WO2024011335A1 - Cellule immunitaire modifiée - Google Patents

Cellule immunitaire modifiée Download PDF

Info

Publication number
WO2024011335A1
WO2024011335A1 PCT/CN2022/104785 CN2022104785W WO2024011335A1 WO 2024011335 A1 WO2024011335 A1 WO 2024011335A1 CN 2022104785 W CN2022104785 W CN 2022104785W WO 2024011335 A1 WO2024011335 A1 WO 2024011335A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
constant region
immune cell
antigen
modified immune
Prior art date
Application number
PCT/CN2022/104785
Other languages
English (en)
Chinese (zh)
Inventor
林欣
郁翰扬
刘玥
赵学强
芮魏
Original Assignee
清华大学
华夏英泰（北京）生物技术有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 清华大学, 华夏英泰（北京）生物技术有限公司 filed Critical 清华大学
Priority to PCT/CN2022/104785 priority Critical patent/WO2024011335A1/fr
Publication of WO2024011335A1 publication Critical patent/WO2024011335A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material

Definitions

  • the present invention relates to the field of biomedicine, and in particular to a modified immune cell.
  • the present invention discloses a modified immune cell that overexpresses nuclear factor- ⁇ B (NF- ⁇ B) family transcription factors and the use of the modified immune cell.
  • NF- ⁇ B nuclear factor- ⁇ B
  • the three most important transcription factor families are AP-1, NFAT and NF- ⁇ B, which are the three transcription factor families mainly expressed by T cells after TCR activation.
  • the NF- ⁇ B family consists of five members: P50 (precursor P105), P52 (precursor P100), P65, c-Rel and RelB. These five members all have an N-terminal Rel homology domain RHD, which is responsible for its binding to DNA and dimerization.
  • the classical NF- ⁇ B signal originates from the heterodimer of RelA and p50 and the heterodimer of c-Rel and p50; the non-classical NF- ⁇ B signal originates from the heterodimer of RelB and p52.
  • RelA, c-Rel and RelB there is a transcription activation region that positively regulates gene expression.
  • p50 and p52 proteins do not have transcription activation regions, so their homodimers will inhibit transcription.
  • NF- ⁇ B signaling is regulated by a variety of membrane receptors, including B lymphoid receptors.
  • B lymphoid receptors In T cells, NF- ⁇ B transcription factors mainly receive signals from the T lymphoid receptor and tumor necrosis factor receptor TNFR family, among which non-classical NF- ⁇ B is mainly regulated by TNFR signals (Philipson B I, O'Connor R S, May M J, et al. 4-1BB costimulation promotes CAR T cell survival through noncanonical NF- ⁇ B signaling. Science signaling, 2020).
  • P52 is a transcription factor of the non-canonical NF- ⁇ B family, and its precursor protein is p100 encoded by the Nfkb2 gene.
  • p100 When non-canonical NF- ⁇ B signaling is not activated, p100 will form a strong dimer with RelB, another transcription factor of the NF- ⁇ B family, and cannot enter the nucleus; when non-canonical NF- ⁇ B is activated, p100 will be After phosphorylation, it is ubiquitinated and cleaved to p52, and combines with RelB to form a dimer and enters the nucleus, thereby regulating downstream gene expression (Shao-cong Sun.
  • NF- ⁇ B-inducing kinase forms a complex with tumor necrosis factor receptor-associated factor (TRAF) and cIAP and is ubiquitinated, making it unable to phosphorylate oxidizes downstream IKK ⁇ , leading to the formation of a complex between RelB and p100 to prevent nuclear entry.
  • TRAF3 After the tumor necrosis factor receptor binds to its ligand, TRAF3 will be recruited and ubiquitinated, causing NIK to be phosphorylated and phosphorylated downstream IKK ⁇ , ultimately causing p100 to be phosphorylated and cleaved into p52 to bind to RelB Incorporated into the core.
  • Chimeric antigen receptor T cell (CAR-T) therapy is an anti-cancer immunotherapy that has achieved good results in recent years. Unlike the way natural T cells recognize tumor cells, the recognition of tumor cells by CAR-T cells does not rely on MHC molecules.
  • the CAR molecule consists of three parts: the extracellular region is the antigen recognition domain derived from the antibody, responsible for recognizing the target antigen; the transmembrane region; and the intracellular region is the signaling molecule and co-stimulatory signaling molecule derived from the T cell receptor, responsible for Transmits T cell activation signals after receiving stimulation.
  • the T cell receptor (TCR) complex molecule contains multiple chains.
  • the TCR ⁇ chain and TCR ⁇ chain are responsible for recognizing MHC-peptide molecules.
  • the other six CD3 subunits combine with the TCR ⁇ / ⁇ chain to perform signal transduction.
  • the natural TCR complex contains a total of 10 ITAM signal sequences, which can theoretically conduct stronger signals than CAR. Previous studies have shown that although TCR signals are conducted more slowly than CAR signals, TCR signals are more persistent. Therefore, by utilizing the signaling function of natural TCR, a new type of receptor can be constructed to alleviate T cell incompetence and enable it to better exert its anti-solid tumor effect.
  • the extracellular region of the TCR is very similar to the Fab domain of the antibody, so the TCR variable region sequence can be replaced with the antibody variable region sequence to obtain the synthetic T cell receptor antigen receptor (Snythetic TCR and Antigen Receptor, STAR). It has both the specificity of antibodies and the superior signaling function of natural TCR, which can mediate complete T cell activation.
  • Embodiment 1 A modified immune cell modified to overexpress a nuclear factor- ⁇ B (NF- ⁇ B) family transcription factor.
  • NF- ⁇ B nuclear factor- ⁇ B
  • Embodiment 2 The modified immune cell of embodiment 1, wherein the immune cell is selected from T cells, B cells or NK cells, preferably T cells.
  • Embodiment 3 The modified immune cell of embodiment 1 or 2, wherein the NF- ⁇ B family transcription factor is selected from the group consisting of P50, P105, P52, P100, P65, c-Rel and RelB, or any combination thereof, preferably Preferably, the NF- ⁇ B family transcription factor is p52.
  • Embodiment 4 The modified immune cell of any one of embodiments 1-3, wherein the modified immune cell comprises an introduced nucleotide sequence encoding the NF- ⁇ B family transcription factor, thereby overexpressing The NF- ⁇ B family transcription factors.
  • Embodiment 5 The modified immune cell of embodiment 4, wherein a nucleotide sequence encoding the NF- ⁇ B family transcription factor is introduced into the modified immune cell via an expression vector, optionally encoding the NF-
  • the nucleotide sequence of the ⁇ B family transcription factor is operably linked to regulatory sequences in the expression vector.
  • Embodiment 6 The modified immune cell of any one of embodiments 1-5, wherein the modified immune cell further comprises a target-specific receptor.
  • Embodiment 7 The modified immune cell of Embodiment 6, wherein the modified immune cell comprises an introduced nucleotide sequence encoding the target-specific receptor, thereby expressing the target-specific receptor.
  • Embodiment 8 The modified immune cell of embodiment 7, wherein a nucleotide sequence encoding said target-specific receptor is introduced into said modified immune cell via an expression vector, optionally encoding said target-specific receptor
  • the nucleotide sequence of the receptor is operably linked to regulatory sequences in the expression vector.
  • Embodiment 9 The modified immune cell of any one of embodiments 6-8, wherein the target-specific receptor is selected from the group consisting of chimeric antigen receptors (CARs) and T cell receptors (TCRs).
  • CARs chimeric antigen receptors
  • TCRs T cell receptors
  • Embodiment 10 The modified immune cell of embodiment 9, wherein the target-specific receptor is a modified T-cell receptor (TCR), such as a Synthetic T-Cell Receptor and Antibody Receptor,STAR).
  • TCR modified T-cell receptor
  • Embodiment 11 The modified immune cell of embodiment 10, wherein the modified TCR, such as STAR, is derived from an ⁇ TCR, and wherein the ⁇ chain comprises a first constant region and the ⁇ chain comprises a second constant region.
  • the modified TCR such as STAR
  • Embodiment 12 The modified immune cell of embodiment 11, wherein the first constant region is a native TCR ⁇ chain constant region, eg, a native human TCR ⁇ chain constant region or a native mouse TCR ⁇ chain constant region.
  • the first constant region is a native TCR ⁇ chain constant region, eg, a native human TCR ⁇ chain constant region or a native mouse TCR ⁇ chain constant region.
  • Embodiment 13 The modified immune cell of embodiment 11, wherein the first constant region is a modified TCR ⁇ chain constant region.
  • Embodiment 14 The modified immune cell of embodiment 13, wherein the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region at position 48 relative to the wild-type mouse TCR ⁇ chain constant region. Amino acids such as threonine T are mutated to cysteine C.
  • Embodiment 15 The modified immune cell of embodiment 13 or 14, wherein the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region, which is at step 112 relative to a wild-type mouse TCR ⁇ chain constant region.
  • the amino acid at position 114 such as serine S, is changed to leucine L
  • the amino acid at position 114 such as methionine M
  • the amino acid at position 115 such as glycine G
  • Embodiment 16 The modified immune cell of any one of embodiments 13-15, wherein the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region relative to a wild-type mouse TCR ⁇ chain constant region.
  • the amino acid at position 48 such as threonine T is mutated to cysteine C
  • the amino acid at position 112 such as serine S is mutated into leucine L
  • the amino acid at position 114 such as methionine M is mutated
  • the amino acid at position 115 such as glycine G is changed to lycine V.
  • Embodiment 17 The modified immune cell of any one of embodiments 11-16, wherein the first constant region comprises the amino acid sequence set forth in one of SEQ ID NOs: 1, 3, 5, 7 and 28.
  • Embodiment 18 The modified immune cell of any one of embodiments 11-17, wherein the second constant region is a native TCR beta chain constant region, e.g., a native human TCR beta chain constant region or a native mouse TCR beta chain constant region .
  • the second constant region is a native TCR beta chain constant region, e.g., a native human TCR beta chain constant region or a native mouse TCR beta chain constant region .
  • Embodiment 19 The modified immune cell of any one of embodiments 11-17, wherein the second constant region is a modified TCR beta chain constant region.
  • Embodiment 20 The modified immune cell of embodiment 19, wherein the modified TCR beta chain constant region is derived from a mouse TCR beta chain constant region at position 56 relative to the wild-type mouse TCR beta chain constant region. Amino acids such as serine S are mutated to cysteine C.
  • Embodiment 21 The modified immune cell of any one of embodiments 11-20, wherein the second constant region comprises the amino acid sequence set forth in one of SEQ ID NOs: 2, 4 and 6.
  • Embodiment 22 The modified immune cell of any one of embodiments 11-21, wherein the first constant region is derived from a mouse TCR ⁇ chain constant region that is at The amino acid at position 48, such as threonine T, is mutated into cysteine C, the amino acid at position 112, such as serine S, is mutated into leucine L, and the amino acid at position 114, such as methionine M, is mutated into iso.
  • the first constant region is derived from a mouse TCR ⁇ chain constant region that is at The amino acid at position 48, such as threonine T, is mutated into cysteine C, the amino acid at position 112, such as serine S, is mutated into leucine L, and the amino acid at position 114, such as methionine M, is mutated into iso.
  • Leucine I the amino acid at position 115 such as glycine G is changed to leucine V; and the second constant region is derived from the mouse TCR ⁇ chain constant region, which is relative to the wild-type mouse TCR ⁇ chain constant region, The amino acid at position 56, such as serine S, is mutated to cysteine C.
  • Embodiment 23 The modified immune cell of embodiment 22, wherein the first constant region includes the amino acid sequence shown in SEQ ID NO: 28; the second constant region includes the amino acid sequence shown in SEQ ID NO: 6.
  • Embodiment 24 The modified immune cell of any one of embodiments 11-23, wherein the modified TCR, such as STAR, is derived from an ⁇ TCR, and wherein the ⁇ chain comprises a first antigen-binding region and the ⁇ chain comprises a second antigen. bonding zone.
  • the modified TCR such as STAR
  • Embodiment 25 The modified immune cell of embodiment 24, wherein the first antigen-binding region and the second antigen-binding region each specifically bind a target antigen, independently or in combination.
  • Embodiment 26 The modified immune cell of embodiment 25, wherein the target antigen is a disease-associated antigen, preferably a cancer-associated antigen, such as a cancer-associated antigen selected from the group consisting of: GPC3, CD16, CD64, CD78, CD96, CLL1 , CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2/neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), EGFR variants III (EGFRvIII), CD19, CD20, CD30, CD40, disialoganglioside GD2, ductal epithelial mucin, gp36, TAG-72, glycosphingolipid, glioma-associated antigen, ⁇ -human chorionic membrane Gonadotropin, alpha fetoglobulin (AFP), lectin-responsive AFP, thyroglobulin
  • Embodiment 27 The modified immune cell of any one of embodiments 24-26, wherein the first antigen-binding region comprises a heavy chain variable region of an antibody that specifically binds a target antigen, and the second antigen binds The region includes the light chain variable region of the antibody; alternatively, the first antigen-binding region includes the light chain variable region of an antibody that specifically binds the target antigen, and the second antigen-binding region includes the heavy chain variable region of the antibody. chain variable region.
  • Embodiment 28 The modified immune cell of any one of embodiments 24-26, wherein said first antigen-binding region comprises a single chain antibody or single domain antibody that specifically binds a target antigen; and/or said second The antigen-binding region contains single-chain antibodies or single-domain antibodies that specifically bind to the target antigen,
  • the single-chain antibody includes a heavy chain variable region and a light chain variable region connected by a linker, such as a (G4S)n linker, where n represents an integer from 1 to 10, preferably, n is 1 or 3.
  • a linker such as a (G4S)n linker, where n represents an integer from 1 to 10, preferably, n is 1 or 3.
  • Embodiment 29 The modified immune cell of embodiment 28, wherein the first antigen binding region and the second antigen binding region bind the same target antigen.
  • Embodiment 30 The modified immune cell of embodiment 28, wherein the first antigen-binding region and the second antigen-binding region bind to different regions of the same target antigen (eg, different epitopes) or bind to different target antigens .
  • Embodiment 31 A pharmaceutical composition comprising the modified immune cell of any one of embodiments 1-30, and a pharmaceutically acceptable carrier.
  • Embodiment 32 Use of the modified immune cell of any one of embodiments 1-30 or the pharmaceutical composition of embodiment 31 for the preparation of a medicament for treating a disease, such as cancer, in a subject.
  • Embodiment 33 A method of treating a disease, such as cancer, in a subject, comprising administering to the subject a therapeutically effective amount of the modified immune cell of any one of embodiments 1-30 or the pharmaceutical composition of embodiment 31.
  • Embodiment 34 A method of significantly shrinking a subject in a subject having cancer, comprising administering to the subject a therapeutically effective amount of the modified immune cell of any one of embodiments 1-30 or of embodiment 31 Pharmaceutical compositions.
  • Embodiment 35 A method of prolonging the survival time of a subject suffering from cancer, comprising administering to the subject a therapeutically effective amount of the modified immune cell of any one of embodiments 1-30 or the pharmaceutical composition of embodiment 31 .
  • Embodiment 36 An isolated nucleic acid molecule comprising a nucleotide sequence encoding an NF- ⁇ B family transcription factor as defined in any one of embodiments 1-30 and/or encoding any one of embodiments 1-30 The nucleotide sequence of the defined target-specific receptor.
  • Embodiment 37 An expression vector comprising i) a nucleotide sequence encoding a target-specific receptor as defined in any one of embodiments 1-30 and/or ii) encoding an implementation operably linked to a regulatory sequence. Nucleotide sequence of the NF- ⁇ B family transcription factor as defined in any of Schemes 1-30.
  • Embodiment 38 A method of preparing modified immune cells, comprising
  • Embodiment 39 The method of embodiment 38, wherein said immune cells are selected from T cells, B cells or NK cells, preferably T cells.
  • Embodiment 40 The method of embodiment 38 or 39, wherein the NF- ⁇ B family transcription factor is selected from the group consisting of P50, P105, P52, P100, P65, c-Rel and RelB, or any combination thereof, preferably, the The NF- ⁇ B family transcription factor is p52.
  • Embodiment 41 The method of any one of embodiments 38-40, wherein said method is performed by combining a nucleic acid molecule comprising a nucleotide sequence encoding said NF- ⁇ B family transcription factor or a coding sequence operably linked to a regulatory sequence.
  • the expression vector of the nucleotide sequence of the NF- ⁇ B family transcription factor is introduced into the immune cell to overexpress the NF- ⁇ B family transcription factor.
  • Embodiment 42 The method of embodiment 41, wherein the NF- ⁇ B family transcription factor is p52, and the nucleotide sequence encoding the p52 is shown in SEQ ID NO: 8.
  • Embodiment 43 The method of any one of embodiments 38-42, wherein the method further comprises c) converting a nucleic acid molecule comprising a nucleotide sequence encoding a target-specific receptor or encoding a nucleic acid molecule operably linked to a regulatory sequence.
  • An expression vector for the nucleotide sequence of a target-specific receptor is introduced into the immune cell.
  • Embodiment 44 The method of Embodiment 43, wherein the target-specific receptor is selected from the group consisting of chimeric antigen receptor (CAR) and T cell receptor (TCR).
  • CAR chimeric antigen receptor
  • TCR T cell receptor
  • Embodiment 45 The method of embodiment 44, wherein the target-specific receptor is a modified T-cell receptor (TCR), such as a Synthetic T-Cell Receptor and Antibody Receptor, STAR).
  • TCR modified T-cell receptor
  • Embodiment 46 The method of any one of embodiments 38-45, wherein said method further comprises the step
  • Embodiment 47 A method for improving T cell proliferation ability, improving T cell effector survival time, increasing the number of T cells in vivo, inducing T cells to differentiate into effector T cells, reducing T cell inhibitory receptor expression, and increasing CD8+ in the T cell population T cell ratio, or a method for improving the target killing ability of T cells, the method includes:
  • Embodiment 48 The method of embodiment 47, wherein the NF- ⁇ B family transcription factor is selected from the group consisting of P50, P105, P52, P100, P65, c-Rel and RelB, or any combination thereof, preferably, the NF- The ⁇ B family transcription factor is p52.
  • Embodiment 49 The method of embodiment 48, wherein the method is accomplished by combining a nucleic acid molecule comprising a nucleotide sequence encoding the NF- ⁇ B family transcription factor or a nucleic acid molecule encoding the NF- ⁇ B family operably linked to a regulatory sequence.
  • An expression vector of the nucleotide sequence of the transcription factor is introduced into the T cells to overexpress the NF- ⁇ B family transcription factor.
  • Embodiment 50 The method of embodiment 49, wherein the NF- ⁇ B family transcription factor is p52, and the nucleotide sequence encoding the p52 is shown in SEQ ID NO: 8.
  • Embodiment 51 The method of any one of embodiments 47-50, wherein the method further comprises the step
  • Embodiment 51 A kit for preparing the modified immune cell of any one of embodiments 1-30, said kit comprising the nucleic acid molecule of embodiment 36 and/or the expression vector of embodiment 37, Optionally, the kit further contains reagents for isolating, culturing and/or expanding immune cells such as T cells, and/or preparations for introducing the nucleic acid molecules or expression vectors into cells.
  • Figure 1 Structure of STAR showing constant region modification.
  • Figure 2 Shows the vector structure for co-expression of p52/RFP and STAR.
  • Figure 3 Shows that overexpression of p52 increases the killing ability of STAR-T cells against target cell A431.
  • Figure 4 Shows that overexpression of p52 increases the proportion of CD8+ T cells.
  • Figure 5 Shows that overexpression of p52 improves the proliferation ability of CD8+T cells.
  • Figure 6 Shows that after 5 days of antigen protein stimulation, overexpression of p52 makes mut-STAR T cells more differentiated into effector T cells.
  • FIG. 9 ELISA results show that overexpression of p52 can increase the secretion of IFN- ⁇ and IL2 by mut-STAR T cells and enhance the effector function of T cells.
  • Figure 10 Shows the experimental design of the low-dose Raji hematoma model.
  • Figure 11 Shows the results of tumor size monitoring in the low-dose Raji hematoma model experiment.
  • Figure 12 Shows the tumor size imaging in the low-dose Raji hematoma model experiment.
  • Figure 13 Shows the count of reinfused human T cells in the peripheral blood of mice during experiments in the low-dose Raji hematoma model.
  • Figure 14 Shows experimental design of excess Raji hematoma model.
  • Figure 15 Shows the count of reinfused human T cells in the peripheral blood of mice during experiments in the excess Raji hematoma model.
  • Figure 16 Shows the count of human CD8+ T cells reinfused in the peripheral blood of mice during the excess Raji hematoma model experiment.
  • Figure 17 Shows the survival curve of mice during the experiment of excess Raji hematoma model.
  • FIG. 18 A431 subcutaneous tumor model experiments show that overexpression of p52 significantly increases the inhibition of tumors by mut-STAR T cells.
  • FIG. 19 A549 subcutaneous tumor model experiments show that overexpression of p52 significantly increases the inhibition of tumors by mut-STAR T cells.
  • FIG. 20 Subcutaneous A431-NYESO-1 tumor model to detect the effect of overexpression of p52 on the tumor suppressive effect of 1G4-TCR T cells.
  • Figure 21 Shows that in the subcutaneous A431-NYESO-1 tumor model, 24 days after T cell infusion, overexpression of p52 significantly increased the tumor suppressive effect of 1G4-TCR T cells.
  • FIG. 22 Shows the tumor size imaging in the subcutaneous A431-NYESO-1 tumor model experiment.
  • Figure 23 shows that overexpression of p52 on first-generation CAR (zCAR) T cells can improve its target cell killing ability, and is stronger than BBzCAR.
  • Figure 24 Shows that overexpression of p52 on first-generation CAR (zCAR) T cells can improve their proliferation ability.
  • the protein or nucleic acid may consist of the sequence, or may have additional amino acids or nucleic acids at one or both ends of the protein or nucleic acid. glycosides, but still have the activity described in the present invention.
  • those skilled in the art know that the methionine encoded by the start codon at the N-terminus of the polypeptide will be retained under certain practical circumstances (such as when expressed in a specific expression system), but will not substantially affect the function of the polypeptide.
  • amino acid numbering refers to SEQ ID NO:x
  • SEQ ID NO:x is a specific sequence listed herein
  • amino acid correspondence can be determined according to sequence comparison methods known in the art. For example, amino acid correspondence can be determined through the EMBL-EBI online alignment tool (https://www.ebi.ac.uk/Tools/psa/), where two sequences can be determined using the Needleman-Wunsch algorithm using default parameters. Alignment.
  • the amino acid in the polypeptide can also be described herein. It is "alanine at position 48 of the polypeptide, and the amino acid position refers to SEQ ID NO:x".
  • the amino acid position related to the ⁇ chain constant region refers to SEQ ID NO: 3.
  • the amino acid position related to the ⁇ -chain constant region refers to SEQ ID NO: 4.
  • the invention provides a modified immune cell modified to overexpress a nuclear factor- ⁇ B (NF- ⁇ B) family transcription factor.
  • NF- ⁇ B nuclear factor- ⁇ B
  • the modified immune cells are isolated.
  • the modified immune cells are therapeutic immune cells.
  • the modified immune cells are used for administration to a subject in need thereof to treat a disease, such as a tumor or an infectious disease in the subject.
  • the immune cells described herein can be a variety of different immune cells, including but not limited to T cells, B cells, or NK cells.
  • Immune cells described herein can be obtained by various non-limiting methods from many non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, ascites fluid , pleural effusion, spleen tissue and tumors.
  • cells can be derived from healthy donors or from patients diagnosed with cancer.
  • cells may be part of a mixed population of cells exhibiting different phenotypic characteristics.
  • T cells can be obtained by isolating peripheral blood mononuclear cells (PBMC) and then activating and amplifying them with specific antibodies.
  • PBMC peripheral blood mononuclear cells
  • the immune cells are derived from the subject's autologous cells.
  • autologous means that a cell, cell line or cell population used to treat a subject is derived from the subject.
  • the immune cells, such as T cells are derived from allogeneic cells, such as from a donor that is human leukocyte antigen (HLA) compatible with the subject. Cells from the donor can be converted into non-alloreactive cells using standard protocols and replicated as needed, producing cells that can be administered to one or more patients.
  • HLA human leukocyte antigen
  • the NF- ⁇ B family transcription factor is selected from P50, P105, P52, P100, P65, c-Rel and RelB, or any combination thereof.
  • the NF- ⁇ B family transcription factor is a transcription factor of the non-canonical NF- ⁇ B family.
  • the non-canonical NF- ⁇ B family transcription factor is selected from RelB and p52. In some preferred embodiments, the non-canonical NF- ⁇ B family transcription factor is p52.
  • Exemplary p52 includes the amino acid sequence set forth in SEQ ID NO:9 or is encoded by the nucleotide sequence set forth in SEQ ID NO:8.
  • the p52 also encompasses functional variants thereof, such as naturally occurring functional variants, for example, the functional variants of p52 comprise at least 75%, at least 80% of the same as SEQ ID NO: 9 , at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% sequence identical
  • the unique amino acid sequence but retains the activity of SEQ ID NO:9, such as the activity of binding to RelB and initiating downstream gene expression.
  • overexpression of NF- ⁇ B family transcription factors in immune cells can be achieved by incorporating a nucleic acid molecule encoding a nucleotide sequence encoding the NF- ⁇ B family transcription factor or comprising the nucleic acid molecule encoding the NF- ⁇ B family transcription factor. This is achieved by introducing the expression vector of the nucleotide sequence of the transcription factor into the immune cells.
  • it can also be achieved by targeted modification of the endogenous NF- ⁇ B family transcription factor gene in immune cells.
  • overexpression of the transcription factor can be achieved by targeted modification of the expression regulatory region of the gene.
  • the targeted modification can be achieved, for example, by gene editing technologies known in the art, such as CRISPR technology, TALEN, ZFN and other gene editing technologies.
  • the modified immune cells comprise introduced nucleotide sequences encoding the NF- ⁇ B family transcription factors, thereby overexpressing the NF- ⁇ B family transcription factors.
  • the nucleotide sequence encoding the NF- ⁇ B family transcription factor is introduced into the modified immune cell via an expression vector. In some embodiments, the nucleotide sequence encoding the NF- ⁇ B family transcription factor is operably linked to regulatory sequences in the expression vector.
  • the "expression vector" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or an RNA capable of translation (such as mRNA).
  • the expression vector is a viral vector, such as a lentiviral vector.
  • regulatory sequence and “regulatory element” are used interchangeably and refer to a coding sequence that is located upstream (5' non-coding sequence), intermediate or downstream (3' non-coding sequence) and affects the transcription, RNA processing or Stability or translated nucleotide sequence.
  • Expression regulatory elements refer to nucleotide sequences capable of controlling the transcription, RNA processing or stability, or translation of a nucleotide sequence of interest. Regulatory sequences may include, but are not limited to, promoters, translation leaders, introns, enhancers, and polyadenylation recognition sequences.
  • operably linked means that a regulatory element (eg, but not limited to, a promoter sequence, a transcription termination sequence, etc.) is linked to a nucleic acid sequence (eg, a coding sequence or an open reading frame) such that the nucleotide Transcription of the sequence is controlled and regulated by the transcriptional regulatory elements.
  • a regulatory element eg, but not limited to, a promoter sequence, a transcription termination sequence, etc.
  • nucleic acid sequence eg, a coding sequence or an open reading frame
  • the modified immune cells further comprise (eg express) a "target-specific receptor.”
  • the target-specific receptor is capable of mediating activation of the immune cell upon specific binding to a target.
  • the modified immune cell comprises an introduced nucleotide sequence encoding the target-specific receptor, thereby expressing the target-specific receptor.
  • the nucleotide sequence encoding the target-specific receptor is introduced into the modified immune cell via an expression vector. In some embodiments, the nucleotide sequence encoding the target-specific receptor is operably linked to regulatory sequences in the expression vector.
  • a nucleotide sequence encoding the target-specific receptor and a nucleotide sequence encoding the NF- ⁇ B family transcription factor are introduced into the modified immune cell in the same expression vector.
  • the target-specific receptor is a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • CAR Chimeric antigen receptor
  • the CAR may comprise an extracellular target (antigen) binding region directed to a specific target (eg, an antigen).
  • a specific target eg, an antigen
  • the target (antigen) binding region is a single chain antibody or single domain antibody that specifically binds a target antigen.
  • the CAR may also include a transmembrane domain and an intracellular signaling domain.
  • the intracellular signal transduction domain of the CAR according to the present invention is responsible for intracellular signal transduction after the extracellular target binding region binds to the target, resulting in activation of immune cells and immune response.
  • the intracellular signaling domain has the ability to activate at least one normal effector function of the CAR-expressing immune cell.
  • the intracellular signaling domain for a CAR may be a cytoplasmic sequence such as, but not limited to, that of a T cell receptor and a coreceptor that act in concert to initiate signal transduction upon antigen receptor engagement, as well as derivatives or variants of any of these sequences and any synthetic sequences having the same functional capabilities.
  • Intracellular signaling domains include two distinct types of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation and those that act in an antigen-independent manner to provide secondary or costimulatory signals.
  • the primary cytoplasmic signaling sequence may include a signaling motif known as the immunoreceptor tyrosine activation motif of ITAM.
  • Non-limiting examples of ITAMs used in CARs of the invention may include those derived from TCR ⁇ , FcR ⁇ , FcR ⁇ , FcR ⁇ , CD3 ⁇ , CD3 ⁇ , CD5, CD22, CD79a, CD79b, and CD66d.
  • the intracellular signaling domain of a CAR of the invention includes a CD3 ⁇ signaling domain.
  • the intracellular signaling domain of the CAR of the invention also includes a costimulatory domain (second generation or higher CAR), such as a 41BB costimulatory domain or a CD28 costimulatory domain.
  • a CAR is expressed on the surface of cells. Therefore, a CAR may also include a transmembrane domain. Suitable transmembrane domains of the CAR of the invention have the ability to: (a) be expressed on the surface of cells, preferably immune cells, such as but not limited to lymphocytes or natural killer (NK) cells, and (b) bind to the ligand binding domain Interacts with intracellular signal transduction domains to guide immune cells to respond to predetermined target cells.
  • Transmembrane domains can be derived from natural or synthetic sources. The transmembrane domain can be derived from any membrane-bound or transmembrane protein.
  • the transmembrane domain can be derived from subunits of T cell receptors such as alpha subunits, beta subunits, gamma or delta subunits, polypeptides constituting the CD3 complex, p55 ( ⁇ chain), p75 ( ⁇ chain) or ⁇ , subunit chain of an Fc receptor, in particular Fc ⁇ receptor III or CD protein.
  • the transmembrane domain may be synthetic and may consist primarily of hydrophobic residues such as leucine and valine.
  • the transmembrane domain is derived from human CD8 alpha chain.
  • the transmembrane domain may further comprise a hinge region located between the extracellular ligand binding domain and said transmembrane domain. The hinge region is, for example, derived from the extracellular region of CD8, CD4 or CD28.
  • the CAR is a first generation CAR that does not contain a costimulatory domain.
  • the first-generation CAR may be composed of an extracellular ligand-binding domain, a hinge region, a transmembrane region, and a CD3 ⁇ signaling domain.
  • the target-specific receptor is a T cell receptor (TCR). In some preferred embodiments, the target-specific receptor is a modified T cell receptor (TCR). In some embodiments, the TCR is an ⁇ TCR. In some embodiments, the TCR is a ⁇ TCR.
  • the target-specific receptor is a Synthetic T-Cell Receptor and Antibody Receptor (STAR).
  • STARs are derived from native TCRs and can be generated by replacing the variable region of the native TCR with a different given target binding region, such as a given antibody variable region.
  • Synthetic T cell receptor antibody receptors (STAR) of the present invention include, but are not limited to, those disclosed in WO2021135178A1 or WO2021223707A1.
  • the modified TCR such as STAR
  • the ⁇ chain includes a first constant region and the ⁇ chain includes a second constant region.
  • the alpha chain further comprises a first target binding region, and/or the beta chain further comprises a second target binding region.
  • the modified TCR such as the alpha chain and/or beta chain of STAR, has at least one functional domain attached to its C-terminus.
  • the alpha chain of the modified TCR such as STAR
  • the beta chain of the modified TCR such as STAR, has at least one functional domain attached to its C-terminus.
  • the alpha and beta chains of the STAR have at least one functional domain linked to their C-terminus.
  • the native intracellular region of the alpha chain and/or beta chain of the modified TCR is deleted. In some embodiments, the native intracellular region of the alpha chain of the modified TCR, such as STAR, is deleted. In some embodiments, the native intracellular region of the beta chain of the modified TCR, such as STAR, is deleted. In some embodiments, the native intracellular regions of the alpha and beta chains of the modified TCR, such as STAR, are deleted.
  • the at least one functional domain is linked to the C-terminus of the alpha chain and/or beta chain from which the native intracellular region is deleted, either directly or through a linker. In some embodiments, the at least one functional domain is linked to the C-terminus of the alpha chain from which the native intracellular region is deleted, either directly or through a linker. In some embodiments, the at least one functional domain is linked to the C-terminus of the beta chain from which the native intracellular region is deleted, either directly or through a linker. In some embodiments, the at least one functional domain is linked to the C-terminus of the alpha chain and beta chain from which the native intracellular region is deleted, either directly or through a linker.
  • the alpha chain and/or beta chain in the modified TCR can be linked to the same or different functional domains.
  • the functional domain is a foreign functional domain.
  • the functional domain is an exogenous intracellular domain, eg, a domain that functions in signaling within the cell.
  • exogenous means a protein or nucleic acid sequence from a foreign species or, if from the same species, a protein that has been significantly altered in composition and/or position from its native form by deliberate human intervention or Nucleic acid sequence.
  • a "functional domain” may be an intracellular domain of a co-stimulatory molecule such as CD40, OX40, ICOS, CD28, 4-1BB, CD27, CD137; it may also be an intracellular domain of a co-inhibitory molecule.
  • a co-stimulatory molecule such as CD40, OX40, ICOS, CD28, 4-1BB, CD27, CD137; it may also be an intracellular domain of a co-inhibitory molecule.
  • Structural domain such as the intracellular domain of TIM3, PD1, CTLA4, LAG3; it can also be a cytokine receptor such as an interleukin receptor (such as IL-2 ⁇ receptor, IL-7 ⁇ receptor or IL-21 receptor) , interferon receptor, tumor necrosis factor superfamily receptor, colony-stimulating factor receptor, chemokine receptor, growth factor receptor or the intracellular domain of other membrane proteins; or the domain of an intracellular protein such as NIK.
  • the functional domain can also be a fusion of the intracellular domain of the cytokine receptor and the human STAT5 activation module (SEQ ID NO: 25) directly or through a linker.
  • the functional domain is an intracellular domain of a costimulatory molecule, preferably an intracellular domain of OX40 or ICOS, more preferably an intracellular domain of OX40.
  • An exemplary CD40 intracellular domain includes the amino acid sequence shown in SEQ ID NO:16.
  • An exemplary OX40 intracellular domain includes the amino acid sequence shown in SEQ ID NO:17.
  • An exemplary ICOS intracellular domain includes the amino acid sequence shown in SEQ ID NO: 18.
  • An exemplary CD28 intracellular domain includes the amino acid sequence shown in SEQ ID NO: 19.
  • An exemplary 4-1BB intracellular domain includes the amino acid sequence shown in SEQ ID NO:20.
  • An exemplary CD27 intracellular domain includes the amino acid sequence shown in SEQ ID NO: 21.
  • An exemplary IL-2 ⁇ receptor intracellular domain includes the amino acid sequence shown in SEQ ID NO: 22.
  • An exemplary IL-17 ⁇ receptor intracellular domain includes the amino acid sequence shown in SEQ ID NO: 23.
  • An exemplary IL-21 receptor intracellular domain includes the amino acid sequence shown in SEQ ID NO: 24.
  • An exemplary fusion amino acid sequence of the IL-2 ⁇ receptor intracellular domain and the human STAT5 activation module is shown in SEQ ID NO: 26.
  • An exemplary fusion amino acid sequence of the IL-17 ⁇ receptor intracellular domain and the human STAT5 activation module is shown in SEQ ID NO: 27.
  • the first constant region is a native TCR ⁇ chain constant region, e.g., a native human TCR ⁇ chain constant region (an exemplary human TCR ⁇ chain constant region amino acid sequence is shown in SEQ ID NO: 1) or natural mouse TCR ⁇ Chain constant region (an exemplary mouse TCR ⁇ chain constant region amino acid sequence is shown in SEQ ID NO: 3).
  • a native human TCR ⁇ chain constant region an exemplary human TCR ⁇ chain constant region amino acid sequence is shown in SEQ ID NO: 1
  • natural mouse TCR ⁇ Chain constant region an exemplary mouse TCR ⁇ chain constant region amino acid sequence is shown in SEQ ID NO: 3
  • the first constant region is a modified TCR ⁇ chain constant region.
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region in which the amino acid at position 48, e.g., threonine T, is mutated to Cysteine C.
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region in which the amino acid at position 112, such as serine S, is changed to leucine relative to the wild-type mouse TCR ⁇ chain constant region.
  • the amino acid at position 112 such as serine S
  • the amino acid at position 114 such as methionine M
  • the amino acid at position 115 such as glycine G
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region, in which, relative to the wild-type mouse TCR ⁇ chain constant region, the amino acid at position 6, such as E, is replaced by D, and the amino acid at position 13 is replaced by D.
  • the K at position 1 was replaced by R, and amino acids 15-18 were deleted.
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region in which the amino acid at position 48, e.g., threonine T, is mutated to Cysteine C, the amino acid at position 112 such as serine S is changed to leucine L, the amino acid at position 114 such as methionine M is changed to isoleucine I, the amino acid at position 115 such as Glycine G is changed to glycine V.
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region, in which, relative to the wild-type mouse TCR ⁇ chain constant region, the amino acid at position 6, such as E, is replaced by D, and the amino acid at position 13 is replaced by D.
  • the K at position 1 is replaced by R, the amino acids 15-18 are deleted, the amino acid at position 48, such as threonine T, is mutated to cysteine C, and the amino acid at position 112, such as serine S, is changed to leucine
  • the amino acid at position 114, such as methionine M is changed to isoleucine I
  • the amino acid at position 115 such as glycine G, is changed to lycine V.
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region that lacks the native intracellular region of the constant region relative to the wild-type mouse TCR ⁇ chain constant region, e.g., deletes 136- Amino acid at position 137.
  • the first constant region comprises the amino acid sequence set forth in one of SEQ ID Nos: 1, 3, 5, 7, 28, 29, 31 and 33.
  • the second constant region is a native TCR beta chain constant region, e.g., a native human TCR beta chain constant region (an exemplary human TCR beta chain constant region amino acid sequence is shown in SEQ ID NO: 2) or natural mouse TCR beta Chain constant region (an exemplary mouse TCR beta chain constant region amino acid sequence is shown in SEQ ID NO: 4).
  • a native human TCR beta chain constant region an exemplary human TCR beta chain constant region amino acid sequence is shown in SEQ ID NO: 2
  • natural mouse TCR beta Chain constant region an exemplary mouse TCR beta chain constant region amino acid sequence is shown in SEQ ID NO: 4
  • the second constant region is a modified TCR beta chain constant region.
  • the modified TCR beta chain constant region is derived from a mouse TCR beta chain constant region in which the amino acid at position 56, such as serine S, is mutated to cysteine relative to the wild-type mouse TCR beta chain constant region. Amino acid C.
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region, in which, relative to the wild-type mouse TCR ⁇ chain constant region, the amino acid at position 3, such as R, is replaced by K, and position 6
  • T is replaced by F
  • K at position 9 is replaced by E
  • S at position 11 is replaced by A
  • L at position 12 is replaced by V
  • amino acids at positions 17 and 21-25 are deleted.
  • the modified TCR beta chain constant region is derived from a mouse TCR beta chain constant region in which the amino acid at position 56, such as serine S, is mutated to cysteine relative to the wild-type mouse TCR beta chain constant region.
  • Amino acid C the amino acid at position 3 such as R is replaced by K
  • the amino acid at position 6 such as T is replaced by F
  • the K at position 9 is replaced by E
  • the S at position 11 is replaced by A
  • the L at position 12 is replaced by V substitution
  • amino acids 17 and 21-25 were deleted.
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region that lacks the native intracellular region of the constant region relative to the wild-type mouse TCR ⁇ chain constant region, e.g., deletes 167- Amino acid 172.
  • the second constant region comprises the amino acid sequence set forth in one of SEQ ID Nos: 2, 4, 6, 30, 32, and 34.
  • the modified TCR ⁇ chain constant region is derived from a mouse TCR ⁇ chain constant region in which the amino acid at position 48, such as threonine T, is mutated relative to the wild-type mouse TCR ⁇ chain constant region.
  • the amino acid at position 48 such as threonine T
  • the amino acid at position 112 such as serine S
  • the amino acid at position 114 such as methionine M
  • isoleucine I
  • amino acid at position 115 For example, glycine G is changed to salinine V
  • the modified TCR ⁇ chain constant region is derived from the mouse TCR ⁇ chain constant region, which has an amino acid at position 56, such as serine, relative to the wild-type mouse TCR ⁇ chain constant region. S is mutated to cysteine C.
  • the modified TCR ⁇ chain constant region includes the amino acid sequence shown in SEQ ID NO:28; the modified TCR ⁇ chain constant region includes the amino acid sequence shown in SEQ ID NO:6.
  • target binding region refers to a domain capable of binding, preferably specifically binding, to a target molecule.
  • the target is an antigen.
  • the target binding region is an "antigen binding region.”
  • the target binding region (preferably an antigen binding region) alone or in combination with another target binding region (preferably an antigen binding region) can specifically bind a target molecule (preferably a target antigen).
  • the first target binding region (first antigen binding region) and the second target binding region (second antigen binding region) each, independently or in combination, specifically bind a target antigen.
  • the antigen-binding region is derived from an antibody that specifically binds a target antigen.
  • the antigen-binding region can also be derived from a specific receptor, in which case the ligand of the receptor can serve as the antigen to be targeted.
  • the specific receptor may be a natural T cell receptor.
  • the antigen binding region comprises a variable region from a native T cell receptor.
  • the antigen-binding region may also be derived from a ligand, particularly where the antigen intended to be targeted is a receptor.
  • the target antigen is a disease-associated antigen, preferably a cancer-associated antigen, such as a cancer-associated antigen selected from: GPC3 (glypican 3), CD16, CD64, CD78, CD96, CLL1, CD116, CD117, CD71, CD45, CD71, CD123, CD138, ErbB2 (HER2/neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), EGFR mutation Body III (EGFRvIII), CD19, CD20, CD30, CD40, disialoganglioside GD2, ductal mucin, gp36, TAG-72, glycosphingolipid, glioma-associated antigen, ⁇ -human villi Membrane gonadotropin, alpha fetoglobulin (AFP), lectin-responsive AFP, thyroglobulin, RAGE-1, MN-CA IX, human
  • the target antigen is an antigen derived from a pathogen or a surface antigen of a cell infected by a pathogen, such as RSV F (prevention of respiratory syncytial virus), PA (inhalational anthrax), CD4 (HIV infection), etc.
  • RSV F prevention of respiratory syncytial virus
  • PA inhalational anthrax
  • CD4 HIV infection
  • the target antigen is some disease-causing cells or secreted molecules produced by cells, such as CD3 (involved in transplant rejection), CD25 (involved in acute renal transplant rejection), C5 (involved in paroxysmal nocturnal hemoglobin urea), IL-1 ⁇ (cryopyrin-related periodic syndrome), RANKL (involved in cancer-related bone damage), von Willebrand factor (involved in adult-acquired thrombotic platelet purpura), plasma kallikrein (involved in vascular edema), calcitonin gene-related peptide receptor (involved in migraine in adults), FGF23 (involved in X-linked hypophosphatemia), etc.
  • CD3 in transplant rejection
  • CD25 involved in acute renal transplant rejection
  • C5 in paroxysmal nocturnal hemoglobin urea
  • IL-1 ⁇ cryopyrin-related periodic syndrome
  • RANKL involved in cancer-
  • the antigen-binding region may be derived from one or more known antibodies, including any commercially available antibody, such as FMC63, rituximab, alemtuzumab, epratuzumab (epratuzumab), trastuzumab (trastuzumab), bivacizumab (bivatuzumab), cetuximab (cetuximab), labetuzumab (labetuzumab), palivizumab (palivizumab), Sevirumab, tuvirumab, basiliximab, daclizumab, infliximab, omalizumab, according to law efalizumab, Keliximab, siplizumab, natalizumab, clenoliximab, pemtumomab, Edrecolomab, Cantuzumab, etc.
  • FMC63 FMC63
  • the antigen-binding region comprises the heavy chain variable region set forth in SEQ ID NO: 10 and/or the light chain variable region set forth in SEQ ID NO: 11. In some specific embodiments, the antigen-binding region comprises the heavy chain variable region set forth in SEQ ID NO: 12 and/or the light chain variable region set forth in SEQ ID NO: 13.
  • the first antigen-binding region comprises a heavy chain variable region of an antibody that specifically binds a target antigen
  • the second antigen-binding region comprises a light chain variable region of the antibody
  • the first antigen-binding region includes the light chain variable region of an antibody that specifically binds a target antigen
  • the second antigen-binding region includes the heavy chain variable region of the antibody.
  • the first antigen binding region includes a single chain antibody (eg, scFv) or single domain antibody that specifically binds a target antigen; and/or the second antigen binding region includes a single chain antibody that specifically binds a target antigen.
  • a single chain antibody eg, scFv
  • the second antigen binding region includes a single chain antibody that specifically binds a target antigen.
  • the single chain antibody (e.g., scFv) comprises a heavy chain variable region and a light chain variable region connected by a linker, such as a (G4S)n linker, where n represents 1-10 an integer, preferably, n is 1 or 3.
  • a linker such as a (G4S)n linker, where n represents 1-10 an integer, preferably, n is 1 or 3.
  • the first antigen binding region and the second antigen binding region bind the same target antigen.
  • the first antigen binding region and the second antigen binding region bind to different regions of the same target antigen (eg, different epitopes).
  • the first antigen binding region and the second antigen binding region bind different target antigens.
  • the present invention provides a pharmaceutical composition comprising the modified immune cells of the present invention and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (eg by injection or infusion).
  • the invention provides the use of a modified immune cell of the invention or a pharmaceutical composition of the invention for the preparation of a medicament for treating a disease, such as cancer, in a subject.
  • Subject refers to an organism that suffers from or is susceptible to a disease (eg, cancer) treatable by the cells, methods, or pharmaceutical compositions of the invention.
  • a disease eg, cancer
  • Non-limiting examples include humans, cattle, rats, mice, dogs, monkeys, goats, sheep, cows, deer, and other non-mammals.
  • the subject is a human.
  • the invention provides a method of treating a disease, such as cancer, in a subject, comprising administering to the subject a therapeutically effective amount of a modified immune cell of the invention or a pharmaceutical composition of the invention.
  • a “therapeutically effective amount” or “therapeutically effective dose” or “effective amount” refers to an amount of a substance, compound, material or cell that is at least sufficient to produce a therapeutic effect when administered to a subject. Thus, it is an amount necessary to prevent, cure, ameliorate, block or partially block the symptoms of a disease or condition.
  • an "effective amount" of a cell or pharmaceutical composition of the invention preferably results in a reduction in the severity of disease symptoms, an increase in the frequency and duration of symptom-free periods of the disease, or the prevention of damage or disability resulting from the distress of the disease.
  • an "effective amount" of a cell or pharmaceutical composition of the invention preferably inhibits tumor cell growth or tumor growth by at least about 10%, preferably at least about 20%, more preferably at least about 20%, relative to an untreated subject. Preferably it is at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%.
  • the ability to inhibit tumor growth can be evaluated in animal model systems that predict efficacy against human tumors. Alternatively, it can also be evaluated by examining the ability to inhibit tumor cell growth, which inhibition can be determined in vitro by assays well known to those skilled in the art.
  • the dosage levels of the cells in the pharmaceutical compositions of the present invention may be varied to obtain an amount of active ingredient that is effective in achieving the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
  • the dosage level selected will depend on a variety of pharmacokinetic factors, including the activity of the particular composition of the invention to which it is administered, the route of administration, the time of administration, the rate of excretion of the particular compound to which it is administered, the duration of treatment, and the specific conditions for which it is administered.
  • other drugs, compounds and/or materials in combination with the composition the age, sex, weight, condition, general health and medical history of the patient being treated, and similar factors known in the medical field.
  • modified immune cells or pharmaceutical compositions or drugs according to the invention may be performed in any convenient manner, including by injection, infusion, implantation or transplantation.
  • Administration of cells or compositions described herein can be by intravenous, intralymphatic, intradermal, intratumoral, intramedullary, intramuscular, or intraperitoneal administration.
  • the cells or compositions of the invention are preferably administered by intravenous injection.
  • the disease is, for example, cancer, examples of which include, but are not limited to, lung cancer, ovarian cancer, colon cancer, rectal cancer, melanoma, kidney cancer, bladder cancer, breast cancer, liver cancer , lymphoma, hematological malignancies, head and neck cancer, glioma, gastric cancer, nasopharyngeal cancer, laryngeal cancer, cervical cancer, uterine corpus tumor, osteosarcoma, bone cancer, pancreatic cancer, skin cancer, prostate cancer, uterine cancer, anus Area cancer, testicular cancer, fallopian tube cancer, endometrial cancer, vaginal cancer, vulva cancer, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, Adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukin.
  • the treatment results in significant tumor shrinkage in a subject with cancer.
  • the tumor shrinks by at least about 10%, preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, and more Preferably at least about 80%.
  • the treatment prolongs (eg, significantly prolongs) the survival time of a subject with cancer.
  • survival time is prolonged by at least about 10%, preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, More preferably at least about 80%, more preferably at least about 90%, more preferably at least about 100%, more preferably at least about 150%, more preferably at least about 200%, more preferably at least about 300% or longer.
  • the disease is, for example, infection by a pathogen, examples of which include, but are not limited to, respiratory syncytial virus, Bacillus anthracis, human immunodeficiency virus, and the like.
  • the disease is, for example, cardiovascular, diabetic, neurological, anti-post-transplant rejection, or some other disease.
  • the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding an NF- ⁇ B family transcription factor as described herein and/or a nucleotide sequence encoding a target-specific receptor as described herein.
  • the invention provides an expression vector comprising i) a nucleotide sequence encoding a target-specific receptor as described herein and/or ii) encoding NF- ⁇ B as described herein operably linked to a regulatory sequence. Nucleotide sequences of family transcription factors.
  • the expression vector comprises i) a nucleotide sequence encoding the target-specific receptor and ii) a nucleotide sequence encoding the NF- ⁇ B family transcription factor operably linked to a regulatory sequence , and i) the nucleotide sequence encoding the target-specific receptor and ii) the nucleotide sequence encoding the NF- ⁇ B family transcription factor are connected through an internal ribosome entry site (IRES), thereby achieving the Co-expression of target-specific receptors and the NF- ⁇ B family of transcription factors.
  • IRS internal ribosome entry site
  • the target-specific receptor is a TCR, such as a modified TCR, preferably a STAR, and the nucleotide sequence encoding the NF- ⁇ B family transcription factor is in the same reading frame as i) encoding The nucleotide sequence of the alpha chain, ii) the nucleotide sequence encoding the beta chain and iii) the nucleotide sequence encoding a self-cleaving peptide located between i) and ii).
  • the nucleotide sequence encoding the alpha chain may be located at the 5' end or the 3' end of the nucleotide sequence encoding the beta chain.
  • Self-cleaving peptide as used herein means a peptide that can achieve self-cleavage within a cell.
  • the self-cleaving peptide may contain a protease recognition site, thereby being recognized and specifically cleaved by intracellular proteases.
  • the self-cleaving peptide may be a 2A polypeptide.
  • 2A polypeptides are short peptides from viruses whose self-cleavage occurs during translation. When 2A polypeptide is used to connect two different target proteins and expressed in the same reading frame, the two target proteins are generated at an almost 1:1 ratio.
  • 2A polypeptides can be P2A from porcine techovirus-1, T2A from Thosea asigna virus, and E2A from equine rhinitis A virus. and F2A from foot-and-mouth disease virus. Among them, P2A has the highest cutting efficiency and is therefore preferred.
  • a variety of functional variants of these 2A polypeptides are also known in the art and may be used in the present invention. Coexpression of alpha and beta chains can be achieved by using self-cleaving peptides.
  • the invention provides the use of the nucleic acid molecule or expression vector of the invention in preparing the modified immune cells of the invention.
  • the invention provides a method for preparing modified immune cells (such as the modified immune cells described above in the invention), comprising
  • the immune cells are selected from T cells, B cells or NK cells, preferably T cells.
  • the NF- ⁇ B family transcription factor is selected from P50, P105, P52, P100, P65, c-Rel and RelB, or any combination thereof.
  • the NF- ⁇ B family transcription factor is p52.
  • the method is performed by combining a nucleic acid molecule comprising a nucleotide sequence encoding the NF- ⁇ B family transcription factor or a nucleoside encoding the NF- ⁇ B family transcription factor operably linked to a regulatory sequence.
  • An expression vector of acidic sequences is introduced into the immune cells to overexpress the NF- ⁇ B family transcription factors.
  • the NF- ⁇ B family transcription factor is p52.
  • the nucleotide sequence encoding p52 is set forth in SEQ ID NO: 8.
  • the method further comprises c) converting a nucleic acid molecule comprising a nucleotide sequence encoding a target-specific receptor herein or comprising a nucleotide sequence encoding a target-specific receptor operably linked to a regulatory sequence
  • the expression vector is introduced into the immune cells.
  • the target-specific receptor is selected from the group consisting of chimeric antigen receptors (CARs) and T cell receptors (TCRs).
  • the target-specific receptor is a modified T-cell receptor (TCR), such as a Synthetic T-Cell Receptor and Antibody Receptor (STAR).
  • TCR T cell receptor
  • STAR Synthetic T-Cell Receptor and Antibody Receptor
  • the target-specific receptor is a target-specific receptor as defined above.
  • step b) is performed before step c). In some embodiments, step c) is performed after step b).
  • steps b) and c) are performed simultaneously.
  • expression of a nucleic acid molecule comprising i) a nucleotide sequence encoding the NF- ⁇ B family transcription factor, and ii) a nucleotide sequence encoding the target-specific receptor operably linked to a regulatory sequence can be The vector is introduced into the immune cells.
  • Nucleic acid molecules or expression vectors may be introduced into cells by any appropriate method, including electroporation; transfection using calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microparticle bombardment; lipofectamine transfection ; and infection (e.g., the expression construct is a virus).
  • the expression vector is a viral vector. In some more preferred embodiments, the expression vector is a lentiviral vector.
  • the step of providing isolated immune cells can be performed by methods known in the art for isolating immune cells.
  • immune cells such as T cells can be isolated from the peripheral blood of a subject using commercial kits. Suitable kits include, but are not limited to, EasySep human T cell enrichment kit (Stemcell Technologies).
  • kits include, but are not limited to, EasySep human T cell enrichment kit (Stemcell Technologies).
  • isolated immune cells, such as T cells are not necessarily homogeneous, but may be a mixed population of different cells, preferably in which the desired immune cells, such as T cells, are enriched.
  • Immune cells such as T cells, of the invention can be activated and expanded before or after any modification steps. Immune cells can be expanded in vitro or in vivo.
  • the method further includes the step
  • step d) is performed before and/or after step b). In some embodiments, step d) is performed before and/or after step c).
  • the present invention provides a method to improve the proliferation ability of immune cells such as T cells, improve the survival time of immune cells such as T cells, increase the number of immune cells such as T cells in the body, and induce immune cells such as T cells to effector immune cells such as effector cells.
  • the method includes:
  • the NF- ⁇ B family transcription factor is selected from P50, P105, P52, P100, P65, c-Rel and RelB, or any combination thereof.
  • the NF- ⁇ B family transcription factor is p52.
  • the method is performed by combining a nucleic acid molecule comprising a nucleotide sequence encoding the NF- ⁇ B family transcription factor or a nucleoside encoding the NF- ⁇ B family transcription factor operably linked to a regulatory sequence.
  • the expression vector of the acid sequence is introduced into the immune cells such as T cells to overexpress the NF- ⁇ B family transcription factors.
  • the NF- ⁇ B family transcription factor is p52.
  • the nucleotide sequence encoding said p52 is set forth in SEQ ID NO: 8.
  • the method further includes the step
  • T cells can be expanded, for example, by contact with an agent that stimulates the CD3TCR complex and costimulatory molecules on the surface of the T cell to generate a T cell activation signal.
  • an agent that stimulates the CD3TCR complex and costimulatory molecules on the surface of the T cell to generate a T cell activation signal.
  • chemicals such as calcium ionophore A23187, phorbol 12-myristate 13-acetate (PMA), or mitotic lectins such as phytohemagglutinin (PHA) can be used to generate activation signals for T cells .
  • T cells can be activated by contact with, for example, an anti-CD3 antibody or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface in vitro, or by contact with a protein kinase C activator (e.g., bryostatin ) is activated together with contact with calcium ionophores.
  • a protein kinase C activator e.g., bryostatin
  • T cells can be contacted with anti-CD3 antibodies and anti-CD28 antibodies under conditions suitable to stimulate T cell proliferation.
  • Conditions suitable for T cell culture include suitable media (e.g., Minimal Essential Media or RPMI Media 1640, or X-vivo 5, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN- ⁇ , IL-4, IL-7, GM-CSF, IL-10, IL-2, IL-15, TGF ⁇ and TNF, or additives for cell growth known to those skilled in the art.
  • Other additives for cell growth include, but are not limited to, surfactants, human plasma protein powder, and reducing agents such as N-acetyl-cysteine and 2-mercaptoacetic acid.
  • Media may include RPMI 1640, A1M-V, DMEM, MEM, a-MEM, F-12, X-Vivo 1 and X-Vivo 20, Optimizer, amino acids, sodium pyruvate and vitamins, serum-free or appropriately supplemented serum (or plasma) or a defined set of hormones, and/or an amount of cytokines sufficient to enable T cell growth and expansion.
  • T cells can be maintained under conditions necessary to support growth, such as appropriate temperature (eg, 37°C) and environment (eg, air plus 5% CO2 ).
  • the proliferation ability of the immune cells of the present invention is increased by at least about 10%, preferably at least about 20%, and more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, more preferably at least about 100 %, more preferably at least about 150%, more preferably at least about 200%, more preferably at least about 300% or more.
  • the survival time of the immune cells, such as T cells, of the present invention after reinfusion into the body is extended by at least about 10%, preferably at least about 20 %, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90% , more preferably at least about 100%, more preferably at least about 150%, more preferably at least about 200%, more preferably at least about 300% or more.
  • the number of immune cells, such as T cells, of the present invention is increased by at least about 10%, preferably at least about 20%, after reinfusion into the body. , more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, More preferably at least about 100%, more preferably at least about 150%, more preferably at least about 200%, more preferably at least about 300% or more.
  • the proportion of effector cells, such as effector T cells, in the immune cells, such as T cells, of the invention is increased by at least about 10%, preferably by at least about 20%. %, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90% , more preferably at least about 100%, more preferably at least about 150%, more preferably at least about 200%, more preferably at least about 300% or more.
  • inhibitory receptors in the immune cells of the invention is reduced by at least about 10%, preferably at least about 20%, compared to corresponding control immune cells, such as control T cells, which do not express the NF- ⁇ B family transcription factor. , more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%.
  • the proportion of CD8 + T cells in the immune cells of the present invention is increased by at least about 10%, preferably at least about 20%. , more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, More preferably at least about 100%, more preferably at least about 150%, more preferably at least about 200%, more preferably at least about 300% or more.
  • the target killing ability of the immune cells of the present invention is increased by at least about 10%, preferably at least about 20%, and more preferably at least About 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, more preferably at least about 100%, more preferably at least about 150%, more preferably at least about 200%, more preferably at least about 300% or more.
  • the present invention also provides a kit for preparing the modified immune cells of the present invention.
  • the kit of the present invention includes the nucleic acid molecule of the present invention and/or the expression vector of the present invention.
  • the kit may also include reagents for isolating, culturing and/or amplifying immune cells such as T cells, preparations for introducing nucleic acid molecules or expression vectors into cells, and the like.
  • the secreted antibody (Antibody, Ab) or B cell receptor (BCR) produced by B cells has great similarities with the T cell receptor (TCR) in gene structure, protein structure and spatial conformation.
  • Both antibodies and TCRs are composed of variable regions and constant regions.
  • the variable regions play a role in antigen recognition and binding, while the constant region domains play a role in structural interaction and signal transduction.
  • a synthetic chimeric molecule can be constructed by replacing the variable regions of TCR ⁇ and ⁇ chains (or TCR ⁇ and ⁇ chains) with the heavy chain variable region (VH) and light chain variable region (VL) of the antibody. , called Synthetic T-Cell Receptor and Antibody Receptor, STAR/WT-STAR), its structure is shown in WT-STAR on the left side of Figure 1.
  • the STAR molecule has two chains.
  • the first chain is the fusion of the antigen recognition sequence (such as the variable region VH of the heavy chain of the antibody) and the constant region (C ⁇ ) of the T cell receptor ⁇ chain (TCR ⁇ ).
  • the second chain is The chain is the fusion of the antigen recognition sequence (such as the variable region VL of the light chain of the antibody) and the constant region (C ⁇ ) of the T cell receptor ⁇ chain (TCR ⁇ ).
  • the antigen recognition domain such as VH, VL or scFv, etc.
  • the constant region domain the constant regions of TCR ⁇ , ⁇ , ⁇ and ⁇
  • the first and second chains of the STAR molecule After the first and second chains of the STAR molecule are expressed in T cells, they will combine with the endogenous CD3 ⁇ , CD3 ⁇ , and CD3 ⁇ chains in the endoplasmic reticulum to form an 8-subunit complex, which will be displayed in the form of a complex. on the cell membrane surface.
  • Immunoreceptor Tyrosine-based Activation Motif is a motif that plays a signal transduction role in TCR molecules, and its conserved sequence is YxxL/V.
  • the intracellular region of the CD3 ⁇ , ⁇ , ⁇ , and ⁇ chains contains 1 ITAM sequence, and the intracellular region of the CD3 ⁇ chain contains 3 ITAM sequences, so a complete STAR complex contains a total of 10 ITAM sequences.
  • the intracellular ITAM sequence When the antigen recognition sequence of the STAR receptor binds to its specific antigen, the intracellular ITAM sequence will be phosphorylated one after another, thereby activating downstream signaling pathways, activating transcription factors such as NF- ⁇ , NFAT and AP-1, and triggering T cell activation. , produce effect function.
  • the inventor's previous research showed that compared with conventional chimeric antigen receptor CAR, STAR can better activate T cells, and the background activation in the absence of antigen stimulation is significantly reduced, thus having significant advantages (see Chinese Invention Patent application number: 201810898720.2). However, further improvements to STAR are still expected.
  • the STAR prototype design uses the constant region sequence of the TCR ⁇ / ⁇ chain (or TCR ⁇ and ⁇ chain) of human origin (wild-type human TCR ⁇ constant region, SEQ ID NO:1; wild-type human TCR ⁇ constant region, SEQ ID NO:2 ). Due to the functional conservation of the constant region sequences of human, primate and mouse TCR ⁇ / ⁇ chains (wild-type mouse TCR ⁇ constant region, SEQ ID NO:3; wild-type mouse TCR ⁇ constant region, SEQ ID NO:4) They are highly homogeneous and have the same key amino acid sequences, so they can be replaced with each other.
  • the inventors replaced the constant region of the STAR molecule with a mouse sequence to enhance the function of the STAR molecule after being transferred into human T cells.
  • cysteine point mutations on the STAR molecule to introduce intermolecular disulfide bonds, enhance the mutual pairing between the two chains of the STAR molecule, and reduce the mismatch with the endogenous TCR.
  • the threonine T at position 48 is mutated to cysteine C (mouse TCR ⁇ C-Cys, SEQ ID NO: 5) in the constant region of the TCR ⁇ chain
  • the serine S at position 56 is mutated to cysteine in the constant region of the TCR ⁇ chain.
  • C (mouse TCR ⁇ C-Cys, SEQ ID NO: 6).
  • the inventors substituted hydrophobic amino acids in the transmembrane region of the STAR molecule to increase the stability of the STAR molecule and help it function more permanently. Specifically, three amino acid sites were mutated in the transmembrane region of the TCR ⁇ chain constant region from 111 to 119 amino acids: serine S at position 112 was changed to leucine L, and methionine M at position 114 was changed to hetero.
  • Leucine I and glycine G at position 115 become leucine V.
  • the overall amino acid sequence of this region changed from LSVMGLRIL to LLVIVLRIL.
  • This modification is called mouse TCR ⁇ C-TM9, and the resulting ⁇ chain constant region sequence is SEQ ID NO:7.
  • This design increases the hydrophobicity of the transmembrane region and offsets the instability caused by the positive charge carried by the TCR transmembrane region, allowing the STAR molecule to exist more stably on the cell membrane, thereby obtaining better functions. Its structure See Mut-STAR on the right side of Figure 1.
  • STARs that contain constant region murine sequences, constant region cysteine substitutions, and constant region hydrophobic amino acid substitutions are called mut-STARs.
  • Example 2 In vitro effects of STAR-T cells overexpressing the non-canonical NF- ⁇ B transcription factor p52
  • costimulatory factors 41BB, OX40, etc. from TNFR family receptors
  • overexpressing costimulatory factors can improve the proliferation ability of T cells.
  • the regulation within T cells is very complex, and the in vitro signals after overexpression of co-stimulatory factors may not be effectively transmitted to the nucleus after complex regulation in vivo, resulting in the weakening and reduction of the signals.
  • the present invention directly overexpresses the most important downstream transcription factors of the TNFR family to enhance the signals and functions provided by costimulatory factors. This can bypass the complex regulatory pathways in cells and directly act on the cell nucleus to enhance the proliferation and effector capabilities of T cells. .
  • STAR-T or CAR-T cells (1) improve T cell proliferation ability; (2) improve T cell effector survival time; (3) increase the number of T cells in the body; (4) induce T cells to Effector T cell differentiation; (5) Reduce the expression of T cell inhibitory receptors; (6) Increase the proportion of CD8+ T cells; (7) Significantly shrink the patient's tumor; (8) Prolong the survival time of tumor patients; (9) Improve The inventors further modified STAR-T or CAR-T cells for their tumor-killing ability and ability to infiltrate into the tumor microenvironment and kill target cells efficiently.
  • the non-classical NF- ⁇ B transcription factor refers to the non-full-length protein p52 encoded by the gene Nfkb2 (its coding sequence is SEQ ID NO: 8, and its amino acid sequence is SEQ ID NO: 9).
  • Nfkb2 its coding sequence is SEQ ID NO: 8
  • its amino acid sequence is SEQ ID NO: 9.
  • TNF receptor family members When specific TNF receptor family members are stimulated by ligands (including: LT ⁇ R, CD40, CD27, CD30, BAFF-R, etc.), these members inhibit the action of TFAF3 on NF- ⁇ B-inducing kinase (NIK) by recruiting TRAF2 and TRAF3. Phosphorylation, in turn, causes NIK to phosphorylate IKK ⁇ . The phosphorylated IKK ⁇ phosphorylates p100 and is further processed by the proteasome into p52, which forms a heterodimer with RelB and enters the nucleus, and induces the expression of downstream genes.
  • ligands including: LT ⁇ R, CD40, CD27, CD30, BAFF-R, etc.
  • the vectors used in this example including viral vectors, plasmid vectors, etc., were purchased from or synthesized by commercial companies, and the full-length sequences of these vectors were obtained, and clear enzyme cleavage sites were known.
  • the gene fragments used in this example such as the STAR variable region, TCR constant region, p52 coding sequence, tag sequence, and linker, were all synthesized from commercial companies and connected by PCR.
  • a mut-STAR containing the VH shown in SEQ ID NO:10 and the VL shown in SEQ ID NO:11 (derived from the EGFR-targeting cetuximab Cetuximab) and the corresponding CAR (BBz or 28z CAR ), or a mut-STAR containing the VH shown in SEQ ID NO:12 and the VL shown in SEQ ID NO:13 (derived from the CD19-targeting antibody FMC63) and the corresponding CAR (BBz or 28z CAR), verifying the overexpression of SEQ Optimization of STAR-T or CAR-T cells by p52 shown in ID NO:9.
  • Red fluorescent protein with the amino acid sequence shown in SEQ ID NO:14 was used to replace p52 as a control group.
  • the STAR vector structure is shown in Figure 2, in which the overexpression of p52 is initiated by using the ribosome entry site IRES to achieve co-expression of the two fragments mut-STAR and p52.
  • add a myc-tag (SEQ ID NO:15: GAGCAGAAACTCATCTCTGAAGAGGATCTG) to the N-terminus of mut-STAR, and use a 6 bp sequence (GGATCT) to connect the mut-STAR and myc-tag fragments.
  • the lentiviral vector used in the examples is pHAGE-EF1 ⁇ -IRES-RFP.
  • the linear vector is obtained through restriction endonuclease Not I/Nhe I.
  • the target gene fragment is obtained through synthesis and PCR methods, and the complete vector is obtained through homologous recombination. .
  • the lentiviral packaging, culture and transduction of T cells used to transduce T cells refer to the international patent publication WO 2021/135178A1.
  • the target cells A431 are adherent cells, and the primary T cells are suspension cells. When co-incubating, take the corresponding number of cells, mix them with the target cell culture medium, and then centrifuge them for culture. The specific steps are: use the packaged and purified mut-STAR and mut-STAR-p52 viruses to infect primary T cells, and use flow cytometry to sort out the infected cells for in vitro detection experiments before co-culture. Target cells and primary T cells were co-incubated at 1:2 or 2:1, and the killing of target cells by T cells was detected after 1 day of co-incubation.
  • lactate dehydrogenase LDH kit to detect cell killing ability. After the target cells die, they will release LDH in the body into the cell suspension. Take the co-incubated cell suspension and centrifuge it at 2500rpm/min to remove the precipitate. Take 50uL of the supernatant from each well and add 50uL of LDH detection reagent. After reacting for 15 minutes, add 50uL of stop reagent and use a microplate reader at a wavelength of 490. detection.
  • Target antigen stimulates T cells
  • the target antigen EGFR is a cell surface protein that can be directly used to activate T cells to detect the function of T cells. Usually, 1 ⁇ 10 5 /well of positive T cells is added, centrifuged, and the cell suspension or culture supernatant is collected after 24 hours of activation to detect T cell function, or the value-added ability and memory of T cells are detected after 2.5 days, 5 days, or 7.5 days of activation. T cell swarming and killing of target cells.
  • the results in Figure 4 and Table 2 show that overexpression of p52 can promote an increase in the proportion of CD8+ T cells.
  • the results in Figure 5 show that overexpression of p52 in STAR-T cells can improve the better proliferation ability of CD8+T cells.
  • the results in Figure 6 and Table 3 show that after 5 days of antigen protein stimulation, overexpression of p52 can make mut-STAR T cells differentiate more into effector T cells.
  • the results in Figure 7 show that after long-term antigen stimulation (7.5 days), overexpression of p52 can cause mut-STAR cells to proliferate in greater numbers.
  • the results in Figure 8 and Table 4 show that after long-term antigen stimulation of T cells (7.5 days), the killing effect of T cells on target cells was detected. It was found that STAR-p52 has significantly improved killing ability than STAR.
  • T cells During the activation process of T cells, a large number of cytokines are released to help T cells kill target cells or promote the expansion of T cells themselves. Common ones include IFN- ⁇ and IL-2. After T cells are stimulated with target cells or antigens, T cells are collected, centrifuged, and the supernatant is taken. The amounts of TNF- ⁇ , IFN- ⁇ , and IL-2 were determined by ELISA using kits according to the manufacturer's instructions. TNF- ⁇ , IFN- ⁇ , IL-2 ELISA kits use Human IL-2 Uncoated ELISA, Human TNF- ⁇ Uncoated ELISA, and Human IFN- ⁇ Uncoated ELISA (product numbers are 88-7025, 88-7346, 88-7316 respectively ).
  • the ELISA results in Figure 9 show that overexpression of p52 can increase the secretion of IFN- ⁇ and IL2 by mut-STAR T cells and enhance the effector function of T cells.
  • Example 3 In vivo effects of STAR-T cells overexpressing the non-canonical NF- ⁇ B transcription factor p52
  • Raji cells human Burkitt’s lymphoma cell line Raji cells were used to xenograft NSG immunodeficient mice.
  • Raji cells are cell lines that express luciferase genes through lentiviral vectors.
  • the development and changes of Raji tumors can be monitored in real time in mice through luciferin chemiluminescence and in vivo imaging.
  • the specific experimental design is shown in Figure 10.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne le domaine de la biomédecine, et concerne en particulier une cellule immunitaire modifiée. En particulier, la présente invention concerne une cellule immunitaire modifiée qui surexprime des facteurs de transcription de la famille des facteurs nucléaires κB (NF-κB), et l'utilisation de cette cellule immunitaire modifiée.
PCT/CN2022/104785 2022-07-10 2022-07-10 Cellule immunitaire modifiée WO2024011335A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2022/104785 WO2024011335A1 (fr) 2022-07-10 2022-07-10 Cellule immunitaire modifiée

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2022/104785 WO2024011335A1 (fr) 2022-07-10 2022-07-10 Cellule immunitaire modifiée

Publications (1)

Publication Number Publication Date
WO2024011335A1 true WO2024011335A1 (fr) 2024-01-18

Family

ID=89535100

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/104785 WO2024011335A1 (fr) 2022-07-10 2022-07-10 Cellule immunitaire modifiée

Country Status (1)

Country Link
WO (1) WO2024011335A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102018211201B3 (de) * 2018-07-06 2018-12-27 Zetec Gmbh & Co. Kg Sensor-Effektor Zellen zur Verwendung in der Therapie
CN112040987A (zh) * 2018-03-15 2020-12-04 Ksq治疗公司 用于改进的免疫疗法的基因调控组合物和方法
WO2021223707A1 (fr) * 2020-05-07 2021-11-11 华夏英泰（北京）生物技术有限公司 Chimère améliorée constituée d'un récepteur des lymphocytes t et de molécules co-stimulatrices

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112040987A (zh) * 2018-03-15 2020-12-04 Ksq治疗公司 用于改进的免疫疗法的基因调控组合物和方法
DE102018211201B3 (de) * 2018-07-06 2018-12-27 Zetec Gmbh & Co. Kg Sensor-Effektor Zellen zur Verwendung in der Therapie
WO2021223707A1 (fr) * 2020-05-07 2021-11-11 华夏英泰（北京）生物技术有限公司 Chimère améliorée constituée d'un récepteur des lymphocytes t et de molécules co-stimulatrices

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LEGARDA-ADDISON DIANA, TING ADRIAN T.: "Negative Regulation of TCR Signaling by NF-κB2/p100", THE JOURNAL OF IMMUNOLOGY, WILLIAMS & WILKINS CO., US, vol. 178, no. 12, 15 June 2007 (2007-06-15), US , pages 7767 - 7778, XP093127368, ISSN: 0022-1767, DOI: 10.4049/jimmunol.178.12.7767 *
LEGUT, M. ET AL.: "A Genome-scale Screen for Synthetic Drivers of T-cell Proliferation", NATURE, vol. 603, no. 7902, 31 March 2022 (2022-03-31), XP037768966, DOI: 10.1038/s41586-022-04494-7 *

Similar Documents

Publication Publication Date Title
US20220380461A1 (en) Transgene genetic tags and methods of use
EP3490585B1 (fr) Polypeptides immunomdulateurs et compositions et procédés associés
US11913024B2 (en) Methods for culturing cells and kits and apparatus for same
EP2884999B1 (fr) Procédé et compositions pour l'immunothérapie cellulaire
US20220025001A1 (en) Nucleic acid constructs for co-expression of chimeric antigen receptor and transcription factor, cells containing and therapeutic use thereof
JP2022169543A (ja) 改善された養子ｔ細胞療法
KR20210019993A (ko) Τ 세포 수용체 및 이를 발현하는 조작된 세포
CA3060526A1 (fr) Reactifs particulaires oligomeres et leurs methodes d'utilisation
CN108064252A (zh) 嵌合抗原受体及其使用方法
CN113423726A (zh) 为过继细胞治疗提供靶向共刺激的受体
US20200038443A1 (en) Multi-function and multi-targeting car system and methods for use thereof
JP2017537622A (ja) がんを治療するための方法及び組成物
CN111836827B (zh) 包含nkg2d结构域的多特异性嵌合受体和其使用方法
CA3001792A1 (fr) Recepteur
US20230295319A1 (en) Chimeric antigen receptors and uses thereof
JP2023529841A (ja) キメラ抗原受容体のための新規コンストラクト
WO2021030153A2 (fr) Récepteurs de lymphocytes t modifiés et leurs utilisations
EP3833682B1 (fr) Compositions et procédés de module suicide
AU2017347686A1 (en) Cell death inducing chimeric antigen receptors
JP2023535229A (ja) 改善されたｔ細胞受容体共刺激分子キメラ
US20210079111A1 (en) Cd19-cd20 bispecific and dual passway car-t and methods for use thereof
WO2020259541A1 (fr) Récepteur antigénique chimérique de lymphocyte t pour le traitement de tumeurs, son procédé de préparation et son utilisation
WO2023235440A2 (fr) Compositions et procédés comprenant des polypeptides adaptateurs chimériques
WO2024011335A1 (fr) Cellule immunitaire modifiée
CN111094328A (zh) 用于治疗癌症的方法和组合物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22950474

Country of ref document: EP

Kind code of ref document: A1