WO2024029707A1 - Souche chimérique du virus nord-américain et européen du syndrome respiratoire et reproductif porcin et son procédé de production - Google Patents

Souche chimérique du virus nord-américain et européen du syndrome respiratoire et reproductif porcin et son procédé de production Download PDF

Info

Publication number
WO2024029707A1
WO2024029707A1 PCT/KR2023/007215 KR2023007215W WO2024029707A1 WO 2024029707 A1 WO2024029707 A1 WO 2024029707A1 KR 2023007215 W KR2023007215 W KR 2023007215W WO 2024029707 A1 WO2024029707 A1 WO 2024029707A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
prrsv
genome
virus
chimeric
Prior art date
Application number
PCT/KR2023/007215
Other languages
English (en)
Korean (ko)
Inventor
박창훈
Original Assignee
을지대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020230061089A external-priority patent/KR20240019014A/ko
Priority claimed from KR1020230061090A external-priority patent/KR20240019015A/ko
Application filed by 을지대학교 산학협력단 filed Critical 을지대학교 산학협력단
Publication of WO2024029707A1 publication Critical patent/WO2024029707A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof

Definitions

  • the present invention relates to a chimeric strain of a chimeric virus and a method for producing the same, and more specifically, to a chimeric strain of the North American and European porcine reproductive and respiratory syndrome viruses and a method for producing the same.
  • Porcine reproductive and respiratory syndrome virus causes one of the most devastating diseases in the swine industry, resulting in significant economic losses.
  • the virus causes complex respiratory syndrome in pigs of all ages and reproductive failure in sows (Nauwynck, HJ, et al., Transboundary and emerging diseases , 59, 50-54. 2012).
  • the main clinical signs of PRRSV in sows often occur in the second trimester of pregnancy, and PRRSV infection is associated with high abortion rates (up to 40%) in the third trimester.
  • Early farrowing and congenital piglet infections can also occur, which can increase pre-weaning mortality, and although clinical signs are often mild or absent in adult pigs, piglet mortality due to emergent highly pathogenic strain infections is low.
  • PRRSV order Nidovirales, family Arteriviridae, genus Arterivirus
  • LDV lactate dehydrogenase-elevating virus
  • the present invention is intended to solve various problems including the problems described above, and uses reverse genetics technology to simultaneously express genetically different antigens of North American and European PRRSV, thus protecting against various PRRSV and existing live toxins.
  • the purpose is to provide chimeric strains of North American and European porcine reproductive and respiratory syndrome viruses that can provide significantly broader cross-immunity than vaccine viruses, and methods for producing the same.
  • these tasks are illustrative and do not limit the scope of the present invention.
  • the present invention includes a hybrid genome in which a first genome part derived from the European PRRSV strain genome and a second genome part derived from the North American PRRSV strain genome are mixed, and the hybrid genome includes all ORFs of PRRSV,
  • An infectious chimeric strain of porcine reproductive and respiratory syndrome virus is provided, which contains overlapping ORF6 of the European PRRSV strain and the North American PRRSV strain and induces a cross-immune response to the North American PRRSV and European PRRSV strains.
  • a vaccine composition for preventing or treating North American and European porcine reproductive and respiratory syndrome comprising the infectious chimeric strain as an active ingredient, is provided.
  • Designing a sequence in which the first genome part is connected to the second genome part in frame includes all ORFs of PRRSV, and overlaps ORF6 of the European RRRSV strain genome and the North American PRRSV strain genome;
  • a method for producing infectious chimeric strains of North American and European porcine reproductive and respiratory syndrome viruses including the step of recovering the chimeric strains from the transfected cells.
  • the chimeric strains of the North American and European porcine reproductive and respiratory syndrome viruses of the present invention as described above can produce chimeric viruses that simultaneously express antigens of two genetically very different genotypes (North American and European) depending on the production method. It provides cross-immunity against PRRSV, both North American and European genotypes, and can be used to manufacture a vaccine for the effective prevention and/or treatment of PRRS disease.
  • the scope of the present invention is not limited by this effect.
  • Figure 1a schematically shows the method for producing chimeras of the North American and European porcine reproductive and respiratory syndrome viruses of the present invention, and is a schematic diagram showing the structures of four chimeric virus clones.
  • Figure 1b is a diagram showing the sequence of the chimeric virus clone of the present invention (SEQ ID NO: 6) and the transcriptional regulatory sequence (TRS, SEQ ID NO: 2) inserted therein.
  • Figure 2a is a graph showing the analysis results of the virus replication curve after treatment of the chimera of the present invention and BP2017-2 and E38 parent strain in MARC-145 cells.
  • An asterisk (*) indicates a significant difference (p ⁇ 0.05) between the chimera and the parent strain.
  • Figure 2b is a graph showing the results of chimeric virus production analysis according to serial passage in MARC-145 cells.
  • Figure 3 is a graph showing the results of analyzing the change in copy number of the viral genome in the serum of inoculated pigs over time.
  • the asterisk (*) indicates significant difference ( p ⁇ 0.05) between the BP2017-2 group and the E38 and chimera groups. NC, negative control.
  • Figure 4a is a graph showing the results of the LYM infection analysis, which analyzed the neutralizing activity of the chimera and parent strain against infection by several PRRSV strains. Asterisks (*) and daggers ( ⁇ ) indicate significant differences ( p ⁇ 0.05).
  • Figure 4b is a graph showing the results of the SNU090851 infection analysis, which analyzed the neutralizing activity of the chimera and parent strain against infection with several PRRSV strains.
  • Figure 4c is a graph showing the results of the BP2017-2 infection analysis, which analyzed the neutralizing activity of the chimera and parent strain against infection with several PRRSV strains.
  • Figure 4d is a graph showing the results of the SNU090485 infection analysis, which analyzed the neutralizing activity of the chimera and parent strain against infection with several PRRSV strains.
  • Figure 4e is a graph showing the results of the SNU100057 infection analysis, which analyzed the neutralizing activity of the chimera and parent strain against infection with several PRRSV strains.
  • Figure 4f is a graph showing the results of the E38 infection analysis, which analyzed the neutralizing activity of the chimera and parent strain against infection by several PRRSV strains.
  • Figure 4g is a diagram classifying the phylogenetic tree of the experimental strains (indicated by boxes) used in the present invention and other representative strains.
  • the tree was generated using a distance-based neighbor joining method using MEGA 11.
  • FIG. 5 is a diagram showing the transcriptional regulatory sequence (TRS)6 inserted between the BP2017-2 genome and the genome of E38 for the construction of the chimeric PRRSV clone of the present invention (SEQ ID NO: 7).
  • TRS transcriptional regulatory sequence
  • PRRSV Positive-sense single stranded RNA
  • N glycosylated structural proteins
  • GP2, GP3, GP4, GP5 and N glycosylated structural proteins
  • the minor structural proteins GP2, GP3, and GP4 form a heterotrimer and act when the virus invades into host cells, and the major structural proteins GP5 and M form a heterodimer to increase the virus' infectiousness. It acts to increase.
  • ORF open reading frame
  • ORFs are generally found in the RNA or DNA base sequence of a virus, and the viral RNA or DNA base sequence is divided into units consisting of three bases called codons.
  • ORF is a continuous sequence of codons and is a region that can code for one or more proteins.
  • Viruses often consist of a single RNA molecule or smaller fragment, which may contain one or more ORFs.
  • ORFs are very important for virus survival, and their use can improve understanding of the virus life cycle and replication mechanism, and also play an important role in the development of virus vaccines.
  • the present invention includes a hybrid genome in which a first genome part derived from the European PRRSV strain genome and a second genome part derived from the North American PRRSV strain genome are mixed, and the hybrid genome includes all ORFs of PRRSV,
  • An infectious chimeric strain of porcine reproductive and respiratory syndrome virus is provided, which contains overlapping ORF6 of the European PRRSV strain and the North American PRRSV strain and induces a cross-immune response to the North American PRRSV and European PRRSV strains.
  • the first genomic portion may not include ORF1ab but may include ORF2 to ORF4 and ORF6, and the second genomic portion may include ORF1ab and at least one of ORF6 to ORF5 to ORF7. May contain ORF.
  • the hybrid genome may further include a transcriptional regulatory sequence (TRS) represented by SEQ ID NO: 2, and the transcriptional regulatory sequence (TRS) is located between the first and second genomic parts. can be inserted.
  • TRS transcriptional regulatory sequence
  • the infectious chimeric strain In the infectious chimeric strain, it may be deposited under the accession number KCTC 15431BP, the North American PRRSV strain may be the BP2017-2 strain deposited under the accession number KCTC 13393BP, and the European PRRSV strain may have the nucleotide sequence shown in SEQ ID NO: 1. It may be an E38 strain with comprised genomic nucleic acids.
  • a vaccine composition for preventing or treating North American and European porcine reproductive and respiratory syndrome comprising the infectious chimeric strain as an active ingredient, is provided.
  • Designing a sequence in which the first genome part is connected to the second genome part in frame includes all ORFs of PRRSV, and overlaps ORF6 of the European RRRSV strain genome and the North American PRRSV strain genome;
  • a method for producing infectious chimeric strains of North American and European porcine reproductive and respiratory syndrome viruses including the step of recovering the chimeric strains from the transfected cells.
  • the first genomic part may consist of ORF2 to ORF6, and the second genomic part may include ORF1ab, ORF6, and ORF7.
  • chimeric virus refers to an avirulent virus capable of eliciting an immune response in a target mammal without causing clinical signs of PRRS disease, and also refers to infection with an attenuated virus and an attenuated virus. This may mean a lower incidence of clinical signs in untreated animals, or a reduction in the severity of signs compared to “control” animals infected with non-attenuated PRRS virus.
  • reduced/reduced means a reduction of at least 10%, preferably 25%, more preferably 50%, and most preferably 100% or more compared to the control group as previously defined.
  • a “vaccine composition” may be a PRRS chimeric virus or any immunogenic fragment or fraction thereof, preferably an attenuated PRRS chimeric virus, such as the PRRS chimeric virus of the invention above. This triggers the host's “immunological response” to be a cellular and/or antibody-mediated immune response against PRRSV.
  • the vaccine composition is capable of conferring preventive immunity against PRRSV infection and clinical signs associated therewith.
  • immune response refers to any cell- and/or antibody-mediated immune response to the chimeric virus or vaccine administered to an animal receiving the PRRSV chimeric virus of the present invention, or a vaccine composition comprising the same. means.
  • immune response includes, but is not limited to, one or more of the following effects: antibodies, B cells, and antibodies specifically induced against the antigen or antigens contained in the composition or vaccine. , production or activation of helper T cells, suppressor T cells and/or cytotoxic T cells and/or ⁇ T cells.
  • the host it is desirable for the host to exhibit a therapeutic or prophylactic immunological response such that resistance to new infections is improved and/or the clinical severity of the disease is reduced compared to a control group that has not received the immunogenic composition or vaccine.
  • Such prevention may be evidenced by a reduction in the frequency or severity of symptoms associated with host infection, including the absence of symptoms up to and including the above-mentioned host infections.
  • pigs As used herein, the terms “pigs,” “pig,” and “pig” may be used interchangeably.
  • Vaccinate also means administering the PRRSV chimeric virus described herein or a vaccine comprising the same prior to exposure to PRRS disease.
  • prevention or “prevention” means a reduction in the clinical occurrence frequency, severity or frequency of signs of PRRS as a result of administration of the PRRSV virus of the present invention or a vaccine composition containing it. The reduction in severity or frequency is a result of comparison with an animal or group of animals that did not receive the PRRSV chimeric virus of the present invention or a vaccine composition containing the same.
  • the animal may preferably be a pig.
  • the present invention provides a chimeric strain of the porcine reproductive and respiratory syndrome (PRRS) virus, which possesses the ORF1, ORF6, and ORF7 regions of the North American porcine reproductive and respiratory syndrome virus (PRRSV) and at the same time, the European porcine reproductive and respiratory syndrome virus (PRRSV). ) may include ORF2, ORF3, ORF4, ORF5, and ORF6 regions.
  • PRRS porcine reproductive and respiratory syndrome
  • ORF1, ORF6, and ORF7 sequences of the PRRSV chimeric strain of the present invention may be from the BP2017-2 strain, a type of North American PRRSV, and the ORF2, ORF3, ORF4, ORF5, and ORF6 regions may be from the E38 strain, a type of European PRRSV. .
  • TRS Transcriptional Regulatory Signal
  • the sequence of the restriction enzyme Afe I and part of the TRS 6 sequence of BP2017-2 were inserted into the termination point of the ORF1b sequence of the BP2017-2 strain, and the E38 ORF2 was inserted immediately thereafter. The same sequence was inserted after E38 ORF6 and is connected to ORF6 of BP2017-2.
  • the PRRSV chimeric strain can express the non-structural protein of BP2017-2 and simultaneously express part of the structural protein of BP2017-2 and part of the structural protein of E38.
  • the PRRSV chimeric strain of the present invention has the infectious power to proliferate in MARC 145 cells and has the infectious power to induce an antibody response when inoculated into pigs.
  • the present invention also provides a pharmaceutical composition for preventing or treating porcine reproductive and respiratory syndrome, comprising an attenuated PRRSV mutant strain and/or subcultured progeny of the mutant strain.
  • the porcine reproductive and respiratory syndrome may be caused by the European type (type 1) porcine reproductive and respiratory syndrome virus.
  • the subcultured progeny may be 1 to 80 passages, 1 to 70 passages, 1 to 60 passages, 1 to 50 passages, 1 to 40 passages, 1 to 30 passages, 1 to 20 passages, or 1 to 10 passages of the virus mutant strain. It may contain cultured progeny viruses.
  • composition for preventing or treating porcine reproductive and respiratory syndrome of the present invention may contain additional ingredients known to those skilled in the art, and may further include appropriate carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, These include cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate and mineral oil.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations are prepared by mixing the composition with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. It is prepared. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups.
  • Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.
  • Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • injectable ester such as ethyl oleate.
  • Withepsol, Macrogol, Tween 61, cacao, laurin, glycerogeratin, etc. can be used as a base for suppositories.
  • the preferred dosage of the composition of the present invention varies depending on the individual's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art.
  • the composition of the present invention can be administered in an amount of 0.0001 to 1,000 mg/kg (body weight) per day.
  • the composition may be administered once a day, or may be administered several times.
  • the pharmaceutical composition according to an embodiment of the present invention may be a vaccine composition.
  • the vaccine may be a live vaccine and/or a killed vaccine, and specifically, the attenuated PRRS chimeric virus described herein may be a modified live vaccine containing one or more of the above-described virus strains in a viable state in a pharmaceutically acceptable carrier. . Additionally, inactivated viruses can also be used to produce killed vaccines.
  • the vaccine may contain an appropriate concentration of PRRSV mutants in consideration of the weight, age, dietary stage, and/or immunity of the administration subject within the scope of PRRS prevention.
  • the dosage of the virus variant in the vaccine composition is in the range of TCID 50 2 to 6, or TCID 50 3 to 4, but may vary depending on the type of individual, and is not limited thereto.
  • the vaccine composition of the present invention can be administered to pigs, and the pigs may be pigs in one or more growth stages selected from the group consisting of weaning stage, growing stage, and fattening stage.
  • the pigs in the weaning period refer to pigs from 7 days or more, 14 days or more, or 21 days or more until they reach a body weight of 30 kg
  • the growing period refers to the period when the pig weighs 30 to 50 kg
  • the fattening period refers to the growing period. It may mean a later period.
  • the pig may be a swine and/or a wild boar, and may be of any breed, but for example, one or more species selected from the group consisting of landrace, Yorkshire, Duroc, Berkshire, and Korean native pigs, 2 There may be more than one species, three or more species, four or more species, or five or more species, and includes all pigs born from crossbreeding between the above species.
  • the vaccine may further include one or more selected from the group consisting of a carrier, diluent, excipient, and adjuvant.
  • Pharmaceutically acceptable carriers are not particularly limited in type, but may include any solvent, dispersion medium, coating, stabilizer, preservative, antibacterial and antifungal agent, isotonic agent, absorption delay agent, etc.
  • the attenuated PRRSV mutant strain of the present invention can be administered orally, parenterally, subcutaneously, intramuscularly, intradermally, sublingually, transdermally, rectally, transmucosally, via surface area via inhalation, buccal administration, or a combination thereof. It can be administered. Additionally, the attenuated PRRSV mutant can be administered in the form of a transplant that can allow sustained release of the attenuated virus.
  • the attenuated PRRSV mutant strain of the present invention or the vaccine composition containing the same may be administered through injection, inhalation, or transplantation, but are not limited thereto.
  • the attenuated PRRSV mutant strain or a vaccine composition comprising the same may be administered once or multiple times, and also intermittently, for example, in the same amount or different doses every day for several days, weeks, or months. You can. Injections may be administered in the desired amount, by subcutaneous or intranasal spray, or alternatively, continuous infusion.
  • the pharmaceutical composition of the present invention may be provided in the form of a kit for preventing or treating porcine reproductive and respiratory syndrome.
  • the kit comprises a container, preferably a vaccine composition containing the attenuated PRRS chimeric virus of the invention, a pharmaceutically acceptable carrier, an adjuvant, and an agent for reducing the clinical signs or effects of PRRS infection, preferably the frequency or severity of PRRS. Instructions for use may be included for administering the immunogenic composition to an animal in need thereof. Kits may also include means for injection and/or other forms of administration. Additionally, the kit may include a solvent.
  • the attenuated vaccine can be lyophilized and reconstituted with a solvent to form a solution for injection and/or inhalation.
  • the solvent may be water, saline, buffer, or reinforcing solvent.
  • the kit may include a separate container containing the attenuated virus, solvent, and/or pharmaceutically acceptable carrier. Instructions for use may be labels and/or printed materials affixed to one or more containers.
  • type 1 and type 2 chimeric PRRSV could provide a solution.
  • the viral envelope of PRRSV contains a set of eight structural proteins, including one small non-glycosylated protein and seven glycosylated proteins (GP2a-b, GP3, GP4, GP5, GP5a, M and N) (Huang, C., et al., Virus Research , 202, 101-111. 2015).
  • nsp2, encoded by ORF 1a was recently found to be integrated within the viral envelope of several isoforms (Kappes, MA, et al., Journal of Virology , 87, 13456-13465. 2013 ). Surprisingly, integration into the envelope of all structural proteins is affected by the absence of either protein.
  • the proteins interact with each other and assemble into virions as a multimeric complex (Dokland, T. Virus Research , 154(1-2), 86-97. 2010).
  • the major envelope proteins GP5 and M exist as a heterodimeric complex linked by disulfide bonds (Wissink, EHJ, et al., Journal of Virology , 79(19), 12495-12506. 2005).
  • the GP5-M complex of the E38 strain is required to encapsulate a nucleocapsid composed of BP2017-2 viral RNA and the N protein, the successful rescue of the chimeric virus may be related to the interaction between the GP5-M heterodimer and the N protein. .
  • the PRRSV RNA-dependent RNA polymerase must transcribe six sub-genomic RNAs, which are then translated into structural proteins that are important for the survival of the virus.
  • BP2017-2 polymerase must recognize TRS within the structural protein-coding region of E38.
  • Type 1 and type 2 PRRSV share a common TRS sequence (TTAACC), but there are significant differences (21-42%) in the sequences surrounding the TRS between the two genotypes (Allende, R., et al., Journal of General Virology, 80, 307-315. 1999).
  • the present invention showed for the first time that type 2 PRRSV polymerase can recognize type 1 PRRSV TRS and translate its protein to generate a chimeric virus.
  • the replication curves showed that the chimeric virus had a significantly lower replication capacity in MARC-145 cells than the parent virus, and the titer of the chimeric virus was 10-100 times lower than that of the parent virus. However, replication capacity was restored through serial passages, indicating adaptation through mutation.
  • chimeric virus elicited a higher range of neutralizing antibodies that inhibited infection by both genotype variants better than the parent virus.
  • the concept of a chimeric virus carrying PRRSV antigens from both genotypes represents a possible approach to extend cross-immunity to both genotypes in endemic situations.
  • the present inventors successfully generated type 1 and type 2 PRRSV chimeric viruses. Co-expression of M proteins from both genotypes was important for recovery of viable virus.
  • the chimeric virus induces neutralizing antibodies against several field viruses belonging to both genotypes, showing potential as a vaccine candidate.
  • the protective efficacy of the chimeric virus against dual infection by both genotypes of virulent PRRSV can be evaluated and used as a live vaccine candidate in the future.
  • PRRSV order Nidovirales, family Arteriviridae, genus Arterivirus
  • LDV lactate dehydrogenase-elevating virus
  • PRRS virus is highly variable due to the nature of RNA viruses, so there are large genetic differences among PRRS viruses.
  • PRRS virus is largely divided into North American and European types.
  • Type 1 (Lelystad virus, LV), which represents the European type, and Type 2, which represents the Northern American strain ATCC VR2332 (the genome sequence of VR2332 is registered in GenBank) (see number AY150564).
  • the estimated genome sequence homology between the two genotypes ranges from 55% to 63% for non-structural proteins and 58% to 79% for structural proteins (Meng, XJ, et al., Journal of General Virology, 76, 3181 -3188. 1995). These genotypes are not limited to their continent of origin and are widespread worldwide, including Northeast Asia (Jiang, Y., et al., Frontiers in Microbiology , 11, 618. 2020).
  • PRRSV MLV efficacy may reportedly be affected by infection.
  • concurrent porcine virus infection can alter PRRSV MLV replication in immunized piglets.
  • Possible interference between vaccine strains suggests limitations in current vaccination strategies to protect against prevalent co-infection with type 1 and type 2 PRRSV.
  • porcine reproductive and respiratory syndrome virus PRRSV
  • PRRSV porcine reproductive and respiratory syndrome virus
  • PRRSV porcine reproductive and respiratory syndrome virus
  • PRRSV porcine reproductive and respiratory syndrome virus
  • the current vaccine is a monovalent vaccine composed solely of a single, attenuated North American or European strain, and has the disadvantage of being poor in its ability to provide cross-immunity to field strains that are genetically/antigenically different from each other.
  • the present invention prepared a novel chimeric vaccine candidate against porcine reproductive and respiratory syndrome virus (PRRSV) genotypes 1 and 2, which induced neutralizing antibodies against both genotypes.
  • PRRSV porcine reproductive and respiratory syndrome virus
  • chimeric types 1 and 2 porcine reproductive and respiratory syndrome virus PRRSV
  • PRRSV porcine reproductive and respiratory syndrome virus
  • the chimeric virus of the present invention may be a strong vaccine candidate.
  • the present inventors selected Korean type 2 PRRSV isolate BP2017-2 (GenBank accession No. MK330996, accession number KCTC 13393BP) as the chimeric virus backbone.
  • the viral non-structural protein-coding sequences ORF1a and ORF1ab were used in all infectious clones.
  • E38 GenBank accession No. KT033457, SEQ ID NO. 1
  • ORF2-ORF7 structural proteins of strain E38 were used for the chimeric virus.
  • E38 ORF5 showed 92.2% and 91.7% nucleotide sequence homology to strains SNU090485 and SNU100057, respectively.
  • MARC-145 cells were used for virus propagation, transfection of infectious clones, and virus recovery. The cells were maintained in appropriate media as previously described (Park, C., et al., Virology , 540, 172-183. 2020).
  • Full-length PRRSV cDNA was assembled from six fragments containing the genome of BP2017-2. Each of the fragments was identified using restriction enzymes. For cloning, an Afe I restriction site (AGCGCT, SEQ ID NO: 3) was inserted between the end of ORF1ab and the beginning of ORF2. All fragments containing the full-length BP2017-2 genome were synthesized de novo (BIONEER Co., South Korea). The first fragment contains the cytomegalovirus promoter and hammerhead ribozyme sequences. The hepatitis delta virus ribozyme sequence was located after the 3' UTR of the last fragment.
  • Each full-length cDNA clone was transfected into MARC-145 cells as described above (Park, C., et al., Virology , 540, 172-183. 2020). Cell culture supernatants were collected 10 days after transfection and used to infect MARC-145 cells. Immunofluorescence assay (IFA) using PRRSV-specific anti-N protein antibody (SR-30; Rural Technologies Inc., Brookings, SD, USA) at 4 days post infection (dpi) to confirm virus rescue. carried out. A third serial passage was performed to further confirm recovery of the chimeric virus. The successfully recovered virus was passed five times, and then the culture supernatant was collected. The structural gene region (ORF2-7), which is distinct from the backbone virus BP2017-2, was amplified with specific primers, and the amplified PCR product was sequenced to confirm genetic stability. .
  • the in vitro replication ability of the recovered chimeric virus was evaluated in MARC-145 cells.
  • the cells were infected with either the parental virus or the chimeric virus (passage 7) at a multiplicity of infection (MOI) of 0.01.
  • Culture media from infected cells were then used for virus titration at 0, 1, 2, 3, 4, and 5 dpi.
  • Viruses harvested at each time point were assessed via IFA in MARC-145 cells and quantified as 50% tissue culture infectious dose (TCID 50 )/mL. All in vitro experiments were performed in triplicate as previously described. Production of chimeric viruses was assessed at passages 3, 7, 10, 15, and 20.
  • MARC-145 cells were infected with supernatants from subcultures at an MOI of 0.01.
  • Viral titers were assessed via IFA in MARC-145 cells at 7 dpi.
  • Serum samples were collected at 0, 7, 14, 21, and 28 dpi, and viral RNA was extracted from the samples using the QIAamp viral RNA Minikit (Qiagen, France) as described above (Park, C., et al., Veterinary Microbiology, 172, 432-442. 2014).
  • Real-time RT-PCR was performed to quantify PRRSV levels in samples.
  • Levels of BP2017-2 were calculated using specific primer sets described above, while levels of E38 and chimeric viruses were determined using primers designed to detect E38 ORF7 (SEQ ID NOs: 4 and 5).
  • Primer sequence information primer 5‘--> 3’ sequence number E38 ORF7 F CCAGTCAGTCAATCAACTGTGC 4 E38 ORF7 R GATTGAAAGCCGTCTGGAT 5
  • Serum samples collected at 28 dpi were tested for the presence of neutralizing antibodies against Korean field isolates (SNU090851, LMY, SNU100057, and SNU090485).
  • An ELISA-based serum neutralization test was performed to evaluate infection inhibition against field isolates as described above (Park, C., et al., Veterinary Microbiology , 256, 109048. 2021). Briefly, MARC-145 cells were seeded in 96 -well plates at 5 Four-fold diluted serum was mixed with an equal amount of test virus (BP2017-2, LMY, SNU090851, E38, SNU090485, or SNU100057) at 10 3 TCID 50/100 ⁇ L and incubated at 37°C for 1 hour.
  • test virus BP2017-2, LMY, SNU090851, E38, SNU090485, or SNU100057
  • Negative controls contain only MARC-145 cells without serum or virus, while positive controls contain MARC-145 cells infected with virus without serum.
  • the cells were washed with PBS and cultured for 24 hours. The cells were fixed and washed in 4% formaldehyde, and permeabilization was increased with 0.1% Triton X-100 (Sigma-Aldrich, St. Louis, MO) in PBS. After fixation, the cells were incubated with SR-30 antibody and secondary HRP-conjugated goat-anti-mouse IgG (H+L) (Bethyl Laboratories) and the inhibition rate was calculated. After reaction with TMB peroxidase substrate, color development was measured at 450 nm. The percent infection inhibition of each dilution was calculated and compared to the positive control after subtracting the background absorbance of the negative control.
  • the histopathology of lung lesions was scored with reference to previous literature (Halbur, PG, et al., Veterinary Pathology , 32, 648-660. 1995).
  • the severity of pneumonia caused by PRRSV was estimated based on the thickness of the interstitium where macrophages and lymphocytes infiltrate in response to virus replication. Lesions in each lung tissue were scored as follows: 0, no lesion; 1, mild interstitial pneumonia; 2, moderate multifocal interstitial pneumonia; 3, moderate metastatic interstitial pneumonia; and 4, severe interstitial pneumonia. Each section was examined in a blinded manner. Immunohistochemistry for PRRSV was performed using the SR30 antibody and samples were analyzed morphometrically. To calculate PRRSV antigen-positive signal, serial tissue sections were analyzed using NIH ImageJ software version 1.43. Ten fields were randomly selected and the number of positive cells per unit area (0.95 mm 2 ) was determined.
  • the BP2017-2 genome was used as the backbone of four chimeric infectious clones in which part of the structural gene region was replaced with an equivalent part of the E38 genome.
  • the genome consisted of the untranslated and non-structural protein coding region of BP2017-2 along with the entire structural protein-coding region of E38 (ORF2-7).
  • the structural regions of the different infectious clones are as follows: ORF2-6 of E38 and ORF7 of BP2017-2 in clone 2; ORF2-5 from E38 and ORF6 and 7 from BP2017-2 in clone 3; Clone 4 contained ORF6 from both parent viruses along with ORF2-6 from E38 and ORF6 and 7 from BP2017-2 ( Figure 1A).
  • all chimeric infectious clones contained an additional 40 nucleotides of the partial BP2017-2 ORF5 sequence, including the transcriptional regulatory sequence (TRS)6 between the end of ORF1ab and the start of ORF2a.
  • TRS transcriptional regulatory sequence
  • the present inventors transfected the chimeric clone into MARC-145 cells according to the protocol with reference to prior literature (Park, C., et al., Virology , 540, 172-183. 2020).
  • PRRSV-specific cytopathic effects CPE
  • IFA confirmed the presence of PRRSV antigen in CPE, and its appearance was reproduced after serial passage of the recovered virus. Failure to recover clones 1, 2 and 3 was confirmed using three consecutive blind passages of MARC-145 cells. No viral genes were detected in the culture supernatant of the final subculture by RT-PCR.
  • the present inventors inoculated the recovered chimeric virus into MARC-145 cells and compared it with the parent viruses BP2017-2 and E38.
  • the virus titer of BP2017-2 was estimated to be 10 3.8 TCID 50 /mL at 1 dpi and reached a peak of 10 6.9 TCID 50 /mL at 5 dpi.
  • the titer of E38 increased from 10 2.7 TCID 50 /mL at 1 dpi to 10 5.8 TCID 50 /mL at 4 dpi and decreased to 10 5.6 TCID 50 /mL at 5 dpi.
  • the chimeric virus collected at passage 7 showed a replication curve similar to BP2017-2 during the experimental period.
  • the estimated viral titer was 10 1.8 TCID 50 /mL at 1 dpi and reached a peak of 10 4.7 TCID 50 /mL at 5 dpi.
  • the titer of the chimeric virus was significantly ( p ⁇ 0.05) lower (up to 100-fold) than that of the parent virus throughout the experiment ( Fig. 2A ).
  • the production of chimeric virus in MARC-145 cells increased with serial passages and the estimated virus titer was 10 3.7 TCID 50 /mL at passage 3, but reached 10 5.8 TCID 50 /mL at passage 20.
  • Culture medium was collected at 5 dpi and viral titer was estimated to be TCID 50 /mL ( Figure 2B).
  • the viral genes of the present invention were detected at 7-14 dpi in the sera of all virus-infected pigs in groups T01, T02 and T03. However, one pig each in groups T02 and T03 was confirmed serum PRRSV negative by RT-PCR at 21 dpi. Four pigs from T02 and two pigs from T03 also tested negative for PRRSV genome in serum at 28 dpi. In contrast, the viral genome was detected in serum collected from all pigs in the T01 group throughout the experiment (Table 3).
  • Genomic copy numbers in the T01 group were significantly higher than those in the T02 group (copy numbers of 4.1 ⁇ 4.2 ⁇ and 2.7 ⁇ at 7, 14, and 21 dpi, respectively) and in the T03 group (7, were significantly higher ( p ⁇ 0.05) than the copy numbers of 3.7 ⁇ 3.9 ⁇ and 2.5 ⁇ at 14 and 21 dpi, respectively.
  • PRRSV RNA was not detected in the negative control (T04) at any time point ( Fig. 3 ).
  • mice resulting from PRRSV infection were evaluated after autopsy. There was no significant difference in mean microscopic lung lesion scores between the viral infection groups (T01, 0.66 ⁇ 0.6; T02, 0.25 ⁇ 0.31; and T03, 0.08 ⁇ 0.16). Additionally, the lesion scores of the three virus-infected groups were not significantly different from those of the negative control group (T04, 0.25 ⁇ Table 3). When immunohistochemistry was applied to the lungs of virus-infected mice, PRRSV antigen was hardly detected.
  • the average infection inhibition rate was 38.7 ⁇ SNU090851 for LMY and 23.7 ⁇ BP2017-2 for 58.7 ⁇ .
  • the inhibitory activity of the chimera group (T03) against BP2017-2 infection was significantly lower (58.7 ⁇ 58.7 ⁇ ) than that of the BP2017-2 group (T01; 81.2 ⁇ .
  • ORF5 sequence homology was between 91.7% and 98.6% between type 1 PRRSV strains and 84.2% and 91% between type 2 PRRSV strains, respectively.
  • the similarity between type 2 PRRSV strains was between 58.4% and 61% ( Figure 4g).
  • Table 4 The results of analyzing the sequence homology of ORF5 among PRRSV are summarized in Table 4 below.
  • the present inventors developed a chimeric virus by combining the genomes of type 1 and type 2 PRRSV.
  • Successful recovery of the vaccine candidate and evaluation of its efficacy through innovative reverse genetics technology showed that pigs inoculated with the chimeric virus exhibited stronger immunological responses, showing greater immunity against multiple PRRSV isolates than pigs inoculated with either of the parent viruses. Since it has been shown to produce neutralizing antibodies that provide protection, it can be used as a vaccine candidate to suppress porcine reproductive and respiratory syndrome virus infection.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention utilise la génétique inverse pour obtenir : une souche chimérique des virus nord-américain et européen du syndrome respiratoire et reproductif porcin, la souche chimérique exprimant simultanément les antigènes du SDRP nord-américain et du SDRP européen, génétiquement différents, et pouvant ainsi se défendre contre divers SDRP et fournir une immunité croisée beaucoup plus large que les virus vaccinaux vivants existants ; et un procédé de production de la souche chimérique.
PCT/KR2023/007215 2022-08-02 2023-05-25 Souche chimérique du virus nord-américain et européen du syndrome respiratoire et reproductif porcin et son procédé de production WO2024029707A1 (fr)

Applications Claiming Priority (8)

Application Number Priority Date Filing Date Title
KR20220096299 2022-08-02
KR10-2022-0096298 2022-08-02
KR10-2022-0096299 2022-08-02
KR20220096298 2022-08-02
KR1020230061089A KR20240019014A (ko) 2022-08-02 2023-05-11 북미형 및 유럽형 돼지생식기호흡기증후군 바이러스의 키메라 균주
KR1020230061090A KR20240019015A (ko) 2022-08-02 2023-05-11 북미형 및 유럽형 돼지생식기호흡기증후군 바이러스의 키메라 제조방법
KR10-2023-0061090 2023-05-11
KR10-2023-0061089 2023-05-11

Publications (1)

Publication Number Publication Date
WO2024029707A1 true WO2024029707A1 (fr) 2024-02-08

Family

ID=89849158

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/007215 WO2024029707A1 (fr) 2022-08-02 2023-05-25 Souche chimérique du virus nord-américain et européen du syndrome respiratoire et reproductif porcin et son procédé de production

Country Status (1)

Country Link
WO (1) WO2024029707A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109762792A (zh) * 2019-01-18 2019-05-17 南京农业大学 一种猪繁殖与呼吸综合征病毒嵌合毒株及其应用

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109762792A (zh) * 2019-01-18 2019-05-17 南京农业大学 一种猪繁殖与呼吸综合征病毒嵌合毒株及其应用

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHAUDHARI JAYESHBHAI, VU HIEP L. X.: "Porcine Reproductive and Respiratory Syndrome Virus Reverse Genetics and the Major Applications", VIRUSES, MDPI, CH, vol. 12, no. 11, 31 October 2020 (2020-10-31), CH , pages 1245, XP093135317, ISSN: 1999-4915, DOI: 10.3390/v12111245 *
KIMPSTON-BURKGREN KATHRYN; CORREAS IGNACIO; OSORIO FERNANDO A.; STEFFEN DAVID; PATTNAIK ASIT K.; FANG YING; VU HIEP L.X.: "Relative contribution of porcine reproductive and respiratory syndrome virus open reading frames 2–4 to the induction of protective immunity", VACCINE, ELSEVIER, AMSTERDAM, NL, vol. 35, no. 34, 6 July 2017 (2017-07-06), AMSTERDAM, NL , pages 4408 - 4413, XP085133841, ISSN: 0264-410X, DOI: 10.1016/j.vaccine.2017.06.061 *
SHABIR NADEEM, KHATUN AMINA, NAZKI SALIK, KIM BUMSEOK, CHOI EUN-JIN, SUN DONG, YOON KYOUNG-JIN, KIM WON-IL: "Evaluation of the Cross-Protective Efficacy of a Chimeric Porcine Reproductive and Respiratory Syndrome Virus Constructed Based on Two Field Strains", VIRUSES, MDPI, CH, vol. 8, no. 8, 22 August 2016 (2016-08-22), CH , pages 240, XP093135311, ISSN: 1999-4915, DOI: 10.3390/v8080240 *
TIAN DEBIN, NI YAN-YAN, ZHOU LEI, OPRIESSNIG TANJA, CAO DIANJUN, PIÑEYRO PABLO, YUGO DANIELLE M., OVEREND CHRISTOPHER, CAO QIAN, L: "Chimeric porcine reproductive and respiratory syndrome virus containing shuffled multiple envelope genes confers cross-protection in pigs", VIROLOGY, ELSEVIER, AMSTERDAM, NL, vol. 485, 1 November 2015 (2015-11-01), AMSTERDAM, NL , pages 402 - 413, XP093135314, ISSN: 0042-6822, DOI: 10.1016/j.virol.2015.08.021 *

Similar Documents

Publication Publication Date Title
US11911454B2 (en) Effective vaccination against porcine reproductive and respiratory syndrome (PRRS) virus prior to weaning
US20200197507A1 (en) North american porcine reproductive and respiratory syndrome (prrs) virus and uses thereof
KR100996105B1 (ko) 돼지 생식기 호흡기 증후군 바이러스의 ｎ 단백질돌연변이체
US20110117129A1 (en) Vaccine Against Highly Pathogenic Porcine Reproductive and Respiratory Syndrome (HP PRRS)
AU2017378336B2 (en) Effective vaccination against European strains of porcine reproductive and respiratory syndrome (PRRS) virus prior to weaning
US9687543B2 (en) Porcine reproductive and respiratory syndrome virus compositions and uses thereof
WO2015056850A1 (fr) Souche mutante chimère de virus du syndrome reproducteur et respiratoire porcin
KR102193460B1 (ko) 돼지생식기호흡기증후군 예방용 백신 조성물 및 이의 예방 방법
KR102335864B1 (ko) 돼지 생식기 및 호흡기 증후군 바이러스의 키메라 바이러스 및 이를 이용한 백신
WO2020138761A1 (fr) Virus chimère du virus du syndrome reproducteur et respiratoire porcin, et vaccin l'utilisant
WO2024029707A1 (fr) Souche chimérique du virus nord-américain et européen du syndrome respiratoire et reproductif porcin et son procédé de production
KR20240019015A (ko) 북미형 및 유럽형 돼지생식기호흡기증후군 바이러스의 키메라 제조방법
KR20240019014A (ko) 북미형 및 유럽형 돼지생식기호흡기증후군 바이러스의 키메라 균주
RU2781446C1 (ru) Химерный вирус репродуктивно-респираторного синдрома свиней и вакцина с использованием указанного вируса

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23850218

Country of ref document: EP

Kind code of ref document: A1