WO2023280294A1 - Composés cibles et de petites molécules pour le traitement de maladies neurodégénératives ou d'une lésion du système nerveux central - Google Patents

Composés cibles et de petites molécules pour le traitement de maladies neurodégénératives ou d'une lésion du système nerveux central Download PDF

Info

Publication number
WO2023280294A1
WO2023280294A1 PCT/CN2022/104546 CN2022104546W WO2023280294A1 WO 2023280294 A1 WO2023280294 A1 WO 2023280294A1 CN 2022104546 W CN2022104546 W CN 2022104546W WO 2023280294 A1 WO2023280294 A1 WO 2023280294A1
Authority
WO
WIPO (PCT)
Prior art keywords
ester
pharmaceutically acceptable
acceptable salt
alkoxy
alkyl
Prior art date
Application number
PCT/CN2022/104546
Other languages
English (en)
Chinese (zh)
Other versions
WO2023280294A9 (fr
Inventor
胡宝洋
刘京
滕兆乾
王昱凯
Original Assignee
北京干细胞与再生医学研究院
中国科学院动物研究所
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 北京干细胞与再生医学研究院, 中国科学院动物研究所 filed Critical 北京干细胞与再生医学研究院
Publication of WO2023280294A1 publication Critical patent/WO2023280294A1/fr
Publication of WO2023280294A9 publication Critical patent/WO2023280294A9/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/166—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the carbon of a carboxamide group directly attached to the aromatic ring, e.g. procainamide, procarbazine, metoclopramide, labetalol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention relates to the field of disease treatment. Specifically, the present invention provides specific genes related to neurodegenerative diseases or central nervous system damage, which can be used to prevent or treat neurodegenerative diseases or central nervous system damage or improve neurodegenerative diseases or central nervous system damage. A therapeutic target for one or more symptoms or pathological manifestations of systemic damage, and a marker for assessing efficacy.
  • the present invention also provides small molecular compounds targeting the above therapeutic targets, and one or more of these small molecular compounds for preventing or treating neurodegenerative diseases or central nervous system damage or improving neurodegenerative diseases or central nervous system damage Use for multiple symptoms or pathological manifestations.
  • Neurodegenerative diseases can often be characterized by a slowly progressive loss of neurons in the central nervous system, which often leads to deficits in specific brain functions (eg, memory, movement, cognition) performed by the affected central nervous system area.
  • These neurodegenerative diseases include, for example, Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), multiple sclerosis, Huntington's disease, and multiple system atrophy disease.
  • Neurodegenerative diseases typically extend over a decade, and the actual onset of neurodegeneration may precede clinical manifestations by many years.
  • Traumatic brain injury (TBI) may also lead to neurodegeneration. TBI usually originates from a primary injury, which is directly related to the external shock to the brain, and then gradually develops into a secondary injury. Secondary pathogenesis includes molecular, chemical, and inflammatory cascades involving the release of excitatory neurotransmitters that can lead to temporary or permanent neurologic deficits.
  • AD Alzheimer's disease
  • senile dementia the most common neurodegenerative disease, also known as senile dementia. It causes progressive damage and death of nerve cells in the brain, resulting in a decline in cognitive and other brain functions. Its incidence increases rapidly with age. Patients will first have memory deficits. As symptoms worsen, they gradually lose their ability to take care of themselves, which brings heavy pressure to themselves and their families. As the average life expectancy increases and the degree of social aging increases, the social burden caused by AD may become more serious.
  • AD has been extensively studied by researchers around the world, the mechanisms behind AD have not been fully elucidated. Developing AD drugs has been a serious challenge for researchers all over the world. Between 1998 and 2017, 146 attempts to develop AD drugs failed, and only 4 drugs were successfully approved for the disease, with a success-to-failure ratio of 1:37. And the effect of those successful drugs is not satisfactory, they can only alleviate the symptoms but not cure the disease, and the drugs currently used to slow the progression of AD are not particularly effective.
  • neurodegenerative diseases such as Alzheimer's disease
  • central nervous system damage to break through neurodegenerative diseases (such as Alzheimer's disease) or the treatment dilemma of central nervous system injury.
  • the inventors of the present application discovered therapeutic targets for neurodegenerative diseases or central nervous system damage through in-depth research, and further obtained a class of small molecule compounds targeting the above targets, which can improve neurodegenerative diseases Cognitive dysfunction, ataxia, neuropathy, protein aggregate formation and other symptoms caused by (such as Alzheimer's disease) and improve symptoms such as motor, cognitive and/or sensory impairment caused by central nervous system damage, Accordingly, the following inventions are provided.
  • the present invention provides a method for preventing and/or treating a neurodegenerative disease or central nervous system injury or improving at least one symptom or pathological manifestation of a neurodegenerative disease or central nervous system injury in a subject.
  • the method includes: administering to a subject in need an agent capable of regulating the expression of the Tmem119 gene or the activity of the product of the Tmem119 gene (herein, it may also be referred to as a Tmem119 expression/activity regulator for short).
  • the present invention also provides the use of a reagent capable of regulating the expression of the Tmem119 gene or regulating the activity of the Tmem119 gene product in the preparation of a medicament for preventing and/or treating neurodegenerative diseases or the central nervous system in a subject Impair or improve at least one symptom or pathological manifestation of a neurodegenerative disease or central nervous system injury.
  • the at least one symptom or pathological manifestation of the neurodegenerative disease is selected from cognitive dysfunction, ataxia, neurodegeneration (e.g. neuronal death) and/or protein aggregate formation (e.g. , amyloid beta (A ⁇ ) deposition).
  • neurodegeneration e.g. neuronal death
  • protein aggregate formation e.g. , amyloid beta (A ⁇ ) deposition
  • the medicament is capable of improving at least one symptom or pathological manifestation of a neurodegenerative disease, such as improving cognitive function (eg, improving attention, learning, and/or memory deficits), improving motor function, reducing Neuropathy (eg, neuronal death) and/or reduced protein aggregates (eg, reduced deposition of amyloid beta (A ⁇ ) in the brain and/or tau-associated neurofibrillary tangles).
  • a neurodegenerative disease such as improving cognitive function (eg, improving attention, learning, and/or memory deficits), improving motor function, reducing Neuropathy (eg, neuronal death) and/or reduced protein aggregates (eg, reduced deposition of amyloid beta (A ⁇ ) in the brain and/or tau-associated neurofibrillary tangles).
  • the neurodegenerative disease is characterized by one or more of: cognitive dysfunction, ataxia, neurodegeneration (e.g., neuronal death), and/or protein aggregates Formation (eg, amyloid beta (A ⁇ ) deposition).
  • cognitive dysfunction e.g., cognitive dysfunction
  • ataxia e.g., neurodegeneration
  • neurodegeneration e.g., neuronal death
  • protein aggregates Formation e.g, amyloid beta (A ⁇ ) deposition
  • the neurodegeneration site of the neurodegenerative disease is found in the central nervous system. In certain embodiments, the site of neurodegeneration of the neurodegenerative disease is present in the peripheral nervous system. In certain embodiments, the neurodegeneration site of the neurodegenerative disease is present in both the peripheral nervous system and the central nervous system.
  • the neurodegenerative disease is selected from Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), multiple sclerosis, Huntington's disease Chorea, multiple system atrophy, Lewy's dementia, frontotemporal dementia, vascular dementia, post-traumatic neurodegenerative disease.
  • AD Alzheimer's disease
  • PD Parkinson's disease
  • ALS amyotrophic lateral sclerosis
  • Huntington's disease Chorea multiple system atrophy
  • Lewy's dementia frontotemporal dementia
  • vascular dementia post-traumatic neurodegenerative disease.
  • the at least one symptom or pathological sign of central nervous system injury is selected from motor, sensory and/or cognitive impairment.
  • the medicament is capable of ameliorating at least one symptom or pathological sign of central nervous system injury, such as motor, sensory and/or cognitive impairment.
  • the central nervous system injury is a traumatic central nervous system injury. In certain embodiments, the central nervous system injury is selected from traumatic brain injury, stroke, or spinal cord injury.
  • the at least one symptom or pathological manifestation of traumatic brain injury is selected from neuroinflammation (e.g., up-regulation of pro-inflammatory factors and/or down-regulation of anti-inflammatory factors), dizziness, headache, loss of consciousness, consciousness Confusion, cognitive impairment, ataxia, and/or neurodegeneration (eg, neuronal death).
  • neuroinflammation e.g., up-regulation of pro-inflammatory factors and/or down-regulation of anti-inflammatory factors
  • dizziness e.g., dizziness, headache, loss of consciousness, consciousness Confusion, cognitive impairment, ataxia
  • cognitive impairment e.g., ataxia
  • neurodegeneration e.g, neuronal death
  • the drug can improve at least one symptom or pathological manifestation of traumatic brain injury, such as inhibiting neuroinflammation (eg, inhibiting the expression of pro-inflammatory factors such as IL6, IL-1 ⁇ , TFN- ⁇ , promoting inhibition of Expression of inflammatory factors such as IL10, CD206, Arg1), improving dizziness, headache, loss of consciousness and/or confusion, improving cognitive function (such as improving attention, learning and/or memory function deficits), improving motor function and/or Reduce neuropathy (eg, neuronal death).
  • neuroinflammation eg, inhibiting the expression of pro-inflammatory factors such as IL6, IL-1 ⁇ , TFN- ⁇ , promoting inhibition of Expression of inflammatory factors such as IL10, CD206, Arg1
  • improving dizziness such as IL10, CD206, Arg1
  • cognitive function such as improving attention, learning and/or memory function deficits
  • improving motor function and/or Reduce neuropathy eg, neuronal death.
  • the traumatic brain injury is characterized by one or more of the following: neuroinflammation (e.g., up-regulation of pro-inflammatory factors and/or down-regulation of anti-inflammatory factors), dizziness, headache, consciousness Loss, confusion, cognitive dysfunction, ataxia, neurodegeneration (eg, neuronal death) and/or reduction of synapse-associated proteins (eg, PSD95 and/or Synaptophysin).
  • neuroinflammation e.g., up-regulation of pro-inflammatory factors and/or down-regulation of anti-inflammatory factors
  • dizziness e.g., headache, consciousness Loss, confusion, cognitive dysfunction, ataxia
  • neurodegeneration eg, neuronal death
  • reduction of synapse-associated proteins eg, PSD95 and/or Synaptophysin
  • the medicament is capable of improving at least one symptom or pathological manifestation of spinal cord injury, such as improving motor, sensory and/or sphincter dysfunction, dystonia occurring at the corresponding segment of the injury.
  • the subject is a mammal, such as a human.
  • the Tmem119 gene may be of human origin or from other species (for example, non-human mammals, fish, reptiles or birds, such as mice, rats, hamsters, guinea pigs, rabbits, dogs, cats, Homologous genes of horses, cattle, sheep, pigs, goats, primates, zebrafish, etc.). Methods for identifying homologous genes are known to those skilled in the art, for example, they can be identified by HomoloGene.
  • the homologous gene refers to an orthologous gene. Orthologous genes that have been duplicated as a concomitant event of speciation and continue to maintain the same function.
  • Tmem119 gene and the sequence of its protein product are known to those skilled in the art, for example, refer to NCBI accession number: Gene ID: 338773; Ensembl: ENSG00000183160.
  • gene expression refers to the process by which the information contained in a gene is converted into a gene product.
  • the gene product can be the direct transcription product of the gene (eg, mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, shRNA, RNAi, miRNA, or any other type of RNA) or a protein resulting from translation of the mRNA.
  • Gene products also include modified RNA and modified protein, RNA modification processes such as capping, polyadenylation, methylation and editing, protein modification processes such as methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation and glycosylation.
  • Regular expression of gene expression refers to changes in gene activity, and regulation of expression may include, but is not limited to, gene activation and gene repression.
  • the Tmem119 expression/activity modulator described herein is selected from polypeptides, proteins, nucleic acids, oligonucleotides, low molecular weight chemical compounds, or any combination thereof.
  • the Tmem119 expression/activity modulator described herein is an activator capable of activating or up-regulating the expression of the Tmem119 gene, and/or activating or enhancing the activity of the protein product of the Tmem119 gene.
  • the activator can exert its activating effect by any mechanism, such as by activating the expression of the gene at the RNA or protein level (e.g., enhancing the transcription of the gene, and/or, enhancing the mRNA product of the gene translation).
  • the Tmem119 expression/activity modulators described herein enhance the biological function of the Tmem119 gene by activating its expression level.
  • determination of expression levels can be performed at the nucleic acid level or protein level.
  • Methods of measuring expression at the nucleic acid level include, but are not limited to, Northern blot, PCR, RT-PCR, or real RT-PCR.
  • Methods for measuring expression at the protein level include, but are not limited to, Western blotting or polyacrylamide gel electrophoresis combined with protein staining techniques such as Coomassie brilliant blue or silver staining, mass spectrometry, ELISA, immunofluorescence, and the like.
  • the Tmem119 expression/activity regulator described herein is selected from the protein product of the Tmem119 gene or its active fragment, or the nucleic acid molecule encoding the protein product or its active fragment or the vector comprising the nucleic acid molecule (such as cloning vectors or expression vectors).
  • the term "vector” refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted.
  • the vector is called an expression vector.
  • a vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements it carries can be expressed in the host cell.
  • Vectors are well known to those skilled in the art, including but not limited to: plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC) ; Phage such as lambda phage or M13 phage and animal viruses.
  • artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC)
  • Phage such as lambda phage or M13 phage and animal viruses.
  • Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papillomaviruses, papillomaviruses, Polyoma vacuolar virus (eg SV40).
  • retroviruses including lentiviruses
  • adenoviruses such as herpes simplex virus
  • poxviruses such as herpes simplex virus
  • baculoviruses such as herpes simplex virus
  • baculoviruses such as herpes simplex virus
  • papillomaviruses papillomaviruses
  • papillomaviruses papillomaviruses
  • Polyoma vacuolar virus eg
  • the Tmem119 expression/activity modulators described herein include low molecular weight chemical compounds or small molecular compounds.
  • the expression “low molecular weight chemical compound” or “small molecular compound” refers to organic, non-proteinaceous compounds.
  • the molecular weight of the small molecule compound is no greater than 1500 Da.
  • the small molecular compound can combine and enhance the function of the above-mentioned gene or its expression product.
  • the low molecular weight chemical compound is selected from compounds represented by formula (I), pharmaceutically acceptable salts or esters, prodrugs, stereoisomers, hydrates, solvates, crystals forms, their metabolite forms, or any combination or mixture thereof:
  • Ring A is phenyl, pyridin- 2 -yl, pyridin-3-yl or pyridin-4-yl, each of which is substituted with R and R groups; in certain preferred embodiments, ring A is benzene base;
  • X is hydroxyl, C 1 -C 6 alkoxy or amino
  • R 1 is located at the ortho or para position (e.g. ortho position) of -C(O)X, and R 1 is selected from C 1 -C 6 alkyl (e.g. C 1 -C 4 alkyl, C 1 -C 2 alkyl ), C 1 -C 6 alkoxy (such as C 1 -C 4 alkoxy, C 1 -C 2 alkoxy), or -C (O) R 3 ; the alkyl or alkoxy is not Substituted or substituted by one or several (eg 1, 2 or 3) substituents selected from the group consisting of halogen (eg -F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1
  • C 1 -C 2 haloalkoxy C 1 -C 4 alkylthio (e.g. C 1 -C 2 alkylthio), C 1 -C 4 Alkylamino (eg C 1 -C 2 alkylamino);
  • R 3 is selected from C 1 -C 6 alkyl (such as C 1 -C 4 alkyl, C 1 -C 2 alkyl), C 1 -C 6 alkoxy (such as C 1 -C 4 alkoxy, C 1 -C 2 alkoxy), hydroxyl, amino or
  • the alkyl or alkoxy group is unsubstituted or substituted by one or several (for example 1, 2 or 3) substituents selected from the group consisting of: halogen (for example -F, -Cl, -Br or -I), Nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 Alkoxy (e.g.
  • C 1 -C 2 alkoxy C 1 -C 4 haloalkoxy (e.g. C 1 -C 2 haloalkoxy), C 1 -C 4 alkylthio (e.g. C 1 -C 2 Alkylthio), C 1 -C 4 alkylamino (such as C 1 -C 2 alkylamino);
  • Ring B is phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein each group is substituted by R a group, R b group and R c group; wherein,
  • R a is -Ar or -L-Ar
  • L is C 1 -C 6 alkylene (such as C 1 -C 4 alkylene, C 1 -C 2 alkylene), O, C(O), S, S(O), S(O) 2 ;
  • Ar is Ar 1 or Ar 2 -Ar 3 , wherein Ar 1 , Ar 2 , and Ar 3 are each independently selected from phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein Each group is unsubstituted or substituted by one or several (eg 1, 2 or 3) substituents selected from the group consisting of halogen (eg -F, -Cl, -Br or -I), nitro, amino, Hydroxy, mercapto, C 1 -C 4 alkyl (e.g. C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (e.g.
  • C 1 -C 2 haloalkyl C 1 -C 4 alkoxy (e.g. C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (e.g. C 1 -C 2 haloalkoxy), C 1 -C 4 alkylthio (e.g. C 1 -C 2 alkylthio) , C 1 -C 4 alkylamino (eg C 1 -C 2 alkylamino);
  • R b , R c are each independently selected from hydrogen, halogen (eg -F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 - C 2 alkyl), C 1 -C 4 haloalkyl (e.g. C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (e.g. C 1 -C 2 alkoxy), C 1 -C 4 haloalkyl Oxygen (e.g. C 1 -C 2 haloalkoxy), C 1 -C 4 alkylthio (e.g. C 1 -C 2 alkylthio), C 1 -C 4 alkylamino (e.g. C 1 -C 2 alk base amino);
  • halogen eg -F, -Cl, -Br or -I
  • R 2 is selected from hydrogen, halogen (eg -F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 6 alkyl (eg C 1 -C 4 alkyl, C 1 -C 2 alkyl), C 1 -C 6 haloalkyl (such as C 1 -C 4 haloalkyl, C 1 -C 2 haloalkyl), C 1 -C 6 alkoxy (such as C 1 -C 4 alkoxy group, C 1 -C 2 alkoxy), C 1 -C 6 haloalkoxy (such as C 1 -C 4 haloalkoxy, C 1 -C 2 haloalkoxy), C 1 -C 6 alkylthio ( For example C 1 -C 4 alkylthio, C 1 -C 2 alkylthio), C 1 -C 6 alkylamino (for example C 1 -C 4 alkylamin
  • the compound has a structure represented by formula (I), wherein R 1 is selected from C 1 -C 4 alkyl (such as C 1 -C 2 alkyl) or C 1 -C 4 alkane Oxygen (eg C 1 -C 2 alkoxy); said alkyl or alkoxy is unsubstituted or substituted by one or several (eg 1, 2 or 3) substituents selected from the group consisting of: halogen ( For example -F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkoxy), C 1 -C 4 alkoxy (e.g.
  • R 1 is selected from C 1 -C 4 alkyl (such as C 1 -C 2 alkyl) or C 1 -C 4 alkane Oxygen (e
  • C 1 -C 2 alkoxy C 1 -C 4 haloalkoxy (e.g. C 1 -C 2 haloalkoxy), C 1 -C 4 alkylthio (eg C 1 -C 2 alkylthio), C 1 -C 4 alkylamino (eg C 1 -C 2 alkylamino).
  • R 1 is selected from C 1 -C 4 alkyl (eg C 1 -C 2 alkyl) or C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy); said alkyl or Alkoxy is unsubstituted or substituted by one or several (eg 1, 2 or 3) substituents selected from the group consisting of halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 Alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy) , C 1 -C 4 haloalkoxy (eg C 1 -C 2 haloalkoxy).
  • halogen eg -F, -Cl, -Br or -I
  • C 1 -C 4 Alkyl e
  • R is selected from methyl, ethyl, n -propyl or isopropyl, n-butyl, sec-butyl or tert-butyl, wherein each group is unsubstituted or replaced by one or several (for example 1, 2 or 3) are substituted with substituents selected from the group consisting of halogen (eg -F, -Cl, -Br or -I).
  • halogen eg -F, -Cl, -Br or -I
  • the compound has the structure shown in Formula (Ia):
  • ring A, X, R 2 , and R 3 are as defined above, and in ring A, -C(O)R 3 is located at the ortho or para position (eg, ortho position) of -C(O)X.
  • the compound has a structure represented by formula (Ia), wherein R 3 is selected from C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 alkane Oxygen (such as C 1 -C 2 alkoxy), hydroxyl or amino; said alkyl or alkoxy is unsubstituted or replaced by one or several (such as 1, 2 or 3) substituents selected from the following Substitution: halogen (eg -F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 Haloalkyl (e.g.
  • R 3 is selected from C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 alkane Oxygen (such as C 1 -C 2 alkoxy), hydroxyl or amino; said alkyl or al
  • C 1 -C 2 haloalkyl C 1 -C 4 alkoxy (e.g. C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (e.g. C 1 -C 2 haloalkoxy group), C 1 -C 4 alkylthio (eg C 1 -C 2 alkylthio), C 1 -C 4 alkylamino (eg C 1 -C 2 alkylamino).
  • R 3 is selected from C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy), hydroxyl or amino;
  • the alkyl or alkoxy group is unsubstituted or substituted by one or more (for example 1, 2 or 3) substituents selected from the group consisting of halogen (for example -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (eg C 1 -C 2 haloalkoxy).
  • halogen for example -F, -Cl, -Br or -I
  • R is selected from methyl, ethyl, n-propyl or isopropyl, n-butyl, sec-butyl or tert-butyl, hydroxyl, or amino, wherein each aliphatic group is unsubstituted or Substituted by one or several (eg 1, 2 or 3) substituents selected from the group consisting of halogen (eg -F, -Cl, -Br or -I).
  • halogen eg -F, -Cl, -Br or -I
  • the compound has the structure shown in formula (Ib):
  • ring A, X, R 2 , ring B, R a , R b , R c are as defined above, and in ring A, -C(O)NH- is located at the ortho or para position of -C(O)X (e.g. ortho).
  • the compound has the structure shown in formula (Ib), wherein, in ring B, R a is -Ar 1 or -L-Ar 1 , and Ar 1 is selected from phenyl, pyridine-2- Base, pyridin-3-yl or pyridin-4-yl, wherein each of said groups is unsubstituted or substituted by one or more (for example 1, 2 or 3) substituents selected from the group consisting of: halogen (for example - F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkoxy), C 1 -C 4 alkoxy (e.g.
  • Ar 1 is unsubstituted or substituted with halogen (eg -F, -Cl, -Br or -I).
  • the compound has a structure represented by formula (Ib), wherein, in ring B, R a is -Ar 2 -Ar 3 or -L-Ar 2 -Ar 3 , Ar 2 and Ar 3 each independently selected from phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein each group is unsubstituted or replaced by one or several (for example 1, 2 or 3) Substitution with a substituent selected from: halogen (eg -F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl) , C 1 -C 4 haloalkyl (such as C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (such as C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy
  • Ar 2 and Ar 3 are each independently substituted or unsubstituted phenyl, which is substituted by one or several (for example 1, 2 or 3) substituents selected from the group consisting of halogen ( For example -F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl ( e.g. C 1 -C 2 haloalkoxy), C 1 -C 4 alkoxy (e.g. C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (e.g.
  • Ar2 and Ar3 are each independently unsubstituted or halogen (eg -F, -Cl, -Br or -I) substituted phenyl.
  • L is methylene, ethylene or an oxygen atom.
  • R a in the structure represented by formula (Ib), in ring B, R a is at the para-position or meta-position of -NH-. Preferably, R a is in the para position of -NH-.
  • R b and R c are each independently selected from hydrogen, halogen (such as -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (e.g. C 1 -C 2 haloalkoxy), C 1 -C 4 alkylthio (e.g.
  • halogen such as -F, -Cl, -Br or -I
  • C 1 -C 4 alkyl eg C 1 -C 2 alkyl
  • C 1 -C 4 haloalkyl eg C 1 -C 2 haloalkyl
  • C 1 -C 4 alkoxy eg C 1 -C 2 alk
  • R b , R c are each independently selected from hydrogen, methyl or ethyl.
  • R b and R c are the same.
  • both R b and R c are hydrogen or methyl.
  • X is hydroxyl, C 1 -C 4 alkoxy (such as C 1 -C 2 alkoxy ) or amino. In certain embodiments, X is hydroxy, methoxy, ethoxy, or amino.
  • R is selected from hydrogen , halogen (such as -F, -Cl, -Br or -I), Nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 Alkoxy (e.g. C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (e.g. C 1 -C 2 haloalkoxy), C 1 -C 4 alkylthio (e.g.
  • R2 is hydrogen, phenyl, pyridin- 2 -yl, pyridin-3-yl or pyridin-4-yl.
  • R2 is hydrogen or phenyl, such as hydrogen.
  • R 2 is selected from hydrogen, halogen (such as -F, -Cl , -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 6 alkyl (eg C 1 -C 4 alkyl, C 1 -C 2 alkyl), C 1 -C 6 haloalkyl (e.g. C 1 -C 4 haloalkyl, C 1 -C 2 haloalkyl), C 1 -C 6 alkoxy (e.g.
  • R is selected from hydrogen , halogen (eg -F, -Cl, -Br or -I), nitro, amino, hydroxyl, mercapto, C 1 -C 4 alkyl (eg C 1 -C 2 alkyl ), C 1 -C 4 haloalkyl (such as C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (such as C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy), C 1 -C 4 alkylthio (for example C 1 -C 2 alkylthio), C 1 -C 4 alkylamino (for example C 1 -C 2 alkylamino), Phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl.
  • R2 is hydrogen, phenyl, pyridin- 2
  • R 2 is hydrogen
  • R 2 in ring A, is at the para-position or meta-position of -C(O)X.
  • the compound has the structure of Formula (I),
  • Ring A is phenyl, pyridin- 2 -yl, pyridin-3-yl or pyridin-4-yl, each of which is substituted with R and R groups; in certain preferred embodiments, ring A is benzene base;
  • X is hydroxyl, C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy) or amino;
  • R 1 is located at the ortho or para position (e.g. ortho position) of -C(O)X, and R 1 is selected from C 1 -C 4 alkyl (e.g. C 1 -C 2 alkyl), C 1 -C 4 alkane Oxygen (such as C 1 -C 2 alkoxy), or -C(O)R 3 ; the alkyl or alkoxy is unsubstituted or selected by one or several (such as 1, 2 or 3) Substituents selected from the following substituents: halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (eg C 1 -C 2
  • R 3 is selected from C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy), hydroxyl, amino or
  • the alkyl or alkoxy group is unsubstituted or substituted by one or several (for example 1, 2 or 3) substituents selected from the group consisting of: halogen (for example -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy); wherein,
  • Ring B is phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein each group is substituted by R a group, R b group and R c group; wherein,
  • R a is -Ar or -L-Ar; preferably, in ring B, R a is located at the para-position or meta-position of -NH-, such as para-position;
  • L is C 1 -C 4 alkylene (such as methylene, ethylene), O, C(O), S, S(O), S(O) 2 ;
  • Ar is Ar 1 or Ar 2 -Ar 3 , wherein Ar 1 , Ar 2 , and Ar 3 are each independently selected from phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein Each group is unsubstituted or substituted by one or several (eg 1, 2 or 3) substituents selected from the group consisting of: halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 Alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy) , C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy); preferably, Ar 2 and Ar 3 are each independently substituted or unsubstituted phenyl;
  • R b , R c are each independently selected from hydrogen, halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (such as C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (such as C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy) Oxygen);
  • halogen eg -F, -Cl, -Br or -I
  • C 1 -C 4 alkyl eg C 1 -C 2 alkyl
  • C 1 -C 4 haloalkyl such as C 1 -C 2 haloalkyl
  • C 1 -C 4 alkoxy such as C 1 -C 2 alkoxy
  • R 2 is selected from hydrogen, halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkoxy), C 1 -C 4 alkoxy (e.g. C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (e.g.
  • R 2 is located at the para-position or meta-position of -C(O)X; preferably, when ring A is benzene
  • R 2 is selected from the above groups, when the ring A is pyridyl, R 2 is hydrogen.
  • the compound has the structure of Formula (Ia),
  • Ring A is phenyl, pyridin- 2 -yl, pyridin-3-yl or pyridin-4-yl, each of which is substituted by an R group; in certain preferred embodiments, ring A is phenyl;
  • X is hydroxyl, C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy) or amino;
  • -C(O)R 3 is located at the ortho or para position (eg ortho position) of -C(O)X, and R 3 is selected from C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy), hydroxyl, amino or
  • the alkyl or alkoxy group is unsubstituted or substituted by one or several (for example 1, 2 or 3) substituents selected from the group consisting of: halogen (for example -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy
  • Ring B is phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein each group is substituted by R a group, R b group and R c group; wherein,
  • R a is -Ar or -L-Ar; preferably, in ring B, R a is located at the para-position or meta-position of -NH-, such as para-position;
  • L is C 1 -C 4 alkylene (such as methylene, ethylene), O, C(O), S, S(O), S(O) 2 ;
  • Ar is Ar 1 or Ar 2 -Ar 3 , wherein Ar 1 , Ar 2 , and Ar 3 are each independently selected from phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein Each group is unsubstituted or substituted by one or several (eg 1, 2 or 3) substituents selected from the group consisting of: halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 Alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy) , C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy); preferably, Ar 2 and Ar 3 are each independently substituted or unsubstituted phenyl;
  • R b , R c are each independently selected from hydrogen, halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (such as C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (such as C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy) Oxygen);
  • halogen eg -F, -Cl, -Br or -I
  • C 1 -C 4 alkyl eg C 1 -C 2 alkyl
  • C 1 -C 4 haloalkyl such as C 1 -C 2 haloalkyl
  • C 1 -C 4 alkoxy such as C 1 -C 2 alkoxy
  • R 2 is selected from hydrogen, halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkoxy), C 1 -C 4 alkoxy (e.g. C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (e.g.
  • R 2 is located at the para-position or meta-position of -C(O)X; preferably, when ring A is benzene
  • R 2 is selected from the above groups, when the ring A is pyridyl, R 2 is hydrogen.
  • the compound has the structure of Formula (Ib),
  • Ring A is phenyl, pyridin- 2 -yl, pyridin-3-yl or pyridin-4-yl, each of which is substituted by an R group; in certain preferred embodiments, ring A is phenyl;
  • X is hydroxyl, C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy) or amino;
  • -C(O)NH- is located in the ortho or para position (eg ortho) of -C(O)X;
  • Ring B is phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein each group is substituted by R a group, R b group and R c group; wherein,
  • R a is -Ar or -L-Ar; preferably, in ring B, R a is located at the para-position or meta-position of -NH-, such as para-position;
  • L is C 1 -C 4 alkylene (such as methylene, ethylene), O, C(O), S, S(O), S(O) 2 ;
  • Ar is Ar 1 or Ar 2 -Ar 3 , wherein Ar 1 , Ar 2 , and Ar 3 are each independently selected from phenyl, pyridin-2-yl, pyridin-3-yl or pyridin-4-yl, wherein Each group is unsubstituted or substituted by one or several (eg 1, 2 or 3) substituents selected from the group consisting of: halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 Alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (eg C 1 -C 2 alkoxy) , C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy); preferably, Ar 2 and Ar 3 are each independently substituted or unsubstituted phenyl;
  • R b , R c are each independently selected from hydrogen, halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (such as C 1 -C 2 haloalkyl), C 1 -C 4 alkoxy (such as C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (such as C 1 -C 2 haloalkoxy) Oxygen);
  • halogen eg -F, -Cl, -Br or -I
  • C 1 -C 4 alkyl eg C 1 -C 2 alkyl
  • C 1 -C 4 haloalkyl such as C 1 -C 2 haloalkyl
  • C 1 -C 4 alkoxy such as C 1 -C 2 alkoxy
  • R 2 is selected from hydrogen, halogen (eg -F, -Cl, -Br or -I), C 1 -C 4 alkyl (eg C 1 -C 2 alkyl), C 1 -C 4 haloalkyl (eg C 1 -C 2 haloalkoxy), C 1 -C 4 alkoxy (e.g. C 1 -C 2 alkoxy), C 1 -C 4 haloalkoxy (e.g.
  • R 2 is located at the para-position or meta-position (such as meta-position) of -C(O)X; preferably, When ring A is phenyl, R2 is selected from the above groups, and when ring A is pyridyl, R2 is hydrogen .
  • the compound has the structure of the above formula (Ib), in ring A -C(O)NH- is located in the ortho position of -C(O)X, in ring B R a is located in the position of -NH- Para-position; ring A is phenyl, ring B is phenyl, R a is -phenyl or -L-phenyl; other groups are as defined in the above embodiments.
  • the compound is selected from the compounds in Table 1:
  • the low molecular weight chemical compound is selected from 1-1 or a pharmaceutically acceptable salt or ester thereof, 1-2 or a pharmaceutically acceptable salt or ester thereof, 1-3 or a pharmaceutically acceptable salt or ester thereof, 1-3 or a pharmaceutically acceptable salt or ester thereof, Acceptable salt or ester, 1-4 or a pharmaceutically acceptable salt or ester thereof, 1-5 or a pharmaceutically acceptable salt or ester thereof, 1-6 or a pharmaceutically acceptable salt or ester thereof, 1 -7 or a pharmaceutically acceptable salt or ester thereof, 1-8 or a pharmaceutically acceptable salt or ester thereof, 1-9 or a pharmaceutically acceptable salt or ester thereof, 1-10 or a pharmaceutically acceptable salt thereof salt or ester thereof, 1-11 or a pharmaceutically acceptable salt or ester thereof, 1-12 or a pharmaceutically acceptable salt or ester thereof, 1-13 or a pharmaceutically acceptable salt or ester thereof, 1-14 or a pharmaceutically acceptable salt or ester thereof, 1-15 or a pharmaceutically acceptable salt or ester thereof, 1-16 or a
  • the low molecular weight chemical compound is selected from 1-4 or a pharmaceutically acceptable salt or ester thereof, 1-11 or a pharmaceutically acceptable salt or ester thereof, 1-15 or a pharmaceutically acceptable salt or ester thereof, 1-15 or a pharmaceutically acceptable salt or ester thereof, Acceptable salt or ester, 1-29 or a pharmaceutically acceptable salt or ester thereof, 1-31 or a pharmaceutically acceptable salt or ester thereof, 1-32 or a pharmaceutically acceptable salt or ester thereof, 1 -33 or a pharmaceutically acceptable salt or ester thereof, 1-34 or a pharmaceutically acceptable salt or ester thereof, 1-35 or a pharmaceutically acceptable salt or ester thereof, 1-36 or a pharmaceutically acceptable salt or ester thereof salt or ester thereof, 1-37 or a pharmaceutically acceptable salt or ester thereof, 1-38 or a pharmaceutically acceptable salt or ester thereof, 1-40 or a pharmaceutically acceptable salt or ester thereof, 1-41 or a pharmaceutically acceptable salt or ester thereof, 1-42 or a pharmaceutically acceptable salt or ester thereof, 1-41 or a
  • the low molecular weight chemical compound is selected from 1-2 or a pharmaceutically acceptable salt or ester thereof, 1-3 or a pharmaceutically acceptable salt or ester thereof, 1-4 or a pharmaceutically acceptable salt or ester thereof, 1-4 or a pharmaceutically acceptable salt or ester thereof, An acceptable salt or ester, 1-5 or a pharmaceutically acceptable salt or ester thereof, 1-40 or a pharmaceutically acceptable salt or ester thereof.
  • the low molecular weight chemical compound is selected from 1-40 or a pharmaceutically acceptable salt or ester thereof.
  • the Tmem119 expression/activity modulator described herein can be in any form known in the medical field, such as tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules elixirs, lozenges, suppositories, injections (including injections, freeze-dried powders), inhalants, sprays and other forms.
  • the preferred dosage form depends on the intended mode of administration and therapeutic use.
  • the Tmem119 expression/activity modulator described herein for example, the compound represented by formula (I), its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, Solvates, crystal forms, their metabolite forms, or any combination or mixture thereof
  • the pharmaceutical composition in unit dosage form for ease of administration.
  • Tmem119 expression/activity modulator described herein for example, the compound shown in formula (I), its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate, crystal form, Their metabolite forms, or any combination or mixture thereof
  • Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, elixirs and the like.
  • Liquid dosage forms may contain, in addition to the active compound, inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethanol, isopropanol, ethyl acetate, ethyl acetate, benzyl alcohol, benzyl benzoate Esters, propylene glycol, 1,3-butanediol, dimethylformamide, oils (such as cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil, and sesame oil), glycerin, tetrahydrofurfuryl alcohol, polyethylene glycol Fatty acid esters of diols and sorbitan and mixtures thereof.
  • inert diluents commonly used in the art, such
  • liquid dosage forms for oral administration can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and perfuming agents, and the like.
  • adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring and perfuming agents, and the like.
  • Solid dosage forms for oral administration include capsules, tablets, pills, lozenges, powders, granules and the like.
  • Solid dosage forms may contain, in addition to the active ingredient, pharmaceutically acceptable inert excipients or carriers, such as fillers (such as lactose, sucrose, glucose, mannitol, starch, microcrystalline cellulose, galactose, crospovidone and calcium sulfate); binders (such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia); wetting agents (such as cetyl alcohol and glyceryl monostearate); disintegrants (such as agar, calcium carbonate, starch, alginic acid, sodium carboxymethylcellulose, sodium starch glycolate); lubricants (such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, lauryl Sodium Hydroxyl Sulfate); and mixtures thereof.
  • pharmaceutically acceptable inert excipients or carriers such as fillers (such as lactose, sucrose, glucose, mannitol, star
  • Tmem119 expression/activity modulator described herein for example, the compound shown in formula (I), its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate, crystal form, Their metabolite forms, or any combination or mixture thereof
  • parenteral routes for example, the compound shown in formula (I), its pharmaceutically acceptable salt or ester, prodrug, stereoisomer, hydrate, solvate, crystal form, Their metabolite forms, or any combination or mixture thereof
  • parenteral administration eg, subcutaneous injection, intravenous injection, intraperitoneal injection, intramuscular injection, intrasternal injection and infusion.
  • the dosage forms for parenteral administration can be injection preparations, including injection solutions, sterile powders for injection, or concentrated solutions for injection.
  • the injection form can contain pharmaceutically acceptable carriers such as sterile water, Ringer's solution and isotonic sodium chloride solution, and appropriate additives such as antioxidants, buffers and antibacterial agent.
  • transdermally eg, via a transdermal patch or iontophoretic device
  • intraocularly e.g., intraocularly
  • intranasally or by inhalation e.g., transdermal patch or iontophoretic device
  • Dosage forms for transdermal administration can be topical gels, sprays, ointments and creams.
  • Topical dosage forms can contain, in addition to the active ingredient, ingredients which increase the absorption or penetration of the active compound through the skin or other area of action.
  • the administration will be accomplished using patches of depot and porous membrane type or solid matrix varieties.
  • the dosage form for topical ocular administration may be eye drops, wherein the Tmem119 expression/activity modulator is dissolved or suspended in a suitable carrier.
  • the Tmem119 expression/activity modulators described herein are conveniently delivered in the form of a solution or suspension from a pressurized spray container, by patient's grip or pump or delivered as an aerosol spray formulation from a pressurized container or nebulizer using a suitable propellant.
  • the dosage form for rectal administration may be a suppository.
  • compositions comprising the Tmem119 expression/activity modulator described herein can be prepared by any known pharmaceutical techniques, such as effective formulation and administration methods.
  • effective formulation and administration methods are well known in the art and are described in standard texts.
  • the formulation of pharmaceuticals is described, for example, in Hoover, John E., Remington's Pharmaceutical Sciences.
  • the therapeutic targets provided by the present invention can also be used to screen drugs for the prevention and/or treatment of neurodegenerative diseases or central nervous system damage.
  • the present invention relates to the screening of drug candidates for preventing and/or treating neurodegenerative diseases or central nervous system damage or improving at least one symptom or pathological manifestation of neurodegenerative diseases or central nervous system damage
  • the method comprises the step of screening a reagent capable of regulating the expression of Tmem119 gene or regulating the activity of Tmem119 gene product.
  • the screening step is performed in vitro.
  • the agent is an activator capable of activating or upregulating the expression of the gene, and/or activating or enhancing the activity of the protein product of the gene.
  • the screening step comprises:
  • step (2) comparing the measurement result of step (1) with the expression level of the gene measured in the absence of the test agent;
  • step (1) if the measurement result of step (1) is higher than the measurement result in the absence of the test agent, it indicates that the test agent is an activator of the gene and is used for preventing and/or treating neural A degenerative disease or central nervous system injury or a drug candidate that improves at least one symptom or pathological manifestation of a neurodegenerative disease or central nervous system injury.
  • the screening step comprises:
  • step (3) comparing the measurement result of step (2) with the expression level of the gene measured in the absence of the test agent;
  • test agent with the ability to enhance or activate the expression of the gene
  • the tested agent obtained by screening can be used to prevent and/or treat neurodegenerative diseases or central nervous system damage or improve at least one symptom or pathological manifestation of neurodegenerative diseases or central nervous system damage.
  • neurodegenerative disease As used herein, the terms “neurodegenerative disease”, “neurodegenerative disorder” and “neurodegenerative condition” are used interchangeably and refer to neurodegenerative Any disease, disorder and/or condition of neurons that are affected, such as neurons of the brain and/or neurons of the nervous system associated with degeneration or loss of nerve cells. Typically, neurodegenerative diseases result in progressive degeneration and/or death of nerve cells. In general, neurodegeneration is the progressive loss of structure or function of neurons, including neuronal death. Neurodegenerative diseases can cause problems with movement (called ataxia) or problems with mental or cognitive function (called dementia).
  • ataxia problems with movement
  • dementia problems with mental or cognitive function
  • neurodegenerative diseases include, for example, Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), multiple sclerosis, Huntington's disease, multisystem Atrophy, Lewy's dementia, frontotemporal dementia, vascular dementia, post-traumatic neurodegenerative disease.
  • AD Alzheimer's disease
  • PD Parkinson's disease
  • ALS amyotrophic lateral sclerosis
  • Huntington's disease multiple sclerosis
  • Huntington's disease multisystem Atrophy
  • Lewy's dementia frontotemporal dementia
  • vascular dementia post-traumatic neurodegenerative disease.
  • TBI traumatic brain injury
  • spinal cord injury refers to injury to any part of the spinal cord or to the nerves ending in the spinal canal (cauda equina), usually resulting in changes in strength, sensation, and other bodily functions below the site of injury, including various A variety of motor, sensory and sphincter dysfunction, abnormal muscle tone and corresponding changes in pathological reflexes.
  • cogntive dysfunction includes short-term or long-term deficits in various attention, learning and memory functions.
  • prevention refers to methods performed to prevent or delay the occurrence of a disease or disorder or symptom in a subject.
  • treatment refers to a method performed to obtain a beneficial or desired clinical result.
  • beneficial or desired clinical outcomes include, but are not limited to, relief of symptoms, reduction in extent of disease, stabilization (i.e., no longer worsening) of disease state, delay or slowing of disease progression, amelioration or palliation of disease status, and relief of symptoms (whether partial or total), whether detectable or not.
  • treating can also refer to prolonging survival as compared to expected survival if not receiving treatment.
  • improvement with respect to treatment means the improvement of at least one symptom relative to the same symptom in the absence of treatment.
  • the improvement is a decrease in the severity or frequency of symptoms or a delay in the onset or progression of symptoms in severity or frequency.
  • amelioration of these symptoms results in improved cognitive function (e.g., improved attention, learning and/or memory function deficits), improved motor function, decreased neurodegeneration (e.g., neuronal death) and/or protein aggregation A decrease in the number of neurofibrillary tangles (eg, reduced deposition of amyloid beta (A ⁇ ) in the brain and/or tau-associated neurofibrillary tangles).
  • the term "effective amount" refers to an amount sufficient to achieve, or at least partially achieve, the desired effect.
  • a disease-preventing effective amount refers to an amount sufficient to prevent, arrest, or delay the occurrence of a disease
  • a disease-treating effective amount refers to an amount sufficient to cure or at least partially prevent the disease and its complications in a patient already suffering from the disease. Determining such an effective amount is well within the capability of those skilled in the art. For example, amounts effective for therapeutic use will depend on the severity of the disease to be treated, the general state of the patient's own immune system, the general condition of the patient such as age, weight and sex, the mode of administration of the drug, and other treatments administered concomitantly etc.
  • the term "subject” refers to a mammal, such as a primate mammal, such as a human.
  • the subject eg, human
  • the term "pharmaceutically acceptable carrier or excipient” refers to a carrier and/or excipient that is pharmacologically and/or physiologically compatible with the subject and the active ingredient, which are well known in the art (see, e.g., Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and include, but are not limited to: disintegrants, binders, surfactants, glidants , lubricants, pH regulators, ionic strength enhancers, agents for maintaining osmotic pressure, agents for delaying absorption, diluents, antioxidants, coloring agents, flavoring agents, preservatives, taste masking agents, etc.
  • non-limiting examples of disintegrants include sodium starch glycolate, sodium carboxymethylcellulose, calcium carboxymethylcellulose, croscarmellose sodium, crospovidone, polyvinylpyrrolidone, formazan cellulose, microcrystalline cellulose, lower alkyl-substituted hydroxypropyl cellulose, starch, pregelatinized starch and sodium alginate.
  • Non-limiting examples of binders include microcrystalline cellulose, gelatin, sugars, polyethylene glycols, natural and synthetic gums, polyvinylpyrrolidone, pregelatinized starch, hydroxypropylcellulose, and hydroxypropylmethylcellulose white.
  • Non-limiting examples of diluents include lactose (monohydrate, spray-dried monohydrate, anhydrous, etc.), mannitol, xylitol, dextrose, sucrose, sorbitol, microcrystalline cellulose, starch, and phosphoric acid Calcium hydrogen dihydrate.
  • Non-limiting examples of surfactants include sodium lauryl sulfate and polysorbate 80.
  • Non-limiting examples of glidants include silicon dioxide and talc.
  • Non-limiting examples of lubricants include magnesium stearate, calcium stearate, zinc stearate, sodium stearyl fumarate, and mixtures of magnesium stearate and sodium lauryl sulfate.
  • Non-limiting examples of pH adjusting agents include, but are not phosphate buffers.
  • Ionic strength enhancers include, but are not limited to, sodium chloride.
  • Agents to maintain osmotic pressure include, but are not limited to, sugars, NaCl, and the like.
  • Agents that delay absorption include, but are not limited to, monostearates and gelatin.
  • Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as thimerosal, 2-phenoxyethanol, parabens, chlorobutanol, phenol, sorbic acid, and the like.
  • C 1 -C 4 alkyl refers to a group obtained by removing a hydrogen atom from a straight-chain or branched chain alkane containing 1-4 carbon atoms, including, for example, "C 1- C 2 alkyl", “C 1- C 3 alkyl”, “C 2- C 3 alkyl”, “C 2- C 4 alkyl”, “C 3- C 4 alkyl”, etc. Specific examples include but Not limited to: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl. In certain preferred embodiments, the C 1- C 4 alkyl is a C 1- C 2 alkyl, such as methyl or ethyl.
  • halogen includes fluorine, chlorine, bromine and iodine.
  • alkoxy refers to a group formed in the form of an alkyl-O-.
  • alkylamino refers to a group formed in the form of alkyl-NH-.
  • alkylthio refers to a group formed in the form of an alkyl-S-.
  • halo means substituted with a halogen atom selected from fluorine, chlorine, bromine or iodine atoms.
  • the halogen atom is a fluorine atom or a chlorine atom.
  • C 1- C 4 haloalkyl refers to one or more (such as 2, 3 or 4 ) halogen atoms replacing one or more (such as 2, 3 or 4) a group derived from hydrogen atoms, the halogen atom and C 1- C 4 alkyl are as defined above.
  • the C 1- C 4 haloalkyl is halomethyl or haloethyl.
  • the C 1 -C 4 haloalkyl is a fluoro C 1 -C 4 alkyl.
  • the fluorinated C 1 -C 4 alkyl refers to one or more (for example 2, 3 or 4) fluorine atoms replacing one or more (for example 2, 3) on the C 1- C 4 alkyl or 4) groups derived from hydrogen atoms.
  • the fluoro C 1- C 4 alkyl is a fluoro C 1- C 2 alkyl.
  • the halogenated C 1- C 4 alkyl is monohalogenated C 1- C 4 alkyl, dihalogenated C 1- C 4 alkyl or trihalogenated C 1- C 4 alkyl.
  • the "monohalogenated C 1- C 4 alkyl”, "dihalogenated C 1- C 4 alkyl” and “trihalogenated C 1 -C 4 alkyl” in the present invention refer to 1 and 2 Or a group derived from the substitution of 1, 2 or 3 hydrogen atoms on the "C 1- C 4 alkyl" by 3 "halogen atoms”.
  • substituted means that one or more hydrogen atoms on a group are replaced by one or more substituents, and the “multiple substituents" may be the same or different.
  • C 5 -C 6 aryl refers to an aromatic group containing 5-6 ring members, specific examples include but not limited to phenyl and the like.
  • C 5 -C 6 heteroaryl refers to an aryl group containing 5-6 ring members, and its ring structure contains heteroatoms selected from N, O, S and P , specific examples include but are not limited to furyl, thienyl, pyrrolyl, thiazolyl, isothiazolyl, thiadiazolyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, pyridyl, pyrimidinyl , pyridazinyl, pyrazinyl, etc.
  • ortho refers to the position of a substituent on a group comprising two or more carbon atoms, wherein the substituent is attached to an adjacent carbon atom.
  • salts refers to, (i) an acidic functional group (eg -COOH) present in the compound provided by the invention formed with a suitable inorganic or organic cation (base).
  • Salts include, but are not limited to, alkali metal salts, such as sodium salts, potassium salts, lithium salts, etc.; alkaline earth metal salts, such as calcium salts, magnesium salts, etc.; other metal salts, such as aluminum salts, iron salts, zinc salts, copper salts salt, nickel salt, cobalt salt, etc.; inorganic alkali salt, such as ammonium salt; organic alkali salt, such as tert-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt , ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine
  • salts formed by basic functional groups such as -NH 2 present in the compounds provided by the present invention and suitable inorganic or organic anions (acids), and include but not limited to, hydrohalide salts, such as hydrogen Fluorate, hydrochloride, hydrobromide, hydroiodide, etc.; inorganic acid salts, such as nitrate, perchlorate, sulfate, phosphate, etc.; lower alkanesulfonate, such as methanesulfonate , trifluoromethanesulfonate, ethanesulfonate, etc.; arylsulfonate, such as benzenesulfonate, p-benzenesulfonate, etc.; organic acid salts, such as acetate, malate, fumarate , succinate, citrate, tartrate, oxalate, maleate, etc.; amino acid salts, such as glycinate, trimethylg
  • ester refers to an ester of -COOH present in the compounds provided herein with an appropriate alcohol, or -OH present in the compounds provided herein
  • Esters with suitable acids such as carboxylic acids or oxygen-containing mineral acids.
  • suitable ester groups include, but are not limited to, formate, acetate, propionate, butyrate, acrylate, ethylsuccinate, stearate, or palmitate.
  • esters can be hydrolyzed to produce corresponding acids or alcohols.
  • solvate refers to a substance formed by association of a compound of the present invention with solvent molecules.
  • the solvent can be an organic solvent (such as methanol, ethanol, propanol, acetonitrile, etc.), for example, the compound of the present invention can form an alcoholate with ethanol.
  • the compounds of the present invention may also form hydrates with water.
  • the term "crystalline form" refers to the crystal structure of a substance.
  • the intramolecular or intermolecular bonding mode changes, resulting in different arrangements of molecules or atoms in the lattice space, forming different crystal structures.
  • the compounds of the present invention may exist in one crystal structure or in multiple crystal structures, ie, have "polymorphisms".
  • the compounds of the invention may exist in different crystalline forms.
  • stereoisomer includes conformational isomers and configurational isomers, wherein the configurational isomers mainly include cis-trans isomers and optical isomers.
  • the compounds of the present invention may exist in stereoisomeric forms and thus encompass all possible stereoisomeric forms, and any combination or any mixture thereof. For example a single enantiomer, a single diastereoisomer or a mixture of the above.
  • a compound of the present invention contains an olefinic double bond, unless otherwise specified, it includes cis-isomers and trans-isomers, and any combination thereof.
  • prodrug refers to a compound that can be converted into the present invention in a subject through reactions such as oxidation, reduction, hydrolysis, and the like. Prodrugs may or may not themselves have the biological activity of the compounds of formula (I) (eg, prevention and/or treatment of neurodegenerative diseases or central nervous system injuries).
  • compounds of formula (I) that include hydroxy or carboxyl groups can be administered in the form of esters, which are converted to hydroxy or carboxyl compounds by hydrolysis in vivo.
  • compounds of formula (I) including amino groups are acylated, alkylated or phosphorylated to form compounds such as eicosanoylamino, alanylamino, pivaloyloxymethylamino .
  • prodrugs can be found in Pro-drugs as Novel Delivery Systems, Vol. 14, ACS Symposium Series (T Higuchi and W Stella) and Bioreversible Carriers in Drug Design, Pergamon Press, 1987 (ed. E B Roche, American Pharmaceutical Association).
  • prodrugs according to the present invention include: (i) if the compound of formula (I) contains a carboxylic acid functional group (-COOH), including its esters, for example with (C 1 -C 8 ) alkyl instead of hydrogen; ( ii) if the compound of formula (I) contains an alcohol function (-OH), including its ether, for example with (C 1 -C 6 )alkanoyloxymethyl instead of hydrogen; and (iii) if the compound of formula (I) Containing a primary or secondary amino function ( -NH2 or -NHR, where R is other than H) includes its amides, for example with ( C1 - C10 )alkanoyl replacing one or two hydrogens. Furthermore, certain compounds of formula (I) may themselves act as prodrugs of other compounds of formula (I).
  • the inventors of the present application have creatively discovered therapeutic targets for neurodegenerative diseases or central nervous system damage, and further obtained a class of small molecule compounds targeting the above targets, which can significantly improve neurodegenerative diseases (such as Neuroinflammation, cognitive dysfunction, ataxia, neurodegeneration, protein aggregate formation and other symptoms caused by Alzheimer's disease) and improve motor, sensory and/or cognitive impairment caused by central nervous system damage, etc. Symptoms have great clinical value.
  • neurodegenerative diseases such as Neuroinflammation, cognitive dysfunction, ataxia, neurodegeneration, protein aggregate formation and other symptoms caused by Alzheimer's disease
  • Symptoms have great clinical value.
  • Figure 1 shows the results of ELISA detection of the phagocytosis of A ⁇ 40 and A ⁇ 42 by Tmem119 overexpressing cells.
  • Figure 2 shows the results of immunofluorescence detection of the phagocytosis of fluorescently labeled A ⁇ protein by Tmem119 overexpressed cells.
  • Figure 3 shows the results of Western blot analysis of LAMP1 expression in Tmem119 overexpressed cells.
  • Figure 4 shows the results of western blot detection of A ⁇ plaque content in Tmem119 overexpressed 5xFAD mice (5xFAD Tmem119OE ).
  • Figure 5 shows the results of immunofluorescent staining of A ⁇ plaque content in 5xFAD mice overexpressing Tmem119 (5xFAD Tmem119OE ).
  • Figure 6 shows the results of immunostaining, the results of immunofluorescence staining of plaques and phagocytosis-related gene CD68 in mice overexpressing Tmem119 5xFAD (5xFAD Tmem119OE ).
  • Fig. 7 shows the results of the water maze test in 5xFAD mice overexpressing Tmem119 (5xFAD Tmem119OE ).
  • Figure 8 shows the results of quantitative PCR and Western blot detection of small molecule compounds activating Tmem119 in vitro.
  • Figure 9 shows the results of immunofluorescence staining of the effects of small molecule compounds on the phagocytosis of microglia.
  • Figure 10 shows the results of fluorescent quantitative PCR and Western blot detection of small molecule compounds activating Tmem119 in mice.
  • Figure 11 shows the results of fluorescent quantitative PCR and Western blot detection of Tmem119 expression in the cortex and hippocampus of the mouse brain after administration of the small molecule compound.
  • FIG. 12 shows the results of the Y-maze test on 5FAD mice in Example 4.
  • FIG. 13 shows the results of the water maze test on 5FAD mice in Example 4.
  • FIG. 14 shows the results of the Barnes maze test of 5FAD mice in Example 4.
  • Figure 15 shows the Western blot detection results of the amyloid deposit content in 5FAD mice in Example 4.
  • FIG. 16 shows the results of ELISA detection of amyloid deposits in 5FAD mice in Example 4.
  • 17A-17B show the immunofluorescence staining photos and statistical results of the deposition of amyloid plaques in the cortex and hippocampus of 5FAD mice in Example 4.
  • FIG. 18 shows the results of Golgi staining of the spines in 5FAD mice in Example 4.
  • Figure 19 shows the immunofluorescent staining results of the number of nerve nuclei and apoptosis in 5FAD mice in Example 4.
  • FIG. 20 shows the results of the Y-maze test on 5FAD mice in Example 5.
  • Fig. 21 shows the results of the water maze test on 5FAD mice in Example 5.
  • Figure 22 shows the results of the Barnes maze test of 5FAD mice in Example 5.
  • Figure 24 shows the results of immunofluorescent staining of the deposition of amyloid plaques in 5FAD mice in Example 5.
  • Fig. 25 shows the results of the Y maze test on 3Tg mice in Example 6.
  • Fig. 26 shows the results of the water maze test on 3Tg mice in Example 6.
  • Figure 27 shows the results of the Barnes maze test in 3Tg mice in Example 6.
  • Figure 28 shows the evaluation of the effects of different compounds in Example 7 on Tmem119 gene.
  • Figure 29 shows the evaluation of the inhibitory activity of the small molecule compound in Example 8 on the early inflammatory response in the hippocampal traumatic brain injury model with puncture injury.
  • A qRT-PCR detection results.
  • B ELISA detection.
  • C Western Blot detection (the left side is a representative picture of protein gel electrophoresis, and the right side is a statistical picture of protein quantification).
  • ⁇ -actin was used as an internal reference. There were 3-4 mice in each group; the data in histograms are mean ⁇ standard deviation; *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
  • Fig. 30 shows the evaluation of the inhibitory activity of the small molecule compound in Example 9 on neuron apoptosis in the hippocampus traumatic brain injury model with puncture injury.
  • A Representative image of TUNEL (red) staining of hippocampal tissue on the third day after hippocampal puncture injury;
  • B Statistics on the number of apoptotic neurons in the dentate gyrus region of the hippocampus;
  • C Three days after hippocampal puncture injury, hippocampal tissue Representative images of FJC (red) staining of tissues;
  • D Statistics of the number of apoptotic neurons in the dentate gyrus of the hippocampus.
  • Figure 31 shows the evaluation of the protective activity of the small molecule compound in Example 10 on excessive reduction of synapse-associated proteins in the hippocampal traumatic brain injury model with puncture injury.
  • PSD95 green
  • Synaptophysin red
  • PSD95 and Synaptophysin fluorescence intensity statistics in the hippocampal dentate gyrus region
  • C Western blot detection Expression of Caspase3, PSD95 and Synaptophysin after hippocampal puncture injury.
  • GAPDH was used as an internal reference. 3-4 mice in each group; the scatter plot represents the mean ⁇ standard error; *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
  • Figure 32 shows the evaluation of the improvement activity of the small molecule compound in Example 11 on the ability of learning and memory in the hippocampal traumatic brain injury model with puncture injury.
  • A The time required to find the platform for the first time during the training phase of the water maze experiment.
  • B swimming speed during the testing phase of the water maze experiment.
  • C The time taken to first locate the platform area during the test phase of the water maze experiment.
  • D The number of times crossing the platform area during the testing phase of the water maze experiment.
  • E The time to first finding the hiding box during the training phase of the Barnes maze experiment.
  • F Movement distance during the test phase of the Barnes maze experiment.
  • G Time to first find the location of the hiding box during the test phase of the Barnes maze experiment.
  • H Number of times the hiding box area was traversed during the test phase of the Barnes maze experiment.
  • Figure 33 shows the effect of the small molecule compound in Example 12 on the expression of p-Smad3 and Tmem119 in the hippocampal traumatic brain injury model with puncture injury.
  • A Western blot detection of the expression of p-Smad2, p-Smad3, Smad4 and Tmem119. GAPDH was used as an internal reference.
  • B-C Representative images and statistics of p-Smad3 (green) immunofluorescent staining. 3-4 mice per group; histogram statistics are mean ⁇ SD; *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
  • Figure 34 shows the analysis of BMS scores in Example 13 within 8 days after spinal cord injury. Sham (sham operation group, no modeling), SCI+1-40 (drug treatment group, oral administration of drugs after modeling), SCI (control group, only modeling).
  • Fig. 35 shows the pathological examination 5 weeks after the spinal cord injury in Example 13.
  • GFAP represents astrocytes and 1-40 represents mice fed small molecule compounds 1-40.
  • Tmem119 gene can enhance the phagocytosis of A ⁇
  • mice BV2 mouse microglial cell line, HMO6 microglial cell line, CD511B overexpression vector, CD511B-U6 knockdown vector.
  • BV2 mouse microglia and HMO6 human microglia were seeded in 12-well plates containing DMEM/F12+10% FBS medium. Fresh medium was replaced every 24 hours. Experiments were performed when the cell binding density in the well was around 80%.
  • Target fragment amplification and recovery In order to construct the CD511B-Tmem119-OE overexpression plasmid, we first searched the Tmem119 gene sequence (ID: 231633) on NCBI, and designed primers. , Kozak sequence and target gene sequence, wherein forward sequence: 5'-ATGGTTTCGGCGGCAGCCCCC-3', reverse sequence: 5'-TTAGACACTGGGGTGGACACTGCTGCAA-3'. Target bands were amplified by PCR using cDNA as a template. Use the DNA Gel Recovery and Purification Kit of Tiangen Biological Company to recover the target fragment, and perform subsequent experiments after determining the concentration of the sample.
  • Enzyme digestion Restriction endonuclease digestion (SwaI and BamHI) was performed on the recovered fragment and the CD511B vector, and reacted at 37°C for 4h. DNA was purified and recovered using the DNA Gel Recovery and Purification Kit from Tiangen Biological Company.
  • Ligation Prepare 20 ⁇ l of the ligation system, and carry out the ligation reaction overnight at 16°C.
  • Transformation Add 10 ⁇ l of the ligation product to 500 ⁇ l DH5 ⁇ Escherichia coli competent, mix well, and place on ice for 30 minutes. Heat shock at 42°C for 90s, then quickly place the EP tube on ice for 2min. Then add 500 ⁇ l LB liquid medium without ampicillin, 37° C., 220 rpm, and shake for 45 minutes. After activation, the bacterial solution was centrifuged at 3000rpm for 3min, the supernatant was discarded, and the remaining 100 ⁇ l LB was blown to suspend the bacterial cells, and evenly spread on the ampicillin-resistant agar plate with a sterilized coating rod. Incubate at 37°C for 12-16 hours.
  • Identification of positive clones Pick a single clonal colony and shake it overnight, and extract the plasmid with the small extraction plasmid kit of Tiangen Biological Company. Take 1 ⁇ g of the plasmid for enzyme digestion (SwaI and BamHI), and perform agarose electrophoresis on the digested product to observe the size of the product band. The positive clone is the one that is consistent with the size of the positive control. The positive cloned plasmids were sent for sequencing, and the sequencing results were compared by NCBI-BLAST.
  • CD511B-U6-Tmem119-shRNA plasmid In order to construct the CD511B-U6-Tmem119-shRNA plasmid, first log on to the Invitrogen website to design primers, and select the two highest-scoring nucleotide sequences designed for the CDS region, which are: the first: Forward primer: 5'-CTAGGCACTCCTACTTAGAACAAAGTCAAGAGCTTTGTTCTAAGTAGGAGTGCTTTTTTT- 3'; reverse primer: 5'-AATTAAAAAGCACTCCTACTTAGAACAAAGCTCTTGACTTTGTTCTAAGTAGGAGTGC-3'.
  • Forward primer 5'-CTAGGCACTCCTACTTAGAACAAAGTCAAGAGCTTTGTTCTAAGTAGGAGTGCTTTTTTT- 3'
  • reverse primer 5'-AATTAAAAAGCACTCCTACTTAGAACAAAGCTCTTGACTTTGTTCTAAGTAGGAGTGC-3'.
  • the second line forward primer: 5'-CTAGGGAGTCAAATTTGTCCCAATGTCAAGAGCATTGGGACAAATTTGACTCTTTTT-3'; reverse primer: 5'-AATTAAAAAGGAGTCAAATTTGTCCCAATGCTCTTGACATTGGGACAAATTT GACTC--3'.
  • CTAG is the EcoRI restriction site
  • 3' end AATT is the XbaI restriction site
  • the middle part GCACTCCTACTTAGAACAAAG and GGAGTCAAATTTGTCCCAATG are the shRNA sequences designed by the website
  • TCAAGAG is the stem-loop structure
  • TTTTT is the transcription termination of RNA polymerase III son.
  • the primers were annealed, and the annealing system was 50 ⁇ l. Take 1L of water to boil and quickly pour it into a beaker. When the temperature drops to 95°C, put the annealing system into the beaker for annealing. After the water temperature is naturally cooled to room temperature, the annealing is completed.
  • Carrier digestion Restriction enzyme digestion (EcoRI and XbaI) was performed on the CD511B-U6 vector, and reacted at 37°C for 4h. DNA was purified and recovered using the DNA Gel Recovery and Purification Kit from Tiangen Biological Company.
  • Ligation Prepare 20 ⁇ l of the ligation system, and carry out the ligation reaction overnight at 16°C.
  • Transformation The steps are the same as the construction of the overexpression plasmid.
  • Identification of positive clones pick single clones, extract plasmids, and send them to the company for sequencing.
  • HEK-293T Resuscitate HEK-293T, and perform cell passage.
  • 293T cell density reaches 60%-70%, it can be transfected.
  • the complex was slowly added to 293T cells and placed in a 37°C incubator to continue culturing. After 6 h of transfection, the medium was replaced with fresh medium. The medium supernatants cultured for 48h and 72h were collected respectively, which were the virus supernatants.
  • the collected virus supernatant was centrifuged at 3000rpm for 15min to remove cell debris. Use a 0.22 ⁇ m filter to filter the virus supernatant into an ultracentrifuge tube, and centrifuge at 19,000 rpm at 4° C. for 2 hours to obtain concentrated virus precipitates. Discard the supernatant, place the centrifuge tube in a biological safety cabinet until it is completely dried, and add an appropriate amount of PBS to dissolve the virus precipitate. Take an appropriate amount of concentrated virus to infect the target cells, and generally observe the green fluorescent expression after 48 hours of infection to determine the infection efficiency. At the same time, cells can be collected for related experimental testing. The concentrated virus solution was divided into aliquots and stored in a -80°C refrigerator.
  • the concentrated virus solution was used to infect the cells on the culture plate, followed by flow sorting, and the GFP-positive cell candidates were sorted out by using the FITC light path.
  • BV2 microglial cells were infected with Tmem119-OE or Tmem119-shRNA and blank control for 72 hours, and then supplemented with serum-free DMEM containing 100 ng A ⁇ 1-42 (20276; Anaspec) or A ⁇ 1-40 (24236; Anaspec) 3 hours. Each group has 6 parallel holes. After 3 hours of incubation, conditioned medium was collected from triplicate wells and assessed for A ⁇ 1-42 or A ⁇ 1-40 using the Human A ⁇ 1-42 ELISA Kit (DAB142; R&D Systems) or the Human A ⁇ 1-42 ELISA Kit (DAB142; R&D Systems) Level.
  • DAB142 Human A ⁇ 1-42 ELISA Kit
  • DAB142 Human A ⁇ 1-42 ELISA Kit
  • the medium was replaced with serum-free DMEM and incubated for an additional 3 h to assess the degradation of A ⁇ .
  • Cells were taken and lysed in RIPA buffer added with protease inhibitor PMSF, and the level of A ⁇ 1-42 or A ⁇ 1-40 was determined.
  • Tmem119 can enhance the phagocytosis of A ⁇ by cells and promote the degradation of A ⁇ , thereby reducing A ⁇ deposition.
  • Tmem119 overexpression 5xFAD mice Tmem119 knockout 5xFAD mice.
  • C57/BL6 background mice were used as experimental materials.
  • Tmem119-OE mice customized by southern model organisms
  • Tmem119-KO mice customized by southern model organisms
  • 5xFAD mice (B6SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax,34840-JAX) mice
  • 5xFAD Tmem119-OE overexpression Tmem119-OE
  • 5xFAD Tmem119-KO knockout mice Tmem119-KO mice
  • rabbit polyclonal anti-Iba1 (1:1000; 019-19741; Wako)
  • rabbit polyclonal anti-Iba1 (1:1000; 019-19741; Wako)
  • goat rabbit polyclonal anti-Iba1 (1:500; ab5076; abcam)
  • rabbit monoclonal anti-Tmem119 (1:1000; ab209064; Abcam).
  • HRP-labeled goat anti-rabbit IgG (Prilite C1309), HRP-labeled donkey anti-goat IgG (Prilite C2212), Alexa Fluor 488Goat anti-Rabbit IgG (Thermo Fisher), Alexa Fluor 568Goat anti-Rabbit IgG (Thermo Fisher),Alexa Fluor 568Goat anti-Mouse IgG(Thermo Fisher),Alexa Fluor 568Donkey anti-Goat IgG(Thermo Fisher).
  • mice and Tmem119 gene knockout 5xFAD mice were 8 months old, the brains of the mice were perfused and sectioned, immunofluorescent staining, and antibodies were used to detect A ⁇ precipitation, microglial markers, and phagocytosis.
  • Tmem119 overexpression 5xFAD mice and Tmem119 gene knockout 5xFAD mice were 8 months old, the hippocampal tissues of the mice were taken, and the protein was extracted for Western Blot detection to see the pathological characteristics of the mice.
  • mice and Tmem119 knockout 5xFAD mice were 8 months old, the mice were tested for behavioral cognition and memory-related tests, including water maze, Barnes maze, and Y maze.
  • the water maze test is a classic experimental method widely used to test the spatial learning and memory ability of rodents.
  • the experiment is divided into two processes: acquisition training (Aquisition) and exploration (Probe).
  • each mouse was handled at a fixed time every day (preferably at the beginning of the experiment), in order to make the mice familiar with the experimenter and establish a "friendly" relationship. On the arm, lightly stroke and handle for about 3 minutes.
  • Acquisition training usually lasts for 5 days, and each mouse performs 4 trials in sequence every day, and the starting position of each trial is s, e, n, w, one of the four orientations.
  • the mouse Put the mouse's head into the water with its head facing the pool wall, and put it into the position as shown in the table above. Record the time(s) it takes for the animal to find the underwater platform.
  • the judgment principle for finding the platform is: the mouse stays on the platform for more than 3s, if it is less than 3s, it is not counted. After finding the platform, the mice were allowed to stay on the platform for 30 seconds. If the mouse stays on the platform for a while, such as 5s, and then leaves, then guide the mouse to the platform, and the cumulative stay time is 30s. If the mouse still did not find the platform after 60 s, the mouse was guided to the platform and allowed to stay on the platform for 30 s, and the time to find the platform was recorded as 60 s.
  • mice can be trained according to each trail before starting the next trail.
  • Probe On the second day after 5 consecutive days of acquired training, that is, at the same time on the 6th day, the platform was removed and a probe test lasted for 60 seconds was performed.
  • the Barnes maze is widely used to test the spatial learning and memory ability of rodents.
  • the experiment is divided into two processes: acquisition training (Aquisition) and exploration (Probe).
  • the Y maze device is composed of 3 black arms of equal length and a middle area, each arm is 120 degrees to each other, the arm length is 50cm, the width is 10cm, the height is 20cm, and the height of the bracket is 50cm.
  • the Supermaze software was used to collect images and analyze the data.
  • each rat was put into the same arm, ie, the starting arm, and voluntarily alternated continuously for 8 minutes, and the rate of voluntary alternation was detected. After each rat was finished, it was put back into the cage, and when the next experiment was performed, the odor in the Y maze arm was eliminated with 75% alcohol.
  • Alternation rate% number of times of alternation/(total number of times-2)%.
  • mice The behavioral results of the mice are shown in Figure 7.
  • the results of the water maze showed that the overexpressed Tmem119 5xFAD mice (5xFAD Tmem119OE ) were improved both in the training time, the time to reach the platform for the first time in the test, and the number of crossing the platform.
  • Gene knockout mice (5xFAD Tmem119-KO ) had the opposite result.
  • Example 3 Small molecule compounds can activate Tmem119 gene to enhance phagocytosis
  • the microglial cells of C57/B6P0 mice were isolated and cultured to obtain primary microglial cells. Then purify the primary microglia, the purification includes: when the cells grow to 10-14 days, observe the cells with a low-power microscope, and find that the cell density reaches 100%, and astrocytes are covered with a layer at the bottom of the dish , microglia grow on top of astrocytes, appearing as a translucent circle in the field of view. Place the culture dish on a horizontal shaker for shaking, draw the culture medium into a centrifuge tube and centrifuge, and observe the cell pellet at the bottom of the tube, which is the purified microglia. Discard the supernatant, resuspend the cells with fresh medium, and seed the cells onto PDL-coated 6-well plates or 24-well plate slides. After the cells adhered to the wall, they were directly used in subsequent experiments.
  • mice When C57/B6 mice were 2 months old, 100 ⁇ M 1-40 or 100 ⁇ M 1-29 were injected into the tail vein every 24 hours. After 1 week and 2 weeks, the mouse hippocampus tissue was collected, and the protein was extracted for Western Blot detection. , 3 mice per test.
  • Example 4 The use of small molecule drugs and small molecule compounds in the early onset of 5FAD Alzheimer model mice can improve their pathological phenotype and symptoms
  • mice 1-40 was made into rat food at a concentration of 20 mg/kg with 76-AIN as the base material, and 1-29 was made with 76-AIN as the base material at a concentration of 10 mg/kg.
  • 5FAD mice for 2 months When they were older, the feed was changed to 76-AIN feed containing small molecule drugs, and the control group ate 76-AIN feed without drugs.
  • the SPF environment is strictly guaranteed, the mice are free to eat, and the fresh mouse food is replaced in time to ensure that the drug will not fail due to normal temperature.
  • the results of Golgi staining of neurons in 5FAD mice are shown in Figure 18. After feeding the drug for 1-40 hours before the onset of the disease, the density of the hippocampal nerves in the 5FAD mice was improved compared with the control group. As shown in Figure 19, the results of immunofluorescent staining of neuronal nucleus apoptosis showed that the neuronal nucleus apoptosis of 5FAD mice was significantly reduced after feeding the drug for 1-40 hours before the onset of the disease. The above results indicated that administration of 1-40 before onset of disease could protect the nerves of 5FAD mice and reduce apoptosis.
  • Example 5 The use of small molecule drugs after the onset of 5FAD Alzheimer model mice can improve their pathological phenotype and symptoms
  • mice When the mice were 9 months old, the behavioral tests of Y maze, water maze and Barnes maze were carried out (more than 10 mice in each group, all male mice). After the behavioral experiment, the mice were taken for pathological examination (3-4 in each group).
  • Example 6 The use of small molecule drugs in 3Tg Alzheimer model mice can improve their pathological phenotype and symptoms
  • mice 1-40 was made into mouse food at a concentration of 20 mg/kg with 76-AIN as the base material, and 1-29 was made into mouse food at a concentration of 10 mg/kg with 76-AIN as the base material.
  • 3xTg mice for 2 months When they were older, the feed was changed to 76-AIN feed containing small molecule drugs, and the control group ate 76-AIN feed without drugs.
  • the SPF environment is strictly guaranteed, the mice are free to eat, and the fresh mouse food is replaced in time to ensure that the drug does not lose its efficacy at room temperature.
  • mice When the mice were 5 months old, the behavioral tests of Y maze, water maze and Barnes maze were carried out (more than 10 mice in each group, all of which were female mice).
  • Example 7 Evaluation of the effects of different small molecule compounds on the Tmem119 gene
  • BV2 microglia cells, small molecule compounds in Table 1 1-2 (Phthalic acid) were purchased from sellcek (S6215), 1-3 (Monomethyl phthalate) were purchased from MEC (HY-Y1097), 1 -4 (o-Toluic acid) was purchased from sellcek (S6217), 1-5 (88-97-1) was purchased from sigma (P867386), and 1-40 (Kartogenin) was purchased from MCE (HY-16268).
  • the above-mentioned small molecular compound was added to the BV2 cell culture medium at a concentration of 10 ⁇ M, and the mRNA expression of Tmem119 was detected after 6 hours.
  • Example 8 1-40 significantly inhibited the early inflammatory response of puncture-injured hippocampal tissue
  • mice purchased from Beijing Speifu Company
  • small molecule drugs 1-40 purchased from MCE
  • interleukin-6 IL-6
  • IL-1 ⁇ interleukin-1 ⁇
  • TNF ⁇ tumor necrosis factor
  • EK0527 white blood cells Interlein-10 (IL-10) ELISA kit
  • IL-10 brain stereotaxic instrument
  • the mouse model of brain trauma was established by hippocampal puncture injury method, and the specific experimental steps were as follows: fix the anesthetized mouse on the stereotaxic apparatus, cut the skin along the midline of the brain with sterilized scissors, wipe the mouse skull with a cotton swab, adjust For the left, right, front and back levels of the brain, take the midpoint of the line between Bregma and Lamda as the origin, and use a scalpel above the area between the front and rear (AP) 1.5 mm, and the left and right (ML) between 1 mm and 2.5 mm.
  • AP front and rear
  • ML left and right
  • the cranium was opened, and a bundle of 5 and 26G puncture needles with a spacing of 0.5mm was inserted vertically to 2.5mm below the cortex, and pulled out slowly after staying for 2 minutes. Use a cotton swab to remove blood from the wound, cover the skull, and suture the scalp.
  • the mice were placed in a constant temperature incubator at 37°C until the mice woke up and moved freely, and then they were put back into the breeding cage.
  • the hippocampal tissue was extracted with TROZOL, and 2 ⁇ g of RNA was reverse-transcribed into cDNA, and the mRNA expression of inflammatory factors was detected by qRT-PCR.
  • the qRT-PCR primers are listed in Table 2.
  • ELISA analysis was carried out according to the instructions of the detection kit of Boster Company, and the protein expressions of IL6, IL1 ⁇ , TNF ⁇ and IL10 were quantified respectively.
  • RT-PCR detection showed that on the third day after hippocampal puncture injury in C57BL/6 male mice, the expressions of pro-inflammatory factors IL6, IL-1 ⁇ and TFN- ⁇ were significantly increased, and the expressions of anti-inflammatory factors IL10, CD206 and Arg1 were decreased; Compared with the vehicle group (Veh), the expression of pro-inflammatory factors IL6, IL-1 ⁇ and TFN- ⁇ decreased significantly, while the expression of anti-inflammatory factors IL10, CD206 and Arg1 significantly decreased after hippocampal injury mice were treated with 1-40 administration Reply (Fig. 29A).
  • the results of ELISA confirmed that the expression levels of pro-inflammatory factors IL-6, IL-1 ⁇ and TFN- ⁇ were significantly increased after hippocampal puncture injury, and the expressions of anti-inflammatory factors IL10, Arg1 and CD206 were significantly decreased. Compared with the control group, the expression levels of pro-inflammatory factors IL-6, IL-1 ⁇ and TFN- ⁇ were significantly decreased, while the expression of anti-inflammatory factor IL10 was significantly restored ( FIG. 29B ).
  • Example 9 1-40 effectively reduces neuronal apoptosis in the hippocampus after puncture injury
  • mice purchased from Beijing SPEF Company
  • small molecule drug 1-40 purchased from MCE
  • Rabbit anti-NeuN (Millipore, MAB360)
  • one-step TUNEL cell apoptosis detection kit ( Biyuntian, C1090)
  • brain stereotaxic apparatus (KOPF, Model 940).
  • the TUNEL method for detecting cell apoptosis was operated according to the instructions of Biyuntian One-Step TUNEL Cell Apoptosis Detection Kit. Neuronal degeneration was detected by Fluoro-Jade C (FJC) staining. The patched brain slices were dried at 56°C and eluted with alcohol gradients. FJC staining was performed at room temperature in the dark, and the brain slices were washed with ddH2O and dried. Mount the slides with fluorescence quenched mounting medium.
  • FJC Fluoro-Jade C
  • Example 10 1-40 effectively protects hippocampal tissue from excessive reduction of synapse-related proteins after puncture injury
  • mice purchased from Beijing SPEF Company
  • small molecule drug 1-40 purchased from MCE
  • Mouse anti-Synaptophysin Abcam, ab32127
  • Rabbit anti-cleaved caspase3 CST, 9661s
  • Rabbit anti-PSD95 Abcam, ab18258
  • Mouse anti-GAPDH Beyotime, AF1186
  • brain stereotaxic apparatus KOPF, Model 940
  • mice were perfused with ice-cold PBS and 4% PFA, and the mouse brain was soaked in 4% PFA and fixed overnight, and then dehydrated with 30% sucrose. After frozen tissue sections, immunohistochemical staining analysis was carried out by suspension tissue staining method .
  • Example 11 1-40 significantly improves the learning and memory ability of brain trauma model mice
  • mice purchased from Beijing SPEF Company
  • small molecule drug 1-40 purchased from MCE
  • brain stereotaxic instrument KOPF, Model 940
  • water maze Barnes maze.
  • mice in the administration group were replaced with feed supplemented with 1-40 (concentration: 20 mg/kg) until the end of the experiment. After 21 days of administration, the mice were subjected to water maze and Barnes maze behavioral analysis.
  • the water maze is a circular water tank with a diameter of 120 cm filled with water. Add non-toxic white paint and mix well to make the water opaque. shaped platform (diameter 13 cm).
  • the mice were trained in the water maze for 5 consecutive days, 4 times a day, and the starting quadrant and order of each time were randomly determined by a computer. In each trial, the mouse was lowered close to the tank wall and allowed to search, find and stand on the platform for 20 s over a 60 s trial period.
  • the platform search (probe) test was carried out on the second day after the training: first remove the platform hidden under the water, record it with a video camera and use Smart 3.0 software to analyze the mouse's swimming track, speed, and cost in each quadrant in the water tank. Parameters such as the time of time, the time when the platform area was found for the first time, and the number of times the platform area was crossed.
  • the Barnes maze is a circular platform with a diameter of 122 cm, with 20 equally spaced holes (5 cm in diameter, 2 cm from the edge), only one hole has a removable hiding box directly below it.
  • the mice were acclimatized to the hiding box for 1 min. This was followed by 5 consecutive days of training, with 2 trials per day, each trial allowing mice to search for a hiding box within 5 minutes from the center point of the platform. After 5 min, mice that did not find the hiding box were gently guided to the hiding box. Two consecutive trials of the same mouse were separated by more than 30 min.
  • the spatial memory ability test was carried out on the second day after the training: the hiding box was removed first, and the camera was used to record and use Smart 3.0 software to analyze the mouse's movement-related parameters and the number of times it passed through the hiding box area within 5 minutes.
  • mice in each treatment group showed better and better spatial learning ability, that is, the time to find the hidden platform for the first time was shortened every day.
  • the time for the hippocampal puncture-injured mice to find the platform for the first time was significantly prolonged, and the administration of 1-40 could significantly shorten the time for the hippocampal puncture-injured mice to find the platform for the first time ( FIG. 32A ).
  • the test phase there was no difference in the swimming speed of the mice in each treatment group ( Figure 32B).
  • mice with hippocampal puncture injury were significantly longer than that of the Sham group and the number of crossing the platform within 1 min was significantly decreased. Shorten the time for brain-injured mice to find the platform for the first time and increase the number of times they cross the platform (Fig. 32C, D), suggesting that 1-40 treatments of mice after hippocampal puncture injury can significantly improve the learning and cognitive deficits of mice.
  • Example 12 1-40 can activate the expression of p-Smad3 and Tmem119
  • mice purchased from Beijing SPEF Company
  • small molecule drug 1-40 purchased from MCE
  • Mouse anti-GAPDH Beyotime, AF1186
  • Rabbit anti-phospho-Smad2 CST, 18338S
  • Rabbit anti-Smad2 CST, 100425-T08
  • Rabbit anti-phospho-Smad3 CST, 8828S
  • Rabbit anti-Smad4 CST, 38454S
  • Rabbit anti-Tmem119 Abcam, ab209064.
  • the feed of the mice in the administration group was replaced with feed supplemented with 1-40 (concentration: 20 mg/kg) until the end of the experiment.
  • the hippocampal tissues of some experimental mice were taken for Western blot analysis; the rest of the mice were perfused, and the brains of the mice were sliced for IHC analysis.
  • Example 13 Effect test of 1-40 in spinal cord injury model
  • Small molecule drug 1-40 (HY-16268, MCE); antibody Mouse anti-GFAP (Abcam, ab7260), Goat anti-Iba1 (Abcam, ab5076); 8-week-old C57BL6 male mice (purchased from )
  • Sham sham operation group, only incision and suture skin, no modeling
  • SCI+KGN drug treatment group, oral administration of drugs through rat food after modeling, the dose is about 10mg/kg rat food
  • SCI control group group, fed with normal rat chow after modeling
  • 6 rats in each group 18 rats in total.
  • mice were weighed. After anesthesia, the mice were placed prone and their limbs were fixed on the operating table. The operation area was prepared with hair, sterilized with 1% active iodine, and a sterile towel was spread;
  • the size of the mouse firing pin is 2.5*5mm, and the weight weighs 20g. It falls freely from the height of the 30cm cannula and hits the spinal cord. After successful modeling, the incision was sutured, and penicillin was sprinkled on the wound to prevent infection.
  • the BMS scoring table was established based on the observation of spinal cord injury rats after three stages of recovery, with a total of 21 points.
  • the three phases are: (1) early stage characterized by no or minimal hindlimb articulation; (2) middle stage including several episodes of ataxia gait; (3) late stage including fine motor movements such as toe and tail dragging, trunk instability, and alternating paw rotations .
  • the level of BMS score represents the recovery state of hindlimb motor function after spinal cord injury in rats. The higher the score, the better the recovery, and it is equivalent to normal animals when it reaches 9 points.
  • the score of 0-2 belongs to the early stage of recovery, the animal is unable to support its own weight, so that it drags its trunk, hind legs and buttocks; the score of 2-3 enters the middle stage of recovery, the animal can walk and support its own weight, and the front and rear limbs move in coordination Start to recover; 4-9 stage rats began to recover some fine motor.
  • mice were perfused with ice-cold PBS and 4% PFA, and the mouse brain was soaked in 4% PFA and fixed overnight, and then dehydrated with 30% sucrose. After frozen tissue sections, immunohistochemical staining analysis was carried out by suspension tissue staining method .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Psychiatry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un gène spécifique associé à des maladies neurodégénératives ou à une lésion du système nerveux central, ledit gène pouvant être utilisé en tant que cible thérapeutique pour la prévention ou le traitement de maladies neurodégénératives ou d'une lésion du système nerveux central, ou l'amélioration d'un ou plusieurs symptômes ou caractéristiques pathologiques de maladies neurodégénératives ou d'une lésion du système nerveux central, et utilisé en tant que marqueur pour évaluer l'efficacité. L'invention concerne en outre des composés à petites molécules pour la cible thérapeutique susmentionnée, et l'utilisation des composés à petites molécules pour prévenir ou traiter des maladies neurodégénératives ou une lésion du système nerveux central, ou améliorer un ou plusieurs symptômes ou caractéristiques pathologiques de maladies neurodégénératives ou d'une lésion du système nerveux central.
PCT/CN2022/104546 2021-07-08 2022-07-08 Composés cibles et de petites molécules pour le traitement de maladies neurodégénératives ou d'une lésion du système nerveux central WO2023280294A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202110773964 2021-07-08
CN202110773964.X 2021-07-08

Publications (2)

Publication Number Publication Date
WO2023280294A1 true WO2023280294A1 (fr) 2023-01-12
WO2023280294A9 WO2023280294A9 (fr) 2023-03-02

Family

ID=84800320

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/104546 WO2023280294A1 (fr) 2021-07-08 2022-07-08 Composés cibles et de petites molécules pour le traitement de maladies neurodégénératives ou d'une lésion du système nerveux central

Country Status (2)

Country Link
CN (1) CN115920040A (fr)
WO (1) WO2023280294A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018134815A2 (fr) * 2017-01-17 2018-07-26 Yeda Research And Development Co. Ltd. Procédés de traitement de maladies neurodégénératives par induction de cellules de microglie associées à une maladie (dam)
CN111279196A (zh) * 2017-09-21 2020-06-12 品牌科技股份公司 用于神经变性疾病和神经炎性疾病的诊断和预后的方法
WO2020168096A1 (fr) * 2019-02-13 2020-08-20 Yale University Méthodes de traitement de l'épilepsie

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018134815A2 (fr) * 2017-01-17 2018-07-26 Yeda Research And Development Co. Ltd. Procédés de traitement de maladies neurodégénératives par induction de cellules de microglie associées à une maladie (dam)
CN111279196A (zh) * 2017-09-21 2020-06-12 品牌科技股份公司 用于神经变性疾病和神经炎性疾病的诊断和预后的方法
WO2020168096A1 (fr) * 2019-02-13 2020-08-20 Yale University Méthodes de traitement de l'épilepsie

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JUN-ICHI SATOH, YOSHIHIRO KINO, NAOHIRO ASAHINA, MIKA TAKITANI, JUNKO MIYOSHI, TSUYOSHI ISHIDA, YUKO SAITO: "TMEM119 marks a subset of microglia in the human brain : Human microglial marker TMEM119", NEUROPATHOLOGY, JAPANESE SOCIET OF NEUROPATHOLOGY, KYOTO,, JP, vol. 36, no. 1, 1 February 2016 (2016-02-01), JP , pages 39 - 49, XP055453989, ISSN: 0919-6544, DOI: 10.1111/neup.12235 *
KAISER TOBIAS, FENG GUOPING: "Tmem119-EGFP and Tmem119-CreERT2 Transgenic Mice for Labeling and Manipulating Microglia", ENEURO, vol. 6, no. 4, 1 July 2019 (2019-07-01), pages ENEURO.0448 - 18.2019, XP093023085, ISSN: 2373-2822, DOI: 10.1523/ENEURO.0448-18.2019 *

Also Published As

Publication number Publication date
CN115920040A (zh) 2023-04-07
WO2023280294A9 (fr) 2023-03-02

Similar Documents

Publication Publication Date Title
JP6640275B2 (ja) グリシル−ｌ−２−メチルプロリル−ｌ−グルタミン酸を用いる自閉症スペクトラム障害の治療
JP6134824B2 (ja) テロメラーゼ活性化化合物及びその使用方法
EP3664789B1 (fr) Méthodes de traitement de maladies et de lésions des nerfs
AU2019338896B2 (en) Composition for treating fibrotic diseases, comprising benzhydryl thioacetamide compound as active ingredient
US20150224164A1 (en) Treatment of autism spectrum disorders using glycyl-l-2-methylprolyl-l-glumatic acid
US20220127226A1 (en) Anti-arrhythmicity agents
EP3024463A2 (fr) Composés bicycliques neuroprotecteurs et leurs méthodes d'utilisation dans le traitement des troubles du spectre autistique et des troubles neurodéveloppementaux
US20130266663A1 (en) Sox9 inhibitors
WO2023280294A1 (fr) Composés cibles et de petites molécules pour le traitement de maladies neurodégénératives ou d'une lésion du système nerveux central
JP2016185965A (ja) 滑脳症治療剤
US20220110953A1 (en) Methods and compositions for treating human papillomavirus (hpv)-induced cancers
AU2021250199B2 (en) Deuterated oxophenylarsine compound and use thereof
US20230104617A1 (en) Compound for treating alzheimers disease
US20210087214A1 (en) Therapeutic drug for neurodegenerative disease and application thereof
TW202120082A (zh) 鈣蛋白酶(calpain)抑制劑及其用於治療神經疾病之用途
US10035791B2 (en) Bicyclic compound and pharmaceutical composition thereof for treating stroke and use thereof
AU2013352294A1 (en) Treatment of Autism Spectrum Disorders using glycyl-l-2-methylprolyl-l-glutamic acid
US20230365544A1 (en) Small molecule inhibitors of calcium channel activity and uses thereof
JP2006063012A (ja) 抗ポリグルタミン病剤
CN117180410A (zh) UbV.E4B蛋白的医药用途、药物组合物
CN114617953A (zh) Sh2b衔接蛋白1的制药用途
JP2022012379A (ja) ユビキチン－プロテアソーム系の活性化剤、およびその利用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22837039

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE