CN113584016A - Method for improving enzyme activity of glucosyltransferase EUGT11 by error-prone PCR (polymerase chain reaction) technology and high-throughput screening - Google Patents
Method for improving enzyme activity of glucosyltransferase EUGT11 by error-prone PCR (polymerase chain reaction) technology and high-throughput screening Download PDFInfo
- Publication number
- CN113584016A CN113584016A CN202110942269.1A CN202110942269A CN113584016A CN 113584016 A CN113584016 A CN 113584016A CN 202110942269 A CN202110942269 A CN 202110942269A CN 113584016 A CN113584016 A CN 113584016A
- Authority
- CN
- China
- Prior art keywords
- enzyme activity
- carrying
- error
- prone pcr
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1031—Mutagenizing nucleic acids mutagenesis by gene assembly, e.g. assembly by oligonucleotide extension PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01013—Sucrose synthase (2.4.1.13)
Abstract
The invention provides an error-prone PCR technology and a method for improving enzyme activity of glucosyltransferase EUGT11 by high-throughput screening, which comprises the following steps: a, EUGT11 error-prone PCR amplification, b, constructing an error-prone PCR mutant library, c, screening mutant strains with high flux and improving enzyme activity; d. and (3) analyzing the sequence of the mutant strain with high enzyme activity. Realizing the directed evolution of the glucosyltransferase EUGT11 gene expressed by escherichia coli, and screening to obtain the key base mutation site for improving the enzyme activity and soluble expression quantity of the glucosyltransferase EUGT 11.
Description
Technical Field
The invention provides an error-prone PCR technology and a method for improving enzyme activity of glucosyltransferase EUGT11 by high-throughput screening, belonging to the technical field of biological engineering.
Background
Stevioside (also known as stevioside, stevioside) is a novel natural sweetener extracted from stevia rebaudiana Bertoni (or stevia rebaudiana Bertoni) which is a herb of Compositae, and the use of stevia rebaudiana Bertoni as a herb and sugar substitute in south America has been known for hundreds of years. Stevioside is a natural low calorie sweetener. Stevia sugar has a caloric value of 1/300 of sucrose, is not absorbed after being taken into human body, does not generate heat, and is suitable for patients with diabetes and obesity. Stevia sugar can be mixed with sucrose fructose or isomerized sugar to improve sweetness and taste. Can be used for candy, cake, beverage, solid beverage, fried snack, flavoring agent, and confection. Data from the international sweetener industry show that stevioside has been widely used in the production of foods, beverages, and flavorings in asia, north america, south america, and the european union.
The stevioside compounds have a plurality of components, all have tetracyclic diterpene parent nucleus and are glycosylated and modified to different degrees, so that the stevioside compounds have sweet tastes of different degrees. At present, Stevioside (ST) and Rebaudioside A (RA) in Stevioside compounds are relatively abundant in stevia rebaudiana and have high sweetness, but have aftertaste in mouthfeel, and have better mouthfeel characteristics compared with Rebaudioside D (RD). The content of RD in the stevia rebaudiana is low, and only accounts for about 0.5 percent of the weight of dry leaves, the separation and purification yield from the stevia rebaudiana is low, the production cost is high, and the market demand cannot be met. The glucosyltransferase enzyme EUGT11 catalyzes the formation of RD from RA in the presence of UDPG. The constructed original EUGT11 escherichia coli expression strain has low enzyme activity and low soluble expression quantity of EUGT11 enzyme.
Error-prone PCR is to modify the mutation frequency during amplification by adjusting the reaction conditions, such as increasing the concentration of magnesium ions, adding manganese ions, changing the concentration of four dNTPs in the system, or using low-fidelity DNA polymerase, etc., when the target gene is amplified by using DNA polymerase, thereby randomly introducing mutations into the target gene at a certain frequency to obtain random mutants of protein molecules. The key point is that the selection of the proper mutation frequency is carried out, the mutation frequency is too high, so that most of mutations are harmful mutations, and beneficial mutations cannot be screened, and the mutation frequency is too low, so that all the libraries are wild type populations. The optimal conditions for optimal base substitution rates and error-susceptibility depend primarily on the length of the mutated DNA fragment.
In general, satisfactory results are difficult to obtain for a gene subjected to one-time mutation, and thus a sequential error-prone PCR (sequential iallerror-prone PCR) strategy has been developed. Namely, the beneficial mutation gene obtained by one amplification is used as a template for the next amplification, and random mutagenesis is continuously and repeatedly carried out, so that forward mutations obtained by each amplification are accumulated to generate important beneficial mutations.
Disclosure of Invention
The invention aims to improve the enzyme activity of glucosyltransferase EUGT11 expressed by a coliform strain, realize high-efficiency conversion from RA to RD, and provide a method for improving the enzyme activity of glucosyltransferase EUGT11 by error-prone PCR technology and high-throughput screening.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
a method for improving the enzyme activity of glucosyltransferase EUGT11 by error-prone PCR technology and high-throughput screening is characterized by comprising the following steps:
carrying out error-prone PCR amplification by using a PET30a-EUGT1 plasmid constructed in a laboratory as a template and using primers EP-BsaI-FGAGGTCTCTACGACTCACTATAGGGGAATTGTGAGC and EP-BsaI-RATGGTCTCGCTAGTTATTGCTCAGCGGTGGCA, carrying out agarose gel electrophoresis on a PCR amplification product with the mass fraction of 1.2%, and then cutting, purifying and recovering a target band.
b. Constructing an error-prone PCR mutant library, connecting the purified product with a carrier PET30a by golden gate, transforming the connecting product into escherichia coli BL21(DE3) competence, coating the competent product on a solid LB plate (50 mu g/mLkana) for resistance screening of positive transformants, and forming the error-prone PCR mutant library by all the transformants.
c. Screening mutant strains with high enzyme activity; colonies of individual clones were picked from LB plates and inoculated into 96-well plates containing 1mLLB medium (50. mu.g/mLkana content), each well corresponding to a particular transformant. Wild type clones were inoculated simultaneously per 96-well plate as positive controls. Shaking and culturing at 37 ℃ and 220r/min for 16 h. Under the aseptic condition, 100 mu L of bacterial liquid is taken out from a 96-well plate, transferred to a 96-well plate of a 1mLLB culture medium (containing 50 mu g/mLkana), cultured for 3h at 37 ℃ and 220r/min, added with an IPTG inducer, cultured for 18h at 16 ℃ and 220r/min in a shaking way, centrifugally collected, subjected to enzyme activity determination reaction liquid for re-suspension of bacteria, reacted for 24h at 37 ℃ and 180r/min, subjected to sample preparation and HPLC (high performance liquid chromatography) for detecting the RA conversion rate, and clones with the RA conversion rate higher than that of a positive control are picked out by taking the positive control as reference.
d. Analyzing the sequence of the mutant strain with high enzyme activity; screening out strains with improved enzyme activity, activating in a test tube, carrying out shake flask induction culture, carrying out ultrasonic crushing on thalli, and analyzing the change of protein expression amount by polyacrylamide gel electrophoresis. Extracting plasmids by using a plasmid extraction kit, sequencing by Shanghai worker, analyzing the sequence, and analyzing the influence of the mutant base sites and the amino acid sites on protein expression and enzyme activity.
Further, the error-prone reaction conditions in step a are MgCl 2: 2-10 mM; MnCl 2: 0-1 mM; the PCR reaction conditions were as follows:
further, golden gate ligation in step b, carrier to fragment molar ratio 1: 2; the reaction conditions were as follows:
further, the reaction liquid for enzyme activity determination in the step c is: 0.5mg/ml RA, 1mM UDPG,1mg/ml lysozyme.
Further, the volume of the shake flask validation medium in the step d is 30 ml.
Detailed description of the preferred embodiments
An error-prone PCR technology and a method for improving enzyme activity of glucosyltransferase EUGT11 by high-throughput screening are specifically implemented by the following steps:
example 1
Materials and sources used in the following examples include:
the vector PET30a-EUGT1 containing UGT11 gene is constructed and stored in the laboratory; BL21(DE3) is commercially available from Quanjin; the adjustable error-prone PCR kit is purchased from Beijing Tianenzze Gene technology, Inc.
Example 1:
and a, carrying out error-prone PCR amplification by using a PET30a-EUGT1 plasmid constructed in a laboratory as a template and using primers EP-BsaI-FGAGGTCTCTACGACTCACTATAGGGGAATTGTGAGC and EP-BsaI-RATGGTCTCGCTAGTTATTGCTCAGCGGTGGCA, wherein the ratio of MgCl 2: 6 mM; MnCl 2: 0.2 mM. And (3) carrying out agarose gel electrophoresis on the PCR amplification product with the mass fraction of 1.2%, cutting the gel, purifying and recovering a target band with the size of 1400bp-1500 bp.
b. Constructing an error-prone PCR mutant library, and performing golden gate connection on a purified product and a carrier PET30a according to a molar ratio of the carrier to the fragment of 1: 2, the ligation product was transformed into escherichia coli BL21(DE3) competent, plated on solid LB plates (50 μ g/mLKana) to resistance-select positive transformants, all of which constituted an error-prone PCR mutant pool.
c, screening mutant strains with high enzyme activity; colonies of individual clones were picked from LB plates and inoculated into 96-well plates containing 1mLLB medium (50. mu.g/mLkana content), each well corresponding to a particular transformant. Wild type clones were inoculated simultaneously per 96-well plate as positive controls. Shaking and culturing at 37 ℃ and 220r/min for 16 h. Under the aseptic condition, 100 mu L of bacterial liquid is taken out from a 96-well plate, transferred to a 96-well plate of a 1mLLB culture medium (containing 50 mu g/mLkana), cultured for 3h at 37 ℃ and 220r/min, added with an IPTG inducer, cultured for 18h at 16 ℃ and 220r/min in a shaking way, centrifugally collected, subjected to enzyme activity determination reaction liquid for re-suspension of bacteria, reacted for 24h at 37 ℃ and 180r/min, subjected to sample preparation and HPLC (high performance liquid chromatography) for detecting the RA conversion rate, and clones with the RA conversion rate higher than that of a positive control are picked out by taking the positive control as reference.
d. Analyzing the sequence of the mutant strain with high enzyme activity; and (3) screening out strains with improved enzyme activity, activating the strains in a test tube, carrying out shake flask induction culture on the strains with improved enzyme activity, carrying out ultrasonic crushing on the strains, and analyzing the change of the protein expression amount by polyacrylamide gel electrophoresis. Extracting plasmids by using a plasmid extraction kit, sequencing by Shanghai worker, analyzing the sequence, and analyzing the influence of the mutant base sites and the amino acid sites on protein expression and enzyme activity.
10000 mutant library capacity; the base mutation rate is 0-4.2 per mill (average 1.9 per mill); the mutation rate of amino acid is 0-10.7 per mill (average 4.3 per mill +3 frameshift); the mutant strain with improved enzyme activity has a favorable mutation rate of 0.8 per mill.
Example 2:
and a, carrying out error-prone PCR amplification by using a PET30a-EUGT1 plasmid constructed in a laboratory as a template and using primers EP-BsaI-FGAGGTCTCTACGACTCACTATAGGGGAATTGTGAGC and EP-BsaI-RATGGTCTCGCTAGTTATTGCTCAGCGGTGGCA, wherein the ratio of MgCl 2: 4 mM; MnCl 2: 0.02 mM. And (3) carrying out agarose gel electrophoresis on the PCR amplification product with the mass fraction of 1.2%, cutting the gel, purifying and recovering a target band with the size of 1400bp-1500 bp.
b. Constructing an error-prone PCR mutant library, and performing golden gate connection on a purified product and a carrier PET30a according to a molar ratio of the carrier to the fragment of 1: 2, the ligation product was transformed into escherichia coli BL21(DE3) competent, plated on solid LB plates (50 μ g/mLKana) to resistance-select positive transformants, all of which constituted an error-prone PCR mutant pool.
c. Screening mutant strains with high enzyme activity; colonies of individual clones were picked from LB plates and inoculated into 96-well plates containing 1mLLB medium (50. mu.g/mLkana content), each well corresponding to a particular transformant. Wild type clones were inoculated simultaneously per 96-well plate as positive controls. Shaking and culturing at 37 ℃ and 220r/min for 16 h. Under the aseptic condition, 100 mu L of bacterial liquid is taken out from a 96-well plate, transferred to a 96-well plate of a 1mLLB culture medium (containing 50 mu g/mLkana), cultured for 3h at 37 ℃ and 220r/min, added with an IPTG inducer, cultured for 18h at 16 ℃ and 220r/min in a shaking way, centrifugally collected, subjected to enzyme activity determination reaction liquid for re-suspension of bacteria, reacted for 24h at 37 ℃ and 180r/min, subjected to sample preparation and HPLC (high performance liquid chromatography) for detecting the RA conversion rate, and clones with the RA conversion rate higher than that of a positive control are picked out by taking the positive control as reference.
d. Analyzing the sequence of the mutant strain with high enzyme activity; and (3) screening out strains with improved enzyme activity, activating the strains in a test tube, carrying out shake flask induction culture on the strains with improved enzyme activity, carrying out ultrasonic crushing on the strains, and analyzing the change of the protein expression amount by polyacrylamide gel electrophoresis. Extracting plasmids by using a plasmid extraction kit, sequencing by Shanghai worker, analyzing the sequence, and analyzing the influence of the mutant base sites and the amino acid sites on protein expression and enzyme activity.
10000 mutant library capacity; the base mutation rate is 0-3 per mill (average 2 per mill); the mutation rate of amino acid is 0-1 per mill (average 1 per mill +0 frame shift); the enzyme activity of the mutant strain is improved, and the favorable mutation rate of the mutant strain is 0.6 per mill.
Claims (5)
1. An error-prone PCR technology and a method for improving enzyme activity of glucosyltransferase EUGT11 by high-throughput screening are characterized by comprising the following steps:
carrying out error-prone PCR amplification by using a PET30a-EUGT1 plasmid constructed in a laboratory as a template and using primers EP-BsaI-FGAGGTCTCTACGACTCACTATAGGGGAATTGTGAGC and EP-BsaI-RATGGTCTCGCTAGTTATTGCTCAGCGGTGGCA, and carrying out gel cutting, purifying and recovering a target band after a PCR amplification product is subjected to agarose gel electrophoresis with the mass fraction of 1.2%;
b. constructing an error-prone PCR mutant library, connecting the purified product with a carrier PET30a by golden gate, converting the connecting product into escherichia coli BL21(DE3) competence, coating the competent cells on a solid LB flat plate (50 mu g/mLkana) for resistance screening of positive transformants, and forming the error-prone PCR mutant library by all the transformants;
c. screening mutant strains with high enzyme activity; selecting single clone sub-colonies from an LB plate, inoculating the single clone sub-colonies into a 96-well plate containing a 1mLLB culture medium (containing 50 mu g/mLkana), wherein each hole corresponds to a specific transformant, inoculating wild type clones into each 96-well plate simultaneously to serve as a positive control, carrying out oscillation culture at 37 ℃ and 220r/min for 16h, taking 100 mu L of bacterial liquid from the 96-well plate under an aseptic condition, transferring the bacterial liquid into the 96-well plate containing the 1mLLB culture medium (containing 50 mu g/mLkana), carrying out oscillation culture at 37 ℃ and 220r/min for 3h by adding an IPTG inducer, carrying out oscillation culture at 16 ℃ and 220r/min for 18h, carrying out centrifugal collection of bacteria, carrying out enzyme activity determination of reaction liquid resuspension, carrying out HPLC reaction at 37 ℃ and 180r/min for 24h, carrying out sample preparation, detecting the RA conversion rate, and taking the positive control as reference, and picking out the clones with the RA conversion rate higher than that of the positive control;
d. analyzing the sequence of the mutant strain with high enzyme activity; selecting a strain with improved enzyme activity, activating a test tube, carrying out shake flask induction culture, carrying out ultrasonic crushing on thalli, analyzing the change of protein expression amount by polyacrylamide gel electrophoresis, extracting plasmids by using a plasmid extraction kit, carrying out Shanghai biological engineering sequencing, carrying out sequence analysis, and analyzing the influence of mutant base sites and amino acid sites on protein expression and enzyme activity.
2. The process according to claim 1, wherein the error-prone reaction conditions in step a are MgCl 2: 2-10 mM;
MnCl 2: 0-1 mM; the PCR reaction conditions were as follows:
3. a method according to claim 1, wherein the golden gate ligation in step b is performed in a carrier to fragment molar ratio of 1: 2; the reaction conditions were as follows:
4. the method of claim 1, wherein the liquid for measuring the enzyme activity in the step c is: 0.5mg/ml RA, 1mM UDPG,1mg/ml lysozyme.
5. A method according to claim 1, wherein the volume of shake flask validation medium in step d is 30 ml.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110942269.1A CN113584016A (en) | 2021-08-17 | 2021-08-17 | Method for improving enzyme activity of glucosyltransferase EUGT11 by error-prone PCR (polymerase chain reaction) technology and high-throughput screening |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110942269.1A CN113584016A (en) | 2021-08-17 | 2021-08-17 | Method for improving enzyme activity of glucosyltransferase EUGT11 by error-prone PCR (polymerase chain reaction) technology and high-throughput screening |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113584016A true CN113584016A (en) | 2021-11-02 |
Family
ID=78258298
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110942269.1A Pending CN113584016A (en) | 2021-08-17 | 2021-08-17 | Method for improving enzyme activity of glucosyltransferase EUGT11 by error-prone PCR (polymerase chain reaction) technology and high-throughput screening |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113584016A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114045273A (en) * | 2021-11-15 | 2022-02-15 | 四川大学 | Glycosyl transferase OsUGT91C1 mutant and application thereof |
| WO2024055291A1 (en) * | 2022-09-16 | 2024-03-21 | 中国科学院深圳先进技术研究院 | Method for high-throughput screening of sirtuin mutant, sirtuin mutant, and use thereof |
-
2021
- 2021-08-17 CN CN202110942269.1A patent/CN113584016A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| GAVIN J WILLIAMS & JON S THORSON: "A high-throughput fluorescence-based glycosyltransferase screen and its application in directed evolution", NATURE PROTOCOLS, vol. 3, no. 3, pages 359 - 361 * |
| 郭永华 等: "应用易错PCR技术提高环糊精葡萄糖基转移酶的可溶性表达", 微生物学报, vol. 56, no. 10, pages 1552 - 1554 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114045273A (en) * | 2021-11-15 | 2022-02-15 | 四川大学 | Glycosyl transferase OsUGT91C1 mutant and application thereof |
| CN114045273B (en) * | 2021-11-15 | 2022-07-22 | 四川大学 | Glycosyl transferase OsUGT91C1 mutant and application thereof |
| WO2023083359A1 (en) * | 2021-11-15 | 2023-05-19 | 四川大学 | Glycosyltransferase osugt91c1 mutant and use thereof |
| WO2024055291A1 (en) * | 2022-09-16 | 2024-03-21 | 中国科学院深圳先进技术研究院 | Method for high-throughput screening of sirtuin mutant, sirtuin mutant, and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113584016A (en) | Method for improving enzyme activity of glucosyltransferase EUGT11 by error-prone PCR (polymerase chain reaction) technology and high-throughput screening | |
| US10689410B2 (en) | Recovery of steviol glycosides | |
| US10745720B2 (en) | Production method for tagatose | |
| CN111518782B (en) | Glycosyltransferase UGTZJ1 mutant and application thereof | |
| CN107567492B (en) | UDP-glycosyltransferase | |
| US20160160257A1 (en) | Diterpene production in yarrowia | |
| CN112375750B (en) | Glycosyltransferase mutant and method for catalytically synthesizing rebaudioside A by using same | |
| JP2020010710A (en) | Psicose mixed saccharide composition with improved sweetness quality and crystallization | |
| CA1182409A (en) | Plasmids constructed by gene manipulation, strains of escherichia coli carrying them, and process of tryptophan production using said strains | |
| TWI738050B (en) | Variant phosphoribosylpyrophosphate amidotransferase and method of preparing purine nucleotide using the same | |
| CN114276971A (en) | Recombinant escherichia coli for synthesizing 2' -fucosyllactose by utilizing mannose and application thereof | |
| CN110591989A (en) | High-yield L-tryptophan engineering strain and application thereof | |
| CN114196559A (en) | Steviol glycoside transport | |
| CN111206009B (en) | Genetic engineering bacterium for high yield of D-psicose and application thereof | |
| EP3633023A1 (en) | Strain in microbacterium and method for producing psicose using same | |
| CN111944724A (en) | Strain for efficiently converting stevioside into rubusoside, and culture method and application thereof | |
| CN110592043A (en) | UDP-glucosyltransferase mutant and application thereof | |
| CN114574460B (en) | Method for efficiently biosynthesizing rebaudioside M by utilizing glycosyltransferase UGT76G1 mutant | |
| CN109234340B (en) | Method for catalytically synthesizing rebaudioside M by recombinant yeast | |
| CN109196110A (en) | Preparation method, rebandioside A alternation enzyme and the application of rebandioside A | |
| CN110872586B (en) | Immobilized glucosyltransferase, preparation method and method for producing rebaudioside D by catalysis | |
| CN113862319A (en) | Application of ginseng glycosyltransferase in synthesis of stevioside | |
| CN114045273A (en) | Glycosyl transferase OsUGT91C1 mutant and application thereof | |
| CN113234108A (en) | Method for increasing proportion of D-psicose in mixed sugar solution and application thereof | |
| CN105154459A (en) | Novel bacillus arabinose isomerase gene cloning and expression method and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |