CN117721177A - Method for screening sirtuin mutant with high flux, sirtuin mutant and application thereof - Google Patents

Abstract

The invention relates to a sirtuin mutant for high-throughput screening, a screening method and application thereof. The screening method of the sirtuin mutant comprises the following steps: constructing a sirtuin mutant library by adopting an error-prone PCR technology; lysing each mutant in the sirtuin mutant library, performing solid-liquid separation, and collecting a lysate; the sirtuin deacylation activity of the cleavage supernatant was measured by AMC fluorescence to obtain a sirtuin mutant strain having the desired deacylation activity. The method for screening the sirtuin mutant can be used for conveniently and repeatedly screening the sirtuin mutant of the deacylase with high flux.

Description

Method for screening sirtuin mutant with high flux, sirtuin mutant and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to a method for screening sirtuin mutants with high throughput, the sirtuin mutants and application thereof.

Background

Sirtuin is a protein deacylase using NAD+ as a substrate, widely exists in three-domain life systems of bacteria, archaea and eukaryotes, and participates in regulating and controlling a series of important biological processes such as gene transcription, chromosome separation, RNA shearing, cell metabolism, apoptosis, energy metabolism and the like. In addition to deacetylase activity, sirtuins have also been reported to have other enzymatic activities such as disuccinylation, dimyristoylation, and desnonenoylase activity, among others.

Sirtuin deacylation modulation is closely related to obesity, aging, cancer, neurodegenerative diseases, cardiovascular diseases, and the like. In recent years, the crystal structure of sirtuins in different species, such as human, yeast and E.coli, has been resolved successively. However, the key regulatory sites for sirtuin deacylase activity are not currently fully understood due to the lack of systematic understanding of the molecular mechanism of sirtuin enzyme activity. Furthermore, no sirtuin-targeted drugs have been marketed to date. The reason for this is largely due to the lack of an efficient and accurate detection method for sirtuin enzyme activity. At present, the sirtuin enzyme activity detection method mainly comprises an isotope labeling method, an immunoblotting method, a high performance liquid chromatography method and a fluorescence method. The isotope labeling method is not commonly used because of complicated operation and potential safety, the immunoblotting method and the high performance liquid chromatography are only suitable for conventional in-vitro enzyme activity characterization, and the fluorescence method based on coumarin and the fluorescence method based on FRET can be applied to large-scale measurement of the sirtuin enzyme activity, but the current research still needs in-vitro expression and purification to obtain the sirtuin protein, the workload is large, and the enzyme is usually inactivated by direct cleavage after in-vivo synthesis of the sirtuin, so that the direct application of the methods in high-flux enzyme activity detection is limited. Currently, fluorescence is only applied to large-scale screening of sirtuin protein inhibitors or activators in vitro. Therefore, developing a high-throughput screening method for sirtuin deacylase activity is a current technical difficulty, and is a precondition for intensive research on sirtuin enzyme activity specificity and discovery of in vivo function regulation.

Disclosure of Invention

Based on this, there is a need to provide a simple, universal, sensitive method for high throughput screening of sirtuin mutants.

In addition, a sirtuin mutant and application thereof are also provided.

A method for screening sirtuin mutants comprising the steps of:

constructing a sirtuin mutant library by adopting an error-prone PCR technology;

lysing each mutant in the sirtuin mutant library, performing solid-liquid separation, and collecting a lysate;

and (3) measuring the sirtuin deacylation activity of the cleavage supernatant at high flux by adopting an AMC fluorescence method to obtain the sirtuin mutant strain with the required deacylation activity.

In the screening method of the sirtuin mutant, a sirtuin protein mutant library is obtained by using an error-prone PCR technology, then the heterologously expressed sirtuin protein mutant is cracked to obtain crude enzyme solution, and then the deacylation activity of the sirtuin mutant is detected in situ by using an AMC (advanced coding control) fluorescent group-based release method, wherein the method mainly comprises three steps of library establishment, cracking and detection, and the sirtuin protein mutant can be subjected to high-throughput screening, and the steps are simple, so that the direct cracking release of the in-vivo synthesized sirtuin can be detected by an AMC fluorescent method by cracking; the method has universality, can carry out enzyme activity screening on different sirtuins, and is not limited to specific functions of the sirtuins in specific environments; more importantly, the method combines error-prone PCR and AMC fluorescence, and enables high-throughput screening of sirtuin artificial mutants to be possible through seamless connection of thallus protein expression-cleavage-detection. The method for screening the sirtuin mutant can be used for conveniently, universally and sensitively screening the sirtuin mutant of the deacylase at high flux.

In one embodiment, the library of sirtuin mutants is constructed using an initial sirtuin, the initial sirtuin gene comprising linked critical region segments and non-critical region segments, the step of constructing the library of sirtuin mutants comprising:

error-prone PCR is carried out by taking a plasmid carrying the initial sirtuin gene as a template to obtain a mutant fragment, wherein the mutant fragment is the key region fragment with point mutation;

taking a plasmid carrying an expression vector as a template and carrying out PCR amplification under the action of high-fidelity enzyme to obtain an expression vector fragment, wherein the expression vector is used for expressing the initial sirtuin, the expression vector fragment consists of an expression element and a replication element used for expressing a sirtuin protein, and the plasmid carrying the expression vector is different from a resistance gene of the plasmid carrying the initial sirtuin gene;

and (3) recombining and connecting the mutant fragment and the expression vector fragment, and transferring the mutant fragment and the expression vector fragment into a host cell to obtain the sirtuin mutant library.

In one embodiment, error-prone PCR is performed using a first primer pair having a sequence shown in SEQ ID No. 1-SEQ ID No. 2.

In one embodiment, in the step of performing PCR amplification by using the plasmid carrying the initial sirtuin gene as a template and under the action of high-fidelity enzyme, a second primer pair is used for performing PCR amplification, and the sequence of the second primer pair is shown as SEQ ID No. 3-SEQ ID No. 4.

In one example, a 10-fold coverage mutant library was constructed, calculated at the currently controlled mutation frequency of 1-4 bases/kb, and amino acid sites in the sirtuin key region could be screened, wherein the mutant library had 2,000-6,000 clones.

In one embodiment, in the step of lysing each mutant in the sirtuin mutant library, lysis is performed using a cell lysate comprising: the non-denaturing detergent and the buffer solution with pH value of 7-8, wherein the volume ratio of the cell lysate to the bacterial solution containing the cells to be detected is 1:20-1:40, the lysis temperature is 20-30 ℃, and the lysis time is 10-20 min.

In one embodiment, the step of determining sirtuin deacylation activity of the cleavage supernatant using AMC fluorescence comprises:

mixing the AMC peptide reaction solution with the cleavage supernatant, and reacting for 1h at 37 ℃ and 200-300 rpm to obtain a first treatment solution, wherein the AMC peptide reaction solution contains AMC peptide with acyl modification, and the final concentration of the AMC peptide is 100-500 mu M;

adding a 2 Xstopping solution into the first treatment solution, and standing at 25-37 ℃ for reaction for 1-1.5 h to obtain a second treatment solution, wherein the stopping solution comprises 2.0-5.0 mg/mL of trypsin and 2 XTris buffer solution containing 2-6 mM NAM;

Detecting the fluorescence intensity of the second treatment liquid at the excitation wavelength of 360nm and the emission wavelength of 460nm, and judging the deacylase activity of the sirtuin in the cell to be detected according to the fluorescence intensity of the second treatment liquid.

In one embodiment, the acyl modification in the AMC peptide fragment with an acyl modification is an acetyl modification, a succinyl modification, a myristoyl modification, a nonanoyl modification or a long chain fatty acyl modification.

In one embodiment, the AMC peptide fragment is a lysine acylation modified with a BOC protecting group and an AMC tagged peptide fragment.

A sirtuin mutant prepared by the screening method of the sirtuin mutant.

In one embodiment, the mutant is obtained by mutation of at least one of the following sites of the wild-type sirtuin: alanine at position 76, phenylalanine at position 91, histidine at position 147, cysteine at position 155, proline at position 185.

In one embodiment, the alanine at position 76 is mutated as follows: a76P, A V;

phenylalanine at position 91 is mutated to one of the following: F91L, F91S;

histidine 147 is mutated to one of the following: H147L, H147Y;

The cysteine at position 155 is mutated to one of the following: C155R, C155S, C Y;

proline at position 185 is mutated to one of the following: P185L, P185T.

The use of the sirtuin mutant described above for modification of deacylase activity.

Drawings

FIG. 1 is a schematic diagram of AMC fluorescence detection;

FIG. 2 is a flow chart of mutant library construction;

FIG. 3 is a gel electrophoresis of mutant fragments and backbone fragments;

FIG. 4 is a graph showing the sequencing result in example 1;

FIG. 5 is a gel electrophoresis of the lysed supernatant;

FIG. 6 is a graph showing the fluorescence detection result of BL21 cleavage product reacted with peptide fragment;

FIG. 7 is a graph showing the fluorescence detection result of the reaction of purified sirtuin protein or sirtuin-containing cell lysis supernatant with a substrate;

FIG. 8 is an exemplary graph of mutant library fluorescence detection results;

FIG. 9 is a diagram of fluorescence detection mutant library enzyme activity and site information;

FIG. 10 is a chart of sirtuin enzyme activity control site analysis;

FIG. 11 shows a cell lysate and AMC-peptide ^Ac Or AMC-peptide ^Su A fluorescent detection result diagram of the peptide fragment reaction;

FIG. 12 is a graph showing the effect of lysates on the enzymatic activity of STM1221 and SIRT 2.

Detailed Description

In order that the above-recited objects, features and advantages of the present invention can be readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. The invention may be embodied in many other forms than described herein and similarly modified by those skilled in the art without departing from the spirit or scope of the invention, which is therefore not limited to the specific embodiments disclosed below.

An embodiment of the present application provides a screening method of sirtuin mutants, including the following steps S210 to S230:

s210, constructing a sirtuin mutant library by adopting an error-prone PCR technology.

Error-prone PCR (Error-prone PCR) is a method for constructing a library of random point mutants of proteins by using a low-fidelity DNA polymerase in PCR and adjusting the PCR reaction conditions to reduce the accuracy of DNA replication, thereby achieving point mutations in genes. After the mutation is introduced into the gene, the corresponding amino acid is changed, thereby influencing the structure and function of the target protein. Error-prone PCR produces a large number of mutant products that are cloned into an expression vector to create a library of random point mutants of the protein of interest. The error-prone PCR is adopted to expand the volume of the mutant library, so that the coverage rate of the mutant library can be increased, and the screening accuracy is improved.

In one embodiment, a library of sirtuin mutants is constructed using an initial sirtuin gene comprising linked critical and non-critical region segments. The initial sirtuin is the sirtuin that needs to be mutated. The initial sirtuin is not limited, and may be a wild-type sirtuin, or may be another sirtuin that has been mutated and also needs to be mutated again.

Wherein the critical region is a region where active sites (i.e., sites that have an effect on enzyme activity) may be present. The non-critical area is an area other than the critical area.

Specifically, as shown in fig. 2 (fig. 2 is a mutant library construction flowchart), the steps of constructing a sirtuin mutant library by error-prone PCR technique include S211 to S213:

s211, performing error-prone PCR by taking a plasmid carrying an initial sirtuin gene as a template to obtain a mutant fragment, wherein the mutant fragment is a key region fragment with point mutation.

Wherein the mutant fragment is a critical region fragment in which 1 to 4 point mutations occur. By controlling the template amount of error-prone PCR, DNA fragments of the key region of the sirtuin with 1-4 point mutations per product can be amplified.

Wherein the plasmid carrying the original sirtuin gene is a pET28a-sirtuin plasmid having Kanamycin (Kanamycin, kan) resistance. The plasmid is capable of expressing the original sirtuin.

Wherein error-prone PCR is performed using the first primer pair. The sequences of the first primer pair are shown as SEQ ID No. 1-SEQ ID No. 2. Specifically, the sequence shown in SEQ ID No.1 is ggaaatgatggaaaacccaaga. The sequence shown in SEQ ID No.2 is ccgacttggcttggctcaag.

Specifically, the EP-PCR system formulation is shown in Table 2.

Table 2 EP-PCR System formulation

In one specific example, DNA fragments (i.e., mutated fragments) of the key region of the sirtuin with 1-4 point mutations per product were amplified by controlling the amount of template using the pET28a-sirtuin plasmid as template and using a random mutant PCR enzyme (GeneMorph II Random Mutagenesis Kit, agilent).

S212, taking a plasmid carrying an expression vector as a template and carrying out PCR amplification under the action of high-fidelity enzyme to obtain an expression vector fragment, wherein the expression vector is used for expressing the initial sirtuin, the expression vector fragment consists of an expression and replication original for expressing the sirtuin protein, and the plasmid carrying the expression vector is different from the resistance gene of the plasmid carrying the initial sirtuin gene.

Wherein the plasmid carrying the expression vector is pTEV5-sirtuin plasmid with ampicillin (Amp) resistance. The plasmid is capable of expressing the original sirtuin.

Wherein, in the step of PCR amplification by taking the plasmid carrying the expression vector as a template and under the action of high-fidelity enzyme, the second primer pair is adopted for PCR amplification. The sequences of the second primer pair are shown in SEQ ID No. 3-SEQ ID No. 4. Specifically, the sequence shown in SEQ ID No.3 is cttgagccaagccaagtcgg. The sequence shown in SEQ ID No.4 is tcttgggttttccatcatttcc.

In one specific example, a fragment of a sirtuin along with an expression vector except for a critical region is amplified using a high fidelity enzyme using pTEV5-sirtuin as a template, and a vector fragment is obtained using DpnI as a template.

The order of S211 and S212 is not limited, and S211 may be performed before S212, S212 may be performed before S211, or S211 and S212 may be performed simultaneously.

S213, recombining and connecting the mutant fragment and the expression vector fragment, and transferring the mutant fragment and the expression vector fragment into a host cell to obtain a sirtuin mutant library.

Wherein, the mutant fragment and the expression vector fragment are connected by adopting recombinase.

Wherein the host cell is a competent host cell. Specifically, the cell may be competent DH 5. Alpha. Or competent BL21, or may be other competent host cells.

In one specific example, PCR product fragments were purified, transformed into DH5 a competence by recombinase ligation, and positive clones, i.e., clones of interest, were selected using ampicillin resistance. And selecting about 10 clones, sequencing, checking whether random point mutation of a key region occurs or not and whether the mutation number meets the requirement, and adjusting the initial template concentration according to the result to enable the obtained clones to reach the desired mutation frequency. Because the fragment ligation products (mutant fragments and vector fragment recombinant ligation products) of the present example are difficult to directly and efficiently transform into BL21, the present protocol converts the recombinant products into DH 5. Alpha. First, and then extracts plasmids from DH 5. Alpha. Mixed plaques for transformation into BL 21. BL21 clones grown successfully on ampicillin plates were then randomly sequenced and tested for expected mutation results. If the fragment ligation product can be directly transferred to BL21, the step of transferring DH 5. Alpha. Can be omitted.

In one specific example, the enzyme used to create a library of sirtuin mutants by error-prone PCR mutagenesis of a selected sirtuin gene is an enzyme in GeneMorph II Random Mutagenesis Kit of Agilent corporation.

S220, splitting each mutant in the sirtuin mutant library, carrying out solid-liquid separation, and collecting splitting supernatant.

Wherein, adopt cell lysate to carry out the schizolysis, cell lysate includes: non-denaturing detergent, buffer at pH 7-8. The cell lysate can lyse cells containing sirtuin, and the obtained lysate can be used for AMC fluorescence detection of sirtuin deacylase activity without purification.

Further, the cell lysate comprises 0.5-2% by mass of non-denaturing detergent, 100-200 mM of salt substance and buffer solution with pH of 7-8.

According to researches, in the cell lysate, the non-denaturing detergent with the mass percentage of 0.5% -2%, 100-200 mM of salt substances and buffer solution with the pH of 7-8 can lyse cells containing the sirtuin, and the obtained lysate can be used for detecting the deacylase activity of the sirtuin through AMC fluorescence without purification, so that the operation is simple, enzyme activity screening can be performed on different sirtuins, and the method is not limited to specific functions of the sirtuin under specific environments. Experiments prove that the cell lysate of the research is adopted to lyse cells, BL21 cell lysate converted with STM1221 is mixed with the AMC peptide segment to react to generate fluorescence, BL21 cell lysate not converted with STM1221 is mixed with the AMC peptide segment to have no fluorescence, and the enzyme activity detection specificity is strong.

Wherein the non-denaturing detergent is at least one of NP-40 (i.e., ethylphenyl polyethylene glycol), sodium oxycholate, and Triton X-100 (polyethylene glycol octylphenyl ether). The addition of non-denaturing detergents allows gentle lysis of the cells, reducing the effect on the released intracellular enzyme activity. Further, the non-denaturing detergent accounts for 0.5-2% of the total mass. Further, the non-denaturing detergent is present in an amount of 0.5% to 1.5% by mass.

The buffer is 25 mM-50 mM Tris-HCl buffer. The buffer solution can assist in cell lysis and can protect the activity of enzymes released by cell lysis.

The salt substance is NaCl or KCl. Sodium chloride and potassium chloride can make the solution reach a certain concentration, maintain osmotic pressure and ensure a certain ionic strength to stabilize protein, and the same component NaCl as normal saline is generally used.

In one specific example, the cell lysate comprises: NP-40 at 1% by mass, 150mM NaCl, pH7.6, 25mM Tris-HCl buffer. The cell lysate can gently lyse cells, and reduce the influence on the activity of released intracellular enzymes.

Wherein the step of lysing the sirtuin mutant library using a cell lysate comprises: mixing the cell lysate with the bacterial liquid containing the sirtuin mutant library cells according to the proportion of 1:20-1:40, and oscillating for 10-20 min at 300rpm at the cracking temperature of 20-30 ℃.

Wherein, the solid-liquid separation mode is centrifugation. In a specific example, the conditions of centrifugation are 4000rpm, centrifugation at 4℃for 10min. The solid-liquid separation method is not limited to centrifugation, and may be other solid-liquid separation methods, such as filtration.

In a specific example, the step of S220 includes: BL21 clones were picked up in 96-well plates and incubated overnight at 37℃at 800 rpm. Then, transferring the saturated bacterial liquid 1:20 into a new 96-well plate for continuous shaking, and after about 1.5-2 hours, the OD reaches 0.4. At this time, IPTG was added at a final concentration of 0.3mM, and sirtuin protein expression was induced at 25 ℃. After 16h, the well plate was centrifuged at 4000rpm at 4℃for 10min to harvest. Then, 10. Mu.L of a mild cell lysate, the active ingredient of which is 25mM Tris-HCl buffer (pH 7.6) containing a non-denaturing detergent, was added to each well of a 96-well plate. The cell lysate was obtained by shaking at 300rpm for 10min. Finally, centrifugation was performed at 4000rpm for 10min at 4℃to obtain a lysate supernatant containing the target sirtuin protein.

S230, measuring the sirtuin deacylation activity of the lysate by adopting an AMC fluorescence method to obtain a sirtuin mutant strain with the required deacylation activity.

7-amino-4-methylcoumarin (AMC) is a polypeptide fluorescent labeling reagent and is widely applied to protease research. When the enzyme activity of the sirtuin is measured by using the AMC fluorescence method, the coumarin amine of the AMC and the carboxyl of the lysine residue at the C end of the polypeptide molecule are subjected to condensation reaction to form an amide bond, so that the polypeptide molecule modified by the AMC is synthesized (the detection principle of the AMC fluorescence method is shown in figure 1). If there is a complete acylated modification group on the lysine side chain, pancreatin cannot hydrolyze the amide bond to release AMC due to steric effects; when the sirtuin removes the acyl modification on the lysine side chain, the steric effect disappears, and the resulting unmodified peptide is then cleaved by trypsin and AMC is released. Since AMC fluoresces under 360nm excitation light and 460nm emission light, and the release amount of AMC is proportional to the enzyme activity of sirtuin, the sirtuin enzyme activity can be quantitatively characterized by reading fluorescence data.

Specifically, the step of S230 includes S231 to S233:

s231, mixing the AMC peptide reaction solution with the cleavage supernatant, and reacting for 1h at 37 ℃ and 200-300 rpm to obtain a first treatment solution.

Wherein the AMC peptide reaction solution contains AMC peptide with acyl modification. The final concentration of the AMC peptide fragment is 100 mu M-500 mu M. Specifically, the final concentration of the AMC peptide fragment was 200. Mu.M. The volume ratio of the AMC peptide fragment reaction solution to the cleavage supernatant was 1:1. The volume ratio is convenient for sampling and sample adding.

In one embodiment, the AMC peptide fragment is a synthetic lysine acylation modified with a BOC protecting group and AMC tagged peptide fragment.

In one embodiment, the acyl modification in the AMC peptide fragment with an acyl modification is an acetyl modification, a succinyl modification, a myristoyl modification, a nonanoyl modification, or a long chain fatty acyl modification. It should be noted that different deacylase activities of sirtuins can be determined using AMC peptide fragments with different acyl modifications. The acyl modification is not limited to the above-mentioned acyl modification, but may be other acyl modifications, and the deacylase activity may be measured as needed, and the AMC-peptide fragment having different acyl modifications may be used.

In a specific example, the AMC peptide fragment with the acyl modification is AMC-peptide ^Ac (i.e., acetyl modified AMC-peptide fragment). The step S231 specifically includes: each well of 384-well plates was filled with AMC-peptide ^Ac Comprises 2. Mu.L of 10 XTris buffer (0.5M Tris-HCl, pH8.0,1.37M NaCl,27mM KCl,10mM MgCl) ₂ )，1μL 20mM NAD ⁺ ，0.8μL 5mM AMC-peptide ^Ac ，6.2μL ddH ₂ O. Thereafter, 10. Mu.L of the obtained sirtuin protein cleavage supernatant was added in a total volume of 20. Mu.L and the final concentration of the peptide fragment was 200. Mu.M. The reaction was carried out at 37℃and 300rpm for 1 hour to obtain a first treatment solution.

S232, adding a 2 Xstopping solution into the first treatment solution, and standing at 25-37 ℃ for reaction for 1-1.5 h to obtain a second treatment solution.

Wherein the volume ratio of the first treatment liquid to the termination liquid is 1:1. The volume ratio is convenient for sampling and sample adding.

Wherein the stop solution comprises 2.0 mg/mL-5.0 mg/mL of trypsin and 2 XTris buffer containing 2 mM-6 mM NAM.

S233, detecting the fluorescence intensity of the second treatment liquid at the excitation wavelength of 360nm and the emission wavelength of 460nm, and judging the deacylase activity of the sirtuin in the cell to be detected according to the fluorescence intensity of the second treatment liquid.

Wherein, the tool for detecting fluorescence intensity is an enzyme-labeled instrument. The means for detecting fluorescence intensity is not limited to the enzyme-labeled instrument, and may be other means capable of detecting fluorescence intensity, such as a fluorescence photometer.

In one specific example, BL21 lysate into a blank plasmid is used as a negative control, and BL21 lysate into a wild-type pTEV5-sirtuin plasmid is used as a positive control.

The fluorescence intensity was found to be proportional to the deacetylase activity of the sirtuin protein. Therefore, the deacetylation activity of the sirtuin can be quantitatively detected according to the proportional relationship. For example, quantitative determination is performed by a standard curve method.

After the sirtuin mutant strain with the required deacylation activity is obtained, clones with large change of the enzyme activity can be sequenced, analyzed and summarized, so that corresponding mutation site information can be obtained, and the deacylation active site of the sirtuin protein can be predicted and verified.

Wherein, calculated under the mutation frequency of 1-4 bases/kb controlled at present, a mutant library with 10 times coverage rate is constructed (2,000-6,000 clones are screened), and the sirtuin amino acid sites of all key regions can be screened, wherein, the mutant library has 2,000-6,000 clones.

The screening method of the sirtuin mutant can simply, conveniently, high-flux and reproducibly screen the deacylase sirtuin artificial mutant. Obtaining random point mutation fragments of the DNA of the sirtuin protein coding by error-prone PCR, constructing recombinant plasmids and transforming the recombinant plasmids into escherichia coli to obtain a sirtuin protein mutant library. Then, the heterologous expressed sirtuin protein mutant in 96-well plate was lysed using optimized gentle cell lysate and crude enzyme solution was obtained. Finally, the deacylation activity of the sirtuin mutant was detected in situ using a method based on AMC fluorophore release. Therefore, the method mainly comprises three steps of library establishment, cleavage and detection, and the sirtuin protein mutant can be subjected to high-throughput screening by culturing and inducing the sirtuin protein through a 96-well plate and performing fluorescence detection through an enzyme-labeled instrument. The method is mainly characterized by simple steps, and the adopted cell lysate is optimized to enable the direct cleavage release of the sirtuin synthesized in vivo to be detected by AMC fluorescence method; moreover, the method has universality, can carry out enzyme activity screening on different sirtuins, and is not limited to the specific functions of the sirtuins in a specific environment; more importantly, the method combines error-prone PCR and AMC fluorescence, and enables high-throughput screening of sirtuin artificial mutants to be possible through seamless connection of thallus protein expression-cleavage-detection. And sequencing the sirtuin mutant to obtain mutation site information, analyzing the relation between site mutation and enzyme activity change, and predicting and verifying the key site of sirtuin deacylation activity.

AMC fluorescence detection is often used to detect single sirtuin enzyme activity, or to screen substrates, inhibitors, etc. corresponding to sirtuin by in vitro enzyme activity detection at high throughput. However, since many sirtuin proteins cannot be expressed and purified in vitro, direct cleavage release after synthesis of the sirtuin in vivo often results in inactivation of subsequent enzymes, and protein purification and other processes are required for enzyme activity detection. The method adopts cell lysate and lyses the sirtuin mutant, the obtained lysate can be used for AMC fluorescence detection of the deacylase activity of the sirtuin without purification, the operation is simple, and the enzyme activity screening can be carried out on different sirtuins, and is not limited to the specific functions of the sirtuin in a specific environment.

At present, the site research of the sirtuin protein or the screening verification of a large number of molecular biology experiments is time-consuming and labor-consuming; or the flux is very low by protein structure resolution. Therefore, development of a high-throughput mutant screening method relying on enzyme activity detection is particularly important. The invention combines error-prone PCR for library construction and AMC fluorescence for enzyme activity detection, obtains a random mutant library with controllable frequency through molecular cloning, obtains enzyme activity information through in-situ detection after protein expression, constructs a complete sirtuin mutant screening system, is simple, reliable and high in flux, can screen and discover deacylated active regulation sites of the sirtuin protein by a simple and high-flux method, and provides a foundation for subsequent study of the structure and functions of the sirtuin.

The method screens sirtuin enzyme activity mutants, performs in-situ expression and activity measurement in escherichia coli, eliminates complicated protein purification and transfer processes, and is very simple and convenient; moreover, the method can be used for testing different deacylation enzyme activities of the sirtuins by using different acylation modified peptide fragments, and can be used for screening the enzyme activities of different sirtuins, so that the method has universality; in addition, the method can simultaneously measure a plurality of proteins in a large batch by combining error-prone PCR and AMC fluorescence, and the test result can be quantified. In conclusion, compared with other methods, the method for researching the high-flux fluorescent lamp has the advantages of simplicity, universality, high flux and the like.

An embodiment of the present application further provides a sirtuin mutant, which is prepared by the screening method of the sirtuin mutant. The sirtuin mutant can be used for deacylase activity change.

Wherein the mutant is obtained by mutating at least one of the following sites of the wild type sirtuin: alanine at position 76, phenylalanine at position 91, histidine at position 147, cysteine at position 155, proline at position 185.

Further, alanine at position 76 was mutated as follows: a76P, A V.

Phenylalanine at position 91 is mutated to one of the following: F91L, F91S.

Histidine 147 is mutated to one of the following: H147L, H147Y.

The cysteine at position 155 is mutated to one of the following: C155R, C155S, C Y.

Proline at position 185 is mutated to one of the following: P185L, P185T.

The following is a detailed description of embodiments.

Reagents and apparatus used in the examples, unless otherwise specified, are all routine choices in the art. The experimental methods without specific conditions noted in the examples are generally carried out according to conventional conditions, such as those described in the literature, books, or recommended by the manufacturer of the kit. The reagents used in the examples are all commercially available.

EXAMPLE 1 obtaining random Point mutant pool

For example, a Sirtuin protein STM1221 derived from salmonella is selected, and random point mutation is carried out in a specific site region (V43-N240) to obtain a random point mutant library with 1-3 mutant amino acids. The specific operation is as follows:

the higher deacetylase activity of the sirtuin protein STM1221 was determined by previous studies, and the segment V43-N240 was selected as a possible active site for the presence of gene fragments by sequence alignment. The gene is constructed on Kan-resistant pET28a-STM1221 plasmid, and a first primer pair (the sequences are shown as SEQ ID No. 1-SEQ ID No. 2) is adopted to amplify DNA fragments (short mutated fragments) of STM1221 key regions with 2-4 point mutations in each product through EP-PCR (i.e. error-prone PCR). Meanwhile, using pTEV5-STM1221 as a template, adopting a second primer pair (the sequences are shown as SEQ ID No. 3-SEQ ID No. 4), amplifying fragments (carrier fragments for short) of STM1221 and an expression vector except a key region by using high-fidelity enzyme, and digesting the template by using DpnI. Gel electrophoresis imaging is carried out on the mutant fragment and the skeleton fragment. The gel electrophoresis diagram of the mutant fragment and the skeleton fragment is shown in FIG. 3. FIG. 3 is a gel electrophoresis diagram of fragments and vector PCR products, wherein band 1 represents a mutant fragment, band 2 represents a vector fragment, and band 3 is a 1.1kb standard. The PCR primers are shown in Table 1. The EP-PCR system formulation is shown in Table 2.

Subsequently, the mutant fragment and the vector fragment are linked by using a recombinase, transformed into DH5 alpha competence, and positive clones, namely target clones, are screened by using Amp resistance. About 10 clones were picked, sequenced, and examined for the occurrence of random point mutations at 2-4 sites in the critical region. The sequencing results are detailed in FIG. 4, and it can be seen from FIG. 4 that random point mutations of 1-4 sites occurred in 8 of 9 clones. Subsequently, the mixed plasmid was extracted from DH 5. Alpha. Plaque and transformed into BL 21. BL21 clones grown successfully on Amp plates were randomly picked and sequenced, and mutation results were examined as expected.

Table 1 primer sequence listing for cloning construction

Primers	Sequence
		STM1221(43-240)-Frag-F	ggaaatgatggaaaacccaaga(SEQ ID No.1)
STM1221(43-240)-Frag-R	ccgacttggcttggctcaag(SEQ ID No.2)
		STM1221(43-240)-Vect-F	cttgagccaagccaagtcgg(SEQ ID No.3)
STM1221(43-240)-Vect-R	tcttgggttttccatcatttcc(SEQ ID No.4)

Table 2 EP-PCR System formulation

Example 2 expression of STM1221 mutant library in situ and protein acquisition

(1) After obtaining a pool of STM1221 random mutants in BL21, the clones were all picked into individual wells of a 96-well plate, cultured in Amp-resistant LB liquid medium, and shaken at 37℃and 800rpm overnight. Transferring the saturated bacteria liquid 1:20 into a new 96-well plate, continuing shaking, after about 1.5-2h, OD reaches 0.4, adding IPTG with the final concentration of 0.3mM, and inducing protein expression at 25 ℃. After 16h, the well plate was centrifuged at 4000rpm at 4℃for 10min to obtain a pellet, and 10. Mu.L of cell lysate was added to each well: non-denaturing detergent with final concentration of 0.5% -2%, pH7.6 and 25mM Tris-HCl buffer solution), oscillating at 300rpm for 10min to obtain cell lysate, centrifuging at 4000rpm and 4 ℃ for 10min to obtain lysate supernatant containing target sirtuin protein, and performing gel electrophoresis imaging on the lysate supernatant.

(2) Referring to step (1) of this example, a bacterial solution induced by E.coli BL21 transformed with pTEV5-SIRT2 plasmid in the same manner was lysed to obtain a lysate containing SIRT2 protein, and the lysate was subjected to gel electrophoresis imaging. Gel electrophoresis of the cleavage supernatant is shown in FIG. 5, and SIRT2 protein is exemplified in FIG. 5. In FIG. 5, lanes 1 are markers, lanes 2, 3 are 0mM IPTG induced lysate supernatant protein lanes, and lanes 4, 5 are lysate supernatant protein lanes after 16h of 0.3mM IPTG induction. As can be seen from fig. 5, the supernatant of the IPTG-induced BL21 cell lysate clearly shows the target band of SIRT2, demonstrating that this method is capable of releasing intracellular proteins, i.e. sirtuins, into the supernatant.

(3) Each well of 384-well plates was filled with AMC-peptide ^Ac The reaction solution of the substrate was 10. Mu.L, which contained 2. Mu.L of 10 XTris buffer (0.5M Tris-HCl, pH 8.0,1.37M NaCl,27mM KCl,10mM MgCl) ₂ )，1μL 20mM NAD ⁺ ，0.8μL 5mM AMC-peptide ^Ac ，6.2μL ddH ₂ O. After that, 10. Mu.L of ddH for use was added ₂ STM1221 or SIRT2 protein solution diluted by O or lysis buffer, the total volume of the reaction system is 20 mu L, the final concentration of Tris is 50mM, and NAD is obtained ⁺ The final concentration was 1mM, the final concentration of peptide fragment was 200. Mu.M, and the final concentration of sirtuin protein was 5. Mu.M. After 1h of reaction at 37℃with shaking at 300rpm, 20. Mu.L of 2 Xstop solution (2.0 mg/mL of trypsin,4mM NAM in 2 XTris buffer) was added to each well, and the mixture was allowed to stand at 25℃for 1.5h. Then, the fluorescence intensity is detected by an enzyme-labeled instrument under excitation of 360nm and emission wavelength of 460nm, and a reaction system without sirtuin is used as a negative control. The measurement results are shown in FIG. 12. FIG. 12 is a graph showing the effect of lysates on the enzymatic activity of STM1221 and SIRT 2.

As can be seen from fig. 12, sirtuin in ddH ₂ The fluorescence intensity of the O and the lysate after the reaction with the peptide fragment was equivalent, which indicates that the lysate of this example did not affect the enzyme activity of the sirtuin.

Example 3 use of AMC-peptides ^Ac Detection of deacetylation Activity of STM1221 mutant library

The mutant library experiment described above obtained in example 2 was carried out to obtain about 80 mutant proteins per 96 well plates, and thus, by enlarging the number of cultured colonies, a total of 1000 STM1221 mutant libraries were obtained in 12 96 well plates. AMC-ARK for subsequent detection ^Ac Peptide fragments (i.e., the AMC labeled peptide fragments modified by acetylation) were synthesized by Anhui national pharmaceutical Co., ltd.

In order to determine whether the lysate would affect protease activity, first, cleavage and enzyme activity detection experiments were performed using BL21 transformed with wild-type STM 1221. BL21 bacteria were lysed using the cell lysate (i.e., lysies buffer) used in example 2, and the lysates were used to detect deacetylase activity. As shown in FIG. six, the cleavage products were directly taken for AMC fluorescence detection, but the cleavage products of the negative control BL21 also reacted with the peptide fragments to generate fluorescence, and no reaction occurred after heat inactivation, which proves that other enzymes may be present in the cell debris of BL21 to generate interference. And after the lysate is centrifuged, only supernatant is taken for AMC fluorescence detection, and only BL21 lysate converted into STM1221 can react with the AMC peptide fragments to generate fluorescence. The fluorescence detection result of BL21 cleavage product and peptide fragment reaction is shown in FIG. 6. In FIG. 6, panel a shows the result of the reaction of whole cell lysate with AMC peptide fragments, and panel b shows the result of the reaction of the supernatant fraction of the lysate with AMC peptide fragments. The formula of the AMC fluorescence detection system is shown in Table 3.

TABLE 3 AMC fluorescence detection System formulation

The activity of purified sirtuin proteins was detected in vitro using synthetic AMC substrates, and the two methods were compared using wild-type STM1221 in this study. Reaction solution 1 containing AMC peptide fragment was added to each well of 384-well platesmu.L, including 2. Mu.L of 10 XTris buffer (0.5M Tris-HCl, pH8.0,1.37M NaCl,27mM KCl,10mM MgCl) ₂ )，1μL 20mM NAD ⁺ ，0.8μL 5mM AMC-peptide ^Ac ，6.2μL ddH ₂ O. Thereafter, 10. Mu.L of purified sirtuin protein or supernatant of the cleavage product of the previous step containing the protein was added. Cell lysis was performed using 2L E.coli BL21, and at least 1mL of sirtuin protein at a concentration of 100. Mu.M could be obtained by final lysis. When the culture system was reduced to a 96-well plate, 200. Mu.L of the bacterial liquid could obtain at least 10. Mu.L of 1. Mu.M protein. Thus, purified STM1221 protein at an initial concentration of 1. Mu.M or 5. Mu.M was chosen for comparison. Because SIRT2 protein also has strong deacetylation capacity, purified SIRT2 or BL21-SIRT2 cleavage products were added as controls. The total volume of the reaction was 20. Mu.L and the final concentration of peptide fragment was 200. Mu.M. The reaction was continued for 1h at 37℃with shaking at 300 rpm. Thereafter, 20. Mu.L of 2 Xstop solution (2.0 mg/mL of trypsin,4mM NAM in Tris assay buffer) was added to each well, and the mixture was allowed to stand at 25℃for 1.5 hours. Then, the fluorescence intensity was detected by an enzyme-labeled instrument at an emission wavelength of 460nm with excitation at 360 nm. The measurement results are shown in Table 4 and FIG. 7. Table 4 shows the values of the respective mutant strains for AMC fluorescence detection, and 1 96-well plate is taken as an example. FIG. 7 shows the results of fluorescence detection of the reaction of purified sirtuin protein or sirtuin-containing cell lysate with a substrate.

TABLE 4 Table 4

Plate 9	1	2	3	4	5	6	7	8	9	10	11	12
													A	46345	110776	66225	451517	142592	546643	153566	93713	312580	113637	99076	49649
B	457713	394376	456787	156837	57052	78195	468420	123861	448189	194200	163502	33148
													C	43628	447466	417861	188219	430785	512417	131285	78640	502496	203276	221562	41640
D	50234	145617	108342	166403	112513	173697	87715	61080	361874	454928	427015	35795
													E	439686	145898	172811	445285	364610	151662	261912	113259	478781	314798	319949	623942
F	505759	484979	145862	270170	495971	529583	318542	301906	361055	97035	538771	563119
													G	51702	54297	498888	75456	509944	417199	251863	273607	264120	234231	226971	562954
H	484050	182736	507296	112210	162246	265215	382770	492457	197407	261659	154586	618305

As can be seen from FIG. 7, 1. Mu.M or 5. Mu.M purified STM1221 or SIRT2 was detected with fluorescence, while lysates containing these proteins showed stronger fluorescence after reaction with the peptide fragments, and BL21 lysates transformed with the blank plasmids were not reacted with the substrate, demonstrating the feasibility of detecting enzyme activity by cell lysis, and the method was greatly reduced in workload compared to purified proteins, in vitro assays, and provided conditions for high throughput screening.

The fluorescence intensity of the reaction product is in direct proportion to the deacetylase activity of the sirtuin, BL21 lysate transferred into a blank plasmid is used as a negative control, BL21 lysate transferred into a wild pTEV5-STM1221 plasmid is used as a positive control, the STM1221 mutant library of the 12 96-well plates is detected, and the deacetylase activity of STM1221 is primarily quantified to obtain 480 clone strains with larger enzyme activity change. Examples of mutant library fluorescence detection results are shown in fig. 8, in which the gray scale represents fluorescence intensity, and the last column is BL21 negative control (4 wells) and w.t.stm1221 positive control (4 wells), respectively.

EXAMPLE 4 sequencing of STM1221 mutant key active site information and validation

STM1221 clones with a decrease in deacetylase activity of > 80% were selected for sequencing, about 500 clones, and 176 mutation sites were obtained after excluding clones with a single clone point mutation number of greater than 5.

Table 5 shows some mutant sites and fluorescence detection results, single point clones detected by sequencing in the same batch of experiments. In the established mutant library containing about 1800 clones, two unit mutants of STM1221-H147L and STM1221-H147Y were obtained by random mutagenesis, and the enzyme activity fluorescence detection results are shown in FIG. nine, and the deacetylation capacity was reduced to be equivalent to that of the negative control. While the H147 site in STM1221 has been shown to be an absolutely conserved site in sirtuin proteins that determines deacylation activity, successful mutation of this site and complete disappearance of the enzyme activity was detected demonstrating the feasibility of screening mutants by this method. In addition, some other mutants such as STM1221-C176G/A212V were obtained, the enzyme activity of which was greatly reduced. The enzyme activity and the site information of the fluorescence detection mutant library are detected, the result is shown in fig. 9, and fig. 9 shows the enzyme activity and the site information of the fluorescence detection mutant library. In FIG. 9, panel a shows the results of fluorescence detection of the mutant library, and panel b shows the results of repeated fluorescence detection of the mutant library. As can be seen from FIG. 9a, the clones with greatly reduced fluorescence were sequenced to obtain point mutation information, and these clones were again induced to express in BL21, and the fluorescence was detected by cleavage, and the results are shown in FIG. 9b, which shows that the fluorescence detection mutants were higher in accuracy and better in reproducibility, consistent with the first detection.

TABLE 5 site of Unit mutant and fluorescence detection results

The sirtuin enzyme activity control sites were analyzed and the results are shown in FIG. 10. FIG. 10 is a chart showing analysis of sirtuin enzyme activity control sites. For the same degree of deacetylation activity change, the enzyme activity decrease due to one site mutation and the enzyme activity change due to 3 site mutations, the former sites have a greater determining effect on the deacetylation activity of STM 1221. Therefore, scoring is performed according to the weight of the mutation site, so that the score information of the amino acid site is obtained, and the higher the score is, the greater the active site determining effect is. From the site information, it is speculated that the amino acids W67, V75, H227, etc. in STM1221 may be crucial for their deacetylation activity. In the subsequent work, corresponding amino acid sites are found for mutation in other typical sirtuins such as human SIRT2, SIRT5, colibacillus cobB and the like through sequence alignment, and active sites are verified.

Specifically, in the established mutant library containing about 1800 clones, a large number of clones with greatly reduced deacetylation activity were found by fluorescence detection, the clones were sequenced to obtain site mutation information in the critical region, and only the cases that four or less point mutations were contained in a single clone were considered, and the mutation site information was counted and scored according to their weights, i.e., only one point mutation was found in one clone, the site was scored 1 point, and four point mutations were found in one clone, and each point was scored 0.25. The statistical results are shown below in FIG. 10, where the score for 5 sites is above 4.5, including the His-147 site that is absolutely conserved in all sirtuin proteins and determines the sirtuin deacylation activity, further confirming that the random point mutation pooling and high throughput fluorescence screening method of this study is feasible for active site searching. Apart from the amino acids at positions Ala-76, this site is mentioned in the structure-related reports of CobB and Sir2Tm proteins, and may be related to the decolonizing activity of CobB and Sir2Tm, the remaining three sites, including Phe-91, cys-155 and Pro-185, which are not reported in the corresponding sites in other sirtuins, and therefore, the method of the present application is of great significance for efficiently discovering completely new potential active sites.

Example 5

Sirtuin is an enzyme with various deacylation activities, which can remove not only acetyl groups on lysine, but also succinyl, crotonyl, long-chain fatty acyl and the like. Synthesis of lysineAMC-peptides with different acyl modifications ^Acy The peptide fragment can be used for detecting other deacylation activities of the sirtuin protein and obtaining information of other deacylated active sites. Therefore, the method used in the present application is not limited to the detection of deacetylation activity, but can be applied to the detection of other deacylation activities of sirtuins, and all the methods are included in the protection scope of the present invention.

This example synthesizes succinylated AMC-peptides in the same manner as in the previous example ^Su Peptide fragments, which react with cell lysates transformed with sirtuin protein expression vectors, likewise produce fluorescence. The measurement results are shown in FIG. 11. FIG. 11 shows a cell lysate and AMC-peptide ^Ac Or AMC-peptide ^Su Fluorescence detection results of the peptide fragment reaction. As shown in FIG. 11, BL21 lysate transformed with the blank plasmid pUC19 did not react with any of the acylated peptide fragments. STM1221 with multiple activities can react with two peptide fragments to generate fluorescence, and the SIRT2 lysate of the deacetylase is only mixed with AMC-peptide ^Ac Reaction of cleavage product of Succinylase SIRT5 with AMC-peptide ^Su The reaction and the generation of strong fluorescence prove the reaction specificity of the substrates, can be used for detecting other enzyme activities and characterizing other mutant libraries to obtain other deacylated active site information.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Claims (13)

1. A method for screening sirtuin mutants, comprising the steps of:

constructing a sirtuin mutant library by adopting an error-prone PCR technology;

lysing each mutant in the sirtuin mutant library, performing solid-liquid separation, and collecting a lysate;

and (3) measuring the sirtuin deacylation activity of the cleavage supernatant at high flux by adopting an AMC fluorescence method to obtain the sirtuin mutant strain with the required deacylation activity.

2. The method of screening for sirtuin mutants according to claim 1, wherein the step of constructing the sirtuin mutant library using error-prone PCR using an initial sirtuin comprising linked critical region segments and non-critical region segments comprises:

error-prone PCR is carried out by taking a plasmid carrying the initial sirtuin gene as a template to obtain a mutant fragment, wherein the mutant fragment is the key region fragment with point mutation;

taking a plasmid carrying an expression vector as a template and carrying out PCR amplification under the action of high-fidelity enzyme to obtain an expression vector fragment, wherein the expression vector is used for expressing the initial sirtuin, the expression vector fragment consists of an expression element and a replication element used for expressing a sirtuin protein, and the plasmid carrying the expression vector is different from a resistance gene of the plasmid carrying the initial sirtuin gene;

and (3) recombining and connecting the mutant fragment and the expression vector fragment, and transferring the mutant fragment and the expression vector fragment into a host cell to obtain the sirtuin mutant library.

3. The method for screening sirtuin mutant according to claim 2, wherein error-prone PCR is performed using a first primer pair having a sequence shown in SEQ ID No.1 to SEQ ID No. 2.

4. The method for screening sirtuin mutant according to claim 2, wherein in the step of PCR amplification using the plasmid of the expression vector as a template and under the action of high fidelity enzyme, a second primer pair is used for PCR amplification, and the sequence of the second primer pair is shown as SEQ ID No. 3-SEQ ID No. 4.

5. The method for screening of sirtuin mutants according to claim 2, wherein the amino acid site of the key region of sirtuin can be screened by constructing a 10-fold coverage mutant library calculated at the mutation frequency of 1-4 bases/kb under current control, wherein the mutant library has 2,000-6,000 clones.

6. The method for screening of sirtuin mutants according to claim 1, wherein in the step of lysing each mutant in the sirtuin mutant library, lysis is performed using a cell lysate comprising: the non-denaturing detergent and the buffer solution with pH value of 7-8, wherein the volume ratio of the cell lysate to the bacterial solution containing the cells to be detected is 1:20-1:40, the lysis temperature is 20-30 ℃, and the lysis time is 10-20 min.

7. The method for screening sirtuin mutants according to claim 1, wherein the step of determining sirtuin deacylation activity of the cleavage supernatant by AMC fluorescence method comprises:

Mixing the AMC peptide reaction solution with the cleavage supernatant, and reacting for 1h at 37 ℃ and 200-300 rpm to obtain a first treatment solution, wherein the AMC peptide reaction solution contains AMC peptide with acyl modification, and the final concentration of the AMC peptide is 100-500 mu M;

adding a 2 Xstopping solution into the first treatment solution, and standing at 25-37 ℃ for reaction for 1-1.5 h to obtain a second treatment solution, wherein the stopping solution comprises 2.0-5.0 mg/mL of trypsin and 2 XTris buffer solution containing 2-6 mM NAM;

detecting the fluorescence intensity of the second treatment liquid at the excitation wavelength of 360nm and the emission wavelength of 460nm, and judging the deacylase activity of the sirtuin in the cell to be detected according to the fluorescence intensity of the second treatment liquid.

8. The method according to claim 7, wherein the acyl modification in the AMC peptide fragment with an acyl modification is an acetyl modification, a succinyl modification, a myristoyl modification, a nonanoyl modification or a long chain fatty acyl modification.

9. The method according to claim 8, wherein the AMC peptide fragment is a peptide fragment having a BOC protecting group-containing lysine acylation modification and an AMC tag.

10. A sirtuin mutant produced by the method of screening a sirtuin mutant according to any one of claims 1 to 9.

11. The sirtuin mutant of claim 10, characterized in that it is obtained by mutation of at least one of the following sites of a wild-type sirtuin: alanine at position 76, phenylalanine at position 91, histidine at position 147, cysteine at position 155, proline at position 185.

12. The sirtuin mutant of claim 10, wherein the alanine at position 76 is one of the following mutations: a76P, A V;

phenylalanine at position 91 is mutated to one of the following: F91L, F91S;

histidine 147 is mutated to one of the following: H147L, H147Y;

the cysteine at position 155 is mutated to one of the following: C155R, C155S, C Y;

proline at position 185 is mutated to one of the following: P185L, P185T.

13. Use of a sirtuin mutant according to any one of claims 10 to 12 for modification of deacylase activity.