WO2024055291A1 - Method for high-throughput screening of sirtuin mutant, sirtuin mutant, and use thereof - Google Patents

Abstract

The present invention relates to a sirtuin mutant, a method for high-throughput screening of a sirtuin mutant, and use. The screening method for a sirtuin mutant comprises the following steps: constructing a sirtuin mutant library using an error-prone PCR technology; lysing each mutant in the sirtuin mutant library, carrying out solid-liquid separation, and collecting a lysate supernatant; and determining the deacylation activity of sirtuin in the lysate supernatant using an AMC fluorescence method, and obtaining a sirtuin mutant strain with the required deacylation activity. By using the screening method for a sirtuin mutant, a mutant of the deacylation enzyme sirtuin can be simply, conveniently, and repeatedly selected using a high throughput method.

Description

Methods for high-throughput screening of sirtuin mutants and sirtuin mutants and their applications Technical field

The invention relates to the field of biotechnology, and in particular to a method for high-throughput screening of sirtuin mutants, sirtuin mutants and their applications.

Background technique

Sirtuin is a type of protein deacylase that uses NAD+ as a substrate. It is widely present in three domains of life systems: bacteria, archaea, and eukaryotes. It participates in the regulation of gene transcription, chromosome segregation, RNA shearing, cell metabolism, and apoptosis. A series of important biological processes such as death and energy metabolism. In addition to deacetylase activity, sirtuin has also been reported to have other enzymatic activities, such as desuccinylation, demyristoylation, and denonanoylase activities.

The regulation of Sirtuin deacylation is closely related to obesity, aging, cancer, neurodegeneration and cardiovascular diseases. In recent years, the crystal structures of sirtuin in different species, such as humans, yeast and E. coli, have been solved. However, due to the lack of systematic understanding of the molecular mechanism of sirtuin enzyme activity, the key regulatory sites of sirtuin deacylase activity are currently not fully understood. Moreover, no drugs targeting sirtuin have been approved for marketing so far. The reason is largely due to the lack of an efficient and accurate detection method for sirtuin enzyme activity. At present, the main methods for detecting sirtuin enzyme activity include isotope labeling, immunoblotting, high-performance liquid chromatography and fluorescence. Among them, isotope labeling methods are no longer commonly used due to cumbersome operations and potential safety. Western blotting and high-performance liquid chromatography are only suitable for routine in vitro enzyme activity characterization. Although coumarin-based fluorescence methods and FRET-based fluorescence methods are It can be used to measure sirtuin enzyme activity on a large scale, but current research still requires in vitro expression and purification to obtain sirtuin protein, which requires a large workload. Direct cleavage of sirtuin after synthesis in vivo often results in inactivation of the enzyme, which limits the use of these methods at high temperatures. Direct application in throughput enzyme activity detection. Currently, fluorescence methods are only used for large-scale screening of sirtuin protein inhibitors or activators in vitro. Therefore, developing a high-throughput screening method for sirtuin deacylase activity is currently a technical difficulty, and it is also the prerequisite for in-depth study of the specificity of sirtuin enzyme activity and the discovery of its functional regulation in vivo.

Contents of the invention

Based on this, it is necessary to provide a simple, universal, and sensitive method for high-throughput screening of sirtuin mutants.

In addition, a sirtuin mutant and its application are also provided.

A method for screening sirtuin mutants, including the following steps:

Error-prone PCR technology was used to construct a sirtuin mutant library;

Each mutant in the sirtuin mutant library is lysed, solid-liquid separation is performed, and the lysis supernatant is collected;

The AMC fluorescence method is used to measure the sirtuin deacylation activity of the lysis supernatant in a high-throughput manner, and a sirtuin mutant strain with the required deacylation activity is obtained.

In the above screening method for sirtuin mutants, error-prone PCR technology is used to obtain a library of sirtuin protein mutants, and then the heterologously expressed sirtuin protein mutants are lysed to obtain a crude enzyme solution, and then a method based on the release of AMC fluorescent groups is used. The in-site detection of deacylation activity of sirtuin mutants mainly includes three steps of library construction, lysis and detection. High-throughput screening of sirtuin protein mutants can be carried out. The steps are simple. Sirtuin synthesized in vivo is directly cleaved through lysis to release the fluorescence of AMC. detection method; this method is universal and can screen different sirtuins for enzyme activity, and is not limited to the specific functions of sirtuins in specific environments; more importantly, this method combines error-prone PCR and AMC fluorescence methods. Through the seamless connection of bacterial protein expression-lysis-detection, high-throughput screening of artificial sirtuin mutants is possible. Using the above-mentioned screening method for sirtuin mutants, deacylase sirtuin mutants can be screened in a simple, universal, sensitive and high-throughput manner.

In one embodiment, an initial sirtuin gene is used to construct the sirtuin mutant library. The initial sirtuin gene includes connected critical region fragments and non-critical region fragments. The steps of constructing the sirtuin mutant library include:

Using the plasmid carrying the initial sirtuin gene as a template, error-prone PCR is performed to obtain a mutant fragment, which is the key region fragment where point mutations occur;

Using the plasmid carrying the expression vector as a template and performing PCR amplification under the action of a high-fidelity enzyme, an expression vector fragment is obtained. The expression vector is used to express the initial sirtuin. The expression vector fragment is used to express the sirtuin protein. The expression and replication originals are composed of the plasmid carrying the expression vector and the resistance gene of the plasmid carrying the initial sirtuin gene is different;

The mutant fragment and the expression vector fragment are recombinantly ligated and then transferred into host cells to obtain the sirtuin mutant library.

In one of the embodiments, a first primer pair is used to perform error-prone PCR, and the sequences of the first primer pair are as shown in SEQ ID No. 1 to SEQ ID No. 2.

In one embodiment, in the step of using the plasmid carrying the initial sirtuin gene as a template and performing PCR amplification under the action of a high-fidelity enzyme, a second primer pair is used to perform PCR amplification, and the third primer pair is used for PCR amplification. The sequences of the two primer pairs are shown in SEQ ID No. 3 ~ SEQ ID No. 4.

In one embodiment, based on the currently controlled mutation frequency of 1-4 bases/kb, a mutant library with 10-fold coverage can be constructed to screen out the amino acid sites in the critical region of sirtuin, where the mutation The body bank has 2,000-6,000 clones.

In one embodiment, in the step of lysing each mutant in the sirtuin mutant library, a cell lysis solution is used for lysis, and the cell lysis solution includes: a non-denaturing detergent and a buffer with a pH of 7 to 8, so The volume ratio of the cell lysis solution to the bacterial solution containing the cells to be tested is 1:20-1:40, the lysis temperature is 20°C-30°C, and the lysis time is 10min-20min.

In one embodiment, the step of using the AMC fluorescence method to determine the sirtuin deacylation activity of the lysis supernatant includes:

Mix the AMC peptide reaction solution with the lysis supernatant and react for 1 hour at 37°C and 200rpm to 300rpm to obtain the first treatment solution. The AMC peptide reaction solution contains the AMC peptide with acyl modification, so The final concentration of the AMC peptide is 100 μM ~ 500 μM;

Add 2× stop solution to the first treatment solution, and let it react at 25°C to 37°C for 1h to 1.5h to obtain the second treatment solution. The stop solution includes 2.0mg/mL to 5.0mg/mL trypsin, 2×Tris buffer containing 2mM~6mM NAM;

The fluorescence intensity of the second treatment solution is detected at an excitation wavelength of 360 nm and an emission wavelength of 460 nm, and the deacylase activity of sirtuin in the cells to be tested is determined based on the fluorescence intensity of the second treatment solution.

In one embodiment, the acyl modification in the AMC peptide with acyl modification is acetyl modification, succinyl modification, myristoyl modification, nonanoyl modification or long-chain fatty acyl modification.

In one embodiment, the AMC peptide is a lysine acylation-modified peptide with a BOC protection group and AMC label.

A sirtuin mutant is prepared by the above-mentioned screening method for sirtuin mutants.

In one embodiment, it is obtained by mutating at least one of the following sites of wild-type sirtuin: alanine at position 76, phenylalanine at position 91, histidine at position 147, histidine at position 155 cysteine at position 185 and proline at position 185.

In one of the embodiments, it is characterized in that the alanine at position 76 undergoes one of the following mutations: A76P, A76V;

The phenylalanine at position 91 has one of the following mutations: F91L, F91S;

Histidine at position 147 has one of the following mutations: H147L, H147Y;

The cysteine at position 155 has one of the following mutations: C155R, C155S, C155Y;

The proline at position 185 has one of the following mutations: P185L, P185T.

Application of the above sirtuin mutants in changing deacylase activity.

Description of drawings

Figure 1 is the schematic diagram of AMC fluorescence detection;

Figure 2 is a flow chart of mutant library construction;

Figure 3 shows the gel electrophoresis pattern of the mutant fragments and backbone fragments;

Figure 4 is a diagram of the sequencing results in Example 1;

Figure 5 is a gel electrophoresis diagram of the lysis supernatant;

Figure 6 shows the fluorescence detection results of the reaction between BL21 cleavage products and peptide fragments;

Figure 7 shows the fluorescence detection results of the reaction between purified sirtuin protein or sirtuin-containing cell lysate supernatant and substrate;

Figure 8 is an example of the fluorescence detection results of the mutant library;

Figure 9 is a fluorescence detection mutant library enzyme activity and site information diagram;

Figure 10 is an analysis diagram of the regulatory sites of sirtuin enzyme activity;

Figure 11 shows the fluorescence detection results of the reaction between cell lysate and AMC-peptide ^Ac or AMC-peptide ^Su peptide segments;

Figure 12 shows the effect of lysate on the enzyme activities of STM1221 and SIRT2.

Detailed ways

In order to make the above objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation modes of the present invention will be described in detail below with reference to specific embodiments and drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the invention. However, the present invention can be implemented in many other ways different from those described here. Those skilled in the art can make similar improvements without departing from the connotation of the present invention. Therefore, the present invention is not limited to the specific implementation disclosed below.

One embodiment of the present application provides a method for screening sirtuin mutants, including the following steps S210 to S230:

S210. Use error-prone PCR technology to construct a sirtuin mutant library.

Error-prone PCR is a method used to construct a library of random point mutants of proteins. It uses low-fidelity DNA polymerase in PCR and adjusts PCR reaction conditions to reduce the accuracy of DNA replication. This enables point mutations in genes. After a mutation is introduced into a gene, the corresponding amino acid changes, thereby affecting the structure and function of the target protein. Error-prone PCR produces a large number of mutation products that are cloned and ligated into expression vectors to generate a library of random point mutants of the target protein. The use of error-prone PCR can expand the size of the mutant library, increase its coverage, and improve screening accuracy.

In one embodiment, an initial sirtuin gene is used to construct a sirtuin mutant library, and the initial sirtuin gene includes connected critical region fragments and non-critical region fragments. The initial sirtuin is the sirtuin that needs to be mutated. The initial sirtuin is not limited and can be a wild-type sirtuin or other sirtuin that has been mutated and needs to be mutated again.

Among them, the key region is the region where active sites (i.e., sites that affect enzyme activity) may exist. Non-critical areas are areas other than critical areas.

Specifically, as shown in Figure 2 (Figure 2 is a flow chart of mutant library construction), the steps of constructing a sirtuin mutant library using error-prone PCR technology include S211 to S213:

S211. Use the plasmid carrying the initial sirtuin gene as a template to perform error-prone PCR to obtain a mutant fragment, which is a key region fragment where point mutations occur.

Among them, the mutated fragments are key region fragments with 1 to 4 point mutations. It should be noted that by controlling the template amount of error-prone PCR, DNA fragments in the key region of sirtuin with 1-4 point mutations in each product can be amplified.

Among them, the plasmid carrying the initial sirtuin gene is the pET28a-sirtuin plasmid with kanamycin (Kanamycin, Kan) resistance. This plasmid is capable of expressing the original sirtuin.

Among them, the first primer pair is used to perform error-prone PCR. The sequence of the first primer pair is shown as SEQ ID No.1 ~ SEQ ID No.2. Specifically, the sequence shown in SEQ ID No. 1 is ggaaatgatggaaaacccaaga. The sequence shown in SEQ ID No. 2 is ccgacttggcttggctcaag.

Specifically, the EP-PCR system formula is shown in Table 2.

Table 2 EP-PCR system formula

In a specific example, pET28a-sirtuin plasmid was used as a template, random mutation PCR enzyme (GeneMorph II Random Mutagenesis Kit, Agilent) was used, and sirtuin with 1-4 point mutations in each product was amplified by controlling the template amount. DNA fragments in critical regions (i.e., mutated fragments).

S212. Using the plasmid carrying the expression vector as a template and performing PCR amplification under the action of a high-fidelity enzyme, an expression vector fragment is obtained. The expression vector is used to express the initial sirtuin. The expression vector fragment is composed of expression and replication elements for expressing the sirtuin protein. The resistance gene of the plasmid carrying the expression vector is different from that of the plasmid carrying the initial sirtuin gene.

Among them, the plasmid carrying the expression vector is pTEV5-sirtuin plasmid with ampicillin (Ampiciline, Amp) resistance. This plasmid is capable of expressing the original sirtuin.

Among them, in the step of using the plasmid carrying the expression vector as a template and performing PCR amplification under the action of a high-fidelity enzyme, a second primer pair is used to perform PCR amplification. The sequence of the second primer pair is shown in SEQ ID No. 3 ~ SEQ ID No. 4. Specifically, the sequence shown in SEQ ID No. 3 is cttgagccaagccaagtcgg. The sequence shown in SEQ ID No. 4 is tcttgggttttccatcatttcc.

In a specific example, pTEV5-sirtuin was used as a template, a high-fidelity enzyme was used to amplify the fragments of sirtuin except the critical region together with the expression vector, and the template was eliminated with DpnI to obtain the vector fragment.

It should be noted that the order of S211 and S212 is not limited. S211 can be performed first and then S212, S212 can be performed first and then S211, or S211 and S212 can be performed at the same time.

S213. Recombine the mutant fragment and the expression vector fragment and transfer them into the host cell to obtain a sirtuin mutant library.

Among them, recombinase is used to connect the mutant fragment and the expression vector fragment.

Wherein, the host cell is a competent host cell. Specifically, it can be competent DH5α or competent BL21, or other competent host cells.

In a specific example, the PCR product fragment is purified, ligated and transformed into a DH5α competent state by recombinase, and ampicillin resistance is used to screen out positive clones, that is, target clones. Pick about 10 clones, sequence them, check whether random point mutations occur in key regions and whether the number of mutations meets the requirements, and adjust the initial template concentration based on the results to make the obtained clones reach the desired mutation frequency. Because the fragment ligation products (mutated fragments and vector fragment recombinant ligation products) in this example are difficult to directly and efficiently transform into BL21, this protocol first transforms the recombinant products into DH5α, then extracts plasmids from DH5α mixed plaques and transforms them into BL21 middle. The BL21 clones that successfully grew on the ampicillin plate were randomly selected and sequenced to check whether the mutation results were as expected. It should be noted that if the fragment ligation product can be directly transferred into BL21, the step of transferring into DH5α can be omitted.

In a specific example, the enzyme used to perform error-prone PCR mutagenesis of the selected sirtuin gene to establish a sirtuin mutant library is the enzyme in Agilent's GeneMorph II Random Mutagenesis Kit.

S220. Each mutant in the sirtuin mutant library is lysed, solid-liquid separation is performed, and the lysis supernatant is collected.

Among them, cell lysis solution is used for lysis, and the cell lysis solution includes: non-denaturing detergent and buffer solution with pH 7-8. The cell lysate can lyse cells containing sirtuin, and the obtained lysate can be used for AMC fluorescence detection of sirtuin deacylase activity without purification.

Further, the cell lysis solution includes a non-denaturing detergent with a mass percentage of 0.5% to 2%, a salt substance of 100mM to 200mM, and a buffer with a pH of 7 to 8.

Studies have found that in the above cell lysate, non-denaturing detergents with a mass percentage of 0.5% to 2%, salts from 100mM to 200mM, and buffers with a pH of 7 to 8 can lyse cells containing sirtuin, yielding The cleavage product can be used for AMC fluorescence detection of sirtuin deacylase activity without purification. It is simple to operate and can screen different sirtuins for enzyme activity. It is not limited to the specific functions of sirtuins in specific environments. It has been verified through experiments that the cells were lysed using the cell lysate in this study. The BL21 cell lysates transformed with STM1221 reacted with AMC peptides to produce fluorescence, while the BL21 cell lysates not transformed with STM1221 showed no fluorescence when mixed with AMC peptides. , enzyme activity detection has strong specificity.

Among them, the non-denaturing detergent is at least one of NP-40 (ie, ethylphenyl polyethylene glycol), sodium oxycholate and Triton X-100 (polyethylene glycol octyl phenyl ether). The addition of non-denaturing detergent can gently lyse cells and reduce the impact on the activity of released intracellular enzymes. Further, the mass percentage of the non-denaturing detergent is 0.5% to 2%. Furthermore, the mass percentage of the non-denaturing detergent is 0.5% to 1.5%.

The buffer is 25mM ~ 50mM Tris-HCl buffer. This buffer can both assist in cell lysis and protect the activity of enzymes released by cell lysis.

The salt substance is NaCl or KCl. Sodium chloride and potassium chloride can make the solution reach a certain concentration, maintain osmotic pressure, and ensure a certain ionic strength to stabilize proteins. Generally, NaCl, the same ingredient as physiological saline, is used.

In a specific example, the cell lysis solution includes: NP-40 with a mass percentage of 1%, 150mM NaCl, pH7.6, and 25mM Tris-HCl buffer. This cell lysis solution can gently lyse cells and reduce the impact on the activity of released intracellular enzymes.

Among them, the steps of using cell lysis solution to lyse the sirtuin mutant library include: mixing the cell lysate and the bacterial solution containing the sirtuin mutant library cells in a ratio of 1:20 to 1:40, and lysing at a temperature of 20°C to 30°C. Shake at 300rpm for 10min~20min.

Among them, the solid-liquid separation method is centrifugation. In a specific example, the centrifugation conditions are 4000 rpm and 4°C for 10 minutes. It should be noted that the solid-liquid separation method is not limited to centrifugation, and can also be other solid-liquid separation methods, such as filtration.

In a specific example, step S220 includes: picking the BL21 clone into a 96-well plate for culture, and shaking the culture at 37°C and 800 rpm overnight. After that, transfer the saturated bacterial solution 1:20 to a new 96-well plate and continue shaking the bacteria. After about 1.5-2 hours, the OD reaches 0.4. At this time, IPTG with a final concentration of 0.3mM was added to induce sirtuin protein expression at 25°C. After 16 hours, centrifuge the well plate at 4000 rpm and 4°C for 10 minutes to collect bacteria. Then, add 10 μL of mild cell lysis solution to each well of the 96-well plate. The active ingredient of the lysis solution is 25mM Tris-HCl buffer (pH 7.6) containing non-denaturing detergent. Shake at 300 rpm for 10 min to obtain cell lysate. Finally, centrifuge at 4000 rpm and 4°C for 10 min to obtain the lysis supernatant containing the target sirtuin protein.

S230. Use the AMC fluorescence method to measure the sirtuin deacylation activity of the lysis supernatant to obtain the sirtuin mutant strain with the required deacylation activity.

7-amino-4-methylcoumarin (AMC) is a peptide fluorescent labeling reagent that is widely used in protease research. When using the AMC fluorescence method to measure sirtuin enzyme activity, the coumarin amine of AMC is condensed with the carboxyl group of the C-terminal lysine residue of the polypeptide molecule to form an amide bond, and the AMC-modified polypeptide molecule is synthesized (the detection principle of the AMC fluorescence method is shown in the figure shown in 1). If there is a complete acylation modification group on the lysine side chain, trypsin cannot hydrolyze the amide bond to release AMC due to steric hindrance; but when sirtuin removes the acyl modification on the lysine side chain, the steric hindrance effect disappears , the resulting demodified peptide is subsequently cleaved by trypsin, and AMC is released. Since AMC produces fluorescence under 360nm excitation light and 460nm emission light, and the amount of AMC released is proportional to the enzyme activity of sirtuin, the activity of sirtuin enzyme can be quantitatively characterized by reading the fluorescence data.

Specifically, the steps of S230 include S231-S233:

S231. Mix the AMC peptide reaction solution and the above-mentioned lysis supernatant, and react at 37°C and 200 to 300 rpm for 1 hour to obtain the first treatment solution.

Among them, the AMC peptide reaction solution contains acyl-modified AMC peptides. The final concentration of AMC peptide is 100μM~500μM. Specifically, the final concentration of AMC peptide was 200 μM. The volume ratio of AMC peptide reaction solution and lysis supernatant is 1:1. This volume ratio facilitates sampling and loading.

In one embodiment, the AMC peptide is a synthetic lysine acylation-modified peptide with a BOC protection group and AMC label.

In one embodiment, the acyl modification in the AMC peptide with acyl modification is acetyl modification, succinyl modification, myristoyl modification, nonanoyl modification or long-chain fatty acyl modification. It should be noted that the different deacylase activities of sirtuin can be measured using AMC peptides with different acyl modifications. It should be noted that the acyl modification is not limited to the above-mentioned acyl modifications, and can also be other acyl modifications. AMC-peptide peptides with different acyl modifications can be used according to the deacylase activity measured as needed.

In a specific example, the AMC peptide with acyl modification is AMC-peptide ^Ac (i.e., acetyl-modified AMC-peptide peptide). The specific steps of S231 are: add 10 μL of reaction solution containing AMC-peptide ^Ac to each well of the 384-well plate, including 2 μL of 10×Tris buffer (0.5M Tris-HCl, pH8.0, 1.37M NaCl, 27mM KCl, 10mM MgCl ₂ ), 1 μL 20mM NAD ⁺ , 0.8 μL 5mM AMC-peptide ^Ac , 6.2 μL ddH ₂ O. After that, 10 μL of the obtained sirtuin protein lysis supernatant was added, the total volume was 20 μL, and the final concentration of the peptide was 200 μM. The reaction was carried out with shaking at 37°C and 300 rpm for 1 hour to obtain the first treatment liquid.

S232. Add 2× stop solution to the first treatment solution, and let it react at 25°C to 37°C for 1h to 1.5h to obtain the second treatment solution.

The volume ratio of the first treatment solution to the stop solution is 1:1. This volume ratio facilitates sampling and loading.

Among them, the stop solution includes 2.0mg/mL~5.0mg/mL trypsin and 2×Tris buffer containing 2mM~6mM NAM.

S233. Detect the fluorescence intensity of the second treatment solution at an excitation wavelength of 360nm and an emission wavelength of 460nm, and determine the deacylase activity of sirtuin in the cells to be tested based on the fluorescence intensity of the second treatment solution.

Among them, the tool for detecting fluorescence intensity is a microplate reader. It should be noted that the tool for detecting fluorescence intensity is not limited to a microplate reader, and may also be other tools capable of detecting fluorescence intensity, such as a fluorescence photometer.

In a specific example, the BL21 lysate transferred into the blank plasmid is used as a negative control, and the BL21 lysate transferred into the wild-type pTEV5-sirtuin plasmid is used as the positive control.

The study found that the fluorescence intensity is directly proportional to the deacetylase activity of sirtuin protein. Therefore, the deacetylation activity of sirtuin can be quantitatively detected based on this proportional relationship. For example, the standard curve method is used for quantitative detection.

It should be noted that after obtaining the sirtuin mutant strain with the required deacylation activity, you can also sequence, analyze, and summarize the clones with large changes in enzyme activity to obtain the corresponding mutation site information, predict and verify sirtuin Protein deacetylation active site.

Among them, based on the currently controlled mutation frequency of 1-4 bases/kb, a mutant library with 10-fold coverage (screening 2,000-6,000 clones) can be constructed to screen for sirtuin amino acid sites in all key regions, where , the mutant library has 2,000-6,000 clones.

The above-mentioned screening method for sirtuin mutants can easily, high-throughput, and reproducibly screen artificial mutants of deacylase sirtuin. Error-prone PCR was used to obtain random point mutation fragments of sirtuin protein coding DNA, and the recombinant plasmid was constructed and transformed into E. coli to obtain a sirtuin protein mutant library. Then, the optimized mild cell lysis solution was used to lyse the heterologously expressed sirtuin protein mutant in a 96-well plate and obtain crude enzyme solution. Finally, the deacylation activity of sirtuin mutants was detected in situ using a method based on the release of AMC fluorophores. Therefore, this method mainly includes three steps: library construction, lysis and detection. High-throughput screening of sirtuin protein mutants can be carried out through 96-well plate culture to induce sirtuin protein and microplate reader fluorescence detection. The main feature of this method is that the steps are simple, and the optimized cell lysis solution allows the sirtuin synthesized in the body to be directly cleaved and released for detection by the AMC fluorescence method; moreover, the method is universal and can screen different sirtuins for enzyme activity without limitation. Due to the specific functions of sirtuin in specific environments; more importantly, this method combines error-prone PCR and AMC fluorescence methods to enable high-throughput screening of sirtuin artificial mutations through the seamless connection of bacterial protein expression-lysis-detection. body becomes possible. Subsequent sequencing of sirtuin mutants will provide information on mutation sites, which can analyze the relationship between site mutations and changes in enzyme activity, and predict and verify key sites for sirtuin deacylation activity.

AMC fluorescence detection is mostly used to detect the enzyme activity of a single sirtuin, or to screen the substrates and inhibitors corresponding to sirtuin through high-throughput in vitro enzyme activity detection. However, since many sirtuin proteins cannot be expressed and purified in vitro, the direct cleavage and release of sirtuin after synthesis in vivo often results in the inactivation of subsequent reaction enzymes, and protein purification and other processes are required before enzyme activity detection can be carried out. This application uses cell lysis solution to gently lyse sirtuin mutants. The obtained cleavage product can be used for AMC fluorescence detection of sirtuin deacylase activity without purification. The operation is simple and can screen different sirtuins for enzyme activity. It is not limited to It is based on the specific functions that sirtuin performs in a specific environment.

At present, research on the sites of sirtuin proteins is either through screening and verification through a large number of molecular biology experiments, which is time-consuming and laborious; or through protein structure analysis, which is very low-throughput. Therefore, the development of a high-throughput mutant screening method that relies on enzyme activity detection is particularly important. The present invention organically combines error-prone PCR for library construction and AMC fluorescence method for enzyme activity detection, obtains a random mutant library with controllable frequency through molecular cloning, expresses the protein and obtains enzyme activity information through in-situ detection, thereby constructing a complete set of The sirtuin mutant screening system is simple, reliable and has high throughput. It can screen and discover the deacylation active regulatory site of sirtuin protein in a simple and high-throughput method, providing a basis for subsequent research on the structure and function of sirtuin.

This method screens sirtuin enzymatic activity mutants, performs in situ expression and activity measurement in E. coli, minus the tedious protein purification and transfer process, and is very simple; moreover, the use of different acylation modified peptides can be used to test the activity of sirtuin This method can be used to screen different sirtuins for enzyme activity based on different deacylase activities, and is universal. Moreover, this method combines error-prone PCR and AMC fluorescence methods, and can simultaneously measure multiple proteins in large batches. Test results can be quantified. In summary, compared with other methods, the method in this study has the advantages of simplicity, universality, and high throughput.

One embodiment of the present application also provides a sirtuin mutant, which is prepared by the above-mentioned screening method for sirtuin mutants. This sirtuin mutant can be used to alter deacylase activity.

Among them, it is obtained by mutating at least one of the following sites of wild-type sirtuin: alanine at position 76, phenylalanine at position 91, histidine at position 147, and cysteine at position 155 Acid, proline at position 185.

Furthermore, the alanine at position 76 undergoes one of the following mutations: A76P, A76V.

The phenylalanine at position 91 has one of the following mutations: F91L, F91S.

The histidine at position 147 has one of the following mutations: H147L, H147Y.

The cysteine at position 155 has one of the following mutations: C155R, C155S, or C155Y.

The proline at position 185 has one of the following mutations: P185L, P185T.

The following is the specific examples section.

Unless otherwise specified, the reagents and instruments used in the examples are conventional choices in the art. Experimental methods that do not indicate specific conditions in the examples are usually implemented according to conventional conditions, such as conditions described in literature and books or methods recommended by kit manufacturers. The reagents used in the examples are all commercially available.

Example 1 Obtaining a random point mutant library

The sirtuin protein STM1221 derived from Salmonella was selected as an example, and random point mutations were carried out in its specific site region (V43-N240) to obtain a random point mutant library with 1-3 mutated amino acids. The specific operations are as follows:

Through previous studies, it was determined that the sirtuin protein STM1221 has high deacetylase activity. Through sequence comparison, the V43-N240 segment was selected as a possible active site gene fragment. This gene was constructed into the Kan-resistant pET28a-STM1221 plasmid, and amplified by EP-PCR (error-prone PCR) using the first primer pair (sequences shown in SEQ ID No. 1 ~ SEQ ID No. 2) The DNA fragment of the key region of STM1221 with 2-4 point mutations in each product (referred to as the mutation fragment) was obtained. At the same time, pTEV5-STM1221 was used as a template, and the second primer pair (sequences are shown in SEQ ID No. 3 ~ SEQ ID No. 4) was used to amplify STM1221 except the key region together with the fragment of the expression vector (abbreviated to vector fragment) and digest the template with DpnI. Gel electrophoresis imaging of mutant fragments and backbone fragments. The gel electrophoresis patterns of the mutant fragments and backbone fragments are shown in Figure 3. Figure 3 is a gel electrophoresis diagram of fragment and vector PCR products, in which band 1 represents the mutant fragment, band 2 represents the vector fragment, and band 3 is the 1.1 kb standard. The primers used in PCR are detailed in Table 1. The EP-PCR system formula is detailed in Table 2.

Subsequently, recombinase was used to connect the mutant fragment and the vector fragment, transformed into DH5α competent state, and Amp resistance was used to screen out positive clones, that is, target clones. Pick about 10 clones, sequence them, and verify that random point mutations at 2-4 sites in the critical region have indeed occurred. The sequencing results are detailed in Figure 4. It can be seen from Figure 4 that 8 of the 9 clones have random point mutations of 1-4 sites. Subsequently, mixed plasmids were extracted from DH5α plaques and transformed into BL21. The BL21 clones that successfully grew on the Amp plate were randomly selected and sequenced, and the mutation results were also in line with expectations.

Table 1 Primer sequence list used for cloning construction

Primers	Sequence
STM1221(43-240)-Frag-F	ggaaatgatggaaaacccaaga(SEQ ID No.1)
STM1221(43-240)-Frag-R	ccgacttggcttggctcaag(SEQ ID No.2)
STM1221(43-240)-Vect-F	cttgagccaagccaagtcgg(SEQ ID No.3)
STM1221(43-240)-Vect-R	tcttgggttttccatcatttcc(SEQ ID No.4)

Table 2 EP-PCR system formula

Example 2 In situ expression of STM1221 mutant library and acquisition of protein

(1) After obtaining the STM1221 random mutant library in BL21, pick all clones into each well of a 96-well plate, culture them in Amp-resistant LB liquid medium, and shake at 800 rpm at 37°C overnight. Then transfer the saturated bacterial solution 1:20 to a new 96-well plate and continue shaking the bacteria. After about 1.5-2 hours, the OD reaches 0.4. Add IPTG with a final concentration of 0.3mM and induce protein expression at 25°C. After 16 hours, centrifuge the well plate at 4000 rpm and 4°C for 10 minutes to obtain the precipitate, and then add 10 μL of cell lysis solution to each well: non-denaturing detergent with a final concentration of 0.5% to 2% and pH7.6, 25mM Tris-HCl buffer) , shake at 300 rpm for 10 min to obtain the cell lysate, then centrifuge at 4000 rpm and 4°C for 10 min to obtain the lysis supernatant containing the target sirtuin protein, and perform gel electrophoresis imaging on the lysis supernatant.

(2) Refer to step (1) of this example to lyse the induced bacterial liquid of E. coli BL21 transformed with pTEV5-SIRT2 plasmid according to the same method to obtain a lysed supernatant containing SIRT2 protein, and conduct lysis on the lysed supernatant. Gel electrophoresis imaging. The gel electrophoresis pattern of the lysis supernatant is shown in Figure 5 for details. Figure 5 takes SIRT2 protein as an example. In Figure 5, band 1 is the marker, bands 2 and 3 are the protein bands of the supernatant of the lysate induced by 0mM IPTG, and bands 4 and 5 are the protein bands of the supernatant of the lysate induced by 0.3mM IPTG for 16 hours. . As can be seen from Figure 5, the supernatant of the BL21 cell lysate after IPTG induction can clearly show the target band of SIRT2, proving that this method can release the intracellular protein, namely sirtuin, into the supernatant.

(3) Add 10 μL of reaction solution containing AMC-peptide ^Ac substrate to each well of the 384-well plate, including 2 μL of 10×Tris buffer (0.5M Tris-HCl, pH 8.0, 1.37M NaCl, 27mM KCl, 10mM MgCl ₂ ), 1 μL 20mM NAD ⁺ , 0.8 μL 5mM AMC-peptide ^Ac , 6.2 μL ddH ₂ O. After that, add 10μL of STM1221 or SIRT2 protein solution diluted with ddH ₂ O or lysis buffer. The total volume of the reaction system is 20μL. The final concentration of Tris is 50mM, the final concentration of NAD ⁺ is 1mM, the final concentration of the peptide is 200μM, and the final concentration of sirtuin protein is 20μL. is 5μM. After shaking for 1 hour at 37°C and 300 rpm, add 20 μL of 2× stop solution (2.0 mg/mL trypsin, 4mM NAM in 2× Tris buffer) to each well, and let the reaction stand for 1.5 hours at 25°C. Afterwards, a microplate reader was used to detect the fluorescence intensity at 360nm excitation and 460nm emission wavelengths, and the reaction system without sirtuin was used as a negative control. The measurement results are detailed in Figure 12. Figure 12 shows the effect of lysate on the enzyme activities of STM1221 and SIRT2.

It can be seen from Figure 12 that the fluorescence intensity of sirtuin after reacting with the peptide fragment in ddH ₂ O and lysis solution is similar, indicating that the lysis solution in this example does not affect the enzyme activity of sirtuin.

Example 3 Using AMC-peptide ^Ac to detect the deacetylation activity of STM1221 mutant library

The above mutant library experiment obtained in Example 2 yielded approximately 80 mutant proteins per 96-well plate. Therefore, by expanding the number of culture colonies, a total of 1,000 STM1221 mutant libraries were obtained in 12 96-well plates. The AMC-ARK ^Ac peptide used for subsequent detection (i.e., the AMC-labeled peptide modified by acetylation) was synthesized by Anhui Guoping Pharmaceutical Co., Ltd.

In order to test whether the lysis solution would affect the protease activity, BL21 transformed with wild-type STM1221 was first used to conduct lysis and enzyme activity detection experiments. The BL21 bacteria were lysed using the cell lysis solution (i.e., lysis buffer) used in Example 2, and the lysate product was used to detect sirtuin activity. As shown in Figure 6, the cleavage products were directly taken for AMC fluorescence detection, but the cleavage products of BL21 in the negative control group also reacted with the peptides to produce fluorescence, and no longer reacted after heat inactivation, proving that there may be other components in the cell fragments of BL21. Enzymes can interfere. After centrifuging the lysate, only the supernatant was used for AMC fluorescence detection. Only the BL21 lysate transformed with STM1221 will react with the AMC peptide to produce fluorescence. The fluorescence detection results of the reaction between BL21 cleavage products and peptide fragments are shown in Figure 6. In Figure 6, Figure a shows the results of the reaction between whole cell lysate and AMC peptides, and Figure B shows the results of the reaction between the supernatant of the lysate and AMC peptides. The AMC fluorescence detection system formula is detailed in Table 3.

Table 3 AMC fluorescence detection system formula

Currently, there are methods that use synthetic AMC substrates to detect the activity of purified sirtuin proteins in vitro. This study also used wild-type STM1221 to compare the two methods. Add 10 μL of reaction solution containing AMC peptide to each well of the 384-well plate, including 2 μL of 10×Tris buffer (0.5M Tris-HCl, pH8.0, 1.37M NaCl, 27mM KCl, 10mM MgCl ₂ ), 1 μL of 20mM NAD ⁺ , 0.8 μL 5mM AMC-peptide ^Ac , 6.2 μL ddH ₂ O. After that, add 10 μL of purified sirtuin protein or the protein-containing lysate supernatant from the previous step. Use 2L E. coli BL21 for cell lysis. The final lysis can obtain at least 1 mL of sirtuin protein with a concentration of 100 μM. If the culture system is reduced to a 96-well plate, 200 μL of bacterial solution can obtain at least 10 μL of protein with a concentration of 1 μM. Therefore, purified STM1221 protein with an initial concentration of 1 μM or 5 μM was selected as a comparison. Because SIRT2 protein also has strong deacetylation ability, purified SIRT2 or BL21-SIRT2 cleavage product was added as a control. The total reaction volume was 20 μL, and the final peptide concentration was 200 μM. 37℃, 300rpm shaking reaction for 1h. After that, 20 μL of 2× stop solution (2.0 mg/mL trypsin, 4 mM NAM in Tris assay buffer) was added to each well, and the reaction was allowed to stand at 25°C for 1.5 h. Afterwards, use a microplate reader to detect the fluorescence intensity at 360nm excitation and 460nm emission wavelengths. The measurement results are shown in Table 4 and Figure 7. Table 4 shows the values of each mutant strain detected by AMC fluorescence, taking a 96-well plate as an example. Figure 7 shows the fluorescence detection results of the reaction between purified sirtuin protein or sirtuin-containing cell lysate supernatant and substrate.

Table 4

Plate 9	1	2	3	4	5	6	7	8	9	10	11	12
A	46345	110776	66225	451517	142592	546643	153566	93713	312580	113637	99076	49649
B	457713	394376	456787	156837	57052	78195	468420	123861	448189	194200	163502	33148
C	43628	447466	417861	188219	430785	512417	131285	78640	502496	203276	221562	41640
D	50234	145617	108342	166403	112513	173697	87715	61080	361874	454928	427015	35795
E	439686	145898	172811	445285	364610	151662	261912	113259	478781	314798	319949	623942
F	505759	484979	145862	270170	495971	529583	318542	301906	361055	97035	538771	563119
G	51702	54297	498888	75456	509944	417199	251863	273607	264120	234231	226971	562954
H	484050	182736	507296	112210	162246	265215	382770	492457	197407	261659	154586	618305

As can be seen from Figure 7, fluorescence was detected when 1 μM or 5 μM purified STM1221 or SIRT2 reacted with the substrate, while the lysate containing these proteins showed stronger fluorescence after reacting with the peptide fragments, and BL21 transformed into the blank plasmid The cleavage product did not react with the substrate, which proved the feasibility of cell lysis to detect enzyme activity. Compared with purified proteins and in vitro detection, this method significantly reduces the workload, and also provides conditions for high-throughput screening.

The fluorescence intensity of the reaction product is proportional to the deacetylase activity of sirtuin. The BL21 lysate transferred into the blank plasmid is used as a negative control, and the BL21 lysate transferred into the wild-type pTEV5-STM1221 plasmid is used as a positive control. The 12 established above are detected. Using the STM1221 mutant library in a 96-well plate, the deacetylation activity of STM1221 was preliminarily quantified, and 480 cloned strains with large changes in enzyme activity were obtained. An example of the fluorescence detection results of the mutant library is shown in Figure 8. In Figure 8, the shades of gray represent fluorescence intensity, and the last column is the BL21 negative control (4 wells) and W.T.STM1221 positive control (4 wells).

Example 4 Sequencing the STM1221 mutant to obtain key active site information and verify it

STM1221 clones with deacetylase activity reduced by more than 80% were selected for sequencing, about 500 clones, and after excluding clones with more than 5 point mutations in a single clone, 176 mutation sites were obtained.

Table 5 shows some mutant sites and fluorescence detection results, which are single-point clones detected by sequencing in the same batch of experiments. In the established mutant library containing about 1800 clones, two single point mutants, STM1221-H147L and STM1221-H147Y, were obtained through random mutation. The enzyme activity fluorescence detection results are shown in Figure 9. The deacetylation ability is reduced. to be equivalent to the negative control. The H147 site in STM1221 has been confirmed to be an absolutely conserved site in the sirtuin protein that determines the deacylation activity. Therefore, the successful mutation of this site and the complete disappearance of the enzyme activity was detected, which proves the feasibility of this method to screen mutants. . In addition, some other mutants such as STM1221-C176G/A212V were also obtained, whose enzyme activity was significantly reduced. The enzyme activity and site information of the fluorescence detection mutant library were detected. The results are shown in Figure 9. Figure 9 shows the enzyme activity and site information of the fluorescence detection mutant library. In Figure 9, picture a is the result of fluorescence detection of the mutant library, and picture b is the result of repeated fluorescence detection of the mutant library. As can be seen from Figure 9a, the point mutation information was obtained by sequencing the clones whose fluorescence was greatly reduced, and these clones were induced to express again in BL21, and the fluorescence was detected by lysing. The results are shown in Figure 9b, which is consistent with the first detection. It can be seen that the mutation was detected by fluorescence. The accuracy is higher and the repeatability is better.

Table 5 Site and fluorescence detection results of single point mutants

The regulatory sites for sirtuin enzyme activity were analyzed. The results are shown in Figure 10. Figure 10 is an analysis diagram of the regulatory sites of sirtuin enzyme activity. For the same degree of change in deacetylation activity, the decrease in enzyme activity due to one site mutation and the change in enzyme activity due to three site mutations, the former site determines the deacetylation activity of STM1221 bigger. Therefore, score information is obtained based on the weight of the mutation site, and the score information of the amino acid site is obtained. The higher the score, the greater its determining role in the active site. It can be speculated from the site information that amino acids such as W67, V75, and H227 in STM1221 may play a decisive role in its deacetylation activity. In the follow-up work, through sequence comparison, the corresponding amino acid sites in other typical sirtuins such as human SIRT2, SIRT5, and E. coli cobB were found for mutation and the active site was verified.

Specifically, in the established mutant library containing about 1,800 clones, a large number of clones with significantly reduced deacetylation activity were discovered through fluorescence detection. These clones were sequenced to obtain site mutation information in the key regions. Only consideration was given to If a single clone contains four or less point mutations, the information on these mutation sites will be compiled and scored according to their weights. That is, if there is only one point mutation in a clone, the site will score 1 point, and if there are four in a clone For point mutations, each site is scored 0.25. The statistical results are shown in Figure 10 below. There are 5 sites with scores above 4.5, including the His-147 site that is absolutely conserved in all sirtuin proteins and determines the sirtuin deacylation activity, further confirming the results of this study. The method of random point mutation library construction and high-throughput fluorescence screening is feasible to find active sites. In addition to the Ala-76 amino acid, this site has been mentioned in reports on the structure of CobB and Sir2Tm proteins, and may be related to the decrotonylation of CobB and the depropionylation activity of Sir2Tm. The remaining three sites, Including Phe-91, Cys-155 and Pro-185, their corresponding sites in other sirtuins have not been reported. Therefore, the method of this application is of great significance for efficiently discovering new potential active sites.

Example 5

Sirtuin is a type of enzyme with multiple deacylation activities. It can not only remove the acetyl group on lysine, but also remove succinyl, crotonyl, long-chain fatty acyl, etc. Synthesizing AMC-peptide ^Acy peptides with different acyl modifications on lysine can be used to detect other deacylation activities of sirtuin proteins and obtain other deacylation active site information. Therefore, the method used in this application is not limited to the detection of deacetylation activity, and can also be applied to the detection of other deacylation activities of sirtuin, which should be included in the protection scope of the present invention.

In this example, the succinylated AMC-peptide ^Su peptide segment was synthesized according to the same method as the previous example, and reacted with the cell lysate transformed with the sirtuin protein expression vector to produce fluorescence. The measurement results are detailed in Figure 11. Figure 11 shows the fluorescence detection results of the reaction between cell lysate and AMC-peptide ^Ac or AMC-peptide ^Su peptide segments. As shown in Figure 11, the BL21 lysate transformed with blank plasmid pUC19 did not react with any acylated peptides. STM1221, which has multiple activities, can react with two peptides to produce fluorescence. The cleavage solution of deacetylase SIRT2 only reacts with AMC-peptide ^Ac , while the cleavage product of desuccinylase SIRT5 reacts with AMC-peptide ^Su and produces strong fluorescence. Fluorescence, demonstrating the reaction specificity of these substrates, can be used to detect other enzyme activities, characterize other mutant libraries, and obtain other deacylated active site information.

The above-mentioned embodiments only express several implementation modes of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention. It should be noted that, for those of ordinary skill in the art, several modifications and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the scope of protection of the patent of the present invention should be determined by the appended claims.

Claims (13)

1. A method for screening sirtuin mutants, which is characterized by including the following steps:

   Error-prone PCR technology was used to construct a sirtuin mutant library;

   Each mutant in the sirtuin mutant library is lysed, solid-liquid separation is performed, and the lysis supernatant is collected;

   The AMC fluorescence method is used to measure the sirtuin deacylation activity of the lysis supernatant in a high-throughput manner, and a sirtuin mutant strain with the required deacylation activity is obtained.
2. The screening method for sirtuin mutants according to claim 1, characterized in that the sirtuin mutant library is constructed using initial sirtuin, the initial sirtuin gene includes connected critical region fragments and non-critical region fragments, and error-prone PCR is used The steps to construct the sirtuin mutant library include:

   Using the plasmid carrying the initial sirtuin gene as a template, error-prone PCR is performed to obtain a mutant fragment, which is the key region fragment where point mutations occur;

   Using the plasmid carrying the expression vector as a template and performing PCR amplification under the action of a high-fidelity enzyme, an expression vector fragment is obtained. The expression vector is used to express the initial sirtuin. The expression vector fragment is used to express the sirtuin protein. The expression and replication originals are composed of the plasmid carrying the expression vector and the resistance gene of the plasmid carrying the initial sirtuin gene is different;

   The mutant fragment and the expression vector fragment are recombinantly ligated and then transferred into host cells to obtain the sirtuin mutant library.
3. The screening method for sirtuin mutants according to claim 2, characterized in that error-prone PCR is performed using a first primer pair, and the sequence of the first primer pair is as shown in SEQ ID No. 1 ~ SEQ ID No. 2 .
4. The screening method for sirtuin mutants according to claim 2, characterized in that, in the step of using the plasmid of the expression vector as a template and performing PCR amplification under the action of a high-fidelity enzyme, a second primer pair is used to perform PCR Amplification, the sequence of the second primer pair is as shown in SEQ ID No. 3 ~ SEQ ID No. 4.
5. The screening method for sirtuin mutants according to claim 2, characterized in that, based on the currently controlled mutation frequency of 1-4 bases/kb, a mutant library with 10 times coverage can be constructed to screen out the key sirtuin Amino acid positions in the region, where the mutant library has 2,000-6,000 clones.
6. The screening method for sirtuin mutants according to claim 1, characterized in that, in the step of lysing each mutant in the sirtuin mutant library, a cell lysis solution is used for lysis, and the cell lysis solution includes: non-denaturing Scale agent, buffer solution with pH 7 to 8, the volume ratio of the cell lysate to the bacterial liquid containing the cells to be tested is 1:20 to 1:40, the lysis temperature is 20°C to 30°C, and the lysis time is 10 minutes ~20min.
7. The method for screening sirtuin mutants according to claim 1, wherein the step of using the AMC fluorescence method to measure the sirtuin deacylation activity of the lysis supernatant includes:

   Mix the AMC peptide reaction solution with the lysis supernatant and react for 1 hour at 37°C and 200rpm to 300rpm to obtain the first treatment solution. The AMC peptide reaction solution contains the AMC peptide with acyl modification, so The final concentration of the AMC peptide is 100 μM ~ 500 μM;

   Add 2× stop solution to the first treatment solution, and let it react at 25°C to 37°C for 1h to 1.5h to obtain the second treatment solution. The stop solution includes 2.0mg/mL to 5.0mg/mL trypsin, 2×Tris buffer containing 2mM~6mM NAM;

   The fluorescence intensity of the second treatment solution is detected at an excitation wavelength of 360 nm and an emission wavelength of 460 nm, and the deacylase activity of sirtuin in the cells to be tested is determined based on the fluorescence intensity of the second treatment solution.
8. The screening method for sirtuin mutants according to claim 7, wherein the acyl modification in the AMC peptide with acyl modification is acetyl modification, succinyl modification, myristoyl modification, nonanoyl modification or long chain fatty acyl modification.
9. The method for screening sirtuin mutants according to claim 8, wherein the AMC peptide is a lysine acylation-modified peptide with a BOC protection group and AMC label.
10. A sirtuin mutant, characterized in that it is prepared by the screening method for sirtuin mutants according to any one of claims 1 to 9.
11. The sirtuin mutant according to claim 10, characterized in that it is obtained by mutating at least one of the following sites of wild-type sirtuin: alanine at position 76, phenylalanine at position 91, phenylalanine at position 147 Histidine at position 155, cysteine at position 155, and proline at position 185.
12. The sirtuin mutant according to claim 10, characterized in that the alanine at position 76 undergoes one of the following mutations: A76P, A76V;

    The phenylalanine at position 91 has one of the following mutations: F91L, F91S;

    Histidine at position 147 has one of the following mutations: H147L, H147Y;

    The cysteine at position 155 has one of the following mutations: C155R, C155S, C155Y;

    The proline at position 185 has one of the following mutations: P185L, P185T.
13. Application of the sirtuin mutant described in any one of claims 10 to 12 in changing deacylase activity.

Images