericin B, Mycoplasma inhibitors such as gentamicin, ciprofloxacin, azithromycin, and tylosin may be used.
  • antibiotics such as penicillin, streptomycin, and fungizone
  • antifungal agents such as amphotericin B, Mycoplasma inhibitors such as gentamicin, ciprofloxacin, azithromycin, and tylosin may be used.
  • Growth factors can be added to the basic medium for cell proliferation.
  • growth factors include epidermal growth factor (EGF), fibroblast growth factor (FGF), and insulin-like growth factor (insulin-like growth factor).
  • IGF insulin-like growth factor
  • nerve growth factor NGF
  • PDGF platelet-derived growth factor
  • TGF vascular endothelial growth factor
  • VEGF vascular endothelial growth factor growth factor
  • activin A activin A, etc.
  • hormones that can be added to the basic medium include insulin, hydrocortisone, triiodothyronine, estrogen, androgen, progesterone, prolactin, follicle-stimulating hormone, gastrin-releasing peptide, dexamethasone, estradiol, and glucagon.
  • the basic medium contains buffering agents such as citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, and tris, or sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, and glycerin. , propylene glycol, polyethylene, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, glucose, etc. may be included.
  • buffering agents such as citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, and tris, or sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, and glycerin.
  • propylene glycol polyethylene, glycol, maltose, sucrose, erythritol, arabitol
  • the basic medium contains cell adhesion factors such as type 1 or 2 collagen, gelatin, fibronectin, laminin, poly-L-lysine, and poly-D-lysine, as well as salt, free fatty acids, hormones, and vitamins that bind to tissue and Albumin, which transports between cells and plays a role in regulating pH and osmotic pressure, and transferrin, which plays an important role in iron transport, may be additionally included.
  • cell adhesion factors such as type 1 or 2 collagen, gelatin, fibronectin, laminin, poly-L-lysine, and poly-D-lysine
  • salt free fatty acids
  • hormones hormones
  • transferrin which plays an important role in iron transport
  • DMEM Dulbecco's Modified Eagle's Medium
  • MEM Minimal Essential Medium
  • BME Base Medium Eagle
  • RPMI 1640 F-10, F-12, DMEM/F12, MEM- ⁇ (Minimal Essential Medium- ⁇ ), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A medium, AmnioMax complete medium, AminoMaxII complete medium, EBM (Endothelial Basal Medium) medium, Chang's Medium, MesenCult-XF, DMEM/HG (Dulbecco's Modified Eagle's Medium high glucose) medium, and MCDB+DMEM/LG (MCDB +Dulbecco's Modified Eagle's Medium low glucose) medium. You can.
  • the solvent included in the composition of the present invention may be a buffer solution, which includes citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, tris, etc. It may be a physiological saline solution. In particular, it may be phosphate buffered saline (PBS), Tris Buffered Saline (TBS), HEPES Buffered Saline, DPBS (Dulbecco's phosphate-buffered saline), etc.
  • PBS phosphate buffered saline
  • TBS Tris Buffered Saline
  • HEPES Buffered Saline HEPES Buffered Saline
  • DPBS Dulbecco's phosphate-buffered saline
  • Solvents included in the composition of the present invention may also include sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, glycerin, propylene glycol, polyethylene, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, glucose. It may be an isotonic solution containing such as an isotonic agent. This isotonic solution may be Ringer's solution, lactate Ringer's solution, acetic acid Ringer's solution, bicarbonate Ringer's solution, or 5% glucose aqueous solution, and can be prepared and used directly or purchased commercially.
  • the adipose-derived stem cells (ADSC) of the present invention have self-renewal ability and can differentiate into cells of various types such as skin, cartilage, and bone, as well as bone marrow-derived stem cells or umbilical cord blood-derived stem cells. Compared to stem cells, it is easier to collect and can be cultured in large quantities, and because it contains a large amount of stem cells, it is highly utilized in cell therapy products.
  • adipose-derived stem cells have self-renewal and differentiation abilities, their origin is not particularly limited and may be derived from humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, or rabbits. Preferably it is of human origin.
  • the present invention relates to a method for producing dermal papilla cells differentiated from adipose-derived stem cells, comprising the step of treating and culturing the composition for inducing differentiation of the present invention as described above in the adipose-derived stem cell culture medium. will be.
  • the culture temperature may be in the range of 25-40°C, preferably 35 ⁇ 2°C.
  • culture is performed until differentiation into dermal papilla cells is sufficient or achieved as intended.
  • culturing can be performed for a period of 24 hours, 48 hours, 72 hours, 96 hours, 5 days, 6 days, 7 days, 8 days, 9 days, or more.
  • the amount of carbon dioxide (CO 2 ) is 10% to 1% (v/v), preferably 8% to 2% (v/v). ), especially at 5% (v/v).
  • the culture can be performed in a closed incubator, especially in a closed incubator in which a sterile state is maintained.
  • Incubators suitable for the present invention include GE Xuri W25, GE Xuri W5, Sartorius BioSTAT RM 20
  • the present invention relates to a composition for preventing hair loss or promoting hair growth
  • a composition for preventing hair loss or promoting hair growth comprising as an active ingredient dermal papilla cells differentiated from adipose-derived stem cells, obtained according to the production method described above.
  • the pharmaceutical composition of the present invention can be prepared as an oral or parenteral dosage form by a conventional method known in the art depending on the route of administration, including a pharmaceutically acceptable carrier or excipient.
  • Such pharmaceutically acceptable carriers or excipients are those that do not inhibit the activity or properties of the drug without being particularly toxic to the human body, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, algae, etc. Nate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water (e.g. saline and sterile water), syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc.
  • a suitable carrier or excipient may be one of the following ingredients: saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, and ethanol.
  • saline solution sterile water
  • Ringer's solution buffered saline solution
  • albumin injection solution dextrose solution
  • maltodextrin solution glycerol
  • ethanol ethanol
  • the above ingredients can be used alone or in combination, and other common pharmaceutical additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed.
  • the pharmaceutical composition of the present invention when formulated for oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and when formulated for parenteral administration, especially as an injection, it can be manufactured in unit dosage ampoules or multiple doses. It can be prepared in single dosage form.
  • the pharmaceutical composition of the present invention can be manufactured in the form of solutions, suspensions, tablets, pills, capsules, sustained-release preparations, etc.
  • the pharmaceutical composition of the present invention is formulated into a unit dosage form suitable for administration into the patient's body according to a conventional method in the pharmaceutical field, and is administered through an oral administration route using an administration method commonly used in the art. or on the skin, intralesional, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, pulmonary, transdermal, subcutaneous, intraperitoneal, intranasal, digestive tract, topical, sublingual, intravaginal, It can be administered by parenteral administration routes, such as the rectal route.
  • the dosage (effective amount) of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, gender, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. It can be prescribed appropriately, and a person skilled in the art can appropriately determine the dosage by considering these factors.
  • the pharmaceutical composition of the present invention is prepared as an injection in the form of a unit dose.
  • the amount of hair follicle cells contained per unit dose of the pharmaceutical composition of the present invention is 10 2 -10. It may be in the range of 7 cells/ml.
  • compositions for inducing differentiation of adipose-derived stem cells into dermal papilla cells a method for differentiating dermal papilla cells using the composition, and a pharmaceutical composition for preventing hair loss or promoting hair growth.
  • composition and differentiation method for inducing differentiation of the present invention are techniques for differentiating dermal papilla cells from adipose-derived stem cells using moroniside, and these differentiated dermal papilla cells can have a useful effect as a cell therapy agent for hair loss treatment. there is.
  • Figure 1 is a diagram showing the process of differentiating dermal papilla cells from human adipose-derived stem cells according to the present invention.
  • Figure 2 shows the results of confirming the toxicity of the substance inducing differentiation into dermal papilla cells of the present invention in human adipose-derived stem cells.
  • Figure 3 shows the results of confirming the expression level of genes of Versican, Corin, Bmp2, and Bmp4, which are essential factors for dermal papilla cells, after inducing differentiation from human adipose-derived stem cells into dermal papilla cells.
  • Figure 4 shows the results of confirming the expression level of genes for Wnt5 ⁇ , Lef-1, Hey-1, and Wif-1, which are dermal papilla cell growth factors related to Wnt5 ⁇ , after inducing differentiation from human adipose-derived stem cells into dermal papilla cells.
  • Figure 5 shows hair follicle formation by H&E staining of mouse tissues of the non-cell-administered control group (#1), human adipose-derived stem cell-administered group (#2), control dermal papilla cell-administered group (#3), and differentiated cell-administered group (#4). This is a photo showing the extent.
  • Human adipose tissue used in the present invention was purchased from Goma Biotech Co., Ltd. (Seoul, Korea), and stem cells were isolated from adipose tissue by the method of Zuk et al. (Mol Biol Cell. 2022 Dec; 13(12): 4279-4295 ) was performed in accordance with.
  • stem cells from adipose tissue After isolating stem cells from adipose tissue, they were cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with penicillin (100 U/ml), streptomycin (100 ug/ml), and 10% heat-inactivated serum in 95% air and 5% CO2. and cultured at 37°C. When the cells attached to the culture dish grew, they were collected using 0.25% trypsin/10 mM EDTA and maintained in DMEM supplemented with 10% (w/v) Fetal Bovine Serum (FBS).
  • DMEM Dulbecco's Modified Eagle's Medium
  • penicillin 100 U/ml
  • streptomycin 100 ug/ml
  • 10% heat-inactivated serum in 95% air and 5% CO2.
  • human dermal papilla cells were purchased from PromoCell and used as a control (Dermal papilla cell, DPC).
  • the culture method was one of culturing human adipose-derived stem cells. same.
  • a differentiation inducing medium of a new composition was prepared to differentiate dermal papilla cells from human adipose-derived stem cells.
  • the medium is a medium used for culturing human adipose-derived stem cells as in Example 1 (DMEM supplemented with 10% (w/v) FBS) and basic fiber as an active ingredient for inducing differentiation into dermal papilla cells. It was prepared by mixing 10 ng/ml of fibroblast growth factor-basic (bFGF), 1 ng/ml of bone morphogenetic protein 2 (BMP2), and 10 ⁇ M of morroniside.
  • bFGF fibroblast growth factor-basic
  • BMP2 bone morphogenetic protein 2
  • the differentiation inducing composition prepared in this way is shown in Table 1 below, and was named FDI-1 (Frombio Differentiation Inducer-1) for convenience.
  • FDI-1 Frombio Differentiation Inducer-1
  • a differentiation induction medium containing 6BIO (6-bromo-indirubin-3'-oxime), which is known to be effective in the differentiation of existing dermal papilla cells, was used instead of moroniside as a control group.
  • bFGF bFGF
  • BMP2 BMP2, 6BIO, and Morroniside
  • composition of differentiation inducing composition Composition type menstruum Added substance 1 Additive substance 2 Additive substance 3 Differentiation-inducing composition (FDI-1) DMEM (10% FBS) 10 ng/ml bFGF 1 ng/ml BMP2 10 ⁇ M Morroniside comparison group 10 ⁇ M 6BIO
  • Example 3 Method of differentiating human adipose-derived stem cells into dermal papilla cells
  • Human adipose-derived stem cells were inoculated into 6-well plates at a concentration of 1 ⁇ 10 5 cells/well, 1 ml each, and culture conditions used in Example 1 were used. and cultured for 24 hours. When the cells attached to the bottom, they were washed with the solvent DPBS (Dulbecco's Phosphate-buffered saline) and then treated with FDI-1 to induce differentiation.
  • DPBS Dynamicon-phosphate-buffered saline
  • CCK-8 a reagent used to confirm toxicity, was purchased from Dongin Biotech (Seoul, Korea), and human adipose-derived stem cells were used as cells isolated in Example 1 above.
  • 100 ul of human adipose-derived stem cells were treated in 96-well plates at a concentration of 1 ⁇ 10 4 cells/well, and then cultured for 24 hours under the culture conditions used in Example 1.
  • the cells attached to the bottom they were washed with DPBS, a solvent, and then treated with FDI-1 and cultured for up to 72 hours.
  • culture was performed for 3 hours with 10 ul of CCK-8 reagent and 100 ul of human adipose-derived stem cell culture medium, and then the absorbance was measured with a spectrophotometer at 540 nm. did.
  • Real-time PCR Real-time PCR was performed using the SYBR green method using the synthesized cDNA and primers for adipose-derived stem cell-specific marker genes in Table 1 below.
  • SYBR Green I is an interchelator that binds to double-stranded DNA and exhibits fluorescence. Interchelator emits fluorescence by binding to double-stranded DNA synthesized through PCR reaction, and the amount of amplification product produced can be measured by detecting this fluorescence intensity.
  • the expression level of the stem cell pluripotency marker gene was examined in the same manner.
  • Wnt5 ⁇ -related dermal papilla cell growth genes Wnt5 ⁇ , Lef-1, Hey-1, and Wif-1 were confirmed using real-time PCR, and the primer sequences for each factor are shown in Table 3 below.
  • the expression of Wnt5 ⁇ -related dermal papilla cell growth factor was very high in cells that induced differentiation by treatment with a comparative composition containing FDI-1 and 6BIO.
  • the expression of Wnt5 ⁇ -related dermal papilla cell growth factor is similar or higher in the group treated with FDI-1, the differentiation induction medium of the present invention, compared to the group treated with the control differentiation induction medium.
  • Animal testing model hair growth efficacy test division cell type Number of doses Dosage administered Method of administration observation period #One Negative control group Non-administration 1 dose 1 Transdermal administration 4 weeks (30 days) #2 Positive control group 1 Human adipose-derived stem cells #3 Positive control group 2 hair papilla cells #4 test group FDI-1 differentiated cells
  • the formation of hair follicles occurred at a very high frequency in the group administered cells (#4) induced differentiation with FDI-1 compared to the group not administered cells, which was the negative control group (see arrow).
  • the hair follicles in the differentiated cell-administered group (#4) were larger in diameter and longer than the human adipose-derived stem cell-administered group (#2), which was used as a positive control group.
  • the hair follicle formation rate and the size and length of hair follicle diameter were similar in the differentiated cell administration group (#4), indicating that cells differentiated from human adipose-derived stem cells according to the present invention were It can be seen that it has a similar function to dermal papilla cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Cell Biology (AREA)
  • Dermatology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Rheumatology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Disclosed are a composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells, and a differentiation method using the composition. The composition for inducing differentiation and the differentiation method, of the present invention, relate to technologies using morroniside to enable dermal papilla cells to be differentiated from adipose-derived stem cells, and the differentiated dermal papilla cells can be useful as a cell therapeutic agent for hair loss treatment.

Description

지방 유래 줄기세포의 모유두세포로의 분화 유도용 조성물 및 그 조성물을 이용한 분화 방법Composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells and differentiation method using the composition
본 발명은 지방 유래 줄기세포의 모유두세포로의 분화 유도용 조성물 및 그 조성물을 이용한 분화 방법에 관한 것이다.The present invention relates to a composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells and a differentiation method using the composition.
일반적인 사람의 모발은 모발의 활발한 성장을 보이는 성장기(anagen), 모발의 퇴화가 시작되는 퇴행기(catagen)와 모발의 성장이 멈추거나 휴식에 들어가는 휴지기(telogen)를 반복하며 발모와 탈모 주기를 거친다. 탈모는 크게, 성장기 모발이 정상적인 성장 주기를 거쳐 자연스럽게 모낭에서 탈락되는 자연 탈모와, 유전적 요인, 호르몬 분비 이상, 정신적 스트레스, 질병, 약물 부작용 등이 원인이 되어 발생하는 이상 탈모로 분류된다.A typical human's hair goes through a cycle of hair growth and hair loss, repeating the growth phase (anagen) when the hair actively grows, the catagen phase (catagen) when the hair begins to deteriorate, and the resting phase (telogen) when the hair stops growing or goes into rest. Hair loss is broadly classified into natural hair loss, in which growing hair naturally falls out of the hair follicle through a normal growth cycle, and abnormal hair loss, which occurs due to genetic factors, abnormal hormonal secretion, mental stress, disease, and drug side effects.
모발은 피부 부속기관인 모낭에서 성장하는데, 모낭에는 모구, 모유두, 모기질, 멜라닌형성세포, 피지선, 기모근 등이 존재한다. 모유두세포(dermal papilla cell)는 모낭 하부의 모유두에 위치한 섬유아세포(dermal fibroblast cell)의 일종으로 모유두세포에는 모세혈관이 분포하고 있어 이를 통해 모낭에 산소와 영양을 공급하고, IGF-1(insulinlike growth fator-1), KGF(keratinocyte growth factor), β-FGF(β-fibroblast growth factor), HGF(hepatocyte growth factor), SCF(stem cell factor), VEGF(vascular endothelial growth factor) 등의 성장인자(growth factor)와, EGF(Epidermal growth factor)와 TGF-β(transforming growth factor-β) 등의 저해인자 (inhibition factor)를 분비하여 모낭 상피세포의 성장을 조절한다.Hair grows in hair follicles, which are skin appendages, and hair follicles contain hair bulbs, dermal papilla, hair matrix, melanin forming cells, sebaceous glands, and pili muscles. Dermal papilla cells are a type of dermal fibroblast cell located in the dermal papilla at the bottom of the hair follicle. Capillaries are distributed in the dermal papilla cells, which supply oxygen and nutrients to the hair follicle and IGF-1 (insulinlike growth factor). growth factors such as fator-1), KGF (keratinocyte growth factor), β-FGF (β-fibroblast growth factor), HGF (hepatocyte growth factor), SCF (stem cell factor), and VEGF (vascular endothelial growth factor) It regulates the growth of hair follicle epithelial cells by secreting inhibition factors such as epidermal growth factor (EGF) and transforming growth factor-β (TGF-β).
따라서 모유두세포의 사멸이 억제되고 그 증식이 촉진되면 모발이 건강해지고 모발 성장이 촉진되어, 탈모를 억제할 수 있다. 모발의 성장은 모유두를 들러싸고 있는 상피세포(epithelial cell)가 분열하여 모간(hair shaft)을 만들면서 진행되는데, 이러한 상피세포의 분열은 모유두세포에 의해 조절되며, 남성형 탈모증에서 남성 호르몬이 모낭에 작용하는 부위 역시 모유두로서 모유두세포는 발모에 있어 매우 중요한 역할을 하고 있다.Therefore, if the death of dermal papilla cells is suppressed and their proliferation is promoted, hair becomes healthy, hair growth is promoted, and hair loss can be suppressed. Hair growth progresses as the epithelial cells surrounding the dermal papilla divide to form the hair shaft. This division of epithelial cells is controlled by the dermal papilla cells, and in androgenetic alopecia, male hormones are released into the hair follicles. The area of action is also the dermal papilla. Dermal papilla cells play a very important role in hair growth.
현재 미국 FDA(food and drug administration)로부터 승인받은 탈모치료제는 미녹시딜(minoxidil)과 피나스테라이드(finasteride)가 있으나, 피나스테라이드는 성기능 저하, 기형아 출산 등의 부작용이 보고되어 있으며, 미녹시딜의 경우는 알레르기성 피부염, 가려움증, 사용 중단 시의 탈모 재발 등의 부작용이 보고되어 있다. 따라서 이러한 단점을 보완하여 보다 안전하고, 모낭에서 모유두세포의 증식을 촉진하고 모발 손실 예방과 모발 성장 강화 효과를 가진 새로운 약물의 개발이 필요하다.Currently, there are two types of hair loss treatments approved by the U.S. Food and Drug Administration (FDA): minoxidil and finasteride. However, finasteride has been reported to have side effects such as decreased sexual function and birth defects, and in the case of minoxidil, allergic dermatitis, Side effects such as itching and recurrence of hair loss upon discontinuation of use have been reported. Therefore, it is necessary to develop a new drug that is safer by compensating for these shortcomings and has the effect of promoting the proliferation of dermal papilla cells in hair follicles, preventing hair loss, and enhancing hair growth.
최근 탈모 치료제로서 유도만능줄기세포나 지방조직 유래 중간엽 줄기세포로부터 분화시킨 모유두세포를 두피에 이식하기 위한 세포치료제가 관심을 받고 있다.Recently, as a treatment for hair loss, cell therapy for transplanting dermal papilla cells differentiated from induced pluripotent stem cells or adipose tissue-derived mesenchymal stem cells to the scalp has been attracting attention.
본 발명은 사람 지방조직 유래 중간엽 줄기세포를 모유두세포로 분화시킬 있는 기술 등을 개시한다.The present invention discloses a technology for differentiating human adipose tissue-derived mesenchymal stem cells into dermal papilla cells.
본 발명의 목적은 지방 유래 줄기세포의 모유두세포로의 분화 유도용 조성물을 제공하는 데 있다.The purpose of the present invention is to provide a composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells.
본 발명의 다른 목적은 상기 조성물을 이용하여 지방 유래 줄기세포를 모유두세포로 분화시키는 방법을 제공하는 데 있다.Another object of the present invention is to provide a method for differentiating adipose-derived stem cells into dermal papilla cells using the composition.
본 발명의 다른 목적이나 구체적인 목적은 이하에서 제시될 것이다.Other or specific purposes of the present invention will be presented below.
본 발명은 아래의 실시예에서 확인되는 바와 같이, 모로니사이드(Morroniside)가 bFGF(Fibroblast Growth Factor-basic)와 BMP2((Bone morphogenetic protein 2) 등의 인자와 함께 사람 지방 유래 줄기세포에 처리될 때 그 줄기세포에서, 대조세포로 사용한 상업적으로 판매중인 모유두세포(PromoCell, Human Centered Science, 독일)와 모유두세포의 필수 유전자 발현 등에 있어 유사한 특성을 보이는 모유두세포가 분화 유도되고, 또 그 분화 유도된 모유두세포를 누두 마우수 모델에 투여하였을 때 모낭 형성율과 모낭 직경의 크기, 길이가, 상기 대조세포인 모유두세포(PromoCell)와 유사한 수준으로 나타남을 확인함으로써 완성된 것이다.The present invention, as confirmed in the examples below, allows Morroniside to be treated with human adipose-derived stem cells together with factors such as bFGF (Fibroblast Growth Factor-basic) and BMP2 (Bone morphogenetic protein 2). Then, from the stem cells, dermal papilla cells that show similar characteristics in terms of expression of essential genes of dermal papilla cells and commercially sold dermal papilla cells (PromoCell, Human Centered Science, Germany) used as control cells are induced to differentiate, and the differentiation is induced. This was completed by confirming that when dermal papilla cells were administered to the infundibulum mouse model, the hair follicle formation rate and the size and length of hair follicle diameter were similar to those of the control cells, dermal papilla cells (PromoCell).
본 발명은 이러한 실험 결과에 기초하여 제공되는 것으로, 일 측면에 있어서 본 발명은 모로니사이드를 활성성분으로 포함하는 지방 유래(즉 사람 지방조직에서 분리된) 줄기세포의 모유두세포로의 분화 유도용 조성물로 파악할 수 있다.The present invention is provided based on the results of these experiments. In one aspect, the present invention is for inducing differentiation of fat-derived (i.e. isolated from human adipose tissue) stem cells containing moroniside as an active ingredient into dermal papilla cells. It can be identified by composition.
본 발명에서, 모로니사이드는 단독으로 또는 그 자체는 활성이 없는 담체 성분과 함께 사람 지방 유래 줄기세포의 모유두세포로의 분화를 유도하는 활성성분으로 작용한다. 모로니사이드의 IUPAC 명칭은 「methyl (1S,3R,4aS,8S,8aS)-3-hydroxy-1-methyl-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,3,4,4a,8,8a-hexahydropyrano[3,4-c]pyran-5-carboxylate」인 공지 화합물로 그 CAS 번호는 25406-64-8이며, Wnt/β-catenin 신호 절달 경로를 통해 모발 성장을 조절한다고 알려져 있는 물질이다(Scientific Reports, (2018) 8:13785). In the present invention, moroniside acts alone or together with an inactive carrier component as an active ingredient that induces differentiation of human adipose-derived stem cells into dermal papilla cells. The IUPAC name of moroniside is 「methyl (1S,3R,4aS,8S,8aS)-3-hydroxy-1-methyl-8-[(2S,3R,4S,5S,6R)-3,4,5- It is a known compound called ‘trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,3,4,4a,8,8a-hexahydropyrano[3,4-c]pyran-5-carboxylate’ and its CAS number is 25406. It is -64-8, and is a substance known to regulate hair growth through the Wnt/β-catenin signaling pathway (Scientific Reports, (2018) 8:13785).
본 발명의 조성물은 활성성분인 모로니사이드 이외에 모로니사이드 분화 유도 활성을 보완 또는 상승시키기 위하여 bFGF(Fibroblast Growth Factor-basic) 및/또는 BMP2((Bone morphogenetic protein 2)를 추가로 포함할 수 있으며, 이들 인자는 사람 유래(사람 혈액 등으로부터 분리된 것이거나, 유전자 재조합 방법으로 제조된, 그 아미노산 서열이 사람의 그것과 같은 것을 말함)의 것일 수 있다.In addition to the active ingredient moroniside, the composition of the present invention may additionally contain bFGF (Fibroblast Growth Factor-basic) and/or BMP2 (Bone morphogenetic protein 2) to complement or increase the differentiation inducing activity of moroniside. , these factors may be of human origin (meaning that they are isolated from human blood, etc., or manufactured by genetic recombination, and the amino acid sequence is the same as that of humans).
본 발명의 조성물은 활성성분인 모로니사이드를 지방 유래 줄기세포를 모유두세포로 충분히 또는 의도한 정도로 분화시키기에 필요한 양으로 포함할 수 있다. 통상 3~20 μM의 범위, 특히 5~15 μM의 범위로 포함하게 될 것이다.The composition of the present invention may contain the active ingredient moroniside in the amount necessary to sufficiently differentiate adipose-derived stem cells into dermal papilla cells or to the intended degree. Typically, it will be included in the range of 3 to 20 μM, especially 5 to 15 μM.
또 본 발명의 조성물이 bFGF 및/또는 BMP2를 포함할 경우, 충분히 또는 의도한 정도로 모유두세포로 분화시키기 위하여 bFGF는 3~20 ng/ml 범위, BMP2는 0.3~3 ng/ml의 범위로 포함하는 것이 바람직할 것이다.In addition, when the composition of the present invention contains bFGF and/or BMP2, in order to differentiate into dermal papilla cells sufficiently or to the intended extent, bFGF is contained in the range of 3 to 20 ng/ml and BMP2 is contained in the range of 0.3 to 3 ng/ml. It would be desirable.
본 발명의 조성물은 활성성분인 모로니사이드 이외에 용매를 포함할 수 있다. 그러한 용매는 세포 배양 배지이거나, 완충액, 등장액이거나, 또는 정제수나 DMSO(디메틸 설폭사이드; dimethyl sulfoxide) 등 기타의 적절한 용매일 수 있다. The composition of the present invention may include a solvent in addition to the active ingredient moroniside. Such solvent may be cell culture medium, buffer, isotonic solution, or other suitable solvent such as purified water or dimethyl sulfoxide (DMSO).
또 본 발명에서 세포 배양 배지는 특별한 제한이 없이 당업계에서 포유동물 세포 배양을 위하여 사용되는 모든 기본 배지가 사용될 수 있다. 기본 배지는 세포 성장, 증식 및/또는 증폭을 위한 것으로서, 기본적으로 당류, 아미노산, 무기염을 포함하고, 선택적으로 비타민, 미량원소, 항미생물제, 성장인자, 호르몬, 완충제, 등장화제 등을 포함할 수 있다.In addition, the cell culture medium in the present invention is not particularly limited and any basic medium used in the art for culturing mammalian cells can be used. The basic medium is for cell growth, proliferation and/or amplification, and basically contains sugars, amino acids, mineral salts, and may optionally contain vitamins, trace elements, antimicrobial agents, growth factors, hormones, buffers, isotonic agents, etc. You can.
당류는 단당류, 이당류 등이 사용될 수 있으며, 구체적으로 글루코오스, 프럭토오스, 만노오스, 갈락토오스, 리보오스, 소르보오스, 리불로오스, 락토오스, 말토오스, 수크로오스, 라피노오스 또는 이들의 1종 이상의 혼합물이 사용될 수 있다.Saccharides may be monosaccharides, disaccharides, etc., and specifically include glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, or mixtures of one or more of these. can be used
기본 배지에 포함되는 아미노산은 아스파르트산, 글루타민산, 아스파라긴, 세린, 글루타민, 히스티딘, 글리신, 트레오닌, 아르기닌, 알라닌, 티로신, 시스테인, 발린, 메티오닌, 노르발린, 트립토판, 페닐알라닌, 이솔루신, 루신, 리신, 하이드록시프롤린, 사르코신(sarcosine) 및/또는 프롤린을 포함한다. 아미노산은 바람직하게는 합성 아미노산이며, 그러한 합성 아미노산은 디펩티드, 트리펩티드 형태일 수 있다. 이러한 디펩티드, 트리펩티드는 세포를 포함하는 세포 배양물에서 유리 형태의 아미노산으로 전환될 수 있다. Amino acids included in the basic medium are aspartic acid, glutamic acid, asparagine, serine, glutamine, histidine, glycine, threonine, arginine, alanine, tyrosine, cysteine, valine, methionine, norvaline, tryptophan, phenylalanine, isoleucine, leucine, and lysine. , hydroxyproline, sarcosine and/or proline. The amino acid is preferably a synthetic amino acid, and such synthetic amino acid may be in the form of a dipeptide or tripeptide. These dipeptides and tripeptides can be converted to free amino acids in cell cultures containing cells.
기본 배지에는 당류, 아미노산 이외에, 삼투 균형을 유지하고 나트륨, 칼륨 및 칼슘 이온을 제공하여 막 전위를 조절하는 데 도움이 되는, 염화나트륨, 염화칼륨, 염화칼슘, 황산마그네슘, 인산2수소나트륨 등의 무기염류가 추가로 포함될 수 있다.In addition to sugars and amino acids, the basic medium contains inorganic salts such as sodium chloride, potassium chloride, calcium chloride, magnesium sulfate, and sodium dihydrogen phosphate, which help maintain osmotic balance and regulate membrane potential by providing sodium, potassium, and calcium ions. Additional items may be included.
또한 기본 배지에는 선택적으로 비타민이 포함될 수 있다. 비타민은 많은 것이 세포의 성장과 증식에 필수적이며, 세포에서 충분한 양으로 합성될 수 없으므로 세포 배양 배지에 충분히 보충될 필요가 있다. 비타민 A, 비타민 B군, 비타민 C, 비타민 E 등의 비타민이 기본 배지에 포함될 수 있다. 특히 티아민, 리보플라빈, 피리독신, 시아노코발라민, 비오틴, 엽산, 판토텐산, 니코틴아미드 등의 비타민 B군은 세포의 성장 촉진을 위해 첨가되는 것이 바람직하다. Additionally, the basic medium may optionally contain vitamins. Many vitamins are essential for cell growth and proliferation and cannot be synthesized in sufficient amounts by cells, so they need to be sufficiently supplemented in cell culture media. Vitamins such as vitamin A, B vitamins, vitamin C, and vitamin E may be included in the basic medium. In particular, B vitamins such as thiamine, riboflavin, pyridoxine, cyanocobalamin, biotin, folic acid, pantothenic acid, and nicotinamide are preferably added to promote cell growth.
또한 기본 배지에는 당류, 아미노산, 비타민 이외에도 미량원소, 항생제, 성장인자, 호르몬, 완충제, 등장화제 등이 선택적으로 포함될 수 있다.Additionally, the basic medium may optionally contain trace elements, antibiotics, growth factors, hormones, buffers, isotonic agents, etc. in addition to sugars, amino acids, and vitamins.
미량원소는 적절한 세포 성장을 위해 그리고 효소의 기능 유지를 위해 기본 배지에 첨가될 수 있으며, 이러한 미량원소로서 구리, 아연, 셀레늄, 트리카르복실산 중간체 등을 들 수 있다.Trace elements may be added to the basic medium for proper cell growth and to maintain enzyme function. Examples of such trace elements include copper, zinc, selenium, and tricarboxylic acid intermediates.
항미생물제는 외부 미생물에 의한 오염을 방지를 위하여 기본 배지에 첨가될 수 있으며, 구체적으로 페니실린(penicillin), 스트렙토마이신(streptomycin), 폰지존(fungizone) 등의 항생제, 암포테리신 B 등의 항진균제, 젠타마이신, 시프로플록사신, 아지트로마이신, 타일로신 등의 마이코플라스마 억제제 등이 사용될 수 있다.Antimicrobial agents can be added to the basic medium to prevent contamination by external microorganisms, specifically antibiotics such as penicillin, streptomycin, and fungizone, antifungal agents such as amphotericin B, Mycoplasma inhibitors such as gentamicin, ciprofloxacin, azithromycin, and tylosin may be used.
성장인자는 세포의 증식을 위하여 기본 배지에 첨가될 수 있으며, 그러한 성장인자로서는 표피 성장 인자(epidermal growth factor, EGF), 섬유아세포 성장 인자(fibroblast growth factor, FGF), 인슐린 유사 성장 인자(insulin-like growth factor, IGF), 신경 성장 인자(nerve growth factor, NGF), 혈소판 유래 성장 인자(platelet-derived growth factor, PDGF), 형질 전환 성장 인자(transforming growth factor, TGF) 혈관 내피 증식 인자( vascular endothelial growth factor, VEGF), 액티빈 A 등이 예시될 수 있다.Growth factors can be added to the basic medium for cell proliferation. Such growth factors include epidermal growth factor (EGF), fibroblast growth factor (FGF), and insulin-like growth factor (insulin-like growth factor). like growth factor (IGF), nerve growth factor (NGF), platelet-derived growth factor (PDGF), transforming growth factor (TGF), vascular endothelial growth factor (vascular endothelial growth factor) growth factor (VEGF), activin A, etc. may be examples.
또 기본 배지에 첨가될 수 있는 호르몬으로서는 인슐린, 하이드로코르티손, 트리요오드타이로닌, 에스트로겐, 안드로겐, 프로게스테론, 프롤락틴, 여포 자극 호르몬, 가스트린 방출 펩티드, 덱사메타손, 에스트라디올, 글루카곤 등을 들 수 있다. Additionally, hormones that can be added to the basic medium include insulin, hydrocortisone, triiodothyronine, estrogen, androgen, progesterone, prolactin, follicle-stimulating hormone, gastrin-releasing peptide, dexamethasone, estradiol, and glucagon.
또 기본 배지에는 시트레이트, 포스페이트, 숙시네이트, 타르트레이트, 푸마레이트, 글루코네이트, 옥살레이트, 락테이트, 아세테이트, 히스티딘, 트리스 등의 완충제가 포함되거나 염화나트륨, 염화칼륨, 붕산, 붕산나트륨, 만니톨, 글리세린, 프로필렌글리콜, 폴리에틸렌, 글리콜, 말토스, 자당, 에리쓰리톨, 아라비톨, 자일리톨, 소르비톨 트리할로즈, 포도당 등의 등장화제가 포함될 수 있다.Additionally, the basic medium contains buffering agents such as citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, and tris, or sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, and glycerin. , propylene glycol, polyethylene, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, glucose, etc. may be included.
또 기본 배지에는 제1형 또는 제2형 콜라겐, 젤라틴, 피브로넥틴, 라미닌, 폴리-L-리신, 폴리-D-리신 등의 세포 접착 인자나, 염분, 유리지방산, 호르몬, 비타민과 결합하여 조직과 세포 사이에서 운반하고 pH, 삼투압을 조절하는 역할을 하는 알부민이나, 철 수송에 중요한 역할을 하는 트랜스페린 (Transferrin) 등이 추가로 포함될 수 있다.In addition, the basic medium contains cell adhesion factors such as type 1 or 2 collagen, gelatin, fibronectin, laminin, poly-L-lysine, and poly-D-lysine, as well as salt, free fatty acids, hormones, and vitamins that bind to tissue and Albumin, which transports between cells and plays a role in regulating pH and osmotic pressure, and transferrin, which plays an important role in iron transport, may be additionally included.
이러한 기본 배지는 직접 조제하여 사용하거나 상업적으로 시판되는 것을 사용할 수 있는데, 상업적으로 시판되는 배지는 예컨대, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM/F12, MEM-α (Minimal Essential Medium-α), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A 배지, AmnioMax complete 배지, AminoMaxⅡ complete 배지, EBM (Endothelial Basal Medium) 배지, Chang's Medium, MesenCult-XF, DMEM/HG (Dulbecco's Modified Eagle's Medium high glucose)배지, 및 MCDB+DMEM/LG (MCDB +Dulbecco's Modified Eagle's Medium low glucose) 배지 등일 수 있다. These basic media can be prepared directly or used commercially. Commercially available media include, for example, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), and RPMI 1640. , F-10, F-12, DMEM/F12, MEM-α (Minimal Essential Medium-α), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A medium, AmnioMax complete medium, AminoMaxⅡ complete medium, EBM (Endothelial Basal Medium) medium, Chang's Medium, MesenCult-XF, DMEM/HG (Dulbecco's Modified Eagle's Medium high glucose) medium, and MCDB+DMEM/LG (MCDB +Dulbecco's Modified Eagle's Medium low glucose) medium. You can.
본 발명의 조성물에 포함되는 용매는 완충액일 수도 있는데, 완충액은 시트레이트, 포스페이트, 숙시네이트, 타르트레이트, 푸마레이트, 글루코네이트, 옥살레이트, 락테이트, 아세테이트, 히스티딘, 트리스 등을 완충제로 포함하는 생리 식염수(saline solution)일 수 있다. 특히 인산 완충 생리 식염수(Phosphate Buffered Saline, PBS), 트리스 완충 생리 식염수(Tris Buffered Saline, TBS), HEPES 완충 생리 식염수(HEPES Buffered Saline), DPBS(Dulbecco's phosphate-buffered saline) 등일 수 있다.The solvent included in the composition of the present invention may be a buffer solution, which includes citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, tris, etc. It may be a physiological saline solution. In particular, it may be phosphate buffered saline (PBS), Tris Buffered Saline (TBS), HEPES Buffered Saline, DPBS (Dulbecco's phosphate-buffered saline), etc.
본 발명의 조성물에 포함되는 용매는 또한 염화나트륨, 염화칼륨, 붕산, 붕산나트륨, 만니톨, 글리세린, 프로필렌글리콜, 폴리에틸렌, 글리콜, 말토스, 자당, 에리쓰리톨, 아라비톨, 자일리톨, 소르비톨 트리할로즈, 포도당 등을 등장화제로 포함하는 등장액일 수도 있다. 이러한 등장액은 링거액, 젖산 링거액, 아세트산 링거액, 중탄산 링거액, 5% 글루코스 수용액일 수 있으며, 직접 제조하여 사용하거나 상업적으로 시판되는 것을 구입하여 사용할 수 있다.Solvents included in the composition of the present invention may also include sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, glycerin, propylene glycol, polyethylene, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, glucose. It may be an isotonic solution containing such as an isotonic agent. This isotonic solution may be Ringer's solution, lactate Ringer's solution, acetic acid Ringer's solution, bicarbonate Ringer's solution, or 5% glucose aqueous solution, and can be prepared and used directly or purchased commercially.
본 발명의 지방 유래 줄기세포(adipose-derived stem cell, ADSC)는 자가 재생능(self-renewal)을 가지고 피부, 연골, 뼈 등 다양한 계열의 세포로 분화가 가능할 뿐만 아니라 골수 유래 줄기세포나 제대혈 유래 줄기세포에 비해 채취하기가 쉽고 대량 배양이 가능하면서도 줄기세포 함유량이 많기 때문에 세포치료제서의 활용도가 높다. 지방 유래 줄기세포는 자가재생능과 분화능을 갖는 것이면, 그 유래는 특별한 제한이 없이, 사람, 원숭이, 돼지, 말, 소, 양, 개, 고양이, 마우스 또는 토끼 등으로부터 유래한 것일 수 있다. 바람직하게는 사람으로부터 유래한 것이다. 지방 유래 줄기세포의 분리, 배양, 증식 방법 등과 관련해서는 당업계에 공지되어 있으며, 구체적으로 문헌[Aronowitz et al. SpringerPlus (2015) 4:713], 문헌[Scientific Report, 2017, 7:10015], 문헌[J Vis Exp. 2019 Dec; 16(154):e59419], 문헌[Cell Regeneration (2015) 4:7], 한국 등록특허 제10-2431623호 등을 참조할 수 있다.The adipose-derived stem cells (ADSC) of the present invention have self-renewal ability and can differentiate into cells of various types such as skin, cartilage, and bone, as well as bone marrow-derived stem cells or umbilical cord blood-derived stem cells. Compared to stem cells, it is easier to collect and can be cultured in large quantities, and because it contains a large amount of stem cells, it is highly utilized in cell therapy products. As long as adipose-derived stem cells have self-renewal and differentiation abilities, their origin is not particularly limited and may be derived from humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, or rabbits. Preferably it is of human origin. Methods for isolating, culturing, and proliferating adipose-derived stem cells are known in the art, and are specifically described in Aronowitz et al. SpringerPlus (2015) 4:713], Scientific Report, 2017, 7:10015, J Vis Exp. 2019 Dec; 16(154):e59419], literature [Cell Regeneration (2015) 4:7], Korean Patent No. 10-2431623, etc.
다른 측면에서 있어서, 본 발명은 지방 유래 줄기세포 배양 배지에 전술한 바의 본 발명의 분화 유도용 조성물을 처리하고 배양하는 단계를 포함하는 지방 유래 줄기세포로부터 분화된 모유두세포의 제조 방법 방법에 관한 것이다.In another aspect, the present invention relates to a method for producing dermal papilla cells differentiated from adipose-derived stem cells, comprising the step of treating and culturing the composition for inducing differentiation of the present invention as described above in the adipose-derived stem cell culture medium. will be.
본 발명의 방법에서, 배양 온도는 25~40℃ 범위, 바람직하게는 35±2℃일 수 있다. In the method of the present invention, the culture temperature may be in the range of 25-40°C, preferably 35±2°C.
또 본 발명의 방법에서, 배양은 모유두세포로의 분화가 충분히 또는 의도한 만큼 이루어질 될 때가지 수행된다. 일부 구현예에서, 배양은 24시간, 48시간, 72시간, 96시간, 5일, 6일, 7일, 8일, 9일 이상의 기간 동안 수행될 수 있다. Also, in the method of the present invention, culture is performed until differentiation into dermal papilla cells is sufficient or achieved as intended. In some embodiments, culturing can be performed for a period of 24 hours, 48 hours, 72 hours, 96 hours, 5 days, 6 days, 7 days, 8 days, 9 days, or more.
또 본 발명의 방법에서, 배양은모유두세포로의 분화가 원활히 이루어지도록, 이산화탄소(CO2)의 양이 10 % 내지 1 % (v/v), 바람직하게는 8 % 내지 2 % (v/v), 특히 5 % (v/v)에서 수행될 수 있다.In addition, in the method of the present invention, in order to facilitate differentiation into hair papilla cells, the amount of carbon dioxide (CO 2 ) is 10% to 1% (v/v), preferably 8% to 2% (v/v). ), especially at 5% (v/v).
또 본 발명의 방법에서, 배양은 폐쇄된 배양기에서, 특히 멸균된 상태가 유지되는 폐쇄 배양기에서 수행될 수 있다. 본 발명에 적합한 배양기는 GE Xuri W25, GE Xuri W5, Sartorius BioSTAT RM 20 | 50, Finesse SmartRocker Bioreactor Systems, Pall XRS Bioreactor Systems 등일 수 있다. Also, in the method of the present invention, the culture can be performed in a closed incubator, especially in a closed incubator in which a sterile state is maintained. Incubators suitable for the present invention include GE Xuri W25, GE Xuri W5, Sartorius BioSTAT RM 20 | 50, Finesse SmartRocker Bioreactor Systems, Pall XRS Bioreactor Systems, etc.
또 다른 측면에 있어서, 본 발명은 전술한 바의 제조 방법에 따라 얻어진, 지방 유래 줄기세포로부터 분화된 모유두세포를 유효성분으로 포함하는 탈모 예방 또는 발모 촉진용 조성물에 관한 것이다.In another aspect, the present invention relates to a composition for preventing hair loss or promoting hair growth comprising as an active ingredient dermal papilla cells differentiated from adipose-derived stem cells, obtained according to the production method described above.
본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체 또는 부형제를 포함하여 투여 경로에 따라 당업계에 공지된 통상의 방법으로 경구용 또는 비경구용 제형으로 제조될 수 있다. The pharmaceutical composition of the present invention can be prepared as an oral or parenteral dosage form by a conventional method known in the art depending on the route of administration, including a pharmaceutically acceptable carrier or excipient.
그러한 약제학적으로 허용가능한 담체 또는 부형제는 인체에 특별한 독성을 가지지 않으면서 약물의 활성이나 특성을 저해하지 않는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물(예를 들면, 식염수 및 멸균수), 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘, 미네랄 오일, 링거액, 완충제, 말토덱스트린 용액, 글리세롤, 에탄올, 덱스트란, 알부민, 또는 이들의 임의의 조합일 수 있다. 특히 본 발명의 약제학적 조성물이 액상 용액으로 제제화될 경우 적합한 담체 또는 부형제로서는, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사 용액, 덱스트로스 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 등의 성분 중에서 하나 이상의 성분을 단독 또는 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 의약품 첨가제 등을 첨가하여 사용할 수 있다.Such pharmaceutically acceptable carriers or excipients are those that do not inhibit the activity or properties of the drug without being particularly toxic to the human body, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, algae, etc. Nate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water (e.g. saline and sterile water), syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc. , magnesium stearate, mineral oil, Ringer's solution, buffer, maltodextrin solution, glycerol, ethanol, dextran, albumin, or any combination thereof. In particular, when the pharmaceutical composition of the present invention is formulated as a liquid solution, a suitable carrier or excipient may be one of the following ingredients: saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, and ethanol. The above ingredients can be used alone or in combination, and other common pharmaceutical additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed.
본 발명의 약제학적 조성물이 경구 투여제로 제제될 경우는 정제, 트로키, 캡슐, 엘릭서, 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있고 비경구 투여제 특히 주사제로 제제화 경우 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 본 발명의 약제학적 조성물은 용액, 현탁액, 정제, 환약, 캡슐, 서방형 제제 등의 형태로도 제조화할 수 있다.When the pharmaceutical composition of the present invention is formulated for oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and when formulated for parenteral administration, especially as an injection, it can be manufactured in unit dosage ampoules or multiple doses. It can be prepared in single dosage form. The pharmaceutical composition of the present invention can be manufactured in the form of solutions, suspensions, tablets, pills, capsules, sustained-release preparations, etc.
본 발명의 약제학적 조성물은 약제학적 분야에서 통상의 방법에 따라 환자의 신체 내 투여에 적합한 단위 투여형의 제제 형태로 제형화시켜 당업계에서 통상적으로 사용하는 투여 방법을 이용하여 경구 투여 경로나, 또는 피부, 병변 내(intralesional), 정맥 내, 근육 내, 동맥 내, 골수 내, 수막강 내, 심실 내, 폐, 경피, 피하, 복 내, 비강 내, 소화관 내, 국소, 설하, 질 내, 직장 경로 등 비경구 투여 경로에 의하여 투여될 수 있다.The pharmaceutical composition of the present invention is formulated into a unit dosage form suitable for administration into the patient's body according to a conventional method in the pharmaceutical field, and is administered through an oral administration route using an administration method commonly used in the art. or on the skin, intralesional, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, pulmonary, transdermal, subcutaneous, intraperitoneal, intranasal, digestive tract, topical, sublingual, intravaginal, It can be administered by parenteral administration routes, such as the rectal route.
본 발명의 약제학적 조성물의 투여량(유효량)은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성별, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있고, 당업자라면 이러한 요인들을 고려하여 투여량을 적절히 결정할 수 있다. 바람직한 양태에 있어 본 발명의 약제학적 조성물은 단위 용량 형태의 주사제로 제조되며, 단위 용량 형태의 주사제로 제조될 경우 본 발명의 약제학적 조성물의 단위 용량 당 포함되는 모우두세포의 양은 102-107 cell/ml 범위일 수 있다. The dosage (effective amount) of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, gender, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. It can be prescribed appropriately, and a person skilled in the art can appropriately determine the dosage by considering these factors. In a preferred embodiment, the pharmaceutical composition of the present invention is prepared as an injection in the form of a unit dose. When prepared as an injection in the form of a unit dose, the amount of hair follicle cells contained per unit dose of the pharmaceutical composition of the present invention is 10 2 -10. It may be in the range of 7 cells/ml.
전술한 바와 같이, 본 발명에 따르면 지방 유래 줄기세포의 모유두세포로의 분화 유도용 조성물과 그 조성물을 이용한 모유두세포의 분화 방법 그리고 탈모 예방 또는 발모 촉진 약학적 조성물을 제공할 수 있다.As described above, according to the present invention, it is possible to provide a composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells, a method for differentiating dermal papilla cells using the composition, and a pharmaceutical composition for preventing hair loss or promoting hair growth.
본 발명의 분화 유도용 조성물과 분화 방법은 모로니사이드를 이용하여 지방 유래 줄기세포로부터 모유두세포를 분화시킬 수 있는 기술로서, 이러한 분화된 모유두세포는 탈모 치료를 위한 세포치료제로서 유용한 효과를 가질 수 있다. The composition and differentiation method for inducing differentiation of the present invention are techniques for differentiating dermal papilla cells from adipose-derived stem cells using moroniside, and these differentiated dermal papilla cells can have a useful effect as a cell therapy agent for hair loss treatment. there is.
도 1은 본 발명에 따라 사람 지방 유래 줄기세포로부터 모유두세포를 분화시키는 과정을 보여주는 그림이다.Figure 1 is a diagram showing the process of differentiating dermal papilla cells from human adipose-derived stem cells according to the present invention.
도 2는 본 발명의 모유두세포로의 분화를 유도하는 물질에 의한 사람 지방 유래 줄기세포에서의 독성을 확인한 결과이다.Figure 2 shows the results of confirming the toxicity of the substance inducing differentiation into dermal papilla cells of the present invention in human adipose-derived stem cells.
도 3은 사람 지방 유래 줄기세포로부터 모유두세포로 분화를 유도한 후 모유두세포 필수 인자인 Versican, Corin, Bmp2, Bmp4의 유전자의 발현 정도를 확인한 결과이다.Figure 3 shows the results of confirming the expression level of genes of Versican, Corin, Bmp2, and Bmp4, which are essential factors for dermal papilla cells, after inducing differentiation from human adipose-derived stem cells into dermal papilla cells.
도 4는 사람 지방 유래 줄기세포로부터 모유두세포로 분화를 유도한 후 Wnt5α와 관련한 모유두세포 성장 인자인 Wnt5α, Lef-1, Hey-1, Wif-1의 유전자의 발현 정도를 확인한 결과이다.Figure 4 shows the results of confirming the expression level of genes for Wnt5α, Lef-1, Hey-1, and Wif-1, which are dermal papilla cell growth factors related to Wnt5α, after inducing differentiation from human adipose-derived stem cells into dermal papilla cells.
도 5는 세포 비투여 대조군(#1), 사람 지방 유래 줄기세포 투여군(#2), 대조세포인 모유두세포 투여군(#3), 분화 세포 투여군(#4)의 마우스 조직을 H&E 염색하여 모낭 형성 정도를 나타낸 사진이다.Figure 5 shows hair follicle formation by H&E staining of mouse tissues of the non-cell-administered control group (#1), human adipose-derived stem cell-administered group (#2), control dermal papilla cell-administered group (#3), and differentiated cell-administered group (#4). This is a photo showing the extent.
이하 본 발명을 실시예를 참조하여 설명한다. 그러나 본 발명의 범위가 이러한 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described with reference to examples. However, the scope of the present invention is not limited to these examples.
<실시예 1> 사람 지방 유래 줄기세포로의 분리 및 배양<Example 1> Isolation and culture of human adipose-derived stem cells
본 발명에서 사용한 사람 지방조직은 고마바이오텍(주)(Seoul, Korea)에서 구입하였으며, 지방조직에서 줄기세포의 분리는 Zuk 등의 방법(Mol Biol Cell. 2022 Dec; 13(12): 4279-4295)에 준하여 수행하였다. Human adipose tissue used in the present invention was purchased from Goma Biotech Co., Ltd. (Seoul, Korea), and stem cells were isolated from adipose tissue by the method of Zuk et al. (Mol Biol Cell. 2022 Dec; 13(12): 4279-4295 ) was performed in accordance with.
지방조직에서 줄기세포를 분리한 후, 페니실린(100 U/ml), 스트렙토마이신(100 ug/ml) 및 10% 열비활성 혈청을 첨가한 DMEM(Dulbecco’s Modified Eagle’s Medium)에서 95% 공기, 5% CO₂와 37℃ 조건으로 배양하였다. 배양 접시에 부착되어 세포가 자라면 0.25% 트립신/10 mM EDTA를 이용하여 세포를 모으고, Fetal Bovine Serum(FBS)을 10%(w/v) 첨가한 DMEM에서 유지하였다.After isolating stem cells from adipose tissue, they were cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with penicillin (100 U/ml), streptomycin (100 ug/ml), and 10% heat-inactivated serum in 95% air and 5% CO₂. and cultured at 37°C. When the cells attached to the culture dish grew, they were collected using 0.25% trypsin/10 mM EDTA and maintained in DMEM supplemented with 10% (w/v) Fetal Bovine Serum (FBS).
또한 사람 지방 유래 줄기세포로부터 분화시킨 세포의 특성을 비교하기 위해 PromoCell 社의 사람 모유두세포를 구입하여 대조군(Dermal papilla cell, DPC)으로 사용하였으며, 배양 방법은 사람 지방 유래 줄기세포를 배양하는 방법과 같다.In addition, in order to compare the characteristics of cells differentiated from human adipose-derived stem cells, human dermal papilla cells were purchased from PromoCell and used as a control (Dermal papilla cell, DPC). The culture method was one of culturing human adipose-derived stem cells. same.
<실시예 2> 분화 유도용 배지의 제조<Example 2> Preparation of medium for inducing differentiation
본 발명에서는 사람 지방 유래 줄기세포로부터 모유두세포를 분화시키기 위하여 새로운 조성의 분화 유도 배지를 제조하였다. 해당 배지는 실시예 1에서와 같이 사람 지방 유래 줄기세포를 배양하기 위해 사용하는 배지(FBS를 10%(w/v) 첨가한 DMEM)에 모유두세포로의 분화를 유도하기 위한 유효성분으로서 기본섬유아세포성장인자(Fibroblast Growth Factor-basic, bFGF) 10 ng/ml, 뼈형성단백질 2(Bone morphogenetic protein 2, BMP2) 1 ng/ml 및 모로니사이드(Morroniside) 10 μM 3가지를 혼합하여 제조하였다. 이렇게 제조한 분화 유도 조성물은 하기 표 1과 같으며, 편의상 FDI-1(Frombio Differentiation Inducer-1)로 명명하여 표시하였다. 또한 본 발명의 분화 유도 배지와 비교를 위해 대조군으로 모로니사이드 대신, 기존 모유두세포의 분화에 유효한 것으로 알려진 6BIO(6-bromo-indirubin-3’-oxime)를 넣은 분화 유도 배지를 사용하였다.In the present invention, a differentiation inducing medium of a new composition was prepared to differentiate dermal papilla cells from human adipose-derived stem cells. The medium is a medium used for culturing human adipose-derived stem cells as in Example 1 (DMEM supplemented with 10% (w/v) FBS) and basic fiber as an active ingredient for inducing differentiation into dermal papilla cells. It was prepared by mixing 10 ng/ml of fibroblast growth factor-basic (bFGF), 1 ng/ml of bone morphogenetic protein 2 (BMP2), and 10 μM of morroniside. The differentiation inducing composition prepared in this way is shown in Table 1 below, and was named FDI-1 (Frombio Differentiation Inducer-1) for convenience. In addition, for comparison with the differentiation induction medium of the present invention, a differentiation induction medium containing 6BIO (6-bromo-indirubin-3'-oxime), which is known to be effective in the differentiation of existing dermal papilla cells, was used instead of moroniside as a control group.
실험에서 사용된 분화 유도 물질인 bFGF, BMP2, 6BIO, 모로니사이드(Morroniside)는 시그마-알드리치(Sigma-aldrich) 사에서 구입하여 사용하였다The differentiation inducing substances used in the experiment, bFGF, BMP2, 6BIO, and Morroniside, were purchased from Sigma-Aldrich.
분화 유도 조성물의 조성Composition of differentiation inducing composition
조성물 종류Composition type 용매menstruum 첨가 물질 1Added substance 1 첨가 물질 2 Additive substance 2 첨가 물질 3 Additive substance 3
분화 유도 조성물
(FDI-1)Differentiation-inducing composition
(FDI-1) 		DMEM
(10% FBS)DMEM
(10% FBS) 		10 ng/ml bFGF10 ng/ml bFGF 1 ng/ml BMP21 ng/ml BMP2 10 μM Morroniside10 μM Morroniside
비교군comparison group 10 μM 6BIO10 μM 6BIO
<실시예 3> 사람 지방 유래 줄기세포로부터 모유두세포로의 분화 방법사람 지방 유래 줄기세포를 6-well plates에 1 × 105 cells/well의 농도로 1 ml씩 접종하여 실시예 1에서 사용한 배양조건으로 24시간 동안 배양하였다. 세포가 바닥에 부착되면 용매인 DPBS(Dulbecco’s Phosphate-buffered saline)로 세척한 후 FDI-1를 처리하여 분화를 유도하였다. 본 발명에 따라 사람 지방 유래 줄기세포의 모유두세포로의 분화 과정의 개략도를 도 1에 나타내었다. <Example 3> Method of differentiating human adipose-derived stem cells into dermal papilla cells Human adipose-derived stem cells were inoculated into 6-well plates at a concentration of 1 × 10 5 cells/well, 1 ml each, and culture conditions used in Example 1 were used. and cultured for 24 hours. When the cells attached to the bottom, they were washed with the solvent DPBS (Dulbecco's Phosphate-buffered saline) and then treated with FDI-1 to induce differentiation. A schematic diagram of the differentiation process of human adipose-derived stem cells into dermal papilla cells according to the present invention is shown in Figure 1.
<실시예 4> 분화 유도 물질의 사람 지방 유래 줄기세포에서의 독성 확인<Example 4> Confirmation of toxicity of differentiation-inducing substances in human adipose-derived stem cells
독성 확인을 위해 사용한 시약인 CCK-8은 (주)동인바이오텍(Seoul, Korea)에서 구입하여 사용하였으며, 사람 지방 유래 줄기세포는 상기 실시예 1에서 분리한 세포를 이용하였다.CCK-8, a reagent used to confirm toxicity, was purchased from Dongin Biotech (Seoul, Korea), and human adipose-derived stem cells were used as cells isolated in Example 1 above.
사람 지방 유래 줄기세포를 96-well plates에 1 × 104 cells/well의 농도로 100 ul씩 처리한 다음 실시예 1에서 사용한 배양조건으로 24시간 배양하였다. 세포가 바닥에 부착되면 용매인 DPBS로 세척한 후 FDI-1을 처리하여 최대 72시간까지 배양하였다. 지정된 시간(24, 48, 72시간)에 10 ul의 CCK-8 시약과 사람 지방 유래 줄기세포 배양 배지 100 ul의 조건으로 3시간 동안 배양시킨 후 540 nm에서 스펙트로포토미터(spectrophotometer)로 흡광도를 측정하였다.100 ul of human adipose-derived stem cells were treated in 96-well plates at a concentration of 1 × 10 4 cells/well, and then cultured for 24 hours under the culture conditions used in Example 1. When the cells attached to the bottom, they were washed with DPBS, a solvent, and then treated with FDI-1 and cultured for up to 72 hours. At designated times (24, 48, 72 hours), culture was performed for 3 hours with 10 ul of CCK-8 reagent and 100 ul of human adipose-derived stem cell culture medium, and then the absorbance was measured with a spectrophotometer at 540 nm. did.
그 결과, 도 2에서 확인되는 바와 같이, 지정된 시간에서 FDI-1에 의한 사람 지방 유래 줄기세포에서의 독성은 나타나지 않았다. 특히, 72시간 결과에서 6BIO 등을 처리한 비교군에 비해 FDI-1를 처리한 실험군에서 세포 성장률이 더욱 높은 것을 확인할 수 있다.As a result, as confirmed in Figure 2, no toxicity was observed in human adipose-derived stem cells caused by FDI-1 at the designated time. In particular, the 72-hour results show that the cell growth rate was higher in the experimental group treated with FDI-1 compared to the comparison group treated with 6BIO.
<실시예 5> 분화 유도 후 모유두세포 필수 유전자 발현양 확인<Example 5> Confirmation of expression level of essential genes in dermal papilla cells after differentiation induction
사람 지방 유래 줄기세포를 6-well plates에 1 × 105 cells/well의 농도로 1 ml씩 접종한 후 세포가 바닥에 부착되면 FDI-1을 처리하여 72시간 동안 배양 한 후 72시간 동안 모유두세포로의 분화를 유도한 후 부착된 세포를 Trizol Reagent(Invitrogen)를 이용하여 Total RNA를 분리하였다. 다음 SuperscriptII reverse transcriptase (Invitrogen)와 올리고 dT를 이용하여 1 ㎍ total RNA로부터 cDNA를 합성하였다. 합성된 cDNA 및 아래 표 1의 지방 유래 줄기세포 특이적 표지 유전자의 프라이머를 이용하여 SYBR green method 방법으로 실시간 PCR(Real-time PCR)을 수행하였다. SYBR Green I는 이중가닥 DNA에 결합하여 형광을 나타내는 인터킬레이트(interchelator)이다. 인터킬레이트(Interchelator)는 PCR 반응으로 합성된 이중 가닥 DNA에 결합하여 형광을 발하며 이 형광강도를 검출하여 증폭산물의 생성량을 측정할 수 있다.After inoculating 1 ml of human adipose-derived stem cells at a concentration of 1 After inducing differentiation into cells, total RNA was isolated from the attached cells using Trizol Reagent (Invitrogen). Next, cDNA was synthesized from 1 μg total RNA using SuperscriptII reverse transcriptase (Invitrogen) and oligo dT. Real-time PCR (Real-time PCR) was performed using the SYBR green method using the synthesized cDNA and primers for adipose-derived stem cell-specific marker genes in Table 1 below. SYBR Green I is an interchelator that binds to double-stranded DNA and exhibits fluorescence. Interchelator emits fluorescence by binding to double-stranded DNA synthesized through PCR reaction, and the amount of amplification product produced can be measured by detecting this fluorescence intensity.
모유두세포 필수 유전자의 프라이머 서열Primer sequences of essential genes for hair papilla cells
Versican-ForwardVersican-Forward TGGAATGATGTTCCCTGCAATGGAATGATGTTCCCTGCAA
Versican-ReverseVersican-Reverse AAGGTCTTGGCATTTTCTACAAGGTCTTGCATTTTCTAC
Corin-ForwardCorin-Forward CCCTCCTTGCAGGGCATTGTCCTCCTTGCAGGGCATTGT
Corin-ReverseCorin-Reverse CACTGTCCTGAGCGGCACTTCACTGTCCTGAGCGGCACTT
Bmp2-ForwardBmp2-Forward CCATGGATTCGTGGTGGAAGCCATGGATTCGTGGGTGGAAG
Bmp2-ReverseBmp2-Reverse CTTGGTGCAAAGACCTGCTTCTTGGTGCAAAGACCTGGCTT
Bmp4-ForwardBmp4-Forward CGGGCCAGGAAGAAGAATAACGGGCCAGGAAAGAAGAATAA
Bmp4-ForwardBmp4-Forward CCAGTCATTCCAGCCCACATCCAGTCATTCCAGCCCACAT
모유두세포의 필수적인 유전자로 알려진 Versican, Corin, Bmp2, Bmp4의 발현량을 실시간 PCR을 이용하여 확인한 결과, 도 3에서 보여지는 바와 같이, 사람 유래 지방 줄기세포에 비해 FDI-1을 처리한 세포에서 모유두세포 필수 유전자의 발현이 매우 높았다. 또한, FDI-1을 처리한 실험군에서 유전자의 발현 수준이 구입한 모유두세포와 유사한 수준으로 발현되고, 비교군에 비해서는 더욱 높은 발현 수준을 보이는 것으로 확인하였다. 이를 통해, 기존에 알려진 6BIO가 첨가된 비교군에 비해 모로니사이드(Morroniside)를 첨가한 FDI-1이 모유두세포로의 분화를 같은 배양 기간 동안 더욱 효율적으로 분화를 유도할 수 있음을 알 수 있다.As a result of confirming the expression level of Versican, Corin, Bmp2, and Bmp4, which are known to be essential genes for dermal papilla cells, using real-time PCR, as shown in Figure 3, dermal papilla cells treated with FDI-1 compared to human-derived adipose stem cells Expression of cell essential genes was very high. In addition, it was confirmed that in the experimental group treated with FDI-1, the gene expression level was similar to that of the purchased dermal papilla cells, and that the expression level was higher than that of the comparison group. Through this, it can be seen that FDI-1 with Morroniside can induce differentiation into dermal papilla cells more efficiently during the same culture period compared to the previously known comparison group with 6BIO. .
<실시예 6> 분화 유도 후 Wnt5α 관련한 모유두세포 성장 유전자 발현양 확인<Example 6> Confirmation of expression level of hair papilla cell growth gene related to Wnt5α after differentiation induction
상기 실시예 4에서 제조한 cDNA를 사용하여 동일한 방법으로 줄기세포 전분화능 표지 유전자의 발현양을 조사하였다.Using the cDNA prepared in Example 4, the expression level of the stem cell pluripotency marker gene was examined in the same manner.
Wnt5α와 관련한 모유두세포 성장 유전자인 Wnt5α, Lef-1, Hey-1, Wif-1의 발현량을 실시간 PCR을 이용하여 확인하였으며, 각 인자의 프라이머 서열은 하기 표 3와 같다.The expression levels of Wnt5α-related dermal papilla cell growth genes Wnt5α, Lef-1, Hey-1, and Wif-1 were confirmed using real-time PCR, and the primer sequences for each factor are shown in Table 3 below.
Wnt5α와 관련한 모유두세포 성장 유전자의 프라이머 서열Primer sequence of dermal papilla cell growth gene related to Wnt5α
Wnt5α-ForwardWnt5α-Forward GCGAGACGGCCTTCACATAGCGAGACGGCCTTCACATA
Wnt5α-ReverseWnt5α-Reverse CCACGAACTCCTTGGCAAAGCCACGAACTCCTTGGCAAAG
Lef-1-ForwardLef-1-Forward ACAGATCACCCCACCTCTTGACAGATCACCCCACCTCTTG
Lef-1-ReverseLef-1-Reverse ATAGCTGGATGAGGGATGCCATAGCTGGATGAGGGATGCC
Hey-1-ForwardHey-1-Forward CGAGGTGGAGAAGGAGAGTGCGAGGTGGAGAAGGAGAGTG
Hey-1-ReverseHey-1-Reverse CTGGGTACCAGCCTTCTCAGCTGGGTACCAGCCTTCTCAG
Wif-1-ForwardWife-1-Forward ATGAATTCCTGTCCTTGCGCATGAATTCCTGTCCTTTGCGC
Wif-1-ReverseWif-1-Reverse TCCACTTCAAATGCTGCCACTCCACTTCAAATGCTGCCAC
도 4에서 보여지는 바와 같이, 분화를 유도하지 않은 사람 유래 지방 줄기세포에 비해 FDI-1 및 6BIO가 포함된 비교 조성물을 처리하여 분화를 유도시킨 세포에서 Wnt5α 관련 모유두세포 성장 인자의 발현이 매우 높았고, 특히 대조 분화 유도 배지를 처리한 군에 비해 본 발명의 분화 유도 배지인 FDI-1을 처리한 군에서 Wnt5α 관련 모유두세포 성장 인자의 발현이 비슷하거나 높은 것을 확인할 수 있다. 특히 본 발명의 FDI-1을 처리한 세포의 경우 모유두세포(DPC)에서 발현되는 Wnt5α 관련 모유두세포 성장 인자의 발현 양과 비슷한 것을 확인할 수 있어, 기존에 알려진 분화 유도물질에 비해 FDI-1을 이용하면 사람 유래 지방 줄기세포를 이용하여 모유두세포와 더욱 비슷한 특징을 가질 수 있도록 분화를 유도할 수 있음을 알 수 있다.통계학적 유의성을 검증하고자 각 실험별 음성대조군 결과와의 통계 분석을 Independent T-Test를 통해 분석하였으며, 이를 p-value로 환산하여 나타내었다. 이상의 모든 통계처리는 Excel 프로그램을 이용하여 분석하였다. p-value가 0.05보다 낮은 경우를 통계학적으로 유의하게 분리하고 결과에 별표(*)로 표시하였다. As shown in Figure 4, compared to human-derived adipose stem cells in which differentiation was not induced, the expression of Wnt5α-related dermal papilla cell growth factor was very high in cells that induced differentiation by treatment with a comparative composition containing FDI-1 and 6BIO. , In particular, it can be confirmed that the expression of Wnt5α-related dermal papilla cell growth factor is similar or higher in the group treated with FDI-1, the differentiation induction medium of the present invention, compared to the group treated with the control differentiation induction medium. In particular, in the case of cells treated with FDI-1 of the present invention, it can be confirmed that the expression amount of Wnt5α-related dermal papilla cell growth factor expressed in dermal papilla cells (DPC) is similar to that of the previously known differentiation inducer, using FDI-1 It can be seen that differentiation can be induced using human-derived adipose stem cells to have characteristics more similar to dermal papilla cells. To verify statistical significance, statistical analysis was performed with the results of the negative control group for each experiment using Independent T-Test. It was analyzed through , and it was converted into p-value and expressed. All statistical processing above was analyzed using the Excel program. Cases where the p-value was lower than 0.05 were identified as statistically significant and the results were marked with an asterisk (*).
<실시예 7> 마우스 모델을 이용한 탈모 치료 확인<Example 7> Confirmation of hair loss treatment using mouse model
분화세포의 모발 성장 효과를 검증하기 위해 동물실험 모델로 6주령의 BALB/c 누드마우스에 하기 표 4와 같이 투여하였다. 4주 후 각각의 실험 마우스군을 희생하여 조직시편을 취득한 후 이를 H&E로 염색하여 관찰한 사진을 도 5에 나타내었다.In order to verify the hair growth effect of differentiated cells, 6-week-old BALB/c nude mice were administered as an animal test model as shown in Table 4 below. Four weeks later, each experimental mouse group was sacrificed to obtain tissue specimens, which were then stained with H&E, and the observed photographs are shown in Figure 5.
동물실험 모델 발모 효능시험Animal testing model hair growth efficacy test
구분division 세포 종류cell type 투여 횟수Number of doses 투여 용량Dosage administered 투여 방법Method of administration 관찰 기간observation period
#1#One 음성대조군Negative control group 비투여Non-administration 1회 투여1 dose 1 X 106cells 1 경피 투여 Transdermal administration 4주 (30일)4 weeks (30 days)
#2#2 양성대조군 1 Positive control group 1 사람 지방 유래 줄기세포Human adipose-derived stem cells
#3#3 양성대조군 2 Positive control group 2 모유두세포hair papilla cells
#4#4 시험군test group FDI-1 분화세포FDI-1 differentiated cells
그 결과, 음성대조군인 세포 비투여군에 비해 FDI-1으로 분화를 유도한 세포 투여군(#4)에서 모낭의 형성이 매우 높은 빈도로 발생하였음을 확인할 수 있다(화살표 표시 참조). 특히 양성대조군으로 사용된 사람 지방 유래 줄기세포 투여군(#2)에 비해 분화세포 투여군(#4)에서 모낭의 직경이 크고 길이가 긴 것을 확인하였다. 또한 모유두세포 투여군(#3)과 비교하여 분화세포 투여군(#4)의 모낭 형성율과 모낭 직경의 크기, 길이가 비슷한 수준으로 나타나는 것으로 보아 본 발명에 따라 사람 지방 유래 줄기세포로부터 분화시킨 세포가 모유두세포와 비슷한 기능을 하고 있음을 알 수 있다.As a result, it can be seen that the formation of hair follicles occurred at a very high frequency in the group administered cells (#4) induced differentiation with FDI-1 compared to the group not administered cells, which was the negative control group (see arrow). In particular, it was confirmed that the hair follicles in the differentiated cell-administered group (#4) were larger in diameter and longer than the human adipose-derived stem cell-administered group (#2), which was used as a positive control group. In addition, compared to the dermal papilla cell administration group (#3), the hair follicle formation rate and the size and length of hair follicle diameter were similar in the differentiated cell administration group (#4), indicating that cells differentiated from human adipose-derived stem cells according to the present invention were It can be seen that it has a similar function to dermal papilla cells.

Claims (7)

  1. 모로니사이드를 활성성분으로 포함하는 지방 유래 줄기세포의 모유두세포로의 분화 유도용 조성물. A composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells containing moroniside as an active ingredient.
  2. 제1항에 있어서,According to paragraph 1,
    상기 조성물은 활성성분인 모로니사이드 이외에 bFGF(Fibroblast Growth Factor-basic) 및 BMP2((Bone morphogenetic protein 2) 중 하나 이상을 추가로 포함하는 것을 특징으로 하는 조성물.The composition is characterized in that it further contains one or more of bFGF (Fibroblast Growth Factor-basic) and BMP2 ((Bone morphogenetic protein 2)) in addition to the active ingredient moroniside.
  3. 제1항에 있어서,According to paragraph 1,
    상기 모유두세포는 사람 지방 유래 줄기세포인 조성물.A composition in which the dermal papilla cells are human adipose-derived stem cells.
  4. 제1항 내지 제3항 중 어느 한 항 기재의 조성물을, 지방 유래 줄기세포에 처리하고 배양하는 단계를 포함하는, 지방 유래 줄기세포를 모유두세포로 분화시키는 방법.A method of differentiating adipose-derived stem cells into dermal papilla cells, comprising the step of treating adipose-derived stem cells with the composition according to any one of claims 1 to 3 and culturing them.
  5. 제1항 내지 제3항 중 어느 한 항 기재의 조성물을 지방 유래 줄기세포에 처리하고 배양하여 지방 유래 줄기세포를 모유두세포로 분화시키는 단계, 및 분화된 모유두세포를 얻는 단계를 포함하는 지방 유래 줄기세포로부터 모유두세포를 제조하는 방법.Adipose-derived stem comprising treating adipose-derived stem cells with the composition according to any one of claims 1 to 3 and culturing them to differentiate the adipose-derived stem cells into dermal papilla cells, and obtaining differentiated dermal papilla cells. Method for producing dermal papilla cells from cells.
  6. 제5항 기재의 방법에 따라 얻어진 모유두세포.Dermal papilla cells obtained according to the method described in paragraph 5.
  7. 제6항 기재의 모유두세포를 유효성분으로 포함하는 탈모 예방 또는 발모 촉진용 조성물.A composition for preventing hair loss or promoting hair growth comprising the dermal papilla cells of claim 6 as an active ingredient.
PCT/KR2023/015333 2022-10-05 2023-10-05 Composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells, and differentiation method using composition WO2024076173A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0127181 2022-10-05
KR1020220127181A KR102543431B1 (en) 2022-10-05 2022-10-05 Compostion for inducing differentiation of adipose mesenchymal stem cells to dermal papilla cells and the composition for differentiating using the composition

Publications (1)

Publication Number Publication Date
WO2024076173A1 true WO2024076173A1 (en) 2024-04-11

Family

ID=86763546

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/015333 WO2024076173A1 (en) 2022-10-05 2023-10-05 Composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells, and differentiation method using composition

Country Status (2)

Country Link
KR (2) KR102543431B1 (en)
WO (1) WO2024076173A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102543431B1 (en) * 2022-10-05 2023-06-15 주식회사 프롬바이오 Compostion for inducing differentiation of adipose mesenchymal stem cells to dermal papilla cells and the composition for differentiating using the composition

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180137781A (en) * 2017-06-19 2018-12-28 연세대학교 산학협력단 Process for differentiation into dermal papilla cells from adipose-derived stem cells and uses thereof
WO2019017691A2 (en) * 2017-07-19 2019-01-24 서울대학교 산학협력단 Method of differentiation of human induced pluripotent stem cell to dermal papilla precursor cell and use thereof
KR102141641B1 (en) * 2020-01-31 2020-08-06 주식회사 래디안 Method for differentiation of dermal papilla cells from human adipose mesenchymal stem cells
KR102543431B1 (en) * 2022-10-05 2023-06-15 주식회사 프롬바이오 Compostion for inducing differentiation of adipose mesenchymal stem cells to dermal papilla cells and the composition for differentiating using the composition

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102187371B1 (en) * 2019-08-02 2020-12-04 연세대학교 산학협력단 adipose-derived stem cell overexpressing FoxQ1 and uses thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180137781A (en) * 2017-06-19 2018-12-28 연세대학교 산학협력단 Process for differentiation into dermal papilla cells from adipose-derived stem cells and uses thereof
WO2019017691A2 (en) * 2017-07-19 2019-01-24 서울대학교 산학협력단 Method of differentiation of human induced pluripotent stem cell to dermal papilla precursor cell and use thereof
KR102141641B1 (en) * 2020-01-31 2020-08-06 주식회사 래디안 Method for differentiation of dermal papilla cells from human adipose mesenchymal stem cells
KR102543431B1 (en) * 2022-10-05 2023-06-15 주식회사 프롬바이오 Compostion for inducing differentiation of adipose mesenchymal stem cells to dermal papilla cells and the composition for differentiating using the composition

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LIJUAN ZHOU, HAN WANG, JING JING, LIJUAN YU, XIANJIE WU, ZHONGFA LU: "Morroniside regulates hair growth and cycle transition via activation of the Wnt/β-catenin signaling pathway", SCIENTIFIC REPORTS, vol. 8, no. 1, 1 December 2018 (2018-12-01), XP055746412, DOI: 10.1038/s41598-018-32138-2 *

Also Published As

Publication number Publication date
KR102588893B1 (en) 2023-10-13
KR102543431B1 (en) 2023-06-15

Similar Documents

Publication Publication Date Title
WO2024076173A1 (en) Composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells, and differentiation method using composition
WO2014181954A1 (en) Culture medium composition for improving regenerative capacity of stem cells, and stem cell culturing method using same
WO2011043524A1 (en) Anticancer composition containing human-derived adult stem cells
WO2017018698A1 (en) Composition for preventing or treating tissue fibrosis using milk fat globule-egf factor (mfg-e8)
CN113337459B (en) Method for improving differentiation efficiency of pluripotent stem cells
WO2015005614A1 (en) Composition for preventing and treating liver fibrosis or liver cirrhosis, containing, as active ingredient, mesenchymal stem cells derived from human embryonic stem cells
WO2012074265A2 (en) Composition for promoting the stability of stem cells
CN109517789B (en) Use of Ghrelin activator for inducing differentiation of stem cells into chondrocytes
WO2021153876A1 (en) Differentiation method from human adipose-derived mesenchymal stem cells to dermal papilla cells
WO2013119026A1 (en) Method for differentiating stem cells into neurons
WO2019103528A2 (en) Serum-free culture medium composition
WO2017146468A1 (en) Composition and method for improving efficacy of stem cells
WO2021071289A2 (en) Composition for augmenting stemness and use thereof
WO2014185620A1 (en) Stem cell composition for venous administration
WO2020204317A1 (en) Method for inducing differentiation of stem cells into chondrocytes by using oligopeptides
WO2011065661A2 (en) Chondrogenesis of mesenchymal stem cells using dkk-1 or sfrp-1
WO2023054825A1 (en) Medium composition for culturing urine-derived stem cell, method for isolating and culturing urine-derived stem cell using same, urine-derived stem cell with improved therapeutic function for renal disease, and cell therapy product composition containing same
WO2018155913A1 (en) Method for differentiation into skeletal muscle cell using low-molecular weight compound
WO2023182566A1 (en) Serum-free medium composition for culturing dermal papilla cells, and dermal papilla cell culture method using same
WO2019221477A1 (en) Composition for promoting stem cell differentiation, comprising progenitor cell culture solution and multilayer graphene film, and use thereof
WO2012133992A1 (en) Method for differentiating adipose-derived mesenchymal stem cells into chondrocytes
WO2019190175A2 (en) Method for differentiating motor neurons from tonsil-derived mesenchymal stem cells
WO2011087299A2 (en) Pharmaceutical composition for the treatment of cancer, containing an extracellular matrix of mesenchymal stem cells derived from umbilical cord blood as an active ingredient
KR20210057890A (en) Generation of liver organoid from stem cells for hemophilia A treatment
WO2021020953A2 (en) Medium composition for enhancing wnt protein activity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23875235

Country of ref document: EP

Kind code of ref document: A1