WO2024023801A2 - Cellules immunitaires génétiquement modifiées ayant un transporteur interrompu associé à un gène de traitement d'antigène -1 (tap -1) - Google Patents

Cellules immunitaires génétiquement modifiées ayant un transporteur interrompu associé à un gène de traitement d'antigène -1 (tap -1) Download PDF

Info

Publication number
WO2024023801A2
WO2024023801A2 PCT/IB2023/057725 IB2023057725W WO2024023801A2 WO 2024023801 A2 WO2024023801 A2 WO 2024023801A2 IB 2023057725 W IB2023057725 W IB 2023057725W WO 2024023801 A2 WO2024023801 A2 WO 2024023801A2
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cells
disrupted
car
grna
Prior art date
Application number
PCT/IB2023/057725
Other languages
English (en)
Other versions
WO2024023801A3 (fr
Inventor
Chandirasegaran Massilamany
Original Assignee
Crispr Therapeutics Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Crispr Therapeutics Ag filed Critical Crispr Therapeutics Ag
Publication of WO2024023801A2 publication Critical patent/WO2024023801A2/fr
Publication of WO2024023801A3 publication Critical patent/WO2024023801A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464411—Immunoglobulin superfamily
    • A61K39/464412—CD19 or B4
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464416—Receptors for cytokines
    • A61K39/464417—Receptors for tumor necrosis factors [TNF], e.g. lymphotoxin receptor [LTR], CD30
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464436—Cytokines
    • A61K39/464438—Tumor necrosis factors [TNF], CD70
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/26—Universal/off- the- shelf cellular immunotherapy; Allogenic cells or means to avoid rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/48—Blood cells, e.g. leukemia or lymphoma
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/56—Kidney
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • Chimeric antigen receptor (CAR) T-cell therapy uses genetically-modified T cells to more specifically and efficiently target and kill cancer cells. After T cells have been collected from the blood, the cells are engineered to include CARs on their surface. The CARs may be introduced into the T cells using CRISPR/Cas9 gene editing technology. When these allogeneic CAR T cells are injected into a patient, the receptors enable the T cells to kill cancer cells.
  • CAR Chimeric antigen receptor
  • the present disclosure is based, at least in part, on the development of genetically engineered T cells (e.g., T cells expressing a chimeric antigen receptor or CAR-T cells) comprising a disrupted Transporter Associated with Antigen Processing-1 (TAP-1) gene, optionally in combination additional gene edits (e.g., a disrupted T cell receptor constant region or TRAC gene, a disrupted CD70 gene, or a disrupted CD19 gene).
  • TAP-1 Transporter Associated with Antigen Processing-1
  • additional gene edits e.g., a disrupted T cell receptor constant region or TRAC gene, a disrupted CD70 gene, or a disrupted CD19 gene.
  • T cells comprising a disrupted TAP-1 gene.
  • the T cells may be further engineered to express a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • the disrupted TAP-1 gene may be genetically edited in exon 1 of the TAP-1 gene.
  • the disrupted TAP-1 gene may be genetically edited by CRISPR/Cas-mediated gene editing.
  • the CRISPR/Cas-mediated gene editing comprises a guide RNA (gRNA) targeting a site in the TAP-1 gene that comprises a nucleotide sequence of any one of SEQ ID NOs: 1-8.
  • the target sequence is SEQ ID NO: 1.
  • the target sequence is SEQ ID NO: 3.
  • the gRNA comprises a spacer sequence set forth as any one of SEQ ID NOs: 18, 20, 22, 24, 26, 28, 30, and 32.
  • the gRNA comprises the spacer sequence of SEQ ID NO: 18.
  • the gRNA comprises the spacer sequence of SEQ ID NO: 22.
  • the population of genetically engineered T cells disclosed herein may further comprise:
  • TGFbRIT transforming growth factor beta receptor II
  • the disrupted TRAC gene, the disrupted CD70 gene, the disrupted TGFBRII gene, the disrupted Regl gene, the disrupted CBLB gene, or a combination thereof may be genetically edited by a CRISPR/Cas-mediated gene editing system.
  • the T cells may comprise a nucleic acid encoding the CAR.
  • the nucleic acid may be inserted in a genomic locus of the T cells.
  • the genomic locus in which the nucleic acid encoding the CAR is inserted may be within a safe harbor gene, the disrupted TRAC gene, the disrupted CD70 gene, the disrupted TGFBRII gene, the disrupted Reg-1 gene, or the disrupted CBLB gene.
  • the disrupted TRAC gene comprises the nucleic acid encoding the CAR and the nucleic acid encoding the CAR replaces a fragment in the disrupted TRAC gene.
  • the replaced fragment of the TRAC gene is set forth as SEQ ID NO: 74.
  • the CAR may comprise an extracellular antigen binding domain specific to a tumor antigen, a co- stimulatory signaling domain of 4- IBB or CD28, and a cytoplasmic signaling domain of CD3 ⁇ .
  • the tumor antigen may be CD19, BCMA, or CD70.
  • the extracellular antigen binding domain is a single chain variable fragment (scFv) that binds CD19.
  • scFv single chain variable fragment
  • Such an scFv fragment may comprise the amino acid sequence of SEQ ID NO: 98.
  • an anti-CD19 CAR comprising the scFv may comprise the amino acid sequence of SEQ ID NO: 99.
  • the extracellular antigen binding domain is a single chain variable fragment (scFv) that binds CD70.
  • scFv fragment may comprise the amino acid sequence of SEQ ID NO: 108 or 109.
  • an anti-CD70 CAR comprising the scFv may comprise the amino acid sequence of SEQ ID NO: 110.
  • the extracellular antigen binding domain is a single chain variable fragment (scFv) that binds BCMA.
  • scFv fragment may comprise the amino acid sequence of SEQ ID NO: 119.
  • an anti-BCMA CAR comprising the scFv may comprise the amino acid sequence of SEQ ID NO: 120.
  • any of the genetically engineered T cells disclosed herein may be derived from primary T cells of one or more human donors.
  • Also provided herein is a method for preparing the population of genetically engineered T cells disclosed above and herein. Such method comprises:
  • step (c) producing the population of genetically engineered T cells having a disrupted TAP-1 gene.
  • step (b) may be performed by delivering to the plurality of cells an RNA-guided nuclease and a gRNA targeting the TAP-1 gene.
  • the gRNA targeting TAP-1 is specific to exon 1 of the TAP-1 gene.
  • the gRNA may target a site in the TAP-1 gene that comprises a nucleotide sequence of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7 or 8.
  • Such a gRNA may comprise a spacer sequence set forth as SEQ ID NO: 18, 20, 22, 24, 26, 28, 30, or 32.
  • the gRNA comprises the nucleotide sequence of SEQ ID NO: 17, 33, 19, 35, 21, 37, 23, 39, 25, 41, 27, 43, 29, 45, 31, or 47.
  • the gRNA targets a site in the TAP-1 gene that comprises the nucleotide sequence of SEQ ID NO:1.
  • a gRNA may comprise a spacer set forth as SEQ ID NO: 18.
  • the gRNA comprises the nucleotide sequence of SEQ ID NO: 17 or SEQ ID NO: 33.
  • the gRNA targets a site in the TAP-1 gene that comprises the nucleotide sequence of SEQ ID NO:3.
  • Such a gRNA may comprise a spacer set forth as SEQ ID NO: 22.
  • the gRNA comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 37.
  • the plurality of T cells in step (a) may comprise one or more of the following genetic modifications:
  • T cell receptor alpha chain constant region (TRAC) gene (ii) has a disrupted T cell receptor alpha chain constant region (TRAC) gene
  • any of the methods disclosed herein may further comprise:
  • one or more of (i)-(iv) may be performed by CRISPR/Cas- mediated gene editing comprising one or more RNA-guided nucleases and one or more gRNAs targeting the TRAC gene, the CD70 gene; the TGFBRII gene, the Reg-1 gene, and/or the CBLB gene.
  • the gRNA targeting the TRAC gene comprises the nucleotide sequence of SEQ ID NO: 50. In some examples, the gRNA targeting the TRAC gene comprises the nucleotide sequence of SEQ ID NO:49 or 59.
  • the gRNA targeting the CD70 gene comprises the nucleotide sequence of SEQ ID NO: 58. In some examples, the gRNA targeting the CD70 gene comprises the nucleotide sequence of SEQ ID NO: 57 or 67,
  • the gRNA targeting the TGFBRII gene comprises the nucleotide sequence of SEQ ID NO: 52. In some examples, the gRNA targeting the TGFBRII gene comprises the nucleotide sequence of SEQ ID NO: 51 or 61.
  • the gRNA targeting the Reg-1 gene comprises the nucleotide sequence of SEQ ID NO: 54. In some examples, the gRNA targeting the Reg-1 gene comprises the nucleotide sequence of SEQ ID NO: 53 or 63.
  • the gRNA targeting the CBLB gene comprises the nucleotide sequence of SEQ ID NO: 56. In some examples, the gRNA targeting the CBLB gene comprises the nucleotide sequence of SEQ ID NO: 55 or 65.
  • any of the methods disclosed herein may comprise delivering to the T cells one or more ribonucleoprotein particles (RNP), which comprises the RNA- guided nuclease, one or more of the gRNAs, and the nucleic acid encoding the CAR.
  • RNP ribonucleoprotein particles
  • the RNA-guided nuclease is a Cas9 nuclease.
  • the RNA-guided nuclease is a S. pyogenes Cas9 nuclease.
  • the nucleic acid encoding the CAR may be in an AAV vector.
  • the nucleic acid encoding the CAR may comprise a left homology arm and a right homology arm flanking the nucleotide sequence encoding the CAR; and the left homology arm and the right homology arm are homologous to a genomic locus in the T cells, allowing for insertion of the nucleic acid into the genomic locus.
  • the genomic locus is a target site of a guide RNA, and insertion of the nucleic acid encoding the CAR at the genomic locus results in deletion and/or mutation of the target site of the guide RNA.
  • the genomic locus is in a safe harbor gene, in the TRAC gene, in the CD70 gene, in the TGFBRII gene, in the Reg-1 gene, or in the CBLB gene.
  • the method comprises disrupting the TRAC gene by CRISPR/Cas-mediated gene editing comprising a gRNA targeting a TRAC gene site comprising nucleotide sequence of SEQ ID NO: 74 and the nucleic acid encoding the CAR is inserted at the TRAC gene site targeted by the gRNA.
  • the method comprises delivering to the T cells a nucleic acid encoding a CAR, which is specific to CD70, and genetically editing the CD70 gene to disrupt its expression.
  • the T cells of step (a) may be derived from primary T cells of one or more human donors.
  • Still further provided herein is a method for eliminating undesired cells in a subject, the method comprising administering to a subject in need thereof T cells expressing a disrupted TAP-1 gene and a chimeric antigen receptor targeting the undesired cells.
  • the undesired cells may be cancer cells, including but not limited, CD19 + , BCMA + , or CD70 + .
  • the T cells may be allogenic to the subject.
  • gRNA guide RNA targeting a TAP-1 gene, comprising a nucleotide sequence specific to a fragment in exon 1 of the TAP-1 gene.
  • gRNA comprises a spacer having any of the sequences of SEQ ID NOs: 18, 20, 22, 24, 26, 28, 30, and 32. In some examples, the gRNA comprises a spacer set forth as SEQ ID NO: 18. In other examples, the gRNA comprises a spacer set forth as SEQ ID NO: 22.
  • the gRNA may further comprise a scaffold sequence.
  • the gRNA comprises one or more modified nucleotides.
  • the gRNA comprises one or more 2’-O-methyl phosphoro thioate residues at the 5’ and/or 3’ terminus of the gRNA.
  • the gRNA comprises the nucleotide sequence of any one of SEQ ID NOs: 17, 33, 19, 35, 21, 37, 23, 39, 25, 41, 27, 43, 29, 45, 31, or 47.
  • the gRNA targeting the TAP-1 gene comprises the nucleotide sequence of SEQ ID NO: 17 or 33.
  • the gRNA targeting the TAP-1 gene comprises the nucleotide sequence of SEQ ID NO: 21 or 37.
  • any of the genetically engineered T cells disclosed herein for use in eliminating undesired cells such as cancer cells and uses of such genetically engineered T cells for manufacturing a medicament for use in eliminating the undesired cells.
  • FIGs 1A-1B include diagrams showing reduction of MHC Class I expression by disrupting the TAP-1 gene via the CRISPR/Cas-mediated gene editing system with various guide RNAs (gRNAs).
  • FIG. 1A gRNAs TAP-l_Exl_Tl, TAP-l_Exl_T2, TAP- l_Exl_T42, and TAP-l_Exl_T53.
  • FIG. IB gRNAs TAP-l_Exl_T3, TAP-l_Exl_T4, TAP-l_Exl_T83, and TAP-l_Exl_T93.
  • the present disclosure aims at establishing genetically engineered T cells having protections against elimination by host immune cells such as natural killer (NK) cells while maintaining CAR-T cell functionality for use in allogenic cell therapy.
  • the genetically engineered T cells may also exhibit one or more of the following superior features: improved cell growth activity; enhanced persistence; reduced T cell exhaustion; resistant to inhibitory effects induced by TGF-
  • the genetically engineered T cells having a disrupted Transporter Associated with antigen Processing- 1 (TAP-1) gene, and optionally one or more additional genetic edits, for example, a disrupted TRAC gene, a disrupted CD70 gene, a disrupted CD 19 gene, a disrupted transforming growth factor beta receptor II (TGFbRIT) gene, a disrupted Regnase-1 (Regl) gene, and a disrupted Casitas B -Lineage Lymphoma Proto-Oncogene-B (CBLB) gene.
  • Any of the genetically engineered T cells disclosed herein may also comprise a nucleic acid coding for a chimeric antigen receptor (CAR).
  • the nucleic acid encoding the CAR may be inserted into the genome of the T cells at a genetic locus of interest, for example, within a safe harbor gene or within any of the disrupted genes (e.g., inserted into the disrupted TRAC gene).
  • T cells having a disrupted TAP-1 gene showed advantageous features disclosed herein, for example, reduced MHC Class I molecule expression, leading to protection against host T cell-mediated responses but does not induce “missing self’ recognition by host NK cells (which would result in NK cell-mediated cell lysis).
  • the genetically engineered T cells e.g., CAR-T cells
  • having a disrupted TAP-1 gene and optionally other genetic edits as disclosed herein would be expected to exhibit superior therapeutic effects, for example, superior anti-tumor effects in allogeneic cell therapy.
  • genetically engineered T cells having a disrupted TAP-1 gene and optionally one or more additional genetic edits, e.g., a disrupted TRAC gene, a disrupted CD70 gene, a disrupted TGFBRII gene, a disrupted Reg-1 gene, a disrupted CBLB gene, or a combination thereof; compositions comprising such; and therapeutic uses of such genetically engineered T cells, for example, in tumor treatment.
  • Components and processes e.g., the CRISPR approach for gene editing and components used therein
  • for making the T cells disclosed herein are also within the scope of the present disclosure.
  • provided herein are genetically engineered T cells having a disrupted TAP-1 gene, and optionally one or more additional genetic edits as disclosed herein. As shown by the studies disclosed herein, such genetically engineered T cells show improved features as disclosed herein. See, e.g., Examples below.
  • the genetically engineered T cells may be derived from parent T cells (e.g., nonedited wild-type T cells) obtained from a suitable source, for example, one or more mammal donors.
  • the parent T cells are primary T cells (e.g., non-transformed and terminally differentiated T cells) obtained from one or more human donors (e.g., healthy donors).
  • the parent T cells may be differentiated from precursor T cells obtained from one or more suitable donor or stem cells such as hematopoietic stem cells or inducible pluripotent stem cells (iPSC), which may be cultured in vitro.
  • T cells from a T cell bank can be used as the starting material for preparing the genetically engineered T cells disclosed herein.
  • the genetically engineered T cells carry a disrupted TAP-1 gene, and optionally, one or more disrupted genes to improve cell persistence, growth/expansion, and/or to reduce T cell exhaustion (e.g., CD70, TGFBRII, Reg-1, and/or CBLB).
  • Such genetically engineered T cells may further comprise one or more disrupted genes, for example, TRAC to, e.g., reduce graft- versus-host effects.
  • any of the genetically engineered T cells may be generated via gene editing (including genomic editing), a type of genetic engineering, in which nucleotide(s)/nucleic acid(s) is/are inserted, deleted, and/or substituted in a DNA sequence, such as in the genome of a targeted cell.
  • Targeted gene editing enables insertion, deletion, and/or substitution at pre-selected sites in the genome of a targeted cell (e.g., in a targeted gene or targeted DNA sequence).
  • a sequence of an endogenous gene is edited, for example by deletion, insertion or substitution of nucleotide(s)/nucleic acid(s)
  • the endogenous gene comprising the affected sequence may be knocked-out due to the sequence alteration.
  • Targeted editing may be used to disrupt endogenous gene expression.
  • “Targeted integration” refers to a process involving insertion of one or more exogenous sequences, with or without deletion of an endogenous sequence at the insertion site. Targeted integration can result from targeted gene editing when a donor template containing an exogenous sequence is present.
  • the present disclosure provides genetically engineered T cells (e.g., CAR-T cells) that comprise a disrupted TAP-1 gene.
  • the genetically engineered T cells disclosed herein may further comprise a disrupted CD70 gene, a disrupted a disrupted TRAC gene, a disrupted TGFBRII gene, a disrupted Reg-1 gene, a disrupted CBLB gene, or a combination thereof.
  • a “disrupted gene” refers to a gene comprising an insertion, deletion or substitution relative to an endogenous gene such that expression of a functional protein from the endogenous gene is reduced or inhibited.
  • “disrupting a gene” refers to a method of inserting, deleting or substituting at least one nucleotide/nucleic acid in an endogenous gene such that expression of a functional protein from the endogenous gene is reduced or inhibited. Methods of disrupting a gene are known to those of skill in the art and described herein.
  • a cell that comprises a disrupted gene does not express (e.g., at the cell surface) a detectable level (e.g., in an immune assay using an antibody binding to the encoded protein or by flow cytometry) of the protein encoded by the gene.
  • a detectable level e.g., in an immune assay using an antibody binding to the encoded protein or by flow cytometry
  • a cell that does not express a detectable level of the protein may be referred to as a knockout cell.
  • the genetically engineered T cells may comprise a disrupted TAP-1 gene, which encodes the TAP-1 protein.
  • the TAP-1 protein assembles with another protein named TAP-2 to form the antigen processing (TAP) complex, which is located in the endoplasmic reticulum, wherein antigenic peptides are attached to major histocompatibility complex (MHC) class I molecules.
  • TAP antigen processing
  • MHC major histocompatibility complex
  • the peptide-bound MHC Class I complexes are then translocated to the cell surface to be recognized by immune cells capable of interacting with them, thereby triggering immune responses to eliminate foreign invaders.
  • TAP-1 genes Structure of TAP-1 genes are known in the art. For example, human TAP-1 gene is located on chromosome 6p21.32. The gene contains 12 exons. Additional information can be found in GenBank under Gene ID: 6890.
  • the genetically engineered T cells may comprise a disrupted TAP-1 gene such that the expression of the TAP-1 protein in the T cells is substantially reduced or eliminated completely.
  • the disrupted TAP-1 gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the TAP-1 gene.
  • suitable target sites e.g., in coding regions or in non-coding regulatory regions such as promoter regions
  • target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells.
  • Exemplary target sites for the genetic edits may include any one of exons 1-12, or a combination thereof.
  • one or more genetic editing may occur in exon 1.
  • Such genetic editing may be induced by a gene editing technology, (e.g., the CRISPR/Cas technology) using a suitable guide RNA, for example, those targeting the TAP-1 sites listed in Table 20.
  • a suitable guide RNA for example, those targeting the TAP-1 sites listed in Table 20.
  • Exemplary TAP- 1 -targeting guide RNAs (gRNAs) are provided in Table 21, which are also within the scope of the present disclosure.
  • T cell exhaustion is a process of stepwise and progressive loss of T cell functions, which may be induced by prolonged antigen stimulation or other factors.
  • Genes involved in T cell exhaustion refer to those that either positively regulate or negatively regulate this biological process.
  • the genetically engineered T cells disclosed herein may comprise genetic editing of a gene that positively regulates T cell exhaustion to disrupt its expression.
  • the genetically engineered T cells may comprise genetic editing of a gene that negatively regulates T cell exhaustion to enhance its expression and/or biologic activity of the gene product.
  • the genetically engineered T cells may comprise an edited gene involved in T cell exhaustion, e.g., disruption of a gene that positively regulates T cell exhaustion.
  • a gene may be a Cluster of Differentiation 70 (CD70) gene.
  • CD70 is a member of the tumor necrosis factor superfamily and its expression is restricted to activated T and B lymphocytes and mature dendritic cells.
  • CD70 is implicated in tumor cell and regulatory T cell survival through interaction with its ligand, CD27.
  • CD70 and its receptor CD27 have multiple roles in immune function in multiple cell types including T cells (activated and T re g cells), and B cells.
  • an edited CD70 gene may have a nucleic acid encoding a CAR (e.g., those disclosed herein) inserted, leading to disruption of the CD70 gene expression.
  • disrupting the CD70 gene in immune cells engineered to express an antigen targeting moiety enhanced anti-tumor efficacy against large tumors and induced a durable anti-cancer memory response. Specifically, the anti-cancer memory response prevented tumor growth upon re-challenge. Further, it has been demonstrated disrupting the CD70 gene results in enhanced cytotoxicity of immune cells engineered to express an antigen targeting moiety at lower ratios of engineered immune cells to target cells, indicating the potential efficacy of low doses of engineered immune cells. See, e.g., W02019/215500, the relevant disclosures of which are incorporated by reference for the purpose and subject matter referenced herein.
  • CD70 genes Structures of CD70 genes are known in the art. For example, human CD70 gene is located on chromosome 19p 13.3. The gene contains four protein encoding exons. Additional information can be found in GenBank under Gene ID: 970.
  • the genetically engineered T cells may comprise a disrupted CD70 gene such that the expression of CD70 in the T cells is substantially reduced or eliminated completely.
  • the disrupted CD70 gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the CD70 gene.
  • suitable target sites e.g., in coding regions or in non-coding regulatory regions such as promoter regions
  • target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells.
  • Exemplary target sites for the genetic edits may include exon 1, exon 2, exon 3, exon 4, or a combination thereof. See also W02019/215500, the relevant disclosures of which are incorporated by reference for the purpose and subject matter referenced herein.
  • CD70 targeting locus and corresponding gRNA can be found in Table 22 below.
  • the genetically engineered T cells as disclosed herein may further comprise a disrupted TRAC gene. This disruption leads to loss of function of the TCR and renders the engineered T cell non-alloreactive and suitable for allogeneic transplantation, minimizing the risk of graft versus host disease. In some embodiments, expression of the endogenous TRAC gene is eliminated to prevent a graft-versus-host response. See also W02019097305, the relevant disclosures of which are incorporated by reference herein for the purpose and subject matter referenced herein.
  • an edited TRAC gene may have a nucleic acid encoding a CAR (e.g., those disclosed herein) inserted, leading to disruption of the TRAC gene expression.
  • a CAR e.g., those disclosed herein
  • the genetically engineered T cells disclosed herein may further comprise one or more additional gene edits (e.g., gene knock-in or knock-out) to improve T cell function.
  • additional gene edits e.g., gene knock-in or knock-out
  • Examples include knock-in or knock-out genes to improve target cell lysis, knock-in or knock-out genes to enhance performance of therapeutic T cells such as CAR-T cells prepared from the genetically engineered T cells.
  • TRAC targeting locus and corresponding gRNA can be found in Table 22 below.
  • the genetically engineered T cells may comprise a disrupted gene involved in mRNA decay.
  • a gene may be Regl.
  • Regl contains a zinc finger motif, binds RNA and exhibits ribonuclease activity. Regl plays roles in both immune and non- immune cells and its expression can be rapidly induced under diverse conditions including microbial infections, treatment with inflammatory cytokines and chemical or mechanical stimulation.
  • Human Regl gene is located on chromosome lp34.3. Additional information can be found in GenBank under Gene ID: 80149.
  • the genetically engineered T cells may comprise a disrupted Regl gene such that the expression of Regl in the T cells is substantially reduced or eliminated completely.
  • the disrupted Regl gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the Regl gene.
  • target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells.
  • Exemplary target sites for the genetic edits may include exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a combination thereof.
  • one or more genetic editing may occur in exon 2 or exon 4.
  • Such genetic editing may be induced by the CRISPR/Cas technology using a suitable guide RNA, for example, those listed in Table 22. See also WO/2022/064428, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
  • the genetically engineered T cells may comprise a disrupted TGFBRII gene, which encodes Transforming Growth Factor Receptor Type II (TGFBRII).
  • TGFBRII receptors are a family of serine/threonine kinase receptors involved in the TGFfJ signaling pathway. These receptors bind growth factor and cytokine signaling proteins in the TGF
  • TGFBRII receptors are a family of serine/threonine kinase receptors involved in the TGFfJ signaling pathway. These receptors bind growth factor and cytokine signaling proteins in the TGF
  • the genetically engineered T cells may comprise a disrupted TGFBRII gene such that the expression of TGFBRII in the T cells is substantially reduced or eliminated completely.
  • the disrupted TGFBRII gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the TGFBRII gene.
  • suitable target sites e.g., in coding regions or in non-coding regulatory regions such as promoter regions
  • target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells.
  • Exemplary target sites for the genetic edits may include exon 1, exon 2, exon 3, exon 4, exon 5, or a combination thereof.
  • one or more genetic editing may occur in exon 4 and/or exon 5.
  • Such genetic editing may be induced by a gene editing technology, (e.g., the CRISPR/Cas technology) using a suitable guide RNA, for example, those listed in Table 22. See also WO/2022/064428, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
  • a gene editing technology e.g., the CRISPR/Cas technology
  • a suitable guide RNA for example, those listed in Table 22.
  • TGFBRII transforming growth factor beta
  • the genetically engineered T cells may comprise a disrupted Cbl proto-oncogene B (CBLB) gene.
  • CBLB Cbl proto-oncogene B
  • the CBEB protein contains a zinc finger motif, binds RNA and exhibits ribonuclease activity.
  • CBEB plays roles in both immune and non-immune cells and its expression can be rapidly induced under diverse conditions including microbial infections, treatment with inflammatory cytokines and chemical or mechanical stimulation.
  • Human cbl-b gene is located on chromosome GRCh38.pl3. Additional information can be found in GenBank under Gene ID: 868.
  • the genetically engineered T cells may comprise a disrupted cbl-b gene such that the expression of cbl-b in the T cells is substantially reduced or eliminated completely.
  • the disrupted cbl-b gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the cbl-b gene.
  • suitable target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells.
  • Exemplary target sites for the genetic edits may include exon 2, exon 7, exon 9, exon 11, exon 12, or a combination thereof.
  • one or more genetic editing may occur in exon 2.
  • one or more genetic editing may occur in exon 7.
  • one or more genetic editing may occur in exon 9.
  • Such genetic editing may be induced by the CRISPR/Cas technology using a suitable guide RNA, for example, those listed in Table 22. See also WO2023/119201, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
  • the genetically engineered T cells disclosed herein can be prepared by genetic editing of parent T cells or precursor cells thereof via a conventional gene editing method or those described herein.
  • any of the genetically engineered T cells disclosed herein may use bona fide T cells as the starting material, for example, non-transformed T cells, terminally differentiated T cells, T cells having stable genome, and/or T cells that depend on cytokines and growth factors for proliferation and expansion.
  • T cells may use T cells generated from precursor cells such as hematopoietic stem cells (e.g., iPSCs), e.g., in vitro culture.
  • iPSCs hematopoietic stem cells
  • the T cells disclosed herein may confer one or more benefits in CAR-T cell clinical applications.
  • T cells for generating the genetically engineered T cells disclosed herein can be derived from one or more suitable mammals, for example, one or more human donors.
  • T cells can be obtained from a number of sources, including, but not limited to, peripheral blood mononuclear cells, bone marrow, lymph nodes tissue, cord blood, thymus issue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors.
  • T cells can be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled person, such as sedimentation, e.g., FICOLLTM separation.
  • the T cell population comprises primary T cells isolated from one or more human donors. Such T cells are terminally differentiated, not transformed, depend on cytokines and/or growth factors for growth, and/or have stable genomes.
  • T cells can be isolated from a mixture of immune cells (e.g., those described herein) to produce an isolated T cell population.
  • immune cells e.g., those described herein
  • cytotoxic and helper T lymphocytes can be sorted into naive, memory, and effector T cell subpopulations either before or after activation, expansion, and/or genetic modification.
  • a specific subpopulation of T cells expressing one or more of the following cell surface markers: TCRocp, CD3, CD4, CD8, CD27 CD28, CD38 CD45RA, CD45RO, CD62L, CD127, CD122, CD95, CD197, CCR7, KLRG1, MCH-I proteins and/or MCH-II proteins, can be further isolated by positive or negative selection techniques.
  • a specific subpopulation of T cells, expressing one or more of the markers of TCRocP, CD4 and/or CD8 is further isolated by positive or negative selection techniques.
  • subpopulations of T cells may be isolated by positive or negative selection prior to genetic engineering and/or post genetic engineering.
  • An isolated population of T cells may express one or more of the T cell markers, including, but not limited to a CD3+, CD4+, CD8+, or a combination thereof.
  • the T cells are isolated from a donor, or subject, and first activated and stimulated to proliferate in vitro prior to undergoing gene editing.
  • the T cells for use in generating the genetically engineered T cells disclosed herein may be derived from a T cell bank.
  • a T cell bank may comprise T cells with genetic editing of certain genes (e.g., genes involved in cell self-renewal, apoptosis, and/or T cell exhaustion or replicative senescence) to improve T cell persistence in cell culture.
  • a T cell bank may be produced from bona fide T cells, for example, non-transformed T cells, terminally differentiated T cells, T cells having stable genome, and/or T cells that depend on cytokines and growth factors for proliferation and expansion.
  • such a T cell bank may be produced from precursor cells such as hematopoietic stem cells (e.g., iPSCs), e.g., in vitro culture.
  • the T cells in the T cell bank may comprise genetic editing of one or more genes involved in cell self-renewal, one or more genes involved in apoptosis, and/or one or more genes involved in T cell exhaustion, so as to disrupt or reduce expression of such genes, leading to improved persistence in culture.
  • Examples of the edited genes in a T cell bank include, but are not limited to, Tet2, Fas, CD70, Regl, or a combination thereof.
  • T cells in a T cell bank may have enhanced expansion capacity in culture, enhanced proliferation capacity, greater T cell activation, and/or reduced apoptosis levels. Additional information of T cell bank may be found in International Application No. PCT/IB2020/058280, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
  • the T cells for generating the genetically engineered T cells disclosed herein may be derived from stem cells (e.g., HSCs or iPSCs) via in vitro differentiation.
  • stem cells e.g., HSCs or iPSCs
  • T cells from any suitable source can be subjected to one or more rounds of stimulation, activation and/or expansion.
  • T cells can be activated and expanded generally using methods as described, for example, in U.S. Patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041.
  • T cells can be activated and expanded for about 1 day to about 4 days, about 1 day to about 3 days, about 1 day to about 2 days, about 2 days to about 3 days, about 2 days to about 4 days, about 3 days to about 4 days, or about 1 day, about 2 days, about 3 days, or about 4 days prior to introduction of the genome editing compositions into the T cells.
  • T cells can be activated and expanded for about 4 hours, about 6 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours prior to introduction of the gene editing compositions into the T cells.
  • T cells are activated at the same time that genome editing compositions are introduced into the T cells.
  • the T cell population can be expanded and/or activated after the genetic editing as disclosed herein. T cell populations or isolated T cells generated by any of the gene editing methods described herein are also within the scope of the present disclosure.
  • any of the genetically engineered T cells can be prepared using conventional gene editing methods or those described herein to edit one or more of the target genes disclosed herein (targeted editing).
  • Targeted editing can be achieved either through a nuclease- independent approach, or through a nuclease-dependent approach.
  • nuclease-dependent targeted editing approach homologous recombination is guided by homologous sequences flanking an exogenous polynucleotide to be introduced into an endogenous sequence through the enzymatic machinery of the host cell.
  • the exogenous polynucleotide may introduce deletions, insertions or replacement of nucleotides in the endogenous sequence.
  • nuclease-dependent approach can achieve targeted editing with higher frequency through the specific introduction of double strand breaks (DSBs) by specific rare-cutting nucleases (e.g., endonucleases).
  • DSBs double strand breaks
  • nuclease-dependent targeted editing also utilizes DNA repair mechanisms, for example, non-homologous end joining (NHEJ), which occurs in response to DSBs.
  • NHEJ non-homologous end joining
  • DNA repair by NHEJ often leads to random insertions or deletions (indels) of a small number of endogenous nucleotides.
  • repair can also occur by a homology directed repair (HDR).
  • HDR homology directed repair
  • gene disruption may occur by deletion of a genomic sequence using two guide RNAs.
  • Methods of using CRISPR-Cas gene editing technology to create a genomic deletion in a cell are known (Bauer DE et al. Vis. Exp. 2015; 95:e52118).
  • Available endonucleases capable of introducing specific and targeted DSBs include, but not limited to, zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and RNA-guided CRISPR-Cas9 nuclease (CRISPR/Cas9; Clustered Regular Interspaced Short Palindromic Repeats Associated 9). Additionally, DICE (dual integrase cassette exchange) system utilizing phiC31 and Bxbl integrases may also be used for targeted integration. Some exemplary approaches are disclosed in detail below.
  • the CRISPR-Cas9 system is a naturally-occurring defense mechanism in prokaryotes that has been repurposed as an RNA-guided DNA-targeting platform used for gene editing. It relies on the DNA nuclease Cas9, and two noncoding RNAs, crisprRNA (crRNA) and transactivating RNA (tracrRNA), to target the cleavage of DNA.
  • CRISPR is an abbreviation for Clustered Regularly Interspaced Short Palindromic Repeats, a family of DNA sequences found in the genomes of bacteria and archaea that contain fragments of DNA (spacer DNA) with similarity to foreign DNA previously exposed to the cell, for example, by viruses that have infected or attacked the prokaryote.
  • CRISPR CRISPR-associated proteins
  • RNA molecules comprising the spacer sequence, which associates with and targets Cas (CRISPR-associated) proteins able to recognize and cut the foreign, exogenous DNA.
  • Cas CRISPR-associated proteins
  • Numerous types and classes of CRISPR/Cas systems have been described (see, e.g., Koonin et al., (2017) Curr Opin Microbiol 37:67-78).
  • crRNA drives sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing typically with a 20 nucleotide (nt) sequence in the target DNA. Changing the sequence of the 5’ 20nt in the crRNA allows targeting of the CRISPR- Cas9 complex to specific loci.
  • the CRISPR-Cas9 complex only binds DNA sequences that contain a sequence match to the first 20 nt of the crRNA, if the target sequence is followed by a specific short DNA motif (with the sequence NGG) referred to as a protospacer adjacent motif (PAM).
  • PAM protospacer adjacent motif
  • tracrRNA hybridizes with the 3’ end of crRNA to form an RNA-duplex structure that is bound by the Cas9 endonuclease to form the catalytically active CRISPR- Cas9 complex, which can then cleave the target DNA.
  • NHEJ is a robust repair mechanism that appears highly active in the majority of cell types, including non-dividing cells. NHEJ is error-prone and can often result in the removal or addition of between one and several hundred nucleotides at the site of the DSB, though such modifications are typically ⁇ 20 nt. The resulting insertions and deletions (indels) can disrupt coding or noncoding regions of genes.
  • HDR uses a long stretch of homologous donor DNA, provided endogenously or exogenously, to repair the DSB with high fidelity. HDR is active only in dividing cells and occurs at a relatively low frequency in most cell types. In many embodiments of the present disclosure, NHEJ is utilized as the repair operant.
  • the Cas9 (CRISPR associated protein 9) endonuclease is used in a CRISPR method for making the genetically engineered T cells as disclosed herein.
  • the Cas9 enzyme may be one from Streptococcus pyogenes, although other Cas9 homologs may also be used. It should be understood, that wild-type Cas9 may be used or modified versions of Cas9 may be used (e.g., evolved versions of Cas9, or Cas9 orthologues or variants), as provided herein.
  • Cas9 may be substituted with another RNA-guided endonuclease, such as Cpfl (of a class II CRISPR/Cas system).
  • the CRISPR/Cas system comprises components derived from a Type-I, Type-II, or Type-Ill system.
  • Updated classification schemes for CRISPR/Cas loci define Class 1 and Class 2 CRISPR/Cas systems, having Types I to V or VI (Makarova et al., (2015) Nat Rev Microbiol, 13(11):722-36; Shmakov et al., (2015) Mol Cell, 60:385-397).
  • Class 2 CRISPR/Cas systems have single protein effectors.
  • Class 2 Cas nucleases include, for example, Cas9, Cpfl, C2cl, C2c2, and C2c3 proteins.
  • the Cpfl nuclease (Zetsche et al., (2015) Cell 163:1-13) is homologous to Cas9 and contains a RuvC-like nuclease domain.
  • the Cas nuclease is from a Type-II CRISPR/Cas system (e.g., a Cas9 protein from a CRISPR/Cas9 system).
  • the Cas nuclease is from a Class 2 CRISPR/Cas system (a single-protein Cas nuclease such as a Cas9 protein or a Cpfl protein).
  • the Cas9 and Cpfl family of proteins are enzymes with DNA endonuclease activity, and they can be directed to cleave a desired nucleic acid target by designing an appropriate guide RNA, as described further herein.
  • a Cas nuclease may comprise more than one nuclease domain.
  • a Cas9 nuclease may comprise at least one RuvC-like nuclease domain (e.g., Cpfl) and at least one HNH-like nuclease domain (e.g., Cas9).
  • the Cas9 nuclease introduces a DSB in the target sequence.
  • the Cas9 nuclease is modified to contain only one functional nuclease domain.
  • the Cas9 nuclease is modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity.
  • the Cas9 nuclease is modified to contain no functional RuvC-like nuclease domain. In other embodiments, the Cas9 nuclease is modified to contain no functional HNH-like nuclease domain. In some embodiments in which only one of the nuclease domains is functional, the Cas9 nuclease is a nickase that is capable of introducing a single-stranded break (a “nick”) into the target sequence. In some embodiments, a conserved amino acid within a Cas9 nuclease domain is substituted to reduce or alter a nuclease activity.
  • the Cas nuclease nickase comprises an amino acid substitution in the RuvC-like nuclease domain.
  • Exemplary amino acid substitutions in the RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 nuclease).
  • the nickase comprises an amino acid substitution in the HNH-like nuclease domain.
  • Exemplary amino acid substitutions in the HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 nuclease).
  • the amino acid sequence of an exemplary S. pyogenes Cas9 nuclease is provided in Table 22 (SEQ ID NO: 82).
  • the Cas nuclease is from a Type-I CRISPR/Cas system. In some embodiments, the Cas nuclease is a component of the Cascade complex of a Type-I CRISPR/Cas system. For example, the Cas nuclease is a Cas3 nuclease. In some embodiments, the Cas nuclease is derived from a Type-Ill CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from Type-IV CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from a Type-V CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from a Type- VI CRISPR/Cas system.
  • gRNAs Guide RNAs
  • the CRISPR technology involves the use of a genome-targeting nucleic acid that can direct the endonuclease to a specific target sequence within a target gene for gene editing at the specific target sequence.
  • the genome-targeting nucleic acid can be a RNA.
  • a genometargeting RNA is referred to as a “guide RNA” or “gRNA” herein.
  • a guide RNA comprises at least a spacer sequence that hybridizes to a target nucleic acid sequence within a target gene for editing, and a CRISPR repeat sequence.
  • the gRNA also comprises a second RNA called the tracrRNA sequence.
  • the CRISPR repeat sequence and tracrRNA sequence hybridize to each other to form a duplex.
  • the crRNA forms a duplex.
  • the duplex binds a site-directed polypeptide, such that the guide RNA and site-direct polypeptide form a complex.
  • the genome-targeting nucleic acid provides target specificity to the complex by virtue of its association with the site- directed polypeptide. The genome-targeting nucleic acid thus directs the activity of the site- directed polypeptide.
  • each guide RNA is designed to include a spacer sequence complementary to its genomic target sequence. See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011).
  • the genome-targeting nucleic acid is a double- molecule guide RNA.
  • a double-molecule guide RNA comprises two strands of RNA molecules. The first strand comprises in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a minimum CRISPR repeat sequence.
  • the second strand comprises a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3’ tracrRNA sequence and an optional tracrRNA extension sequence.
  • the genome-targeting nucleic acid is a singlemolecule guide RNA.
  • a single-molecule guide RNA (referred to as a “sgRNA”) in a Type II system comprises, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3’ tracrRNA sequence and an optional tracrRNA extension sequence.
  • the optional tracrRNA extension may comprise elements that contribute additional functionality (e.g., stability) to the guide RNA.
  • the single-molecule guide linker links the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure.
  • the optional tracrRNA extension comprises one or more hairpins.
  • a single-molecule guide RNA in a Type V system comprises, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence.
  • a spacer sequence in a gRNA is a sequence (e.g., a 20-nucleotide sequence) that defines the target sequence (e.g., a DNA target sequences, such as a genomic target sequence) of a target gene of interest.
  • the spacer sequence may range from 15 to 30 nucleotides.
  • the spacer sequence may contain 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.
  • a spacer sequence contains 20 nucleotides.
  • the “target sequence” is in a target gene that is adjacent to a PAM sequence and is the sequence to be modified by an RNA-guided nuclease (e.g., Cas9).
  • the “target sequence” is on the so-called PAM-strand in a “target nucleic acid,” which is a double-stranded molecule containing the PAM-strand and a complementary non-PAM strand.
  • target nucleic acid which is a double-stranded molecule containing the PAM-strand and a complementary non-PAM strand.
  • the gRNA spacer sequence hybridizes to the complementary sequence located in the non-PAM strand of the target nucleic acid of interest.
  • the gRNA spacer sequence is the RNA equivalent of the target sequence.
  • the gRNA spacer sequence is 5'-AGAGCAACAGUGCUGUGGCC**-3' (SEQ ID NO: 50).
  • the spacer of a gRNA interacts with a target nucleic acid of interest in a sequence-specific manner via hybridization (i.e., base pairing).
  • the nucleotide sequence of the spacer thus varies depending on the target sequence of the target nucleic acid of interest.
  • the spacer sequence is designed to hybridize to a region of the target nucleic acid that is located 5' of a PAM recognizable by a Cas9 enzyme used in the system.
  • the spacer may perfectly match the target sequence or may have mismatches.
  • Each Cas9 enzyme has a particular PAM sequence that it recognizes in a target DNA.
  • S. pyogenes recognizes in a target nucleic acid a PAM that comprises the sequence 5'-NRG-3', where R comprises either A or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.
  • the target nucleic acid sequence has 20 nucleotides in length. In some embodiments, the target nucleic acid has less than 20 nucleotides in length. In some embodiments, the target nucleic acid has more than 20 nucleotides in length. In some embodiments, the target nucleic acid has at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid has at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid sequence has 20 bases immediately 5' of the first nucleotide of the PAM.
  • the target nucleic acid in a sequence comprising 5'- NNNNNNNNNNNNNNNNNNNNNNNNNNNNNRG-3', can be the sequence that corresponds to the Ns, wherein N can be any nucleotide, and the underlined NRG sequence is the S. pyogenes PAM.
  • the guide RNA disclosed herein may target any sequence of interest via the spacer sequence in the crRNA.
  • the degree of complementarity between the spacer sequence of the guide RNA and the target sequence in the target gene can be about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%.
  • the spacer sequence of the guide RNA and the target sequence in the target gene is 100% complementary.
  • the spacer sequence of the guide RNA and the target sequence in the target gene may contain up to 10 mismatches, e.g., up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2, or up to 1 mismatch.
  • the length of the spacer sequence in any of the gRNAs disclosed herein may depend on the CRISPR/Cas9 system and components used for editing any of the target genes also disclosed herein.
  • the spacer sequence may have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more than 50 nucleotides in length.
  • the spacer sequence may have 18-24 nucleotides in length.
  • the targeting sequence may have 19-21 nucleotides in length.
  • the spacer sequence may comprise 20 nucleotides in length.
  • the gRNA can be an sgRNA, which may comprise a 20- nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA may comprise a less than 20 nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA may comprise a more than 20 nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA comprises a variable length spacer sequence with 17-30 nucleotides at the 5’ end of the sgRNA sequence. Examples are provided in Table 22 below. In these exemplary sequences, the fragment of “n” refers to the spacer sequence at the 5’ end.
  • the sgRNA comprises comprise no uracil at the 3’ end of the sgRNA sequence.
  • the sgRNA may comprise one or more uracil at the 3’ end of the sgRNA sequence.
  • the sgRNA can comprise 1-8 uracil residues, at the 3’ end of the sgRNA sequence, e.g., 1, 2, 3, 4, 5, 6, 7, or 8 uracil residues at the 3’ end of the sgRNA sequence.
  • any of the gRNAs disclosed herein, including any of the sgRNAs, may be unmodified. Alternatively, it may contain one or more modified nucleotides and/or modified backbones.
  • a modified gRNA such as an sgRNA can comprise one or more 2'- O-methyl phosphorothioate nucleotides, which may be located at either the 5’ end, the 3’ end, or both.
  • more than one guide RNAs can be used with a CRISPR/Cas nuclease system.
  • Each guide RNA may contain a different targeting sequence, such that the CRISPR/Cas system cleaves more than one target nucleic acid.
  • one or more guide RNAs may have the same or differing properties such as activity or stability within the Cas9 RNP complex.
  • each guide RNA can be encoded on the same or on different vectors. The promoters used to drive expression of the more than one guide RNA is the same or different.
  • the gRNAs disclosed herein target a TAP-1 gene, for example, target a site within any one of exons 1-12, for example, exon 1 of the TAP-1 gene.
  • a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 1 of a TAP-1 gene, or a fragment thereof.
  • Exemplary target sequences of TAP-1 and exemplary gRNA sequences are provided in Table 20 and Table 21 below.
  • the exemplary gRNA is Exl_Tl, or a gRNA that targets the same TAP-1 site as Exl_Tl.
  • the exemplary gRNA is Exl_T3, or a gRNA that targets the same TAP-1 site as Exl_T3.
  • the gRNAs disclosed herein target a CD70 gene, for example, target a site within exon 1 or exon 3 of a CD70 gene.
  • a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 1 or exon 3 of a CD70 gene, or a fragment thereof.
  • Exemplary target sequences in a CD70 gene and exemplary gRNAs specific to the CD70 gene are provided in Table 22 below. See also W02019/215500, the relevant disclosures of which are incorporated by reference for the purpose and subject matter referenced herein.
  • the gRNAs disclosed herein target a Regl gene, for example, target a site within exon 1, exon 2, exon 3, exon 4, exon 5, or exon 6 of the Regl gene.
  • a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 2 or exon 4 of a Regl gene, or a fragment thereof.
  • Exemplary target sequences of Regl and exemplary gRNA sequences are provided in Table 22 below. See also WO/2022/064428, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
  • the gRNAs disclosed herein target a TGFBRII gene, for example, target a site within exon 1, exon 2, exon 3, exon 4, exon 5, or exon 6 of the TGFBRII gene.
  • a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 4 or exon 5 of a TGFBRII gene, or a fragment thereof.
  • Exemplary target sequences of TGFBRII and exemplary gRNA sequences are provided in Table 22 below. See also WO/2022/064428, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
  • the gRNAs disclosed herein target a CBLB gene, for example, target a site within exon 2, exon 7, exon 9, exon 11, or exon 12 of the CBLB gene.
  • a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 2 of a CBLB gene, or a fragment thereof.
  • a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 7 of a CBLB gene, or a fragment thereof.
  • a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 9 of a CBLB gene, or a fragment thereof.
  • Exemplary target sequences in a CBLB gene and exemplary gRNA sequences are provided in Table 22 below. See also WO2023/119201, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein.
  • the gRNAs disclosed herein target a TRAC gene. See also W02019097305, the relevant disclosures of which are incorporated by reference herein for the subject matter and purpose referenced herein.
  • Other gRNA sequences may be designed using the TRAC gene sequence located on chromosome 14 (GRCh38: chromosome 14: 22,547,506-22,552,154; Ensembl; ENSG00000277734).
  • gRNAs targeting the TRAC genomic region and RNA-guided nuclease create breaks in the TRAC genomic region resulting Indels in the TRAC gene disrupting expression of the mRNA or protein.
  • Exemplary spacer sequences and gRNAs targeting a TRAC gene are provided in Table 22 below.
  • guide RNAs used in the CRISPR/Cas/Cpfl system can be readily synthesized by chemical means, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides.
  • HPLC high performance liquid chromatography
  • One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 or Cpfl endonuclease, are more readily generated enzymatically.
  • RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art.
  • the gRNAs of the present disclosure can be produced in vitro transcription (IVT), synthetic and/or chemical synthesis methods, or a combination thereof. Enzymatic (IVT), solid-phase, liquid-phase, combined synthetic methods, small region synthesis, and ligation methods are utilized. In one embodiment, the gRNAs are made using IVT enzymatic synthesis methods. Methods of making polynucleotides by IVT are known in the art and are described in WO2013/151666. Accordingly, the present disclosure also includes polynucleotides, e.g., DNA, constructs and vectors are used to in vitro transcribe a gRNA described herein.
  • RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art.
  • non-natural modified nucleobases can be introduced into any of the gRNAs disclosed herein during synthesis or post-synthesis.
  • modifications are on internucleoside linkages, purine or pyrimidine bases, or sugar.
  • a modification is introduced at the terminal of a gRNA with chemical synthesis or with a polymerase enzyme. Examples of modified nucleic acids and their synthesis are disclosed in WO2013/052523. Synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998).
  • enzymatic or chemical ligation methods can be used to conjugate polynucleotides or their regions with different functional moieties, such as targeting or delivery agents, fluorescent labels, liquids, nanoparticles, etc.
  • Conjugates of polynucleotides and modified polynucleotides are reviewed in Goodchild, Bioconjugate Chemistry, vol. 1(3), 165-187 (1990).
  • a CRISPR/Cas nuclease system for use in genetically editing any of the target genes disclosed here may include at least one guide RNA.
  • the CRISPR/Cas nuclease system may contain multiple gRNAs, for example, 2, 3, or 4 gRNAs. Such multiple gRNAs may target different sites in a same target gene. Alternatively, the multiple gRNAs may target different genes.
  • the guide RNA(s) and the Cas protein may form a ribonucleoprotein (RNP), e.g., a CRISPR/Cas complex.
  • RNP ribonucleoprotein
  • the guide RNA(s) may guide the Cas protein to a target sequence(s) on one or more target genes as those disclosed herein, where the Cas protein cleaves the target gene at the target site.
  • the CRISPR/Cas complex is a Cpfl/guide RNA complex.
  • the CRISPR complex is a Type-II CRISPR/Cas9 complex.
  • the Cas protein is a Cas9 protein.
  • the CRISPR/Cas9 complex is a Cas9/guide RNA complex.
  • the indel frequency (editing frequency) of a particular CRISPR/Cas nuclease system, comprising one or more specific gRNAs may be determined using a TIDE analysis, which can be used to identify highly efficient gRNA molecules for editing a target gene.
  • a highly efficient gRNA yields a gene editing frequency of higher than 80%.
  • a gRNA is considered to be highly efficient if it yields a gene editing frequency of at least 80%, at least 85%, at least 90%, at least 95%, or 100%.
  • the CRISPR/Cas nuclease system disclosed herein comprising one or more gRNAs and at least one RNA-guided nuclease, optionally a donor template as disclosed below, can be delivered to a target cell (e.g., a T cell) for genetic editing of a target gene, via a conventional method.
  • a target cell e.g., a T cell
  • components of a CRISPR/Cas nuclease system as disclosed herein may be delivered to a target cell separately, either simultaneously or sequentially.
  • the components of the CRISPR/Cas nuclease system may be delivered into a target together, for example, as a complex.
  • gRNA and a RNA-guided nuclease can be pre-complexed together to form a ribonucleoprotein (RNP), which can be delivered into a target cell.
  • RNP ribonucleoprotein
  • RNPs are useful for gene editing, at least because they minimize the risk of promiscuous interactions in a nucleic acid-rich cellular environment and protect the RNA from degradation.
  • Methods for forming RNPs are known in the art.
  • an RNP containing an RNA-guided nuclease e.g., a Cas nuclease, such as a Cas9 nuclease
  • one or more gRNAs targeting one or more genes of interest can be delivered a cell (e.g., a T cell).
  • an RNP can be delivered to a T cell by electroporation.
  • an RNA-guided nuclease can be delivered to a cell in a DNA vector that expresses the RNA-guided nuclease in the cell.
  • an RNA- guided nuclease can be delivered to a cell in an RNA that encodes the RNA-guided nuclease and expresses the nuclease in the cell.
  • a gRNA targeting a gene can be delivered to a cell as a RNA, or a DNA vector that expresses the gRNA in the cell.
  • RNA-guided nuclease may be through direct injection or cell transfection using known methods, for example, electroporation or chemical transfection. Other cell transfection methods may be used.
  • gene editing approaching involve zinc finger nuclease (ZFN), transcription activator-like effector nucleases (TALEN), restriction endonucleases, meganucleases homing endonucleases, and the like.
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector nucleases
  • restriction endonucleases meganucleases homing endonucleases, and the like.
  • ZFNs are targeted nucleases comprising a nuclease fused to a zinc finger DNA binding domain (ZFBD), which is a polypeptide domain that binds DNA in a sequencespecific manner through one or more zinc fingers.
  • ZFBD zinc finger DNA binding domain
  • a zinc finger is a domain of about 30 amino acids within the zinc finger binding domain whose structure is stabilized through coordination of a zinc ion. Examples of zinc fingers include, but not limited to, C2H2 zinc fingers, C3H zinc fingers, and C4 zinc fingers.
  • a designed zinc finger domain is a domain not occurring in nature whose design/composition results principally from rational criteria, e.g., application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S.
  • a selected zinc finger domain is a domain not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection.
  • ZFNs are described in greater detail in U.S. Pat. No. 7,888,121 and U.S. Pat. No. 7,972,854. The most recognized example of a ZFN is a fusion of the FokI nuclease with a zinc finger DNA binding domain.
  • a TAEEN is a targeted nuclease comprising a nuclease fused to a TAL effector DNA binding domain.
  • a “transcription activator-like effector DNA binding domain”, “TAL effector DNA binding domain”, or “TALE DNA binding domain” is a polypeptide domain of TAL effector proteins that is responsible for binding of the TAL effector protein to DNA. TAL effector proteins are secreted by plant pathogens of the genus Xanthomonas during infection. These proteins enter the nucleus of the plant cell, bind effector- specific DNA sequences via their DNA binding domain, and activate gene transcription at these sequences via their transactivation domains.
  • TAL effector DNA binding domain specificity depends on an effector-variable number of imperfect 34 amino acid repeats, which comprise polymorphisms at select repeat positions called repeat variable-diresidues (RVD).
  • RVD repeat variable-diresidues
  • TALENs are described in greater detail in US Patent Application No. 2011/0145940. The most recognized example of a TALEN in the art is a fusion polypeptide of the FokI nuclease to a TAL effector DNA binding domain.
  • targeted nucleases suitable for use as provided herein include, but are not limited to, Bxbl, phiC31, R4, PhiBTl, and Wp/SPBc/TP901-l, whether used individually or in combination.
  • nucleases disclosed herein may be delivered using a vector system, including, but not limited to, plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, and combinations thereof.
  • a vector system including, but not limited to, plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, and combinations thereof.
  • Non- viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid ucleic acid conjugates, naked DNA, naked RNA, capped RNA, artificial virions, and agent-enhanced uptake of DNA.
  • Sonoporation using, e.g., the Sonitron 2000 system (Rich- Mar) can also be used for delivery of nucleic acids.
  • the genetically engineered T cells having a disrupted TAP-1 gene and optionally one or more of additional disrupted genes, e.g., TRAC, CD70, TGFBRII, Reg-1, CBLB, or a combination thereof as disclosed herein, may further express a chimeric antigen receptor (CAR) targeting an antigen of interest or cells expressing such an antigen.
  • CAR chimeric antigen receptor
  • a chimeric antigen receptor refers to an artificial immune cell receptor that is engineered to recognize and bind to an antigen expressed by undesired cells, for example, disease cells such as cancer cells.
  • a T cell that expresses a CAR polypeptide is referred to as a CAR T cell.
  • CARs have the ability to redirect T-cell specificity and reactivity toward a selected target in a non-MHC-restricted manner. The non-MHC-restricted antigen recognition gives CAR-T cells the ability to recognize an antigen independent of antigen processing, thus bypassing a major mechanism of tumor escape.
  • CARs advantageously do not dimerize with endogenous T-cell receptor (TCR) alpha and beta chains.
  • First generation CARs join an antibody-derived scFv to the CD3zeta ( or z) intracellular signaling domain of the T-cell receptor through hinge and transmembrane domains.
  • Second generation CARs incorporate an additional co- stimulatory domain, e.g., CD28, 4- IBB (41BB), or ICOS, to supply a costimulatory signal.
  • Third-generation CARs contain two costimulatory domains (e.g., a combination of CD27, CD28, 4-1BB, ICOS, or 0X40) fused with the TCR CD3( ⁇ chain. Maude et al., Blood. 2015; 125(26):4017-4023; Kakarla and Gottschalk, Cancer J. 2014; 20(2): 151-155). Any of the various generations of CAR constructs is within the scope of the present disclosure.
  • a CAR is a fusion polypeptide comprising an extracellular domain that recognizes a target antigen (e.g., a single chain fragment (scFv) of an antibody or other antibody fragment) and an intracellular domain comprising a signaling domain of the T-cell receptor (TCR) complex (e.g., CD3 ⁇ ) and, in most cases, a co- stimulatory domain.
  • a target antigen e.g., a single chain fragment (scFv) of an antibody or other antibody fragment
  • TCR T-cell receptor
  • a CAR construct may further comprise a hinge and transmembrane domain between the extracellular domain and the intracellular domain, as well as a signal peptide at the N-terminus for surface expression. Examples of signal peptides include those provided in provided in Table 23 below. Other signal peptides may be used.
  • the antigen-binding extracellular domain is the region of a CAR polypeptide that is exposed to the extracellular fluid when the CAR is expressed on cell surface.
  • a signal peptide may be located at the N-terminus to facilitate cell surface expression.
  • the antigen binding domain can be a single-chain variable fragment (scFv, which may include an antibody heavy chain variable region (VH) and an antibody light chain variable region (VL) (in either orientation).
  • VH and VL fragment may be linked via a peptide linker.
  • the linker in some embodiments, includes hydrophilic residues with stretches of glycine and serine for flexibility as well as stretches of glutamate and lysine for added solubility.
  • the scFv fragment retains the antigenbinding specificity of the parent antibody, from which the scFv fragment is derived.
  • the scFv may comprise humanized VH and/or VL domains. In other embodiments, the VH and/or VL domains of the scFv are fully human.
  • the antigen-binding extracellular domain may be specific to a target antigen of interest, for example, a pathologic antigen such as a tumor antigen (e.g., a solid tumor antigen).
  • a tumor antigen is a “tumor associated antigen,” referring to an immunogenic molecule, such as a protein, that is generally expressed at a higher level in tumor cells than in non-tumor cells, in which it may not be expressed at all, or only at low levels.
  • tumor-associated structures which are recognized by the immune system of the tumor-harboring host, are referred to as tumor-associated antigens.
  • a tumor-associated antigen is a universal tumor antigen, if it is broadly expressed by most types of tumors.
  • tumor-associated antigens are differentiation antigens, mutational antigens, overexpressed cellular antigens or viral antigens.
  • a tumor antigen is a “tumor specific antigen” or “TSA,” referring to an immunogenic molecule, such as a protein, that is unique to a tumor cell. Tumor specific antigens are exclusively expressed in tumor cells, for example, in a specific type of tumor cells.
  • Exemplary tumor antigens include, but are not limited to, CD19, BCMA, and CD70. Any known antibodies specific to such tumor antigens, for example, those approved for marketing and those in clinical trials, can be used for making the CAR constructs disclosed herein.
  • Non-limiting examples of CAR constructs are provided in W02019097305 and W02019215500, and W02020/095107, the relevant disclosures of which are herein incorporated by reference for the purposes and subject matter referenced herein.
  • the CAR polypeptide disclosed herein may contain a transmembrane domain, which can be a hydrophobic alpha helix that spans the membrane.
  • a “transmembrane domain” refers to any protein structure that is thermodynamically stable in a cell membrane, preferably a eukaryotic cell membrane. The transmembrane domain can provide stability of the CAR containing such.
  • the transmembrane domain of a CAR as provided herein can be a CD8 transmembrane domain.
  • the transmembrane domain can be a CD28 transmembrane domain.
  • the transmembrane domain is a chimera of a CD8 and CD28 transmembrane domain.
  • Other transmembrane domains may be used as provided herein.
  • the transmembrane domain is a CD8a transmembrane domain containing the sequence provided below in Table 23 below. Other transmembrane domains may be used.
  • a hinge domain may be located between an extracellular domain (comprising the antigen binding domain) and a transmembrane domain of a CAR, or between a cytoplasmic domain and a transmembrane domain of the CAR.
  • a hinge domain can be any oligopeptide or polypeptide that functions to link the transmembrane domain to the extracellular domain and/or the cytoplasmic domain in the polypeptide chain.
  • a hinge domain may function to provide flexibility to the CAR, or domains thereof, or to prevent steric hindrance of the CAR, or domains thereof.
  • a hinge domain may comprise up to 300 amino acids (e.g., 10 to 100 amino acids, or 5 to 20 amino acids). In some embodiments, one or more hinge domain(s) may be included in other regions of a CAR. In some embodiments, the hinge domain may be a CD8 hinge domain. Examples are provided in Table 23 below. Other hinge domains may be used.
  • any of the CAR constructs contain one or more intracellular signaling domains (e.g., CD3 ⁇ , and optionally one or more co-stimulatory domains), which are the functional end of the receptor. Following antigen recognition, receptors cluster and a signal is transmitted to the cell.
  • intracellular signaling domains e.g., CD3 ⁇ , and optionally one or more co-stimulatory domains
  • CD3 ⁇ is the cytoplasmic signaling domain of the T cell receptor complex.
  • CD3 ⁇ contains three (3) immunoreceptor tyrosine-based activation motif (ITAM)s, which transmit an activation signal to the T cell after the T cell is engaged with a cognate antigen.
  • ITAM immunoreceptor tyrosine-based activation motif
  • CD3 ⁇ provides a primary T cell activation signal but not a fully competent activation signal, which requires a co- stimulatory signaling.
  • the CAR polypeptides disclosed herein may further comprise one or more co-stimulatory signaling domains.
  • the co-stimulatory domains of CD28 and/or 4- IBB may be used to transmit a full proliferative/survival signal, together with the primary signaling mediated by CD3 ⁇ .
  • the CAR disclosed herein comprises a CD28 co-stimulatory molecule.
  • the CAR disclosed herein comprises a 4- IBB co-stimulatory molecule.
  • a CAR includes a CD3( ⁇ signaling domain and a CD28 co-stimulatory domain.
  • a CAR includes a CD3 ⁇ signaling domain and 4- IBB co-stimulatory domain.
  • a CAR includes a CD3( ⁇ signaling domain, a CD28 co-stimulatory domain, and a 4- IBB co-stimulatory domain.
  • Table 23 provides examples of signaling domains derived from 4-1BB, CD28 and CD3-zeta that may be used herein.
  • the anti-CD19 CAR disclosed herein may comprise the amino acid sequence of SEQ ID NO: 99.
  • the anti-BCMA CAR disclosed herein may comprise the amino acid sequence of SEQ ID NO: 120.
  • the anti- CD70 CAR disclosed herein may comprise the amino acid sequence of SEQ ID NO: 110. See sequence Table 23 provided below.
  • a nucleic acid encoding a CAR can be introduced into any of the genetically engineered T cells disclosed herein by methods known to those of skill in the art.
  • a coding sequence of the CAR may be cloned into a vector, which may be introduced into the genetically engineered T cells for expression of the CAR.
  • a variety of different methods known in the art can be used to introduce any of the nucleic acids or expression vectors disclosed herein into an immune effector cell.
  • Non-limiting examples of methods for introducing nucleic acid into a cell include: lipofection, transfection (e.g., calcium phosphate transfection, transfection using highly branched organic compounds, transfection using cationic polymers, dendrimer-based transfection, optical transfection, particle-based transfection (e.g., nanoparticle transfection), or transfection using liposomes (e.g., cationic liposomes)), microinjection, electroporation, cell squeezing, sonoporation, protoplast fusion, impalefection, hydrodynamic delivery, gene gun, magnetofection, viral transfection, and nucleofection.
  • transfection e.g., calcium phosphate transfection, transfection using highly branched organic compounds, transfection using cationic polymers, dendrimer-based transfection, optical transfection, particle-based transfection (e.g., nanoparticle transfection), or transfection using liposomes (e.g., cationic liposomes)
  • a nucleic acid encoding a CAR construct can be delivered to a cell using an adeno-associated virus (AAV).
  • AAVs are small viruses which integrate site- specifically into the host genome and can therefore deliver a transgene, such as CAR.
  • ITRs Inverted terminal repeats
  • capsids are present flanking the AAV genome and/or the transgene of interest and serve as origins of replication.
  • rep and cap proteins which, when transcribed, form capsids which encapsulate the AAV genome for delivery into target cells.
  • Surface receptors on these capsids which confer AAV serotype, which determines which target organs the capsids will primarily bind and thus what cells the AAV will most efficiently infect.
  • the AAV for use in delivering the CAR-coding nucleic acid is AAV serotype 6 (AAV6).
  • Adeno-associated viruses are among the most frequently used viruses for gene therapy for several reasons. First, AAVs do not provoke an immune response upon administration to mammals, including humans. Second, AAVs are effectively delivered to target cells, particularly when consideration is given to selecting the appropriate AAV serotype. Finally, AAVs have the ability to infect both dividing and non-dividing cells because the genome can persist in the host cell without integration. This trait makes them an ideal candidate for gene therapy.
  • a nucleic acid encoding a CAR can be designed to insert into a genomic site of interest in the host T cells.
  • the target genomic site can be in a safe harbor locus.
  • a nucleic acid encoding a CAR (e.g., via a donor template, which can be carried by a viral vector such as an adeno-associated viral (AAV) vector) can be designed such that it can insert into a genomic site of interest.
  • the nucleic acid may comprise a left homologous arm and a right homologous arm flanking the nucleotide sequence encoding the CAR. The left and right homologous arms are homologous to the upstream and downstream sequences of the genomic site where the CAR-coding sequence is to be inserted.
  • the genomic site where the CAR-coding sequence is to be inserted is also the target site of a guide RNA such that the CAR-coding nucleic acid can be inserted at the guide RNA targeting site.
  • the left homologous arm and the right homologous arm may be homologous to the sequences immediately flank the guide RNA targeting site.
  • the guide RNA targeting site can be deleted and replaced by the CAR-encoding nucleic acid after gene editing.
  • a nucleic acid encoding a CAR (e.g., via a donor template, which can be carried by a viral vector such as an adeno-associated viral (AAV) vector) can be designed such that it can insert into a location within a genomic site of interest.
  • the genomic site of interest is within a safe harbor gene, which are regions of the host (e.g., human) genome that have been identified as safe sites for incorporation of exogenous genes such as therapeutic genes.
  • Human AAVS1 locus is one example.
  • genomic locus of interest may be within one of the disrupted genes disclosed herein.
  • the nucleic acid encoding the CAR may be inserted into the TRAC gene to disrupt the TRAC gene in the genetically engineered T cells and express the CAR polypeptide. Disruption of TRAC leads to loss of function of the endogenous TCR.
  • a disruption in the TRAC gene can be created with an endonuclease such as those described herein and one or more gRNAs targeting one or more TRAC genomic regions. Any of the gRNAs specific to a TRAC gene and the target regions disclosed herein can be used for this purpose.
  • a genomic deletion in the TRAC gene and replacement by a CAR coding segment can be created by homology directed repair or HDR (e.g., using a donor template, which may be part of a viral vector such as an adeno-associated viral (AAV) vector).
  • a disruption in the TRAC gene can be created with an endonuclease as those disclosed herein and one or more gRNAs targeting one or more TRAC genomic regions and inserting a CAR coding segment into the TRAC gene.
  • a donor template as disclosed herein can contain a coding sequence for a CAR.
  • the CAR-coding sequence may be flanked by two regions of homology to allow for efficient HDR at a genomic location of interest, for example, at a TRAC gene using a gene editing method known in the art.
  • a CRISPR-based method can be used. In this case, both strands of the DNA at the target locus can be cut by a CRISPR Cas9 enzyme guided by gRNAs specific to the target locus. HDR then occurs to repair the doublestrand break (DSB) and insert the donor DNA coding for the CAR.
  • DSB doublestrand break
  • the donor sequence is designed with flanking residues which are complementary to the sequence surrounding the DSB site in the target gene (hereinafter “homology arms”), such as the TRAC gene.
  • homology arms serve as the template for DSB repair and allow HDR to be an essentially error-free mechanism.
  • the rate of homology directed repair (HDR) is a function of the distance between the mutation and the cut site so choosing overlapping or nearby target sites is important. Templates can include extra sequences flanked by the homologous regions or can contain a sequence that differs from the genomic sequence, thus allowing sequence editing.
  • the nucleic acid encoding the CAR may be inserted at a different genomic site, for example, at the disrupted CD70 locus, at the disrupted TGFBRII locus, at the disrupted Reg-1 locus, or at the disrupted CBLB locus, via the same CRISPR/Cas9-mediated gene editing and homologous recombination approach disclosed above.
  • a donor template may have no regions of homology to the targeted location in the DNA and may be integrated by NHEJ-dependent end joining following cleavage at the target site.
  • a donor template can be DNA or RNA, single- stranded and/or double- stranded, and can be introduced into a cell in linear or circular form. If introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonucleolytic degradation) by methods known to those of skill in the art. For example, one or more dideoxynucleotide residues are added to the 3' terminus of a linear molecule and/or self-complementary oligonucleotides are ligated to one or both ends. See, for example, Chang et al., (1987) Proc. Natl. Acad. Sci.
  • Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified intemucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.
  • a donor template can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance.
  • a donor template can be introduced into a cell as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)).
  • viruses e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)
  • a donor template in some embodiments, can be inserted at a site nearby an endogenous prompter (e.g., downstream or upstream) so that its expression can be driven by the endogenous promoter.
  • the donor template may comprise an exogenous promoter and/or enhancer, for example, a constitutive promoter, an inducible promoter, or tissue-specific promoter to control the expression of the CAR gene.
  • the exogenous promoter is an EFla promoter, see, e.g., SEQ ID NO: 127 provided in Table 24 below. Other promoters may be used.
  • exogenous sequences may also include transcriptional or translational regulatory sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2 A peptides and/or poly adenylation signals.
  • additional gene editing e.g., gene knock-in or knock-out
  • gene knock-in or knock-out can be introduced into therapeutic T cells as disclosed herein to improve T cell function and therapeutic efficacy.
  • additional gene editing e.g., gene knock-in or knock-out
  • gene knock-in or knock-out can be introduced into therapeutic T cells as disclosed herein to improve T cell function and therapeutic efficacy.
  • /32M knockout can be performed to reduce the risk of or prevent a host-versus-graft response.
  • Other examples include knock-in or knock-out genes to improve target cell lysis, knock-in or knock-out genes to enhance performance of therapeutic T cells such as CAR-T cells.
  • a donor template for delivering an anti-CD19 CAR may be an AAV vector inserted with a nucleic acid fragment comprising the coding sequence of the anti-CD19 CAR, and optionally regulatory sequences for expression of the anti-CD19 CAR (e.g., a promoter such as the EFla promoter provided in the sequence Table), which can be flanked by homologous arms for inserting the coding sequence and the regulatory sequences into a genomic locus of interest.
  • the nucleic acid fragment is inserted in the endogenous TRAC gene locus, thereby disrupting expression of the TRAC gene.
  • the nucleic acid may replace a fragment in the TRAC gene, for example, a fragment comprising the nucleotide sequence of AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 74).
  • the donor template for delivering the anti-CD19 CAR may comprise a nucleotide sequence of SEQ ID NO: 128, which can be inserted into a disrupted TRAC gene, for example, replacing the fragment of SEQ ID NO: 74.
  • a donor template for delivering an anti-BCMA CAR may be an AAV vector inserted with a nucleic acid fragment comprising the coding sequence of the anti- BCMA CAR, and optionally regulatory sequences for expression of the anti- BCMA CAR (e.g., a promoter such as the EFla promoter provided in the sequence Table), which can be flanked by homologous arms for inserting the coding sequence and the regulatory sequences into a genomic locus of interest.
  • the nucleic acid fragment is inserted in the endogenous TRAC gene locus, thereby disrupting expression of the TRAC gene.
  • the nucleic acid may replace a fragment in the TRAC gene, for example, a fragment comprising the nucleotide sequence of SEQ ID NO: 74.
  • the donor template for delivering the anti- BCMA CAR may comprise a nucleotide sequence of SEQ ID NO: 130, which can be inserted into a disrupted TRAC gene, for example, replacing the fragment of SEQ ID NO: 74.
  • a donor template for delivering an anti-CD70 CAR may be an AAV vector inserted with a nucleic acid fragment comprising the coding sequence of the anti-CD70 CAR, and optionally regulatory sequences for expression of the anti-CD70 CAR (e.g., a promoter such as the EFla promoter provided in Table 24 below), which can be flanked by homologous arms for inserting the coding sequence and the regulatory sequences into a genomic locus of interest.
  • the nucleic acid fragment is inserted in the endogenous TRAC gene locus, thereby disrupting expression of the TRAC gene.
  • the nucleic acid may replace a fragment in the TRAC gene, for example, a fragment comprising the nucleotide sequence of SEQ ID NO: 74.
  • the donor template for delivering the anti-CD70 CAR may comprise a nucleotide sequence of SEQ ID NO: 129, which can be inserted into a disrupted TRAC gene, for example, replacing the fragment of SEQ ID NO: 74.
  • the genetically engineered T cells having a disrupted TAP-1 gene, one or more additional disrupted genes, e.g., TRAC, CD70, TGFBRII, Reg-1, and/or CBLB and further expressing a chimeric antigen receptor (CAR) can be produced by sequential targeting of the genes of interest.
  • gene disruption encompasses gene modification through gene editing (e.g., using CRISPR/Cas gene editing to insert or delete one or more nucleotides).
  • a disrupted gene may contain one or more mutations (e.g., insertion, deletion, or nucleotide substitution, etc.) relative to the wild-type counterpart so as to substantially reduce or completely eliminate the activity of the encoded gene product.
  • the one or more mutations may be located in a non-coding region, for example, a promoter region, a regulatory region that regulates transcription or translation; or an intron region.
  • the one or more mutations may be located in a coding region (e.g., in an exon).
  • the disrupted gene does not express or expresses a substantially reduced level of the encoded protein. In other instances, the disrupted gene expresses the encoded protein in a mutated form, which is either not functional or has substantially reduced activity.
  • a disrupted gene is a gene that does not encode functional protein.
  • a cell that comprises a disrupted gene does not express (e.g., at the cell surface) a detectable level (e.g., by antibody, e.g., by flow cytometry) of the protein encoded by the gene.
  • a cell that does not express a detectable level of the protein may be referred to as a knockout cell.
  • a cell having a TRAC gene edit may be considered a TRAC knockout cell if the TRAC protein cannot be detected at the cell surface using an antibody that specifically binds the TRAC protein.
  • the genetically engineered immune cells may comprise a disrupted TAP-1 gene, a disrupted TRAC gene, and express an anti-CD19 CAR, e.g., those disclosed herein (anti-CD19 CAR-T cells).
  • the population of anti-CD19 CAR T cells may comprise a disrupted TRAC gene via the CRISPR/Cas technology using the TA-1 TRAC gRNA.
  • the antiCD 19 CAR T cells may comprise a deletion in the TRAC gene relative to unmodified T cells.
  • the anti-CD19 CAR T cells may comprise a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 74) in the TRAC gene.
  • This fragment can be replaced by the nucleic acid encoding the anti-CD19 CAR (e.g., SEQ ID NO: 128).
  • the genetically engineered immune cells may comprise a disrupted TAP-1 gene, a disrupted TRAC gene, and express an anti-BCMA CAR, e.g., those disclosed herein (anti-BCMA CAR-T cells).
  • the population of anti-BCMA CAR T cells may comprise a disrupted TRAC gene via the CRISPR/Cas technology using the TA-1 TRAC gRNA.
  • the anti- BCMA CAR T cells may comprise a deletion in the TRAC gene relative to unmodified T cells.
  • the anti-BCMA CAR T cells may comprise a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 74) in the TRAC gene.
  • This fragment can be replaced by the nucleic acid encoding the anti-BCMA CAR (e.g., SEQ ID NO: 130).
  • the genetically engineered immune cells may comprise a disrupted TAP-1 gene, a disrupted TRAC gene, a disrupted CD70 gene, and express an anti-CD70 CAR, e.g., those disclosed herein (anti-CD70 CAR-T cells).
  • the population of anti-CD70 CAR T cells may comprise a disrupted TRAC gene via the CRISPR/Cas technology using the TA-1 TRAC gRNA.
  • the anti-BCMA CAR T cells may comprise a deletion in the TRAC gene relative to unmodified T cells.
  • the anti-CD70 CAR T cells may comprise a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 74) in the TRAC gene. This fragment can be replaced by the nucleic acid encoding the anti-CD70 CAR (e.g., SEQ ID NO: 129).
  • the population of anti-CD70 CAR T cells may comprise a disrupted CD70 gene via CRISPR/Cas9 technology using a gRNA targeting the CD70 locus, for example, CD70-7. See Table 22. See also W02019215500, the relevant disclosures of each of which are incorporated by reference for the subject matter and purpose referenced herein.
  • the therapeutic T cells disclosed herein can be administered to a subject for therapeutic purposes, for example, treatment of a tumor such as a solid tumor targeted by the CAR construct expressed by the therapeutic CAR-T cells.
  • a tumor such as a solid tumor targeted by the CAR construct expressed by the therapeutic CAR-T cells.
  • disruption of the TAP-1 gene led to improved T cell persistence, increased cytokine secretion, enhanced CAR potency and/or CAR copy numbers, etc., leading to improved anti-tumor efficacy as observed in animal models.
  • the step of administering may include the placement (e.g., transplantation) of the therapeutic T cells into a subject by a method or route that results in at least partial localization of the therapeutic T cells at a desired site, such as a tumor site, such that a desired effect(s) can be produced.
  • Therapeutic T cells can be administered by any appropriate route that results in delivery to a desired location in the subject where at least a portion of the implanted cells or components of the cells remain viable.
  • the period of viability of the cells after administration to a subject can be as short as a few hours, e.g., twenty-four hours, to a few days, to as long as several years, or even the lifetime of the subject, i.e., long-term engraftment.
  • an effective amount of the therapeutic T cells can be administered via a systemic route of administration, such as an intraperitoneal or intravenous route.
  • the therapeutic T cells are administered systemically, which refers to the administration of a population of cells other than directly into a target site, tissue, or organ, such that it enters, instead, the subject's circulatory system and, thus, is subject to metabolism and other like processes.
  • Suitable modes of administration include injection, infusion, instillation, or ingestion.
  • Injection includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracap sular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrastemal injection and infusion.
  • the route is intravenous.
  • a subject may be any subject for whom diagnosis, treatment, or therapy is desired.
  • the subject is a mammal.
  • the subject is a human.
  • the human patient has a cancer involving CD19 + cancer cells (e.g., B cell malignancy such as B-cell leukemia, non-Hodgkin lymphoma, e.g., diffuse large B cell lymphoma (DLBCL), B cell lymphoma, or transformed follicular lymphoma, or T cell malignancy).
  • B cell malignancy such as B-cell leukemia, non-Hodgkin lymphoma, e.g., diffuse large B cell lymphoma (DLBCL), B cell lymphoma, or transformed follicular lymphoma, or T cell malignancy.
  • CAR-T cells expressing an anti-CD19 CAR may be used to treat such a patient.
  • the human patient has a cancer involving BCMA + cancer cells (e.g., multiple myeloma).
  • CAR-T cells expressing an anti-BCMA CAR may be used to treat such a patient.
  • the human patient has a CD70 + hematological tumor (e.g., cutaneous T cell lymphoma, peripheral T-cell lymphoma, or T cell leukemia) or a solid tumor (e.g., renal cell carcinoma).
  • CAR-T cells expressing an anti-CD70 CAR may be used to treat such a patient.
  • the therapeutic T cells may be autologous (“self’) to the subject, i.e., the cells are from the same subject.
  • the therapeutic T cells can be non- autologous (“non-self,” e.g., allogeneic, syngeneic or xenogeneic) to the subject.
  • “Allogeneic” means that the therapeutic T cells are not derived from the subject who receives the treatment but from different individuals (donors) of the same species as the subject.
  • a donor is an individual who is not the subject being treated.
  • a donor is an individual who is not the patient.
  • a donor is an individual who does not have or is not suspected of having the cancer being treated.
  • an engineered T cell population being administered according to the methods described herein comprises allogeneic T cells obtained from one or more donors.
  • Allogeneic refers to a cell, cell population, or biological samples comprising cells, obtained from one or more different donors of the same species, where the genes at one or more loci are not identical to the recipient (e.g., subject).
  • an engineered T cell population, being administered to a subject can be derived from one or more unrelated donors, or from one or more non-identical siblings.
  • syngeneic cell populations may be used, such as those obtained from genetically identical donors, (e.g., identical twins).
  • the cells are autologous cells; that is, the engineered T cells are obtained or isolated from a subject and administered to the same subject, i.e., the donor and recipient are the same.
  • An effective amount refers to the amount of a population of engineered T cells needed to prevent or alleviate at least one or more signs or symptoms of a medical condition (e.g., cancer), and relates to a sufficient amount of a composition to provide the desired effect, e.g., to treat a subject having a medical condition.
  • An effective amount also includes an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom of the disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.
  • the efficacy of a treatment using the therapeutic T cells disclosed herein can be determined by the skilled clinician.
  • a treatment is considered “effective”, if any one or all of the signs or symptoms of, as but one example, levels of functional target are altered in a beneficial manner (e.g., increased by at least 10%), or other clinically accepted symptoms or markers of disease (e.g., cancer) are improved or ameliorated.
  • Efficacy can also be measured by failure of a subject to worsen as assessed by hospitalization or need for medical interventions (e.g., progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and/or described herein.
  • Treatment includes any treatment of a disease in subject and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms.
  • Combination therapies are also encompassed by the present disclosure.
  • the therapeutic T cells disclosed herein may be co-used with other therapeutic agents, for treating the same indication, or for enhancing efficacy of the therapeutic T cells and/or reducing side effects of the therapeutic T cells.
  • kits for use in producing the genetically engineered T cells, the therapeutic T cells, and for therapeutic uses are provided.
  • kits provided herein may comprise components for performing genetic edit of a TAP-1 gene, and optionally components for editing one or more additional genes, including TRAC gene, CD70 gene, TGFBRII gene, Reg-1 gene, and CBLB gene.
  • the kit may also comprise a population of immune cells to which the genetic editing will be performed (e.g., a leukopak or a T cell bank).
  • a leukopak sample may be an enriched leukapheresis product collected from peripheral blood. It typically contains a variety of blood cells including monocytes, lymphocytes, platelets, plasma, and red cells.
  • the components for genetically editing one or more of the target genes may comprise a suitable endonuclease such as an RNA-guided endonuclease and one or more nucleic acid guides, which direct cleavage of one or more suitable genomic sites by the endonuclease.
  • the kit may comprise a Cas enzyme such as Cas 9 and one or more gRNAs targeting TAP-1, and optionally gRNAs targeting TRAC, CD70, TGFBRII, Reg-1, and/or CBLB. Any of the gRNAs specific to these target genes can be included in the kit.
  • a kit provided herein may comprise a population of genetically engineered T cells as disclosed herein, and one or more components for producing the therapeutic T cells as also disclosed herein.
  • Such components may comprise an endonuclease suitable for gene editing and a nucleic acid coding for a CAR construct of interest.
  • the CAR-coding nucleic acid may be part of a donor template as disclosed herein, which may contain homologous arms flanking the CAR-coding sequence.
  • the donor template may be carried by a viral vector such as an AAV vector.
  • the kit may further comprise gRNAs specific to any of the genomic site of interest, for example, the TRAC gene, for inserting the CAR-coding sequence into the genomic site of interest.
  • the kit disclosed herein may comprise a population of therapeutic T cells as disclosed for the intended therapeutic purposes.
  • kit disclosed herein may further comprise instructions for making the therapeutic T cells, or therapeutic applications of the therapeutic T cells.
  • the included instructions may comprise a description of using the gene editing components to genetically engineer one or more of the target genes (e.g., TRAC, CD70, TGFBRII, Reg-1, CBLB, or a combination thereof).
  • the included instructions may comprise a description of how to introduce a nucleic acid encoding a CAR construction into the T cells for making therapeutic T cells.
  • a kit as disclosed herein may comprise a population of genetically engineered T cells (e.g., CAR-T cells) for use to eliminate undesired cells targeted by the CAR construct (e.g., for treatment of cancer such as a solid tumor).
  • a kit may comprise one or more containers in which the genetically engineered T cells can be placed.
  • the kit may further comprise instructions for administration of the therapeutic T cells as disclosed herein to achieve the intended activity, e.g., eliminating disease cells targeted by the CAR expressed on the therapeutic T cells.
  • the kit may further comprise a description of selecting a subject suitable for treatment based on identifying whether the subject is in need of the treatment.
  • the instructions relating to the use of the therapeutic T cells described herein generally include information as to dosage, dosing schedule, and route of administration for the intended treatment.
  • the containers may be unit doses, bulk packages (e.g., multi-dose packages) or sub-unit doses.
  • Instructions supplied in the kits of the disclosure are typically written instructions on a label or package insert.
  • the label or package insert indicates that the therapeutic T cells are used for treating, delaying the onset, and/or alleviating a disease or disorder in a subject.
  • kits provided herein are in suitable packaging.
  • suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging, and the like.
  • packages for use in combination with a specific device such as an infusion device for administration of the therapeutic T cells.
  • a kit may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
  • the container may also have a sterile access port.
  • Kits optionally may provide additional components such as buffers and interpretive information.
  • the kit comprises a container and a label or package insert(s) on or associated with the container.
  • the disclosure provides articles of manufacture comprising contents of the kits described above.
  • MHC class I molecules was altered by disrupting the transporter associated with antigen processing-1 (TAP-1) gene using the CRISPR/Cas9-mediated gene editing system.
  • TAP-1 antigen processing-1
  • the initial screening consisted of 8 sgRNAs listed in Table 21 below, which target various locations with the TAP-1 gene. In general, unmodified or modified versions of the sgRNAs may be used.
  • PBMCs were thawed and activated with TransActTM. After 0-3 days, the cells were electroporated with Cas9:sgRNA RNP complexes to generate TAP-1’ T cells.
  • the sgRNAs which form RNPs with the Cas9 enzyme, were introduced into the T cells in a single electroporation event. Cells were then maintained in the culture for a week.
  • MHC Class I expression on the CAR-T cell surface were evaluated in the cell populations by flow cytometry and the editing efficiencies were assessed by TIDE analysis. Editing efficiency of the gRNAs measured by TIDE analysis are shown in Table 1. Deletion of TAP- 1 downregulated MHC Class I expression measured by flow cytometry, as shown in FIGs. 1A and IB and Table 2.
  • Example 2 Production and Characterization of Anti-CD70 CAR + T Cells with Deletion of Transporter Associated with Antigen Processing-1 (TAP-1)
  • This example describes generation and characterization of allogeneic human T cells that lack expression of the TRAC gene, the CD70 gene, and the TAP-1 gene, and express an anti-CD70 CAR.
  • PBMCs were thawed and activated with TransActTM. After 0-3 days, the cells were electroporated with Cas9:sgRNA RNP complexes and transduced with adeno-associated adenoviral vectors (AAVs) to generate genetically engineered TRAC" /CD70" /TAP- l“/anti- CD70 CAR + T cells, in which the nucleic acid encoding the anti-CD70 CAR is inserted at the TRAC locus.
  • AAVs adeno-associated adenoviral vectors
  • the sgRNAs specific to the target genes form RNPs with the Cas9 enzyme and the RNPs were introduced into the T cells in single or multiple electroporation events. After the electroporation, the cells were transduced with recombinant AAVs to introduce the donor template encoding the anti-CD70 CAR.
  • Recombinant AAV serotype 6 (AAV6) comprising one of the nucleotide sequences encoding an anti-CD70 CAR listed in Table 23 was delivered with Cas9:sgRNA RNPs (1 pM Cas9, 5 pM gRNA) to activated human T cells.
  • the following sgRNAs were used: TRAC (SEQ ID NO: 59), CD70 (SEQ ID NO: 67) and TAP-1 (SEQ ID NO: 33). Assessment of CAR Expression and Editing, Efficiency
  • CD70 CAR expression was assessed by flow cytometry using biotinylated CD70 antigen (1 pg), followed by incubation with APC-conjugated streptavidin (200 ng). As shown in Table 3, CD70 CAR expression was similar across all the conditions including the TAP- 1 -deficient CAR T cells.
  • CD4 and CD8 T cells in these cell cohorts were also determined by flow cytometry. As shown in Table 4, there were no significant changes in CD4 + to CD8 + cell ratios in any of the CAR T cell populations.
  • Anti-CD70 CAR T cells with or without TAP-1 deletion were plated at different ratios with Caki-1 target cells that have high CD70 expression. One day later, the number of viable target cells and T cells were counted. As shown in Table 5, TAP-1 deletion had minimal impact of the CAR T cell potency. Table 5. Target Cell Lysis by CAR T Cells of CD70 + Caki-1 Cells
  • This example describes generation and characterization of autologous and allogeneic human T cells that lack expression of the TRAC gene, the CD19 gene, and the TAP-1 gene, and which expresses an anti-CD19 CAR.
  • PBMCs were thawed and activated with TransActTM. After 0-3 days, the cells were electroporated with Cas9:sgRNA RNP complexes and transduced with adeno-associated adenoviral vectors (AAVs) to generate genetically engineered TRAC" /CD 19" /TAP- 1 “/antiCD 19 CAR + T cells, in which the nucleic acid encoding the anti-CD19 CAR is inserted at the TRAC locus.
  • a control TRAC"/CD19"/ P2M“ /anti-CD19 CAR + T cells cell group was also generated.
  • the sgRNAs which form RNPs with the Cas9 enzyme, were introduced into the T cells in single or multiple electroporation events. After the electroporation, the cells were transduced with recombinant AAVs to introduce the donor template encoding the anti-CD19 CAR.
  • Recombinant AAV serotype 6 (AAV6) comprising one of the nucleotide sequences encoding an anti-CD19 CAR listed in Table 23 was delivered with Cas9:sgRNA RNPs (1 pM Cas9, 5 pM gRNA) to activated human T cells.
  • the following sgRNAs were used: TRAC (SEQ ID NO: 59), CD70 (SEQ ID NO: 67) and TAP-1 (SEQ ID NO: 33).
  • CAR expression was assessed by flow cytometry using biotinylated CD19 antigen (1 pg), followed by incubation with APC-conjugated streptavidin (200 ng). As shown in Table 6, CAR expression was similar across all anti-CD19 CAR constructs. Table 6.
  • CD4:CD8 T Cell Ratios The frequency of CD4 and CD8 T cells in these cell cohorts, as well as differential profiles of the CAR T cells, were also determined by flow cytometry. As shown in Table 8, there were no significant changes in CD4 + to CD8 + cell ratios in any of the CAR T cell populations.
  • MHC Class I expression on the CAR-T cell surface were evaluated in the T cell populations taken from 2 donors by flow cytometry. Deletion of TAP- 1 downregulated MHC Class I expression in two different donors, as seen in the Table 9 below.
  • Anti-CD19 CAR T cells with or without TAP-1 deletion were plated at different ratios with K562 target cells that expressed CD19 or not. After 24 hours, the remaining viable target cells were assessed by measuring the relative luminescence units using CellTiter-Glo® assay. As shown in Tables 10-13 below, TAP-1 deletion had minimal impact of the CAR T cell potency and were specific for target cells that expressed the CD19 antigen.
  • Anti-CD70 CAR T cells with TAP-1 deletion were labeled with fluorescent dye and plated at different ratios with NK cells 7 days after electroporation. After 20 hours, the cells were stained, and cell lysis was assessed by flow cytometry. As shown in Tables 14-17, anti- CD70 CAR T cells that have TAP-1 knockout were protected from NK cell-mediated lysis.
  • Anti-CD19 CAR T cells with TAP-1 deletion were labeled with fluorescent dye and plated at different ratios with NK cells either from the same donor (i.e., autologous condition) or from a different donor (i.e., allogeneic condition). After 20 hours, the cells were stained, and cell lysis was assessed by flow cytometry. As shown in Tables 18-19, anti-CD19 CAR T cells that have TAP-1 knockout were protected from NK cell-mediated lysis.
  • inventive embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed.
  • inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein.
  • a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
  • the term “about” as used herein means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, the limitations of the measurement system. For example, “about” can mean within an acceptable standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to ⁇ 20 %, preferably up to ⁇ 10 %, more preferably up to ⁇ 5 %, and more preferably still up to ⁇ 1 % of a given value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” is implicit and in this context means within an acceptable error range for the particular value.
  • the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
  • This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified.
  • “at least one of A and B” can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

Abstract

Une population de lymphocytes T génétiquement modifiés, comprenant un transporteur interrompu associé au gène de traitement d'antigène -1 (TAP -1) et éventuellement une ou plusieurs éditions de gène supplémentaires, par exemple, un gène TRAC interrompu, un gène CD70 interrompu, un gène TGFBRII interrompu, un gène Reg-1 interrompu et/ou un gène CBLB interrompu. L'invention concerne également des procédés de fabrication de ces lymphocytes T génétiquement modifiés et leurs utilisations thérapeutiques.
PCT/IB2023/057725 2022-07-29 2023-07-28 Cellules immunitaires génétiquement modifiées ayant un transporteur interrompu associé à un gène de traitement d'antigène -1 (tap -1) WO2024023801A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263393574P 2022-07-29 2022-07-29
US63/393,574 2022-07-29

Publications (2)

Publication Number Publication Date
WO2024023801A2 true WO2024023801A2 (fr) 2024-02-01
WO2024023801A3 WO2024023801A3 (fr) 2024-04-04

Family

ID=87571870

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2023/057725 WO2024023801A2 (fr) 2022-07-29 2023-07-28 Cellules immunitaires génétiquement modifiées ayant un transporteur interrompu associé à un gène de traitement d'antigène -1 (tap -1)

Country Status (1)

Country Link
WO (1) WO2024023801A2 (fr)

Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998053060A1 (fr) 1997-05-23 1998-11-26 Gendaq Limited Proteines de liaison d'acide nucleique
WO1998053059A1 (fr) 1997-05-23 1998-11-26 Medical Research Council Proteines de liaison d'acide nucleique
US5858358A (en) 1992-04-07 1999-01-12 The United States Of America As Represented By The Secretary Of The Navy Methods for selectively stimulating proliferation of T cells
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
WO2002016536A1 (fr) 2000-08-23 2002-02-28 Kao Corporation Detergent bactericide antisalissures, destine aux surfaces dures
US6352694B1 (en) 1994-06-03 2002-03-05 Genetics Institute, Inc. Methods for inducing a population of T cells to proliferate using agents which recognize TCR/CD3 and ligands which stimulate an accessory molecule on the surface of the T cells
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
WO2003016496A2 (fr) 2001-08-20 2003-02-27 The Scripps Research Institute Domaines de fixation en doigt de zinc pour cnn
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6534055B1 (en) 1988-11-23 2003-03-18 Genetics Institute, Inc. Methods for selectively stimulating proliferation of T cells
US6692964B1 (en) 1995-05-04 2004-02-17 The United States Of America As Represented By The Secretary Of The Navy Methods for transfecting T cells
US6797514B2 (en) 2000-02-24 2004-09-28 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
US6867041B2 (en) 2000-02-24 2005-03-15 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
US6905874B2 (en) 2000-02-24 2005-06-14 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
US6905680B2 (en) 1988-11-23 2005-06-14 Genetics Institute, Inc. Methods of treating HIV infected subjects
US7067318B2 (en) 1995-06-07 2006-06-27 The Regents Of The University Of Michigan Methods for transfecting T cells
US7175843B2 (en) 1994-06-03 2007-02-13 Genetics Institute, Llc Methods for selectively stimulating proliferation of T cells
US7888121B2 (en) 2003-08-08 2011-02-15 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20110145940A1 (en) 2009-12-10 2011-06-16 Voytas Daniel F Tal effector-mediated dna modification
US7972854B2 (en) 2004-02-05 2011-07-05 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
WO2013052523A1 (fr) 2011-10-03 2013-04-11 modeRNA Therapeutics Nucléosides, nucléotides et acides nucléiques modifiés, et leurs utilisations
WO2013151666A2 (fr) 2012-04-02 2013-10-10 modeRNA Therapeutics Polynucléotides modifiés destinés à la production de produits biologiques et de protéines associées à une maladie humaine
WO2019097305A2 (fr) 2017-05-12 2019-05-23 Crispr Therapeutics Ag Matériaux et procédés de génie cellulaire et leurs utilisations en immuno-oncologie
WO2019215500A1 (fr) 2018-05-11 2019-11-14 Crispr Therapeutics Ag Procédés et compositions pour le traitement du cancer
WO2020058280A1 (fr) 2018-09-19 2020-03-26 Handy Baby Products Limited Appareil pour le bain d'un nourrisson
WO2020095107A1 (fr) 2018-11-07 2020-05-14 Crispr Therapeutics Ag Immunothérapie cellulaire anti-cd33 contre le cancer
WO2022064428A1 (fr) 2020-09-23 2022-03-31 Crispr Therapeutics Ag Lymphocytes t génétiquement modifiés à interruption de regnase-1 et/ou de tgfbrii ayant une fonctionnalité et une persistance améliorées
WO2023119201A2 (fr) 2021-12-22 2023-06-29 Crispr Therapeutics Ag Lymphocytes t génétiquement modifiés avec un proto-oncogène-b de lymphome de lignée de casitas interrompu (cblb) et leurs utilisations

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2018515139A (ja) * 2015-05-08 2018-06-14 プレジデント アンド フェローズ オブ ハーバード カレッジ 万能ドナー幹細胞および関連する方法
IL310789A (en) * 2021-08-16 2024-04-01 Beam Therapeutics Inc Persistent Allogeneic Modified Immune Cells and Methods of Using Them
WO2023141472A2 (fr) * 2022-01-19 2023-07-27 Nkarta, Inc. Cellules immunitaires modifiées présentant une puissance améliorée et leurs utilisations en immunothérapie

Patent Citations (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6534055B1 (en) 1988-11-23 2003-03-18 Genetics Institute, Inc. Methods for selectively stimulating proliferation of T cells
US6905680B2 (en) 1988-11-23 2005-06-14 Genetics Institute, Inc. Methods of treating HIV infected subjects
US5883223A (en) 1988-11-23 1999-03-16 Gray; Gary S. CD9 antigen peptides and antibodies thereto
US6887466B2 (en) 1988-11-23 2005-05-03 Genetics Institute, Inc. Methods for selectively stimulating proliferation of T cells
US7232566B2 (en) 1988-11-23 2007-06-19 The United States As Represented By The Secretary Of The Navy Methods for treating HIV infected subjects
US7144575B2 (en) 1988-11-23 2006-12-05 The Regents Of The University Of Michigan Methods for selectively stimulating proliferation of T cells
US5858358A (en) 1992-04-07 1999-01-12 The United States Of America As Represented By The Secretary Of The Navy Methods for selectively stimulating proliferation of T cells
US6905681B1 (en) 1994-06-03 2005-06-14 Genetics Institute, Inc. Methods for selectively stimulating proliferation of T cells
US6352694B1 (en) 1994-06-03 2002-03-05 Genetics Institute, Inc. Methods for inducing a population of T cells to proliferate using agents which recognize TCR/CD3 and ligands which stimulate an accessory molecule on the surface of the T cells
US7175843B2 (en) 1994-06-03 2007-02-13 Genetics Institute, Llc Methods for selectively stimulating proliferation of T cells
US6692964B1 (en) 1995-05-04 2004-02-17 The United States Of America As Represented By The Secretary Of The Navy Methods for transfecting T cells
US7172869B2 (en) 1995-05-04 2007-02-06 The United States Of America As Represented By The Secretary Of The Navy Methods for transfecting T cells
US7067318B2 (en) 1995-06-07 2006-06-27 The Regents Of The University Of Michigan Methods for transfecting T cells
WO1998053060A1 (fr) 1997-05-23 1998-11-26 Gendaq Limited Proteines de liaison d'acide nucleique
WO1998053059A1 (fr) 1997-05-23 1998-11-26 Medical Research Council Proteines de liaison d'acide nucleique
WO1998053058A1 (fr) 1997-05-23 1998-11-26 Gendaq Limited Proteines de liaison d'acide nucleique
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6905874B2 (en) 2000-02-24 2005-06-14 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
US6867041B2 (en) 2000-02-24 2005-03-15 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
US6797514B2 (en) 2000-02-24 2004-09-28 Xcyte Therapies, Inc. Simultaneous stimulation and concentration of cells
WO2002016536A1 (fr) 2000-08-23 2002-02-28 Kao Corporation Detergent bactericide antisalissures, destine aux surfaces dures
WO2003016496A2 (fr) 2001-08-20 2003-02-27 The Scripps Research Institute Domaines de fixation en doigt de zinc pour cnn
US7888121B2 (en) 2003-08-08 2011-02-15 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7972854B2 (en) 2004-02-05 2011-07-05 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20110145940A1 (en) 2009-12-10 2011-06-16 Voytas Daniel F Tal effector-mediated dna modification
WO2013052523A1 (fr) 2011-10-03 2013-04-11 modeRNA Therapeutics Nucléosides, nucléotides et acides nucléiques modifiés, et leurs utilisations
WO2013151666A2 (fr) 2012-04-02 2013-10-10 modeRNA Therapeutics Polynucléotides modifiés destinés à la production de produits biologiques et de protéines associées à une maladie humaine
WO2019097305A2 (fr) 2017-05-12 2019-05-23 Crispr Therapeutics Ag Matériaux et procédés de génie cellulaire et leurs utilisations en immuno-oncologie
WO2019215500A1 (fr) 2018-05-11 2019-11-14 Crispr Therapeutics Ag Procédés et compositions pour le traitement du cancer
WO2020058280A1 (fr) 2018-09-19 2020-03-26 Handy Baby Products Limited Appareil pour le bain d'un nourrisson
WO2020095107A1 (fr) 2018-11-07 2020-05-14 Crispr Therapeutics Ag Immunothérapie cellulaire anti-cd33 contre le cancer
WO2022064428A1 (fr) 2020-09-23 2022-03-31 Crispr Therapeutics Ag Lymphocytes t génétiquement modifiés à interruption de regnase-1 et/ou de tgfbrii ayant une fonctionnalité et une persistance améliorées
WO2023119201A2 (fr) 2021-12-22 2023-06-29 Crispr Therapeutics Ag Lymphocytes t génétiquement modifiés avec un proto-oncogène-b de lymphome de lignée de casitas interrompu (cblb) et leurs utilisations

Non-Patent Citations (28)

* Cited by examiner, † Cited by third party
Title
"Antibodies: a practice approach", 1988, IRL PRESS
"Cell and Tissue Culture: Laboratory Procedures", 1993, J. WILEY AND SONS
"Current Protocols in Immunology", 1991
"DNA Cloning: A practical Approach", 1985
"Gene Transfer Vectors for Mammalian Cells", 1987, HUMANA PRESS
"Handbook of Experimental Immunology", 1994, ACADEMIC PRESS, INC.
"Immobilized Cells and Enzymes", 1986, LRL PRESS
"Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS
"Monoclonal antibodies: a practical approach", 2000, OXFORD UNIVERSITY PRESS
"The Antibodies", 1995, HARWOOD ACADEMIC PUBLISHERS
"Using antibodies: a laboratory manual", 1999, COLD SPRING HARBOR LABORATORY PRESS
B. PERBAL: "A practical Guide To Molecular Cloning", 1984
BAUER DE ET AL., VIS. EXP, vol. 95, 2015, pages e52118
C. A. JANEWAYP. TRAVERS: "Immunobiology", 1997
CHANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 4959 - 4963
DELTCHEVA ET AL., NATURE, vol. 471, 2011, pages 602 - 607
ENBLAD ET AL., HUMAN GENE THERAPY, vol. 26, no. 8, 2015, pages 498 - 505
GOODCHILD, BIOCONJUGATE CHEMISTRY, vol. 1, no. 3, 1990, pages 165 - 187
J. P. MATHERP. E. ROBERTS: "Introduction to Cell and Tissue Culture", 1998, PLENUM PRESS
JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821
KAKARLAGOTTSCHALK, CANCER J, vol. 20, no. 2, 2014, pages 151 - 155
KOONIN ET AL., CURR OPIN MICROBIOL, vol. 37, 2017, pages 67 - 78
MAUDE ET AL., BLOOD, vol. 125, no. 26, 2015, pages 4017 - 4023
NAT REV MICROBIOL, vol. 13, no. 11, 2015, pages 722 - 36
NEHLS ET AL., SCIENCE, vol. 272, 1996, pages 886 - 889
SHMAKOV ET AL., MOL CELL, vol. 60, 2015, pages 385 - 397
VERMAECKSTEIN, ANNUAL REVIEW OF BIOCHEMISTRY, vol. 76, 1998, pages 99 - 134
ZETSCHE ET AL., CELL, vol. 163, 2015, pages 1 - 13

Also Published As

Publication number Publication date
WO2024023801A3 (fr) 2024-04-04

Similar Documents

Publication Publication Date Title
US11497773B2 (en) Genetically engineered t cells with regnase-1 and/or TGFBRII disruption have improved functionality and persistence
EP3790629A1 (fr) Procédés et compositions pour le traitement du cancer
US20230346836A1 (en) Genetically engineered t cells with disrupted casitas b-lineage lymphoma proto-oncogene-b (cblb) and uses thereof
US20210292429A1 (en) Anti-liv1 immune cell cancer therapy
US20210079347A1 (en) Genetically engineered t cells having improved persistence in culture
US20220193134A1 (en) Co-use of lenalidomide with car-t cells
US20230303713A1 (en) Anti-cd19 car-t cells with multiple gene edits and therapeutic uses thereof
WO2024023801A2 (fr) Cellules immunitaires génétiquement modifiées ayant un transporteur interrompu associé à un gène de traitement d'antigène -1 (tap -1)
WO2024023802A2 (fr) Cellules immunitaires génétiquement modifiées ayant un gène transporteur associé au traitement des antigènes-2 (tap-2) interrompu
WO2024023804A2 (fr) Cellules immunitaires génétiquement modifiées ayant un gène protéine de liaison transporteur associé au traitement des antigènes (tapbp) interrompu
US20220288122A1 (en) Genetically engineered t cells with ptpn2 knockout have improved functionality and anti-tumor activity
US20230128917A1 (en) Genetically engineered immune cells having a disrupted cd83 gene
US20230331841A1 (en) Anti-cd83 car-t cells with regnase-1 and/or tgfbrii disruption
WO2024062388A2 (fr) Cellules immunitaires génétiquement modifiées exprimant un récepteur antigénique chimérique ciblant cd20
WO2024003786A1 (fr) Récepteur antigénique chimérique ciblant gpc-3 et cellules immunitaires exprimant celui-ci pour des utilisations thérapeutiques
WO2023111913A1 (fr) Cellule anti-liv1 modifiée avec lyse de régnase-1 et/ou tgfbrii
WO2023084399A1 (fr) Cellules immunitaires génétiquement modifiées exprimant des récepteurs antigéniques chimériques masqués spécifiques de la protéine tyrosine kinase 7

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23754855

Country of ref document: EP

Kind code of ref document: A2