WO2023274384A1 - 靶向b7h3的抗原结合多肽及其应用 - Google Patents

靶向b7h3的抗原结合多肽及其应用 Download PDF

Info

Publication number
WO2023274384A1
WO2023274384A1 PCT/CN2022/103070 CN2022103070W WO2023274384A1 WO 2023274384 A1 WO2023274384 A1 WO 2023274384A1 CN 2022103070 W CN2022103070 W CN 2022103070W WO 2023274384 A1 WO2023274384 A1 WO 2023274384A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
hla
cells
gene
immune effector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CN2022/103070
Other languages
English (en)
French (fr)
Chinese (zh)
Inventor
尚小云
蒋海娟
王丹
李甲璐
马少文
沈慧
马丽
陈伟杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ningbo T Maximum Biopharmaceuticals Co Ltd
Original Assignee
Ningbo T Maximum Biopharmaceuticals Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN202280004519.XA priority Critical patent/CN115916833B/zh
Priority to AU2022301099A priority patent/AU2022301099A1/en
Priority to JP2023580778A priority patent/JP2024527557A/ja
Priority to KR1020247003777A priority patent/KR20240027117A/ko
Priority to MX2023015153A priority patent/MX2023015153A/es
Priority to CA3224476A priority patent/CA3224476A1/en
Application filed by Ningbo T Maximum Biopharmaceuticals Co Ltd filed Critical Ningbo T Maximum Biopharmaceuticals Co Ltd
Priority to US18/575,650 priority patent/US12133890B2/en
Priority to EP22832196.4A priority patent/EP4365203A4/en
Publication of WO2023274384A1 publication Critical patent/WO2023274384A1/zh
Anticipated expiration legal-status Critical
Priority to ZA2024/01043A priority patent/ZA202401043B/en
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4224Molecules with a "CD" designation not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70517CD8
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2827Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/11Antigen recognition domain
    • A61K2239/13Antibody-based
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/50Cellular immunotherapy characterised by the use of allogeneic cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/53Hinge
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732Antibody-dependent cellular cytotoxicity [ADCC]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94Stability, e.g. half-life, pH, temperature or enzyme-resistance
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present application relates to the field of biomedicine, in particular to an antigen-binding polypeptide targeting B7H3 and its application.
  • Glioblastomas account for 15 percent of all brain tumors and can originate in ordinary brain cells or develop from low-grade astrocytomas. The usual survival period after diagnosis is 12 to 15 months, and only 3% to 7% of patients survive beyond five years. Survival is usually 3 months without treatment. Glioblastoma, which affects about 3 in every 100,000 people each year, is the most common cancer of brain origin and the second most common brain tumor after meningioma.
  • CAR-T cell technology is a cell-based therapy that has produced excellent results in tumor immunotherapy, especially in the treatment of blood tumors.
  • CAR-T immunotherapy uses genetically modified T cells that can specifically recognize and kill tumor cells expressing specific antigens without being restricted by MHC.
  • CAR-T immunotherapy has achieved good results in the treatment of various B cell malignancies, such as CAR-T cells targeting CD19 in the treatment of acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL) and non-Hodgkin's lymphoma ( NHL).
  • ALL acute lymphoblastic leukemia
  • CLL chronic lymphocytic leukemia
  • NHL non-Hodgkin's lymphoma
  • B7H3 also known as CD276, belongs to the B7 family of immunomodulatory proteins and is a type I membrane protein whose extracellular domain sequence is similar to other B7 family members.
  • the B7H3 gene is located on human chromosome 15, and the gene consists of ten exons, of which exons 4 to 7 encode the extracellular IgV-IgC domain.
  • B7H3 mRNA is expressed in a variety of normal tissues and some tumor cell lines, but it cannot be detected in peripheral blood mononuclear cells (PBMC), but can be expressed in dendrites by inflammatory cytokines (IFN ⁇ ) and the combination of PMA and ionomycin Induces B7H3 expression on cells and monocytes.
  • PBMC peripheral blood mononuclear cells
  • B7H3 mRNA Although B7H3 mRNA is widely expressed in normal tissues, the expression level of B7H3 protein is very low or absent in normal tissues, indicating that the protein expression of B7H3 is strictly post-transcriptionally regulated. In contrast, B7H3 protein is overexpressed in a variety of malignancies and is associated with poor prognosis, higher tumor grade and tumor metastasis, drug resistance and poor overall survival.
  • Universal CAR T cells are T cells isolated from healthy donors.
  • the prepared CAR-T cells not only have high expansion efficiency and strong vitality, but also increase the positive rate of infection.
  • universal CAR-T also faces graft-versus-host Problems with disease (GVHD) and immune rejection.
  • GVHD graft-versus-host Problems with disease
  • the CRISPR/Cas9 system is the most commonly used gene editing method, which can be used to generate T cells deficient in TCR and HLA class I molecules, and reduce the immune rejection immune response caused by allogeneic cell therapy.
  • the purpose of the present invention is to prepare a general-purpose CAR-T cell targeting B7H3, which recognizes tumor cell surface antigens and at the same time knocks out the TCR and HLA-A genes expressed by the cells, thereby reducing immune rejection caused by allogeneic CAR-T therapy Response, prolong cell survival time, improve anti-tumor effect.
  • the application provides an antigen-binding polypeptide that binds to B7H3, said antigen-binding polypeptide comprising at least one complementarity determining region (CDR) of an antibody heavy chain variable region (VH), said VH comprising SEQ ID NO: 25 Amino acid sequence shown.
  • CDR complementarity determining region
  • VH antibody heavy chain variable region
  • the VH comprises the amino acid sequence shown in SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 or SEQ ID NO:29.
  • the antigen-binding polypeptide comprises a VH comprising heavy chain complementarity determining region 1 (HCDR1), heavy chain complementarity determining region 2 (HCDR2) and heavy chain complementarity determining region 3 (HCDR3),
  • HCDR3 comprises the amino acid sequence shown in SEQ ID NO:7.
  • the HCDR3 comprises the amino acid sequence shown in SEQ ID NO:8 or SEQ ID NO:9.
  • the HCDR2 comprises the amino acid sequence shown in SEQ ID NO:4.
  • the HCDR2 comprises the amino acid sequence shown in SEQ ID NO:5 or SEQ ID NO:6.
  • the HCDR1 comprises the amino acid sequence shown in SEQ ID NO:1.
  • the HCDR1 comprises the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3.
  • the VH comprises: HCDR1 comprising the amino acid sequence shown in SEQ ID NO:1, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:4 and comprising the amino acid shown in SEQ ID NO:7 Sequence of HCDR3.
  • the VH comprises:
  • HCDR1 comprising the amino acid sequence shown in SEQ ID NO:2
  • HCDR2 comprising the amino acid sequence shown in SEQ ID NO:5
  • HCDR3 comprising the amino acid sequence shown in SEQ ID NO:8;
  • HCDR1 comprising the amino acid sequence shown in SEQ ID NO:3
  • HCDR2 comprising the amino acid sequence shown in SEQ ID NO:6
  • HCDR3 comprising the amino acid sequence shown in SEQ ID NO:9.
  • the VH comprises heavy chain framework region 1 (HFR1), heavy chain framework region 2 (HFR2), heavy chain framework region 3 (HFR3) and heavy chain framework region 4 (HFR4), the HFR1 Comprising the amino acid sequence shown in SEQ ID NO:10.
  • the HFR1 comprises the amino acid sequence shown in SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 or SEQ ID NO:14.
  • the HFR2 comprises the amino acid sequence shown in SEQ ID NO:15.
  • the HFR2 comprises the amino acid sequence shown in SEQ ID NO: 16 or SEQ ID NO: 17.
  • the HFR3 comprises the amino acid sequence shown in SEQ ID NO: 18.
  • the HFR3 comprises the amino acid sequence shown in SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21.
  • the HFR4 comprises the amino acid sequence shown in SEQ ID NO:22.
  • the HFR4 comprises the amino acid sequence shown in SEQ ID NO:23 or SEQ ID NO:24.
  • the VH comprises HFR1, HFR2, HFR3 and HFR4, and the HFR1, HFR2, HFR3 and HFR4 are selected from:
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:11
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:16
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:19, comprising SEQ ID NO:23 HFR4 of the indicated amino acid sequence
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:12
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:16
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:20, comprising SEQ ID NO:24 HFR4 of the indicated amino acid sequence
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:13
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:17
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:21, comprising SEQ ID NO:23 HFR4 of the indicated amino acid sequence
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:14
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:17
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:20, comprising SEQ ID NO:24
  • the amino acid sequence of HFR4 is shown.
  • the VH comprises the amino acid sequence shown in SEQ ID NO:25.
  • the VH comprises the amino acid sequence shown in SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 or SEQ ID NO:29.
  • the antigen-binding polypeptide comprises an antibody or antigen-binding fragment thereof.
  • the antibodies include monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies, intact antibodies, antibody fragments, human antibodies, humanized antibodies, or chimeric antibodies.
  • the antigen-binding fragments include Fab fragments, Fv fragments, F(ab')2, single chain Fv (scFv) or single domain antibodies (VHH).
  • the present application provides a chimeric antigen receptor (CAR), which comprises a targeting moiety, wherein the targeting moiety comprises the aforementioned antigen-binding polypeptide.
  • CAR chimeric antigen receptor
  • the targeting moiety comprises a VHH.
  • the chimeric antigen receptor comprises a transmembrane domain comprising a transmembrane domain derived from one or more proteins selected from the group consisting of CD8A, CD8B, CD28 , CD3 ⁇ (CD3e), 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4(CD244), Fc ⁇ RI ⁇ , BTLA , CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L (CD154), TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
  • transmembrane domain comprises a transmembrane domain derived from CD8A.
  • transmembrane domain comprises the amino acid sequence shown in any one of SEQ ID NO:42 to SEQ ID NO:90.
  • the chimeric antigen receptor includes an intracellular co-stimulatory signaling domain comprising one or more proteins derived from the group consisting of Intracellular co-stimulatory signaling domains: CD28, CD137, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
  • Intracellular co-stimulatory signaling domains CD28, CD137, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7H3, 2B4, Fc
  • the intracellular costimulatory signaling domain is derived from a costimulatory signaling domain of 4-1BB.
  • the intracellular co-stimulatory signaling domain comprises the amino acid sequence shown in any one of SEQ ID NO:91 to SEQ ID NO:123.
  • the chimeric antigen receptor comprises an intracellular signaling domain comprising an intracellular protein derived from one or more proteins selected from the group consisting of Signal transduction domain: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, DAP10, DAP-12 and domains containing at least one ITAM.
  • Signal transduction domain CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa
  • bovine leukemia virus gp30 Epstein-Barr virus (EBV) LMP2A
  • simian immunodeficiency virus PBj14 Nef simian immunodeficiency virus
  • the intracellular signaling domain comprises a signaling domain derived from CD3 ⁇ .
  • said intracellular signal transduction domain comprises any of SEQ ID NO:107, SEQ ID NO:111, SEQ ID NO:112, SEQ ID NO:124 to SEQ ID NO:134 The amino acid sequence shown in item.
  • the chimeric antigen receptor comprises a hinge region between the targeting moiety and the transmembrane domain, the hinge region comprising a hinge derived from one or more proteins selected from the group consisting of Regions: CD28, IgG1, IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • Regions CD28, IgG1, IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • the hinge region comprises a hinge region derived from CD8A.
  • the hinge region comprises the amino acid sequence shown in any one of SEQ ID NO: 135 to SEQ ID NO: 156.
  • the non-targeting portion of the chimeric antigen receptor comprises the transmembrane domain of the CD8A molecule, the hinge region of CD8A, the intracellular co-stimulatory signaling domain of 4-1BB, and the CD3 ⁇ intracellular signaling structure area.
  • the non-targeting portion of the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO:30.
  • the chimeric antigen receptor further comprises a signal peptide fragment, and the C-terminus of the signal peptide fragment is connected to the N-terminus of the targeting moiety.
  • the signal peptide fragment comprises a CD8A signal peptide fragment.
  • the signal peptide fragment comprises the amino acid sequence shown in SEQ ID NO:31.
  • the chimeric antigen receptor comprises the amino acid sequence shown in any one of SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34 and SEQ ID NO:35.
  • the present application provides one or more isolated nucleic acid molecules encoding the aforementioned antigen-binding polypeptide or the aforementioned chimeric antigen receptor.
  • the isolated nucleic acid molecule comprises the nucleotide sequence shown in any one of SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39.
  • the present application provides a vector comprising the aforementioned isolated nucleic acid molecule.
  • the vector is an expression vector.
  • the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors and retroviral vectors.
  • the present application provides a cell i) comprising the aforementioned isolated nucleic acid molecule or the aforementioned vector; and/or ii) expressing the aforementioned antigen-binding polypeptide or chimeric antigen receptor.
  • the present application provides an immune effector cell, which comprises the aforementioned nucleic acid molecule or the aforementioned vector, and/or expresses the aforementioned CAR.
  • the immune effector cells include human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • NK cells natural killer cells
  • macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells comprise autologous or non-autologous immune effector cells.
  • the immune effector cells include modified immune effector cells.
  • the modified immune effector cells include cells that reduce immune rejection induced by allogeneic cell therapy.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • the modification includes down-regulation of the expression and/or activity of one or more genes associated with immune rejection.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the unmodified corresponding cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
  • the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
  • the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification further comprises administering to the immune effector cells sgRNA targeting the exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:157 to SEQ ID NO:171.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:172 to SEQ ID NO:212.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • said antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:213 to SEQ ID NO:216.
  • the immune effector cells are HLA-B homozygous cells.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the immune effector cells are HLA-A homozygous or heterozygous cells.
  • HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
  • the present application provides a method for preparing immune effector cells, which includes introducing the aforementioned nucleic acid molecules or the aforementioned vectors into the immune effector cells.
  • the method further comprises: before introducing the nucleic acid molecule according to any one of claims XX-XX or the vector according to any one of claims XX-XX into immune effector cells /Thereafter, modifying the immune effector cells, the modification includes down-regulating the expression and/or activity of one or more genes related to immune rejection.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene in said immune effector cells are down-regulated compared to the expression and/or activity of the corresponding genes in corresponding cells without said modification.
  • the expression and/or activity of the CIITA gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
  • the expression and/or activity of the B2M gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene of the immune effector cells is down-regulated compared to corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not downregulated compared to corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated compared to corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
  • the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
  • the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:157 to SEQ ID NO:171.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:172 to SEQ ID NO:212.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • said antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:213 to SEQ ID NO:216.
  • the immune effector cells comprise human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • NK cells natural killer cells
  • macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells comprise autologous or non-autologous immune effector cells.
  • the cells are homozygous for HLA-B.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the cells are HLA-A homozygous or heterozygous cells.
  • HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
  • the present application provides the application of the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned vector, the aforementioned cell, or the aforementioned immune effector cell in the preparation of CAR-T cells.
  • the present application provides a pharmaceutical composition
  • a pharmaceutical composition comprising the aforementioned antigen-binding polypeptide, the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, and/or the aforementioned immune Effector cells, and optionally a pharmaceutically acceptable carrier.
  • the present application provides the aforementioned antigen-binding polypeptide, the aforementioned antigen chimeric receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition , for use in the treatment of a disease or condition associated with the expression of B7H3.
  • the disease or disorder associated with expression of B7H3 comprises a disease or disorder associated with upregulated expression of B7H3.
  • the disease or disorder associated with expression of B7H3 comprises cancer.
  • the cancer comprises adrenocortical carcinoma, bladder cancer, breast cancer, cholangiocarcinoma, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer , ovarian, pancreatic, prostate, sarcoma, melanoma, gastric, thymus, or endometrial cancer.
  • the present application provides the aforementioned antigen-binding polypeptide, the aforementioned antigen chimeric receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition Use in the preparation of a medicament for treating cancer.
  • the cancer comprises a B7H3 positive cancer.
  • the cancer comprises adrenocortical carcinoma, bladder cancer, breast cancer, cholangiocarcinoma, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer , ovarian, pancreatic, prostate, sarcoma, melanoma, gastric, thymus, or endometrial cancer.
  • the present application provides a method for preventing or treating a disease or disorder related to the expression of B7H3, which comprises administering to a subject in need an effective amount of the aforementioned antigen-binding polypeptide, the aforementioned antigen chimeric receptor , the aforementioned isolated nucleic acid molecule, the aforementioned vector, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition.
  • the disease or disorder associated with expression of B7H3 comprises a disease or disorder associated with upregulated expression of B7H3.
  • the disease or disorder associated with expression of B7H3 comprises cancer.
  • the cancer comprises adrenocortical carcinoma, bladder cancer, breast cancer, cholangiocarcinoma, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer , ovarian, pancreatic, prostate, sarcoma, melanoma, gastric, thymus, or endometrial cancer.
  • Figure 1A shows the anti-B7H3 CAR gene lentiviral expression vector described in the present application
  • Figure 1B shows the construction strategy of anti-B7H3 UCAR-T cells described in the present application
  • Figure 2 shows the affinity curve of the anti-B7H3 VHH antibody described in the present application
  • FIG. 3 shows the ADCC function test results of the anti-B7H3 VHH antibody described in the present application
  • Figures 4A-4C show the cell phenotype detection results of the anti-B7H3 UCAR-T cells described in the present application.
  • Figure 5 shows the results of killing target cells by anti-B7H3 UCAR-T cells described in the present application
  • Figures 6A-6C show the detection results of cytokine secretion in the co-culture of anti-B7H3 UCAR-T cells and target cells described in the present application;
  • Figure 7 shows the in vivo anti-tumor effect of the anti-B7H3 UCAR-T cells described in this application.
  • Figures 8A-8B show the results of GVHD and rejection in vivo targeting anti-B7H3 UCAR-T cells described in this application;
  • Figure 9 shows the off-target analysis of anti-B7H3 UCAR-T cells described in this application.
  • Figure 10 shows the chromosomal translocation analysis of anti-B7H3 UCAR-T cells described in the present application
  • Figure 11 shows the karyotype analysis of anti-B7H3 UCAR-T cells described in the present application
  • Figure 12 shows the analysis of Cas9 residues in anti-B7H3 UCAR-T cells described in this application.
  • FIG. 13 shows the results of Sanger sequencing of the TRAC gene in this application after Sg9RNA editing
  • Figure 14 shows the results of TA clone detection of the TRAC gene in this application after Sg9RNA editing
  • Figure 15 shows the results of flow cytometry detection of the TRAC gene in the present application after Sg9RNA editing
  • Figure 16 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg2RNA editing
  • Figure 17 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg5RNA editing
  • Figure 18 shows the results of Sanger sequencing of the HLA-A11 gene in this application after Sg21RNA editing
  • FIG 19 shows the results of Sanger sequencing of the HLA-A11 gene in this application after Rsg2RNA editing
  • Figures 20A-20B show the results of simultaneous knockout of HLA-A02 and TRAC in the modified immune effector cells of the present application
  • Figures 21A-21B show the protein levels of HLA-A02 and TRAC in the modified immune effector cells of the present application
  • Figure 22 shows the mRNA levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application
  • Figures 23A-23B show the protein levels of B2M and CIITA in the modified immune effector cells of the present application
  • Figures 24A-24D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application;
  • Figures 25A-25B show the knockout situation of TRAC and HLA-A mRNA levels in the modified immune effector cells of the present application
  • FIGS 26A-26B show the protein levels of CD69 and CD137 in the modified immune effector cells of the present application
  • Figure 27 shows the co-cultivation of the modified immune effector cells and NK cells of the present application
  • Figure 28 shows the level of IFN- ⁇ expressed by the modified immune effector cells of the present application.
  • Figures 29A-29D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application;
  • Figure 30 shows the infection efficiency of the modified immune effector cells of the present application to CAR
  • Figure 31 shows the amplification factor of the modified immune effector cells of the present application
  • Figure 32 shows the killing effect of the modified immune effector cells of the present application on CD19 positive target cells
  • Figure 33 shows the dosing regimen for administering the modified immune effector cells of the present application
  • Figure 34 shows the killing effect of the modified immune effector cells of the present application on tumors in mice.
  • chimeric antigen receptor generally refers to a group of polypeptides, usually two in the simplest embodiment, which, when in immune effector cells, provide cellular (usually cancer cells) and generate intracellular signals.
  • the CAR comprises at least one extracellular antigen-binding domain (such as a VHH, scFv, or portion thereof), a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain”). ”) comprising a functional signaling domain derived from a stimulatory molecule and/or a co-stimulatory molecule as defined below.
  • the set of polypeptides are in the same polypeptide chain (eg, comprising chimeric fusion proteins). In some embodiments, the set of polypeptides are not contiguous with each other, e.g., in different polypeptide chains. In some aspects, the set of polypeptides includes a dimerization switch that, in the presence of a dimerization molecule, can couple the polypeptides to each other, eg, can couple an antigen binding domain to an intracellular signaling domain. In one aspect, the stimulatory molecule of the CAR is the zeta chain associated with the T cell receptor complex.
  • the cytoplasmic signaling domain comprises a primary signaling domain (eg, the primary signaling domain of CD3-zeta). In one aspect, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below. In one aspect, the co-stimulatory molecule may be selected from 4-1BB (ie CD137), CD27, ICOS and/or CD28. In one aspect, a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule.
  • the CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling structure derived from a co-stimulatory molecule domains and functional signaling domains derived from stimulatory molecules.
  • a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising functions derived from one or more co-stimulatory molecules Sexual signaling domains and functional signaling domains derived from stimulatory molecules.
  • the CAR comprises a chimeric fusion protein which may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising at least two co-stimulatory domains derived from one or more co-stimulatory domains.
  • the CAR comprises an optional leader sequence at the amino terminus (N-ter) of the CAR fusion protein.
  • the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen recognition domain, wherein the leader sequence is optionally cleaved from the antigen recognition domain (e.g., VHH) during cellular processing and localizes the CAR to the cell membrane.
  • the antigen recognition domain e.g., VHH
  • antibody is generally used in the broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments as long as they show the desired biological activity (Miller et al (2003) Jour. of Immunology 170:4854-4861).
  • Antibodies can be murine, human, humanized, chimeric, or derived from other species.
  • a full-length antibody typically refers to an antibody consisting of two “full-length antibody heavy chains” and two “full-length antibody light chains”.
  • a “full-length antibody heavy chain” is generally a polypeptide consisting, in the N-terminal to C-terminal direction, of an antibody heavy chain variable domain (VH), an antibody constant heavy chain domain 1 (CH1), an antibody hinge region (HR) , antibody heavy chain constant domain 2 (CH2), and antibody heavy chain constant domain 3 (CH3), abbreviated as VH-CH1-HR-CH2-CH3; and in the case of antibodies of the IgE subclass, optionally It also includes the antibody heavy chain constant domain 4 (CH4).
  • VH antibody heavy chain variable domain
  • CH1 antibody constant heavy chain domain 1
  • HR antibody hinge region
  • CH2 antibody heavy chain constant domain 2
  • CH3 antibody heavy chain constant domain 3
  • a "full-length antibody heavy chain” is a polypeptide consisting of VH, CH1, HR, CH2 and CH3 in an N-terminal to C-terminal direction.
  • a “full-length antibody light chain” is generally a polypeptide consisting of an antibody light chain variable domain (VL) and an antibody light chain constant domain (CL) in the N-terminal to C-terminal direction, abbreviated as VL-CL.
  • the antibody light chain constant domain (CL) may be kappa (kappa) or lambda (lambda).
  • the two full-length antibody chains are linked together by an inter-polypeptide disulfide bond between the CL domain and the CH1 domain and between the hinge region of the full-length antibody heavy chain.
  • Typical examples of full-length antibodies are natural antibodies such as IgG (eg, IgGl and IgG2), IgM, IgA, IgD, and IgE).
  • antigen-binding fragment generally refers to a portion of an antibody molecule that contains the antigen responsible for the specificity between the antibody and the antigen. combined amino acids.
  • the portion of an antigen that is specifically recognized and bound by an antibody is called an "epitope" as described above.
  • An antigen binding domain will typically comprise an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH); however, it need not comprise both.
  • Fd fragments for example, have two VH regions and typically retain some antigen-binding function of the full antigen-binding domain.
  • antigen-binding fragments of antibodies include (1) Fab fragments, monovalent fragments having VL, VH, constant light chain (CL) and CH1 domains; (2) F(ab') 2 fragments, having two Bivalent fragment of two Fab fragments connected by sulfur bridge; (3) Fd fragment with two VH and CH1 domains; (4) Fv fragment with VL and VH domains of antibody single arm, (5) dAb fragment (Ward et al., "Binding Activities of a Repertoire of Single Immunoglobulin Variable Domains Secreted From Escherichia coli," Nature 341:544-546 (1989), which is hereby incorporated by reference in its entirety), which has a VH domain; (6) Isolated Complementarity Determining Regions (CDRs); (7) Single-chain Fv (scFv), for example derived from a scFv-library.
  • Fab fragments monovalent fragments having VL, VH, constant light chain (CL) and CH1 domains
  • the two domains VL and VH of the Fv fragment are encoded by separate genes, they can be joined using recombinant methods by a synthetic linker that allows it to be produced as a single protein in which the VL and VH regions pair to form a monovalent molecule chain (termed single-chain Fv (scFv)) (see, e.g., Huston et al., "Protein Engineering of Antibody Binding Sites: Recovery of Specific Activity in an Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichia coli," Proc.
  • scFv single-chain Fv
  • VHH involves variable antigen binding from heavy chain antibodies from Camelidae (camel, dromedary, llama, alpaca, etc.) domain (see Nguyen VK et al., 2000, The EMBO Journal, 19, 921-930; Muyldermans S., 2001, J Biotechnol., 74, 277-302 and review Vanlandschoot P. et al., 2011, Antiviral Research 92, 389-407). VHHs may also be referred to as Nanobodies (Nb) and/or Single Domain Antibodies.
  • Antigen-binding fragments targeting IL13R ⁇ 2 are also described in International Patent Application Publications WO2014072888A1 and WO2021041725A1, each of which is incorporated herein by reference in its entirety.
  • single domain antibody or “VHH” generally refers to a class of antibodies that lack the light chain of the antibody and only have the variable region of the heavy chain.
  • the single domain antibody can be from a Bactrian camel, a dromedary, an alpaca, a llama, a nurse shark, a great star shark, or a ray (for example, see Kang Xiaozhen et al., Acta Biological Engineering, 2018, 34( 12): 1974-1984).
  • single domain antibodies can be from alpacas.
  • Single domain antibodies can be composed of a heavy chain variable region (VH).
  • heavy chain variable region generally refers to the amino-terminal domain of the heavy chain of an antigen-binding fragment.
  • the heavy chain variable region can be further divided into hypervariable regions called complementarity determining regions (CDRs), which are interspersed in more conserved regions known as the framework regions (FRs).
  • CDRs complementarity determining regions
  • FRs framework regions
  • Each heavy chain variable region may consist of three CDRs and four FR regions, which may be arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.
  • the heavy chain variable region contains the binding domain that interacts with the antigen.
  • CDR complementarity determining region
  • CDRs Chothia CDRs
  • Padlan FASEB J.9:133-139 (1995)
  • MacCallum J Mol Biol 262(5):732-45 (1996).
  • CDR boundaries for CDR may not strictly follow one of the above systems, but will still overlap with Kabat CDRs, although they can be shortened according to predictions or experimental findings that specific residues or groups of residues or even CDRs as a whole do not significantly affect antigen binding. or extended. In this application, the IMGT numbering system is used.
  • FR generally refers to the more highly conserved portions of antibody variable domains, known as the framework regions.
  • the variable domains of native heavy and light chains may each comprise four FR regions, four in VH (H-FR1, H-FR2, H-FR3, and H-FR4), and four in VL. (L-FR1, L-FR2, L-FR3 and L-FR4).
  • Framework region generally refers to the art-recognized portion of an antibody variable region that exists between the more divergent (ie hypervariable) CDRs.
  • Framework regions are typically referred to as Frameworks 1 to 4 (FR1, FR2, FR3, and FR4) and provide the backbone for representing the six CDRs (three from the heavy chain and three from the light chain) in three-dimensional space, to Forms the antigen-binding surface.
  • homologous sequences may include amino acid sequences that may be at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence .
  • a homologue will comprise the same active site, etc., as the subject amino acid sequence.
  • Homology can be considered in terms of similarity (ie, amino acid residues having similar chemical properties/functions), or can be expressed in terms of sequence identity.
  • sequence having a percentage identity of any one of the SEQ ID NOs of the mentioned amino acid sequence or nucleotide sequence means having said percentage identity over the entire length of the mentioned SEQ ID NO the sequence of.
  • sequence alignment can be performed by various means known to those skilled in the art, for example, using BLAST, BLAST-2, ALIGN, NEEDLE or Megalign (DNASTAR) software and the like. Those skilled in the art can determine appropriate parameters for alignment, including any algorithms needed to achieve optimal alignment across the full-length sequences being compared.
  • binding when referring to the interaction of a binding molecule (such as an antibody) with its binding partner (such as an antigen) generally means that the interaction depends on a specific structure on the binding partner (such as an antigen). determinant or epitope).
  • an antibody will preferentially bind or recognize a binding partner even when the binding partner is present in a mixture of other molecules or organisms. Binding can be mediated by covalent or non-covalent interactions or a combination of both.
  • specifically binds generally means immunospecifically binding to an antigenic determinant or epitope and not immunospecifically binding to other antigenic determinants or epitopes.
  • a binding molecule that immunospecifically binds an antigen may bind other peptides or polypeptides with lower affinity, as determined by, for example, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), BIACORE, or other assays known in the art. Determination. A binding molecule or fragment thereof that immunospecifically binds an antigen may cross-react with a related antigen bearing the same epitope. In certain instances, a binding molecule or fragment thereof that immunospecifically binds an antigen does not cross-react with other antigens.
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunosorbent assay
  • BIACORE enzyme-linked immunosorbent assay
  • KD is used interchangeably with “KD”, and generally refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, and the unit is M (mol/L).
  • isolated nucleic acid molecule generally refers to an isolated form of nucleotides, deoxyribonucleotides or ribonucleotides or their analogs of any length, isolated from their natural environment or artificially synthesized .
  • the term "vector” generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers an inserted nucleic acid molecule into and/or between host cells.
  • the vectors may include vectors mainly used for inserting DNA or RNA into cells, vectors mainly used for replicating DNA or RNA, and vectors mainly used for expression of transcription and/or translation of DNA or RNA.
  • the carrier also includes a carrier having various functions as described above.
  • the vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Generally, the vector can produce the desired expression product by culturing an appropriate host cell containing the vector.
  • viral vector is used broadly to refer to nucleic acid molecules (such as transfer plasmids) or viral particles that mediate the transfer of nucleic acid molecules, including virus-derived nucleic acid elements that generally facilitate the transfer or integration of nucleic acid molecules into the genome of a cell .
  • Virions typically include various viral components and sometimes host cell components in addition to nucleic acid.
  • a viral vector may refer to a virus or virus particle capable of transferring nucleic acid into a cell, or the transferred nucleic acid itself.
  • lentivirus generally refers to the group (or genus) of complex retroviruses.
  • exemplary lentiviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2); Visna-maedi virus (visna-maedivirus, VMV) virus; caprine arthritis-encephalitis virus ( CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immunodeficiency virus (BIV); and simian immunodeficiency virus (SIV).
  • HIV-based vector backbones ie, HIV cis-acting sequence elements
  • lentiviruses are used to deliver CAR-containing polynucleotides to cells.
  • the term "host cell” or “cell” generally refers to an individual cell, cell lines or cell cultures.
  • the host cells may include progeny of a single host cell. Due to natural, accidental or deliberate mutations, the progeny cells may not necessarily be completely identical in morphology or genome to the original parent cells, but they only need to be able to express the isolated antigen-binding fragments described in this application.
  • the host cells can be obtained by using the vectors described in this application to transfect cells in vitro.
  • the host cell can be a prokaryotic cell (such as Escherichia coli), or a eukaryotic cell (such as yeast cells, such as COS cells, Chinese hamster ovary (CHO) cells, HeLa cells, HEK293 cells, COS-1 cells, NSO cells or myeloma cells).
  • the host cells may be E. coli cells.
  • the host cell may be a yeast cell.
  • the host cell can be a mammalian cell.
  • the mammalian cells may be CHO-K1 cells.
  • T cell or "T lymphocyte” may be any T cell, such as a cultured T cell, for example a primary T cell, or a T cell from a cultured T cell line, or a T cell obtained from a mammal.
  • Cells preferably primate, species including monkey, dog or human. If obtained from a mammal, T cells can be obtained from a number of sources including, but not limited to, blood, bone marrow, lymph nodes, thymus or other tissues or fluids. T cells can also be enriched or normalized. T cells can be obtained by maturing hematopoietic stem cells into T cells in vitro or in vivo. In an exemplary aspect, the T cells are human T cells.
  • the T cells are T cells isolated from humans.
  • T cells can be of any type, including NKT cells, and can be of any developmental stage, including but not limited to CD4+/CD8+ double positive T cells; CDA+ helper T cells; e.g. Th1 and Th2 cells, CD8+ T cells (e.g. Cytotoxic T cells); peripheral blood mononuclear cells (PBMC); peripheral blood leukocytes (PBL); tumor infiltrating cells (TIL); memory T cells; untreated T cells, etc.
  • the T cells are CD8+ T cells or CD4+ T cells.
  • the T cells are allogeneic (from a different donor of the same species) to the subject receiving the cells or cells to be received (e.g., the cells are in the form of a therapeutic composition); in some alternatives, the T cells are autologous (donor and recipient are identical); in some alternative approaches, T cells are syngeneic (donor and recipient are different, but identical twins).
  • immune effector cells generally refers to immune cells that participate in the immune response and perform effector functions.
  • the exercising effector functions may include clearing foreign antigens or promoting immune effector responses and the like.
  • Immune effector cells may include plasma cells, T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.
  • the immune effector cells of the present application may be autologous/autogeneic ("own") or non-autologous ("non-self", eg allogeneic, syngeneic or allogeneic).
  • autologous generally refers to cells from the same subject.
  • Allogeneic generally refers to cells that are of the same species but are genetically different from those to which they are being compared.
  • Isgeneic generally refers to cells of a different subject that are genetically identical to the cells being compared.
  • Allogeneic generally refers to a cell of a different species than the compared cell.
  • the cells of the present application are autologous or allogeneic.
  • the term "modify” generally refers to altering the state or structure of a cell and/or changing the state or structure of a cell.
  • the change is usually compared with the state or structure of the corresponding unmodified cell, and the change may include a change in the expression level or function of an endogenous gene, such as down-regulating the expression level of an endogenous gene in a cell by means of genetic engineering, Up-regulation or non-expression, the genetic engineering means may include homologous recombination, CRISPR/Cas9 system gene editing, etc.; the change may also include changes in cellular protein expression, structure or function, such as through the endogenous gene expression level or Changes in protein expression, changes in structure or function achieved by changes in function, such as changes in protein expression, changes in structure or function achieved by regulating protein translation, post-translational modification; the changes may also include introducing exogenous Genes, expression of foreign proteins, etc.
  • T cell receptor alpha cons-stant T cell receptor alpha cons-stant
  • T cell receptor T cell receptor
  • MHC major histocompatibility complex
  • ⁇ T cells account for about 95% of the total T cells, and ⁇ T cells account for about 5% of the total T cells. This ratio varies during ontogeny and in disease states (such as leukemia) and also varies between species. different.
  • Each chain that makes up the TCR contains a variable region and a constant region.
  • the gene encoding the ⁇ chain (TRA, such as the information shown in HGNC: 12027) is located on chromosome 14 and consists of multiple gene segments, including variable Segment (V), connecting segment (J) and constant region (C), TRAC gene usually refers to the gene sequence (for example, the information shown in HGNC:12029) encoding T cell receptor ⁇ chain constant region (C), which is located in Chromosome 14 (14q11.2;14:22,547,505-22,552,131).
  • variable segment (V) genes encoding the N-segment antigen recognition domain is rearranged with one of the junction segment (J) to generate a functional V region exon that is transcribed and spliced together with the
  • the constant regions (C) are linked to form the T cell receptor alpha chain coding sequence.
  • MHC major histocompatibility complex antigen
  • HLA human leukocyte antigen
  • HLA class I antigens (A, B, C in humans) allow each cell to be recognized as "self", while HLA class II antigens (DR, DP and DQ in humans) participate in the communication between lymphocytes and antigen-presenting cells reaction between. Both have been implicated in the rejection of transplanted organs.
  • An important aspect of the HLA gene system is its polymorphism. Different alleles exist for each gene, MHC class I (A, B, and C) and MHC class II (DP, DQ, and DR). HLA alleles are indicated by numbers and subscripts. For example, two unrelated individuals may carry the class I HLA-B genes B5 and Bw41, respectively. Allelic products differ in one or more amino acids in the alpha and/or beta domains.
  • HLA-A MHC class I and II proteins
  • HLA-B HLA-DR
  • the HLA genes are clustered in a "superlocus" present on chromosome position 6p21, which encodes six classical Transplantation of HLA genes and at least 132 protein-coding genes. The complete locus measures roughly 3.6Mb, with at least 224 loci.
  • haplotype a set of alleles present on a single chromosome, inherited from one parent, that tends to be inherited as a group.
  • the set of alleles inherited from each parent forms a haplotype, some of which tend to be associated together. Identifying a patient's haplotype can help predict the probability of finding a matching donor and help develop a search strategy because some alleles and haplotypes are more common than others and they are more common in different races and ethnicities The frequencies in the distribution are different.
  • HLA-A generally refers to a type of human leukocyte antigen polypeptide chain, encoded by the HLA-A gene located on human chromosome 6p21.3 (for example, the information shown in HGNC:4931).
  • HLA-A is one of three major polypeptide types that make up MHC class I molecules on the surface of human cells, the others including HLA-B and HLA-C.
  • the heterodimer composed of the ⁇ chain encoded by the HLA-A gene and the ⁇ chain ( ⁇ 2-microglobulin) encoded by the B2M gene is the HLA-A class MHC I molecule.
  • the ⁇ chain encoded by the HLA-A gene may comprise an ⁇ 1 domain, an ⁇ 2 domain, an ⁇ 3 domain, a transmembrane region, and a cytoplasmic region, wherein the ⁇ 1 domain and the ⁇ 2 domain may be combined with peptides to be activated by MHC I molecules (eg, HLA-A class) present the peptides to cells of the immune lineage.
  • MHC I molecules eg, HLA-A class
  • HLA-A alleles may include those named by the WHO HLA Factor Nomenclature Committee included in the IMGT/HLA database version 3.38.0 (https://www.ebi.ac.uk/ipd/imgt/hla/) Sequence information of the different HLA-A alleles.
  • HLA-B generally refers to a part of the gene family of the human leukocyte antigen (HLA) complex.
  • HLA is the human version of the major histocompatibility complex (MHC), a family of genes present in many species. The genes in this complex are divided into three basic groups: class I, class II and class III.
  • MHC major histocompatibility complex
  • HLA-B gene and two related genes, HLA-A and HLA-C are the major MHC class I genes.
  • the HLA-B gene is located in band 21.3 of the short (p) arm of chromosome 6, from base pairs 31,353,871 to 31,357,211.
  • HLA-B is one of the three main HLAs that should be matched between donor and recipient.
  • HLA-A HLA-B
  • HLA-DR MHC class II
  • HLA-matched refers to a donor-recipient pair in which there is no mismatch in HLA antigens between the donor and recipient, such as providing hematopoietic stem cell transplantation therapy to a recipient in need of A donor for a stem cell transplant.
  • HLA-matched (i.e., in which all 6 alleles are matched) donor-recipient pairs have a reduced risk of graft rejection because endogenous T cells and NK cells are less likely to enter the graft recognized as foreign and thus less likely to mount an immune response against the graft.
  • HLA-mismatched refers to a donor- A recipient pair, such as a donor who provides a hematopoietic stem cell transplant to a recipient in need of hematopoietic stem cell transplantation therapy.
  • one haplotype is matched while the other is not.
  • HLA-mismatched donor-recipient pairs may have an increased risk of graft rejection relative to HLA-matched donor-recipient pairs because endogenous Sexual T cells and NK cells are more likely to recognize an incoming graft as foreign, and such T cells and NK cells are therefore more likely to mount an immune response against the graft.
  • B2M generally refers to ⁇ 2-microglobulin ( ⁇ 2-microglobulin), which is one of the components of MHC class I molecules.
  • ⁇ 2 microglobulin also known as ⁇ chain
  • B2M is normally expressed in all nucleated cells.
  • ⁇ 2 microglobulin is encoded by the B2M gene located at 15q21.1 (for example, the information shown in HGNC:914).
  • CIITA generally refers to the transactivator of major histocompatibility complex class II (MHC II).
  • the transactivator may be a protein having an acidic transcription activation domain, 4 LRRs (leucine rich repeats) and a GTP binding domain.
  • the protein can be localized in the nucleus and acts as a positive regulator of the transcription of major histocompatibility complex class II (MHC II) genes, known as the "master control factor” for the expression of these genes.
  • MHC II major histocompatibility complex class II
  • the protein also binds GTP and uses the binding to GTP to transport itself into the nucleus where it normally acts in a coactivator-like manner through acetyltransferase (AT) activity.
  • the protein is encoded by a gene located at 16p13.13 (for example the information shown at HGNC:7067), enabling the generation of several transcript variants encoding different isoforms.
  • wild-type cell generally refers to a naturally occurring or naturally derived cell.
  • nucleic acid or “polynucleotide” or “nucleic acid molecule” generally refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single- or double-stranded form. Unless specifically limited, the term may include nucleic acids that contain analogs of natural nucleotides that have similar binding properties to a reference nucleic acid (for example, for which sequence information is shown) and in a manner similar to naturally occurring nucleotides metabolism. Unless otherwise stated, the sequence of a nucleic acid may include conservatively modified variants thereof, such as degenerate codon substitutions, alleles, orthologs, SNPs, and complementary sequences, as well as the sequences explicitly indicated.
  • expression generally refers to the transcription and/or translation of a specific nucleotide sequence.
  • gene mutation generally refers to changes in the composition or sequence of base pairs in the structure of a gene. For example, point mutations caused by single base changes, or deletions, duplications, and insertions of multiple bases.
  • the term "gene silencing” generally refers to preventing the expression of certain genes by regulatory mechanisms. It can mainly include two types: one is transcriptional gene silencing (TGS) at the transcriptional level caused by factors such as DNA methylation, heterochromatinization, and position effects, and the other is post-transcriptional gene silencing (post -transcriptional gene silencing (PTGS), that is, at the post-transcriptional level of the gene, it affects the expression of the gene by specifically interfering with the target RNA.
  • TGS transcriptional gene silencing
  • PTGS post-transcriptional gene silencing
  • the expression of the corresponding gene is downregulated/decreased.
  • Gene silencing is generally considered to be a gene knockdown mechanism, and methods commonly used to silence genes can be RNAi, etc.
  • endogenous refers to any substance derived from or produced within an organism, cell, tissue or system.
  • exogenous refers to any substance introduced from or produced outside of an organism, cell, tissue or system.
  • antisense RNA generally refers to a single-stranded RNA that is complementary to the transcript mRNA (messenger RNA). Antisense RNA can inhibit gene expression by binding to mRNA. For example, the combination of antisense RNA and target mRNA increases the sensitivity of the double-stranded RNA molecule to RNase III and degrades it; for example, antisense RNA binds to the upstream non-coding region of mRNA, thereby directly inhibiting the translation of target mRNA .
  • siRNA generally refers to the abbreviation of Small interfering RNA (small interfering RNA) or short in-terfering RNA (short interfering RNA).
  • siRNA is a type of double-stranded non-coding RNA molecule with a length of about 18-28 base pairs, which can cause mRNA degradation through complementary binding to mRNA, thereby interfering with the expression of specific genes.
  • siRNA may be a product obtained by treating long double-stranded RNA or shRNA with Dicer enzyme.
  • the siRNA enters the cell and forms an RNA-induced silencing complex (RISC) with other proteins, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.
  • RISC RNA-induced silencing complex
  • shRNA generally refers to the abbreviation of short hairpin RNA, namely “short hairpin RNA”.
  • shRNA usually includes two short inverted repeat sequences separated by a stem-loop sequence to form a hairpin structure.
  • 5-6 T bases can also be included as the transcription terminator of RNA polymerase III.
  • shRNA can enter cells through viral vectors or plasmids, and be transcribed under the action of polymerase II or polymerase III, and the transcripts are exported from the nucleus (usually through Exportin 5) and then transported after being treated by Dicer To RISC, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.
  • CRISPR/Cas system generally refers to a group of molecules comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule capable of directing and implementing the RNA-guided nuclease or other effector molecule Nucleic acid is modified at a target sequence, eg, causing degradation of the target sequence.
  • a CRISPR system comprises a gRNA and a Cas protein, e.g., a Cas9 protein.
  • Cas9 systems systems comprising Cas9 or functional mutants thereof are referred to herein as “Cas9 systems” or "CRISPR/Cas9 systems”.
  • the gRNA molecule and the Cas molecule can complex to form a ribonucleoprotein (RNP) complex.
  • RNP ribonucleoprotein
  • gRNA molecule or “guide RNA”, “guide RNA”, “guide RNA”, “guide RNA molecule”, “gRNA” are used interchangeably and generally refer to Nucleases or other effector molecules (generally complexed with gRNA molecules) to nucleic acid molecules on the target sequence. In certain embodiments, this is accomplished by hybridizing a portion of the gRNA to DNA (e.g., via a gRNA guidance domain) and by binding a portion of the gRNA molecule to an RNA-guided nuclease or other effector molecule (e.g., via at least a gRNAtracr). described guide.
  • a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a "single guide RNA” or “sgRNA” or the like.
  • a gRNA molecule consists of multiple (eg, two) polynucleotide molecules that are themselves capable of associating (typically by hybridization), referred to herein as “dual guide RNA” or “dgRNA” and the like.
  • Cas protein generally refers to the enzyme responsible for cutting DNA in the CRISPR/Cas system. Enzymes from Type I, II, and III CRISPR/Cas systems may be included. For example, Cas3, Cas9, Cas10.
  • Cas9 protein generally refers to the enzyme from the bacterial type II CRISPR/Cas system responsible for cutting DNA. Cas9 can include the wild-type protein and its functional mutants.
  • allele generally refers to the different variations that the gene sequence at a locus may have.
  • a genetic locus also known as a gene locus or site, refers to a fixed location on a chromosome, such as where a certain gene is located. The arrangement of loci in the genome is called a genetic map.
  • homozygous generally refers to a genotyped individual whose two alleles on the same locus of the homologous chromosome are the same.
  • a pair of relative genes can have individuals of both genotypes AA and aa.
  • heterozygote generally refers to a diploid individual whose two alleles at the same site on the homologous chromosome are different, such as Aa. Heterozygous genotypes generally have higher fitness than homozygous dominant or homozygous recessive genotypes, a phenomenon known as heterozygous dominance.
  • tumor and cancer are used interchangeably and generally refer to a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread to other parts of the body locally or through the bloodstream and lymphatic system. Examples of various cancers are described herein and they include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, Lung cancer, etc.
  • cancer or “tumor” includes pre-malignant as well as malignant cancers and tumors, and also encompasses solid and non-solid tumors.
  • the term "pharmaceutically acceptable” generally refers to a drug that is commensurate with a reasonable benefit/risk ratio, suitable within the scope of sound medical judgment for use in contact with human and animal tissues without undue toxicity, irritation, Those compounds, materials, compositions and/or dosage forms for allergic reactions or other problems or complications.
  • the term "pharmaceutically acceptable carrier” generally refers to any of those conventionally used, and is subject only to physico-chemical considerations such as solubility and reactivity with active binding agents. lack of) and is limited by the route of administration.
  • the pharmaceutically acceptable carriers described herein, such as vehicles, adjuvants, excipients, and diluents, are well known to those skilled in the art and are readily available to the public.
  • a pharmaceutically acceptable carrier is one that is chemically inert to the active ingredients of the pharmaceutical composition and that exhibits no adverse side effects or toxicity under the conditions of use. In some embodiments, the carrier does not produce an adverse, allergic or other inappropriate reaction when administered to an animal or a human.
  • compositions are free of pyrogens and other impurities that could be harmful to humans or animals.
  • Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like; their use is well known in the art.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphates, citrates, or other organic acids; antioxidants; , such as ascorbic acid; low-molecular-weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine amino acids; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and/or Or nonionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG).
  • buffers such as phosphates, citrates,
  • the term “effective amount” or “effective dose” generally refers to an amount sufficient to achieve, or at least partially achieve, the desired effect.
  • a “therapeutically effective amount” or “therapeutically effective dose” of a drug or therapeutic agent is typically one that, when used alone or in combination with another therapeutic agent, promotes regression of disease (by reducing the severity of disease symptoms, frequency of asymptomatic periods of disease), any amount of drug that is evidenced by an increase in the degree and duration of the disease, or by the prevention of impairment or disability due to the presence of a disease.
  • a “therapeutically effective amount” or “effective amount” of an anti-B7H3 CAR-T cell is also an amount or dose in which the therapeutically beneficial effect outweighs any toxic or detrimental effects of the anti-B7H3 CAR-T cell, such as CRS.
  • the term “therapeutically effective amount” includes an amount effective to "treat” a subject (eg, a patient).
  • the therapeutically effective dose is the minimum effective dose (MED) of anti-B7H3 CAR-T cells used to treat multiple myeloma in a subject.
  • the therapeutically effective dose is the maximum tolerated dose (MTD) of anti-B7H3 CAR-T cells that does not result in unresolved CRS in the subject.
  • MED minimum effective dose
  • MTD maximum tolerated dose
  • the term "about” generally refers to a range of 0.5%-10% above or below the specified value, such as 0.5%, 1%, 1.5%, 2%, 2.5%, above or below the specified value. 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.
  • subject generally refers to human or non-human animals, including but not limited to cats, dogs, horses, pigs, cows, sheep, rabbits, mice, rats or monkeys.
  • the application provides an antigen-binding polypeptide comprising at least one complementarity-determining region (CDR) of an antibody heavy chain variable region (VH), said VH comprising at least one sequence having the amino acid sequence shown in SEQ ID NO:25.
  • Amino acid sequences that are about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the VH comprises at least about 90%, about 91%, of the amino acid sequence set forth in SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 or SEQ ID NO:29, Amino acid sequences that are about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the antigen-binding polypeptide comprises a VH comprising heavy chain complementarity determining region 1 (HCDR1), heavy chain complementarity determining region 2 (HCDR2) and heavy chain complementarity determining region 3 (HCDR3)
  • the HCDR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 96% of the amino acid sequence shown in SEQ ID NO:7. Amino acid sequences that are 98%, about 99%, about 99.5% identical.
  • the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:7.
  • the HCDR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 90% of the amino acid sequence shown in SEQ ID NO: 8 or SEQ ID NO: 9 Amino acid sequences that are 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:8 or SEQ ID NO:9.
  • the HCDR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:4 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:4.
  • the HCDR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence set forth in SEQ ID NO:5 or SEQ ID NO:6, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HCDR2 may comprise the amino acid sequence shown in SEQ ID NO:5 or SEQ ID NO:6.
  • the HCDR1 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 1 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:1.
  • the HCDR1 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3.
  • the VH comprises: comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO: 1, HCDR1 having an amino acid sequence of about 96%, about 97%, about 98%, about 99%, about 99.5% identity, comprising at least about 90%, about 91%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HCDR2 and comprising the same as SEQ ID NO:7
  • the amino acid sequences shown are at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical Sexual amino acid sequence of HCDR3.
  • the VH may comprise: HCDR1 comprising the amino acid sequence shown in SEQ ID NO:1, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:4, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO:7.
  • the VH comprises:
  • HCDR1 comprising the amino acid sequence shown in SEQ ID NO:2
  • HCDR2 comprising the amino acid sequence shown in SEQ ID NO:5
  • HCDR3 comprising the amino acid sequence shown in SEQ ID NO:8;
  • HCDR1 comprising the amino acid sequence shown in SEQ ID NO:3
  • HCDR2 comprising the amino acid sequence shown in SEQ ID NO:6
  • HCDR3 comprising the amino acid sequence shown in SEQ ID NO:9.
  • the VH comprises heavy chain framework region 1 (HFR1), heavy chain framework region 2 (HFR2), heavy chain framework region 3 (HFR3) and heavy chain framework region 4 (HFR4), the HFR1 comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO: 10, Amino acid sequences of about 99%, about 99.5% identity.
  • the HFR1 may comprise the amino acid sequence shown in SEQ ID NO:10.
  • the HFR1 comprises at least about 90%, about 91%, of the amino acid sequence set forth in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14, Amino acid sequences that are about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HFR1 comprises the amino acid sequence shown in SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13 or SEQ ID NO:14.
  • the HFR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 15 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HFR2 may comprise the amino acid sequence shown in SEQ ID NO: 15.
  • the HFR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 16 or SEQ ID NO: 17, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HFR2 may comprise the amino acid sequence shown in SEQ ID NO: 16 or SEQ ID NO: 17.
  • the HFR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 18 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HFR3 may comprise the amino acid sequence shown in SEQ ID NO: 18.
  • the HFR3 comprises at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21 %, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the HFR3 may comprise the amino acid sequence shown in SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21.
  • the HFR4 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 22 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the HFR4 may comprise the amino acid sequence shown in SEQ ID NO:22.
  • the HFR4 comprises at least about 90%, about 91%, about 92%, about 93%, about 94% of the amino acid sequence shown in SEQ ID NO: 23 or SEQ ID NO: 24, Amino acid sequences that are about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the HFR4 may comprise the amino acid sequence shown in SEQ ID NO:23 or SEQ ID NO:24.
  • the VH comprises HFR1, HFR2, HFR3 and HFR4, and the HFR1, HFR2, HFR3 and HFR4 are selected from:
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:11
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:16
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:19, comprising SEQ ID NO:23 HFR4 of the indicated amino acid sequence
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:12
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:16
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:20, comprising SEQ ID NO:24 HFR4 of the indicated amino acid sequence
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:13
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:17
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:21, comprising SEQ ID NO:23 HFR4 of the indicated amino acid sequence
  • HFR1 comprising the amino acid sequence shown in SEQ ID NO:14
  • HFR2 comprising the amino acid sequence shown in SEQ ID NO:17
  • HFR3 comprising the amino acid sequence shown in SEQ ID NO:20, comprising SEQ ID NO:24
  • the amino acid sequence of HFR4 is shown.
  • the VH comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence set forth in SEQ ID NO: 25. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
  • the VH can comprise the amino acid sequence shown in SEQ ID NO: 25.
  • the VH comprises at least about 90%, about 91%, of the amino acid sequence set forth in SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 or SEQ ID NO:29, Amino acid sequences that are about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the VH may comprise the amino acid sequence shown in SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28 or SEQ ID NO:29.
  • the antigen-binding polypeptide comprises an antibody or antigen-binding fragment thereof.
  • the antibodies include monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies, intact antibodies, antibody fragments, human antibodies, humanized antibodies, or chimeric antibodies.
  • the antigen-binding fragments include Fab fragments, Fv fragments, F(ab')2, single chain Fv (scFv) or single domain antibodies (VHH).
  • the present application provides a chimeric antigen receptor (CAR) targeting B7H3, which comprises a targeting moiety, wherein the targeting moiety comprises the aforementioned antigen-binding polypeptide.
  • CAR chimeric antigen receptor
  • the targeting moiety comprises a VHH.
  • the targeting moiety comprises VHH
  • the VHH may comprise: HCDR1 comprising the amino acid sequence shown in SEQ ID NO:1, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:4 and comprising SEQ ID NO:7
  • HCDR3 The amino acid sequence of HCDR3 is shown.
  • the targeting moiety comprises a VHH
  • the VHH may comprise the amino acid sequence shown in SEQ ID NO:25.
  • transmembrane domain comprising a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e), 4 -1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4(CD244), Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L (CD154), TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
  • proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e), 4 -1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA
  • transmembrane domain comprises a transmembrane domain derived from CD8A.
  • the transmembrane domain comprises at least about 90%, about 91%, about 92%, about 90% of the amino acid sequence shown in any one of SEQ ID NO:42 to SEQ ID NO:90 Amino acid sequences that are 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • an intracellular co-stimulatory signaling domain comprising intracellular co-stimulatory signaling derived from one or more proteins selected from the group consisting of Domains: CD28, CD137, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM, DAP10, DAP12 , CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
  • Domains CD28, CD137, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM,
  • the intracellular costimulatory signaling domain is derived from a costimulatory signaling domain of 4-1BB.
  • the intracellular co-stimulatory signaling domain comprises at least about 90%, about 91%, of the amino acid sequence shown in any one of SEQ ID NO:91 to SEQ ID NO:123, Amino acid sequences that are about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • an intracellular signaling domain comprising an intracellular signaling domain derived from one or more proteins selected from the group consisting of: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, DAP10, DAP-12 and at least one ITAM domain.
  • an intracellular signaling domain comprising an intracellular signaling domain derived from one or more proteins selected from the group consisting of: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, DAP10, DAP-12 and at least one
  • the intracellular signaling domain comprises a signaling domain derived from CD3 ⁇ .
  • said intracellular signal transduction domain comprises any of SEQ ID NO:107, SEQ ID NO:111, SEQ ID NO:112, SEQ ID NO:124 to SEQ ID NO:134
  • One of the amino acid sequences set forth in any one of the set forth amino acid sequences has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, Amino acid sequences of about 98%, about 99%, about 99.5% identity.
  • it includes a hinge region between the targeting moiety and the transmembrane domain, said hinge region comprising a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1, IgG4 , IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1, IgG4 , IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • the hinge region comprises a hinge region derived from CD8A.
  • the hinge region comprises at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in any one of SEQ ID NO: 135 to SEQ ID NO: 156. , about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the non-targeting portion of the chimeric antigen receptor includes a hinge region, a transmembrane domain, an intracellular co-stimulatory signaling domain, and an intracellular signal transduction domain.
  • the non-targeting portion of the chimeric antigen receptor comprises the transmembrane domain of the CD8A molecule, the hinge region of CD8A, the intracellular co-stimulatory signaling domain of 4-1BB, and the CD3 ⁇ intracellular signaling structure area.
  • the chimeric antigen receptor uses an anti-B7H3 single domain antibody as the extracellular antigen binding domain, which is connected to the intracellular signaling domain through the CD8A molecular hinge region and transmembrane domain, and the intracellular signaling domain consists of 4 -1BB intracellular co-stimulatory signal transduction domain and CD3 ⁇ intracellular signal transduction domain.
  • the non-targeting portion of the chimeric antigen receptor comprises at least about 90%, about 91%, about 92%, about 93%, about 90% of the amino acid sequence set forth in SEQ ID NO: 30. Amino acid sequences that are 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • the chimeric antigen receptor further comprises a signal peptide fragment, and the C-terminus of the signal peptide fragment is connected to the N-terminus of the targeting moiety.
  • the chimeric antigen receptor may include a CAR including a signal peptide, an anti-B7H3 VHH, a CD8A hinge domain, a CD8A transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 ⁇ main signaling domain.
  • the signal peptide fragment comprises a CD8A signal peptide fragment.
  • the chimeric antigen receptor, the signal peptide fragment comprises at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in SEQ ID NO: 31 , about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the present application provides one or more isolated nucleic acid molecules encoding the aforementioned antigen-binding polypeptide or the aforementioned chimeric antigen receptor.
  • the nucleic acid molecule of described separation comprises and SEQ ID NO:36, the nucleotide sequence shown in any one of SEQ ID NO:37, SEQ ID NO:38 and SEQ ID NO:39 Amino acid sequences having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identity .
  • the present application provides a vector comprising the aforementioned isolated nucleic acid molecule.
  • the vector is an expression vector.
  • the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors and retroviral vectors.
  • the vector can be a lentiviral vector.
  • the present application provides a cell i) comprising the aforementioned isolated nucleic acid molecule or the aforementioned vector; and/or ii) expressing the aforementioned antigen-binding polypeptide or chimeric antigen receptor.
  • the present application provides an immune effector cell, which comprises the aforementioned nucleic acid molecule or the aforementioned vector, and/or expresses the aforementioned CAR.
  • the immune effector cells include human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells can be T cells.
  • the immune effector cells may be human T cells.
  • the immune effector cells comprise autologous or non-autologous immune effector cells.
  • the immune effector cells include modified immune effector cells.
  • the modified immune effector cells include cells that reduce immune rejection induced by allogeneic cell therapy.
  • TCR T cell antigen receptor
  • MHCI major histocompatibility complex
  • the modification includes down-regulation of the expression and/or activity of one or more genes associated with immune rejection.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the gene associated with immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A and HLA-B.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC and HLA-A.
  • the gene associated with immune rejection is selected from one or more genes in the group consisting of TRAC and HLA-A.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the unmodified corresponding cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
  • the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
  • the modification comprises knockout of exons of the TRAC gene and knockout of exons of the HLA-A gene in the immune cells.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification further comprises administering to the immune effector cells sgRNA targeting the exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises at least about 90 %, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises at least one of the nucleotide sequences shown in any one of SEQ ID NO: 172 to SEQ ID NO: 212 Amino acid sequences that are about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • the antisense RNA comprises at least about 90%, about 91%, about 92% of the nucleotide sequence shown in any one of SEQ ID NO:213 to SEQ ID NO:216 , about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the immune effector cells are HLA-B homozygous cells.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the immune effector cells are HLA-A homozygous or heterozygous cells.
  • HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
  • the present application provides a method for preparing immune effector cells, which includes introducing the aforementioned nucleic acid molecule or the aforementioned carrier into the immune effector cells.
  • the method further includes: before/after introducing the aforementioned nucleic acid molecule or the aforementioned vector into the immune effector cells, modifying the immune effector cells, the modification includes The expression and/or activity of one or more of the is downregulated.
  • the method includes: after introducing the aforementioned nucleic acid molecule or the aforementioned vector into the immune effector cells, modifying the immune effector cells, the modification including one or The expression and/or activity of multiples were downregulated.
  • the method for preparing immune effector cells may include:
  • the modification includes down-regulating the expression and/or activity of one or more genes related to immune rejection.
  • the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
  • the expression and/or activity of the TRAC gene and the HLA-A gene in said immune effector cells are down-regulated compared to the expression and/or activity of the corresponding genes in corresponding cells without said modification.
  • the expression and/or activity of the CIITA gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
  • the expression and/or activity of the B2M gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
  • the expression and/or activity of the TRAC gene and the HLA-A gene of the immune effector cells is down-regulated compared to corresponding wild-type cells.
  • the expression and/or activity of the CIITA gene is not downregulated compared to corresponding wild-type cells.
  • the expression and/or activity of the B2M gene is not down-regulated compared to corresponding wild-type cells.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the modification includes: gene knockout, gene mutation and/or gene silencing.
  • the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
  • the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
  • the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:157 to SEQ ID NO:171.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises at least one of the nucleotide sequences shown in any one of SEQ ID NO:172 to SEQ ID NO:212 Amino acid sequences that are about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • the antisense RNA comprises at least about 90%, about 91%, about 92% of the nucleotide sequence shown in any one of SEQ ID NO:213 to SEQ ID NO:216 , about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
  • the immune effector cells comprise human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells can be T cells.
  • the immune effector cells comprise autologous or non-autologous immune effector cells.
  • the cells are homozygous for HLA-B.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the cells are HLA-A homozygous or heterozygous cells.
  • HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
  • the method for preparing immune effector cells may include:
  • CD3 magnetic beads were added in proportion to collect CD3-T cells (cells not bound to magnetic beads).
  • the present application provides the application of the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned vector, the aforementioned cell, or the aforementioned immune effector cell in the preparation of CAR-T cells.
  • the present application provides a pharmaceutical composition
  • a pharmaceutical composition comprising the aforementioned antigen-binding polypeptide, the aforementioned chimeric antigen receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, and/or the aforementioned immune Effector cells, and optionally a pharmaceutically acceptable carrier.
  • the pharmaceutical composition may include: buffers, such as neutral buffered saline, phosphate buffered saline, etc.; sugars, such as glucose, mannose, sucrose or dextran, mannitol; proteins; polypeptides or amino acids such as glycine; Antioxidants; chelating agents, such as EDTA or glutathione; adjuvants (eg, aluminum hydroxide); and preservatives.
  • buffers such as neutral buffered saline, phosphate buffered saline, etc.
  • sugars such as glucose, mannose, sucrose or dextran, mannitol
  • proteins such as polypeptides or amino acids such as glycine
  • Antioxidants such as EDTA or glutathione
  • adjuvants eg, aluminum hydroxide
  • the pharmaceutical composition includes the aforementioned immune effector cells and optionally a pharmaceutically acceptable carrier.
  • the present application provides the aforementioned antigen-binding polypeptide, the aforementioned antigen chimeric receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition , for use in the treatment of a disease or condition associated with the expression of B7H3.
  • the disease or disorder associated with expression of B7H3 comprises a disease or disorder associated with upregulated expression of B7H3.
  • the disease or disorder associated with expression of B7H3 comprises cancer.
  • the cancer comprises adrenocortical carcinoma, bladder cancer, breast cancer, cholangiocarcinoma, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer , ovarian, pancreatic, prostate, sarcoma, melanoma, gastric, thymus, or endometrial cancer.
  • the present application provides the aforementioned antigen-binding polypeptide, the aforementioned antigen chimeric receptor, the aforementioned isolated nucleic acid molecule, the aforementioned carrier, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition Use in the preparation of a medicament for treating diseases or conditions related to the expression of B7H3.
  • the disease or disorder associated with expression of B7H3 comprises a disease or disorder associated with upregulated expression of B7H3.
  • the disease or disorder associated with expression of B7H3 comprises cancer.
  • the cancer comprises adrenocortical carcinoma, bladder cancer, breast cancer, cholangiocarcinoma, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer , ovarian, pancreatic, prostate, sarcoma, melanoma, gastric, thymus, or endometrial cancer.
  • the present application provides a method for preventing or treating a disease or disorder related to the expression of B7H3, which comprises administering to a subject in need an effective amount of the aforementioned antigen-binding polypeptide, the aforementioned antigen chimeric receptor , the aforementioned isolated nucleic acid molecule, the aforementioned vector, the aforementioned cell, the aforementioned immune effector cell, and/or the aforementioned pharmaceutical composition.
  • the disease or disorder associated with expression of B7H3 comprises a disease or disorder associated with upregulated expression of B7H3.
  • the disease or disorder associated with expression of B7H3 comprises cancer.
  • the cancer comprises adrenocortical carcinoma, bladder cancer, breast cancer, cholangiocarcinoma, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer , ovarian, pancreatic, prostate, sarcoma, melanoma, gastric, thymus, or endometrial cancer.
  • the present application provides a modified immune effector cell, wherein the expression and/or activity of the TRAC gene and the HLA-A gene are lower than the expression and/or activity of the corresponding gene in the corresponding cell without said modification.
  • the activity is down-regulated, the expression and/or activity of the B2M gene is not down-regulated, and the expression and/or activity of the CIITA gene is not down-regulated; and the HLA-B typing of the modified immune effector cells is consistent with the HLA of the subject -B types are matched.
  • the modified immune effector cells are HLA-B heterozygous and consistent with both alleles of the subject's HLA-B, or the modified immune effector cells are Homozygous for HLA-B and identical to one of the subject's HLA-B alleles.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the modification results in down-regulation of the expression and/or activity of two genes, wherein the two genes consist of the TRAC gene and the HLA-A gene.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated, the expression and/or activity of the B2M gene are not down-regulated, and the expression of the CIITA gene is and/or activity is not downregulated.
  • the expression and/or activity of two genes is downregulated compared to a corresponding wild-type cell, wherein the two genes consist of a TRAC gene and an HLA-A gene.
  • the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
  • the modification includes: gene mutation and/or gene silencing.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:172 to SEQ ID NO:212.
  • the modification further comprises administering to the immune effector cells sgRNA targeting the exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:157 to SEQ ID NO:171.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • said antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:213 to SEQ ID NO:216.
  • the modified immune effector cells express CAR.
  • the CAR includes an antigen-binding domain, a hinge region, a transmembrane domain, an intracellular co-stimulatory signaling domain, and an intracellular signal transduction domain.
  • the antigen binding domain specifically binds a tumor antigen.
  • the tumor antigen is selected from the group consisting of CD19, CD20, CD22, CD33, BCMA, IL13Ra2, EGFR, Her2, GD2 and B7H3.
  • the antigen binding domain is selected from the group consisting of monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies, intact antibodies, antibody fragments, human antibodies, human Antibodies, chimeric antibodies, Fv fragments, F(ab')2, single chain Fv (scFv) and single domain antibodies (VHH).
  • the transmembrane domain comprises a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e), 4-1BB, CD4, CD27 , CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4 (CD244), Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L (CD154), TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
  • proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e), 4-1BB, CD4, CD27 , CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA
  • the intracellular co-stimulatory signaling domain comprises an intracellular co-stimulatory signaling domain derived from one or more proteins selected from the group consisting of CD28, CD137, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD- 1. LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40 and MyD88.
  • proteins selected from the group consisting of CD28, CD137, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVE
  • the intracellular signaling domain comprises an intracellular signaling domain derived from one or more proteins selected from the group consisting of: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, DAP10, DAP-12, and domains containing at least one ITAM.
  • EBV Epstein-Barr virus
  • the hinge region comprises a hinge region derived from one or more proteins selected from the group consisting of CD28, IgG1, IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • the CAR further comprises a signal peptide fragment, the C-terminus of the signal peptide fragment is connected to the N-terminus of the targeting moiety.
  • the signal peptide fragment comprises a CD8A signal peptide fragment.
  • the immune effector cells comprise human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • NK cells natural killer cells
  • macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells comprise non-autologous immune effector cells.
  • the present application provides a method for preparing the aforementioned modified immune effector cells, which comprises the following steps:
  • the modified immune effector cells are HLA-B heterozygous and consistent with both alleles of the subject's HLA-B, or the modified immune effector cells are Homozygous for HLA-B and identical to one of the subject's HLA-B alleles.
  • HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • the modification results in down-regulation of the expression and/or activity of two genes, wherein the two genes consist of the TRAC gene and the HLA-A gene.
  • the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated, the expression and/or activity of the B2M gene are not down-regulated, and the expression and/or activity of the CIITA gene are down-regulated. /or activity is not downregulated.
  • the expression and/or activity of two genes consisting of a TRAC gene and an HLA-A gene is downregulated compared to a corresponding wild-type cell.
  • the expression level and/or activity of the down-regulated gene comprises down-regulation of the expression and/or activity of the nucleic acid molecule encoding the gene; and/or down-regulation of the expression and/or activity of the protein product encoded by the gene. / or the activity is downregulated.
  • the modification includes: gene mutation and/or gene silencing.
  • said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
  • said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
  • the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:172 to SEQ ID NO:212.
  • the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the TRAC gene.
  • the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:157 to SEQ ID NO:171.
  • said modification further comprises administering a Cas enzyme to said cells.
  • the Cas enzyme comprises a Cas9 protein.
  • said antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:213 to SEQ ID NO:216.
  • the immune effector cells comprise human cells.
  • the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • NK cells natural killer cells
  • macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • the immune effector cells comprise non-autologous immune effector cells.
  • the present application provides a composition, which includes the aforementioned modified immune effector cells and a pharmaceutically acceptable carrier.
  • the present application provides the application of the aforementioned modified immune effector cells in the preparation of CAR-T cells.
  • the present application provides the application of the aforementioned modified immune effector cells in the preparation of medicines, and the medicines are used for allogeneic therapy.
  • the present application provides the application of the aforementioned modified immune effector cells in the preparation of medicines for treating tumors.
  • the tumor includes solid tumors and non-solid tumors.
  • the tumor is selected from the group consisting of liver cancer, gastric cancer, lung cancer, breast cancer, non-small cell lung cancer, B lymphoma, Hodgkin's lymphoma, glioma, chronic myelogenous leukemia and Acute myeloid leukemia.
  • the modified immune effector cell wherein compared with the expression and/or activity of the corresponding gene in the corresponding cell without said modification, the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated, and the expression and/or activity of the B2M gene The expression and/or activity are not down-regulated, and the expression and/or activity of the CIITA gene are not down-regulated; and the HLA-B typing of the modified immune effector cells matches the HLA-B typing of the subject .
  • HLA-B homozygotes comprise HLA-B*40 homozygotes, HLA-B*15 homozygotes, HLA-B*46 homozygotes, HLA-B*46 homozygotes, HLA -B*13 homozygote, HLA-B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B *52 homozygous, HLA-B*57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
  • modified immune effector cell according to any one of claims 128-130, wherein the modification causes the expression and/or activity of two genes to be down-regulated, wherein the two genes consist of the TRAC gene and the HLA gene -A genetic composition.
  • the modified immune effector cell according to any one of claims 128-132, wherein the expression and/or activity of two genes are down-regulated compared to corresponding wild-type cells, wherein the two genes It is composed of TRAC gene and HLA-A gene.
  • modified immune effector cell according to any one of claims 128-133, wherein the expression level and/or activity of the gene is down-regulated and comprises the expression and/or activity of the nucleic acid molecule encoding the gene Down-regulate; and/or cause the expression and/or activity of the protein product encoded by said gene to be down-regulated.
  • the modified immune effector cell according to any one of claims 128-134, wherein said modification comprises: gene mutation and/or gene silencing.
  • modified immune effector cell according to any one of claims 128-135, wherein said modification comprises administering to said immune effector cell one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA, and CRISPR/Cas9 systems.
  • the modified immune effector cell of claim 137 wherein the modification comprises administering to the immune effector cell an sgRNA targeting an exon portion of the HLA-A gene.
  • the modified immune effector cell according to claim 138, wherein the sgRNA targeting the exon portion of the HLA-A gene comprises any one of SEQ ID NO:172 to SEQ ID NO:212 The nucleotide sequence shown.
  • modified immune effector cell according to any one of claims 137-139, wherein said modification further comprises administering to said immune effector cell an sgRNA targeting an exon portion of said TRAC gene.
  • modified immune effector cell according to any one of claims 137-141, wherein said modification further comprises administering a Cas enzyme to said cell.
  • the modified immune effector cell of claim 136, wherein the antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:213 to SEQ ID NO:216.
  • the modified immune effector cell of claim 145 wherein the CAR comprises an antigen binding domain, a hinge region, a transmembrane domain, an intracellular co-stimulatory signaling domain, and an intracellular signaling domain.
  • the modified immune effector cell according to any one of claims 147, wherein the tumor antigen is selected from the group consisting of CD19, CD20, CD22, CD33, BCMA, IL13Ra2, EGFR, Her2, GD2 and B7H3.
  • the modified immune effector cell according to any one of claims 146-148, wherein the antigen binding domain is selected from the group consisting of monoclonal antibodies, polyclonal antibodies, dimers, multimers, Multispecific antibodies, whole antibodies, antibody fragments, human antibodies, humanized antibodies, chimeric antibodies, Fv fragments, F(ab')2, single chain Fv (scFv) and single domain antibodies (VHH).
  • the antigen binding domain is selected from the group consisting of monoclonal antibodies, polyclonal antibodies, dimers, multimers, Multispecific antibodies, whole antibodies, antibody fragments, human antibodies, humanized antibodies, chimeric antibodies, Fv fragments, F(ab')2, single chain Fv (scFv) and single domain antibodies (VHH).
  • transmembrane domain comprising a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B , CD28, CD3 ⁇ (CD3e), 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4(CD244), Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM, DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L (CD154), TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
  • proteins selected from the group consisting of: CD8A, CD8B , CD28, CD3 ⁇ (CD3e), 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CT
  • said intracellular co-stimulatory signaling domain comprising an intracellular protein derived from one or more proteins selected from the group consisting of Costimulatory signaling domains: CD28, CD137, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM , DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
  • Costimulatory signaling domains CD28, CD137, CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7H3, 2B4, Fc ⁇ RI ⁇ , BTLA,
  • said intracellular signaling domain comprising an intracellular signal derived from one or more proteins selected from the group consisting of Transduction domains: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, DAP10, DAP-12 and Contains at least one ITAM domain.
  • Transduction domains CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14 Nef, DAP10, DAP-12 and Contains at least one ITAM domain.
  • said hinge region comprising a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1, IgG4 , IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
  • the modified immune effector cell comprising T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monoclonal Nuclear cells, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • modified immune effector cells are HLA-B heterozygous and consistent with both alleles of HLA-B in the subject, or the modified The immune effector cells are homozygous for HLA-B and identical to one of the subject's HLA-B alleles.
  • HLA-B homozygotes comprise HLA-B*40 homozygotes, HLA-B*15 homozygotes, HLA-B*46 homozygotes, HLA-B*13 homozygotes Zygote, HLA-B*51 homozygous, HLA-B*58 homozygous, HLA-B*07 homozygous, HLA-B*35 homozygous, HLA-B*44 homozygous, HLA-B*52 homozygous, HLA-B*57 homozygote, HLA-B*54 homozygote, HLA-B*55 homozygote.
  • the expression level and/or activity of the down-regulating gene comprises down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or making The expression and/or activity of the protein product encoded by the gene is downregulated.
  • the method of claim 168, wherein the modification comprises administering to the immune effector cells an sgRNA targeting an exonic portion of the HLA-A gene.
  • sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotides shown in any one of SEQ ID NO:172 to SEQ ID NO:212 sequence.
  • sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:157 to SEQ ID NO:171.
  • the Cas enzyme comprises a Cas9 protein.
  • antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:213 to SEQ ID NO:216.
  • said immune effector cells comprising T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
  • composition comprising the modified immune effector cell of any one of claims 128-158 and a pharmaceutically acceptable carrier.
  • the tumor comprises solid tumors and non-solid tumors.
  • the tumor is selected from the group consisting of liver cancer, gastric cancer, lung cancer, breast cancer, non-small cell lung cancer, B lymphocyte tumor, Hodgkin lymphoma , glioma, chronic myeloid leukemia, and acute myeloid leukemia.
  • the B7H3-Fc recombinant protein was immobilized on a CM5 chip using 10 mM acetate buffer, and the single domain antibody prepared above was used as the mobile phase to detect the binding ability of the single domain antibody obtained from the screening to the B7H3-Fc recombinant protein.
  • Running reagent containing 10mM N-(2-hydroxyethyl)piperazine-N-2sulfonic acid (HEPES), 150mM sodium chloride (NaCl), 3mM ethylenediaminetetraacetic acid (EDTA), 0.005% Tween-20 (Tween-20), the pH was adjusted to 7.4.
  • HEPES N-(2-hydroxyethyl)piperazine-N-2sulfonic acid
  • NaCl sodium chloride
  • EDTA 3mM ethylenediaminetetraacetic acid
  • Tween-20 Tween-20
  • Human IgG (Fc) capture kit including: mouse anti-human IgG (Fc) antibody, fixation reagent (sodium acetate, pH5.0), regeneration reagent (magnesium chloride).
  • Amino coupling kit including: N-hydroxysuccinimide (NHS), 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and ethanolamine (pH8. 5). Add 10mL of deionized water to each tube of EDC and NHS, and store in separate packages at -18°C or lower, with a shelf life of two months.
  • NHS N-hydroxysuccinimide
  • EDC 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride
  • ethanolamine pH8. 5
  • the mouse anti-human IgG (Fc) antibody was diluted with a fixative (sodium acetate, pH 5.0), and 950 ⁇ L of the fixation reagent was added to 50 ⁇ L of the mouse anti-human IgG (Fc) antibody for fixing eight channels.
  • a fixative sodium acetate, pH 5.0
  • 950 ⁇ L of the fixation reagent was added to 50 ⁇ L of the mouse anti-human IgG (Fc) antibody for fixing eight channels.
  • the surface of the CM5 chip was activated with EDC and NHS at a flow rate of 10 ⁇ L/min for 360 s.
  • the mouse anti-human IgG (Fc) antibody was injected into the channel (channel 1-8, Fc1, 2) for about 360s at a flow rate of 10 ⁇ L/min, and the fixed amount was about 7000 to 14000RU.
  • the chip was blocked with ethanolamine at 10 ⁇ L/min for 420 s.
  • the human B7H3 protein was subjected to buffer replacement using a desalting column and corresponding running reagents, and the concentration of the replaced sample was determined.
  • the reference channel (Fc1) does not require ligand capture.
  • the human B7H3 protein was diluted 2-fold with the running reagent.
  • the diluted human B7H3 protein was sequentially injected into the experimental channel and the reference channel at a flow rate of 30 ⁇ L/min, and the binding and dissociation time were corresponding. Both binding and dissociation steps are performed in the running reagent.
  • the chip After the analysis of each concentration, the chip needs to be regenerated with magnesium chloride at a flow rate of 20 ⁇ L/min for 30 seconds to wash away the ligand and undissociated analyte. For the next concentration analysis, the experimental channel needs to recapture the same amount of ligand.
  • the KD value of each sample was calculated using Biacore 8K analysis software Biacore Insight Evaluation Software.
  • the reference channel (Fc1) was used for background subtraction.
  • Results Table 1 shows that the B7H3 single domain antibodies 1A5 and 1G7 of the present application and their humanized antibodies all have high affinity to human B7H3 protein.
  • the anti-B7H3 CAR structure includes: a B7H3 antigen-binding region (derived from the anti-B7H3 single domain antibody 1A5, the amino acid sequence of which is shown in SEQ ID NO: 28), a CD8A extracellular hinge region, a CD8A transmembrane region, a 4-1BB intracellular co-stimulatory domain and a CD3 ⁇ activation signaling domain.
  • the amino acid sequence of the non-antigen binding domain of anti-B7H3 CAR is shown in SEQ ID NO:34, and the nucleotide sequence is shown in SEQ ID NO:38.
  • an anti-B7H3 CAR lentiviral expression vector was constructed, and the vector schematic diagram (see Figure 1). Optimization: select the commercial lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP as the backbone, and carry out element transformation on the basis of this vector. First, the ampicillin resistance gene ⁇ -lactamase of the vector was replaced with the aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance. Second, we deleted the CMV promoter and its adjacent downstream multiple cloning sites, which are potentially threatening for in vivo applications.
  • the copGFP gene expressed by the EF1 promoter in the original vector was deleted, the SalI restriction site was retained, and the SmaI restriction site was added at the 5' end of SalI for vector construction to form the final destination vector.
  • the added SmaI restriction site is a single restriction site for the final destination vector, and other sequence parts of the vector do not have this restriction site.
  • the non-limiting design principle of the sgRNA of the CRISPR/Cas9 system used in this example is: 5'-NNN(20)-NGG-3', NGG is called protospacer adjacent motif (PAM), wherein , N represents A, T, C or G.
  • PAM protospacer adjacent motif
  • sgRNAs Since many sgRNAs can be designed on the same exon, and sgRNAs consisting of 20 nucleotide sequences may appear repeatedly in the genome, use the website http://crispr.cos.uni-heidelberg.de to Carry out the design and evaluation of sgRNA, paste the exon sequence to this website, the website designs sgRNA and conducts prediction evaluation, the higher the score in the evaluation, it means that there may be higher editing efficiency and lower off-target risk, from which Select the sgRNA with higher score to test.
  • the sgRNA targeting the TRAC gene is shown in SEQ ID NO:157 to SEQ ID NO:171, the sgRNA targeting the HLA-A02 gene is shown in SEQ ID NO:172 to SEQ ID NO:193, and the targeting HLA-A11 gene
  • the sgRNA of the gene is shown in SEQ ID NO:194 to SEQ ID NO:204, and the sgRNA targeting the HLA-A24 gene is shown in SEQ ID NO:205 to SEQ ID NO:212, which were synthesized by GenScript Biotechnology Company.
  • HLA-B typing of the recipient select HLA-B homozygotes that match the HLA-B typing of the recipient.
  • the source of the donor is based on the HLA-B homozygote in the population.
  • One of the alleles of the patient's HLA-B is consistent with the donor's HLA-B homozygote.
  • Cells from these donors can cover a high number of patient populations . Reduce the rejection caused by the inconsistency of HLA-B subtypes.
  • HLA-B mainly selects B*40 homozygote, B*15 homozygote, B*46 homozygote, B*13 homozygote, B*51 homozygote, B*58 homozygote, B*07 homozygote with high frequency in the population Homozygote, B*35 homozygote, B*44 homozygote, B*52 homozygote, B*57 homozygote, B*54 homozygote, B*55 homozygote.
  • HLA-A selects A*02 homozygotes, A*11 homozygotes and A*02/A11 heterozygotes with higher frequencies in the population.
  • Peripheral blood was collected from healthy donors and diluted 1:1 with PBS buffer.
  • cell separation solution Ficoll
  • blood cell dilution solution very slowly along the tube wall, and centrifuge at 800g for 20min at room temperature (set the centrifuge to increase speed 1, reduce speed 0).
  • the liquid in the centrifuge tube is divided into PBS and serum layer, white blood cell layer, lymphocyte separation solution, and red blood cell layer from top to bottom.
  • remove the PBS and serum layer move the white blood cell layer to a new 50ml centrifuge tube, add PBS to 40ml to wash the cells, and centrifuge at 450g for 10min. After centrifugation, the supernatant was discarded to obtain peripheral blood mononuclear cells. Cell counts were performed after the cells were resuspended.
  • T cells in peripheral blood mononuclear cells were extracted using EasySep TM Human T Cell Separation Kit (purchased from StemCell Technologies, catalog number: 17951). Adjust the PBMC density to 5 ⁇ 10 7 cells/ml, and add PBS buffer in the range of 0.25-2ml; first add cocktail to mix well, then add isolation cocktail at 50 ⁇ l/ml, mix well and place at room temperature for 5 minutes; shake RapidSpheres by vortex After vortexing for 30s, add 40 ⁇ l/ml to the cells and mix well; add buffer to the multiple of 2.5ml, and gently blow up and down 2-3 times; add 2.5ml to each tube respectively, and put Place the cryovial on the magnetic stand, and let it stand at room temperature for 3 minutes; gently open the cap of the cryovial, carefully hold the two sides to pick up the magnetic stand, keep it upside down for 2-3 seconds, and pour the cell solution into a new centrifuge tube at one time; use 10 - After resuspending the cells in 20ml buffer (dependured
  • CD3+T cells D0 days
  • activate them with CD3/CD28 antibody magnetic beads
  • lentiviral vector anti-B7H3 CAR lentiviral expression vector prepared in Example 1 transfection on D1 day after activation.
  • the lentiviral vector was washed out on D2, and electroporation was performed on D3.
  • TRAC sgRNA AGAGTCTCTCAGCTGGTACA (SEQ ID NO: 157), A02 sgRNA: CTGACCATGAAGCCACCCCTG (SEQ ID NO: 174), A11 sgRNA: GGCCCCTCCTGCTCTATCCA (SEQ ID NO: 204).
  • Sorting CD3-negative T cells centrifuging after counting cells, discarding supernatant; resuspending cells with buffer and mixing, adding CD3 magnetic beads to 20ul CD3 magnetic beads/ 107 cells, mixing evenly, and incubating in a 4-degree refrigerator.
  • Cell harvesting Collect cells in a centrifuge tube and discard after centrifugation, wash the cells again with normal saline, centrifuge, prepare a cryopreservation solution, resuspend the centrifuged cells in the cryopreservation solution, and draw the cell suspension into the final product with a cell freezer In the storage bag, label the cell cryopreservation bag for the next step of freezing.
  • Knockout efficiency (AB)/A ⁇ 100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.
  • B7H3 target cells PANC-1-Luciferase; adjust the state of the target cells to the logarithmic growth phase, and need to be continuously passaged twice before the experiment;
  • the target cells were resuspended in 1640+10% FBS, and three 24-well plates were taken for each target site, and the target cells were inoculated according to the amount of 2x10 ⁇ 5/well. (Both target cells and effector cells were seeded at a density of 2x10 ⁇ 6/ml). Then add effector cells according to the E/T (effect-to-target ratio, effector cells: target cells) ratio. Fill each well to the maximum volume (such as 600ul). The control was inoculated with the same number of target cells without adding effector cells (600ul). The well plate was placed in a 5% CO 2 , 37° C. incubator and incubated for 24 hours. E/T: 1:2, 1:1, 2:1, 5:1, 10:1 plank, repeat three times.
  • Anti-B7H3 CAR-T cells and anti-B7H3 UCAR-T had significant killing effect on PANC-1-Luciferase cells.
  • Anti-B7H3 UCAR-T cells can achieve a killing efficiency of more than 90% when the effect-to-target ratio is 10:1 (see Figure 5).
  • mice 8-10-week-old NSG mice were subcutaneously injected with tumor cell PANC-1-Luciferase-GFP (5x10 ⁇ 6). The mice were divided into three groups with 5 mice in each group. The tumor formation time was generally 2-4 weeks. Anti-B7H3 UCAR-T cells, anti-B7H3 CAR-T cells, and non-gene knockout T cells 5E6 were injected intratumorally into each group of mice, at a single point injection, with an injection volume of 50ul. Tumor regression in mice was monitored by luciferase.
  • mice Fifteen humanized immune system mice (hHSC-NCG) were prepared and divided into 3 groups. Preparation of cells, experimental group anti-B7H3 UCAR-T cells (knockout TRAC+HLA-A02); control group 1: anti-B7H3 CAR-T; control group 2: anti-B7H3 UCAR-T cells (knockout TRAC+B2M ); each mouse was injected with 1x10 ⁇ 7 cells, and blood was collected at different time points D0, 2h, D3, D7, D14, D21, D28, D35, D42, D49, D56, D60. Genomes were extracted from blood samples at different time points, and the copy/ng genome DNA was calculated by QPCR absolute quantification method. The positive control used UCAR-T cells harvested on the 14th day, and the negative control used DEPC water.
  • GVHD response Prepare TRAC, HLA-A double-knockout T cells, T cells without gene knockout, irradiate allogeneic PBMC, stimulate the two groups of cells prepared respectively, and detect the level of IFN-r.
  • Allogeneic reaction Allogeneic PBMC stimulated the cells of the two groups after irradiation, and detected the level of IFN-r.
  • mice co-inject 5 ⁇ 10 6 TCR-HLA-A-double-negative anti-B7H3 UCAR-T cells and 5 ⁇ 10 6 allogeneic T cells into NSG mice.
  • Control group Inject 5 ⁇ 10 6 TCR-B7H3 UCAR-T cells and 5 ⁇ 10 6 allogeneic T cells into NSG mice.
  • GVHD response observe graft-versus-host response through clinical indicators: survival rate, fur texture and skin integrity, etc.
  • Cytokine detection Peripheral blood serum was collected to detect the levels of cytokines such as IL6, IL-2, TNF- ⁇ , IFN- ⁇ , etc. Blood collection time: before reinfusion, 24h, D3, D7, D14, D28, 2M. Detection of organ lesions: At the end of the observation period (about 2 months), the spleen, liver, skin, gastrointestinal tract, lung, and kidney of the mice were taken for HE section staining analysis.
  • mice injected with untreated T cells developed lethal graft-versus-host disease (GVHD) within 2 months of injection. None of the mice receiving TRAC, HLA-A double knockout cells developed GVHD; the TRAC, HLA-A double knockout T cell group secreted very low levels of cytokines IL6, IL-2, TNF- ⁇ , IFN- ⁇ ; and The morphology of different organs of the mice was normal. It shows that TRAC, HLA-A double-knockout T cell group greatly reduces the GVHD response.
  • GVHD lethal graft-versus-host disease
  • Allogeneic reaction prepare TRAC, HLA-A double-knockout CAR-T cells, co-inject 1x10 ⁇ 7 TCR-HLA-A-double-knockout CAR-T cells and 2x10 ⁇ 6 allogeneic T cells into NSG small mouse body.
  • Control group Inject 1x10 ⁇ 7 TCR - CAR-T cells into NSG mice.
  • Control group transfer to CAS9+ODN label
  • On-target and off-target-WGS (Whole genome sequencing): On D14, 1 ⁇ 10 ⁇ 6 T cells without gene knockout, TRAC, and HLA-A double-knockout T cells were collected and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. detection.
  • Result analysis double-knockout T cells (TRAC+HLA-A) detected whether chromosomal translocation occurred on D14 (harvest).
  • the detection results the detection values of both translocation methods were close to zero detection value, indicating that no rearrangement of the loci occurred ( See Figure 10).
  • Residual Cas9 protein During cell preparation, 1 ⁇ 10 ⁇ 6 cells at each of the three time points before knockout, after knockout, and before harvest were lysed, and then protein quantification kit (NOVATEINBIO, Cat. No. NB-E1372PR ) for quantification, the samples in each group were adjusted to the same loading volume of 2 ⁇ g, and the CRISPR/Cas9 protein ELISA kit was used for detection according to the instructions.
  • the Cas9 protein in the sample is firmly and stably placed on the test paper well. Then use the detection antibody to recognize the bound Cas9 protein, and then develop with the developer.
  • the Cas9 ratio is proportional to the absorbance, and the absolute amount of Cas9 protein is quantified by comparing with the Cas9 control.
  • Double knockout T cells detected the residue of spCas9 at four time points before electroporation (D3), before electroporation (D5), D9, and D14 (harvest). Trace residues were detected before solution (D5), but not detected at the other three time points. (See Figure 12).
  • the RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance.
  • the sgRNA sequence of TRAC is sg9 (as shown in SEQ ID NO:157)
  • the sgRNA sequence of HLA-A is HLA-A02 Sg2 (as shown in SEQ ID NO:173) or HLA-A02 Sg5 (as shown in SEQ ID NO:173) SEQ ID NO:174) or HLA-A11 sg21 (as shown in SEQ ID NO:204) or HLA-A11 Rsg2 (as shown in SEQ ID NO:203)
  • 10 ⁇ g of Cas9 protein purchased from thermo, product number A36499
  • Example 2 Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100 ⁇ l of prepared electroporation buffer .
  • Add the preheated medium into the electro-cup then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO 2 incubator for culture.
  • Knockout efficiency (AB)/A ⁇ 100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.
  • the three detection results of TRAC single gene knockout are shown in Figure 13 to Figure 15, and the knockout efficiency calculation results are shown in Table 2.
  • the three detection methods are basically the same, and only the Sanger sequencing method was used to detect the editing efficiency in subsequent experiments.
  • the RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number: V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance.
  • TRAC Sg9 20 ⁇ g TRAC sgRNA (TRAC Sg9), 20 ⁇ g HLA-A sgRNA (HLA-A02 Sg2 or HLA-A02 Sg5 or HLA-A11 sg21 or targeting HLA-A*24:02:01, HLA-A A*30:01:01:01, HLA-A*33:01:01:01, HLA-A*03:01:01:01, HLA-A*01:01:01:01, or HLA-A* 26:01:01:01:01 sgRNA) into PCR tubes (no RNA), and then add 10 ⁇ g Cas9 protein (purchased from thermo, product number A36499) respectively, mix gently, and incubate at room temperature for 12 minutes.
  • Cas9 protein purchased from thermo, product number A36499
  • Example 2 Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100 ⁇ l of prepared electroporation buffer .
  • Add the preheated medium into the electro-cup then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO 2 incubator for culture.
  • the double-gene knockout efficiency is detected by sequencing, and TRAC-negative and HLA-A-negative T cells with a double-gene knockout efficiency of not less than 80% can be obtained.
  • the results are shown in Figure 20-21.
  • Figure 20A shows the result of using HLA-A02 Sg5 to knock out HLA-A02, wherein the upper row shows the results of the control group (that is, without using HLA-A02 Sg5 to knock out); the next row shows the simultaneous knockout of HLA -The results of A02 and TRAC;
  • Figure 20B shows the results of knocking out TRAC using TRAC Sg9, where the upper line shows the results of the control group (that is, no knocking out with TRAC Sg9); the next line shows simultaneous knockout HLA-A02 and TRAC results.
  • Figure 21A-21B shows the knockout situation of knockout HLA-A02 and TRAC protein level, wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A double knockout refers to the simultaneous knockout of HLA- Results of A02 and TRAC.
  • Example 13 Differences in the expression of TRAC gene, HLA-A gene, B2M gene and CIITA gene in T cells with double gene knockout and corresponding genes in corresponding cells
  • Example 2 The activated T cells prepared in Example 2 were divided into two groups, one group was used as a control, and the other group prepared TRAC gene and HLA-A gene double gene knockout T cells according to the method in Example 5, according to Sanger sequencing was performed in the manner of step (1) of Example 4. According to the sequencing results, the TRAC and HLA-A double gene knockout cells were obtained.
  • the prepared double gene knockout T cells are incubated with corresponding TRAC and HLA-A antibodies, and the double gene knockout cell lines can be obtained by flow sorting or magnetic bead sorting.
  • RNA extraction kit purchased from QIAGEN, catalog number: 74004
  • reverse transcription kit purchased from Applied Biosystems, catalog number: 4368814
  • FIG. 22-23 shows the results.
  • Fig. 22 shows the mRNA level determination of gene expression, and wherein Fig. 22 shows the mRNA level of TRAC, HLA-A, B2M and CIITA;
  • WT refers to the situation without any knockout treatment
  • double knockout group refers to TRAC gene and HLA-A gene double knockout T cells results.
  • Figure 23 shows the protein level determination of gene expression, wherein Figure 23A-23B shows the protein expression levels of B2M and CIITA respectively; wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A Double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.
  • Example 14 Prepare TRAC gene, HLA-A/B2M gene and CIITA gene knockout T cells and verify the expression changes of the corresponding three genes
  • TRAC, HLA-A and CIITA genes in TRAC, HLA-A and CIITA gene knockout T cells were down-regulated; compared with control cells, TRAC, B2M and CIITA triple gene knockout The protein expressions of TRAC, HLA-A and CIITA genes were down-regulated in T cells.
  • FIGS 24A-24D show the knockout status of TRAC, HLA-A and B2M protein levels in sequence.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to TRAC, The result of the T cells of HLA-A and CIITA triple gene knockout
  • TRAC+B2M+CIITA triple knockout refers to the result of B2M, CIITA and TRAC triple gene knockout of T cells
  • TRAC+HLA-A knockdown refers to Example 16 Results of preparation of TRAC and HLA-A knockdown T cells.
  • Figure 24D shows the knockdown of CIITA protein levels.
  • Embodiment 15 designs antisense RNA sequence
  • RNA sequences of the corresponding genes (TRAC gene and HLA-A gene) through the database https://www.ncbi.nlm.nih.gov/ or www.ensembl.org/, and design siRNA with reference to the following principles:
  • the designed antisense RNA sequences include HLA-A-homo-551; HLA-A-homo-NEG; TRAC-homo-375; TRAC-homo-NEG.
  • Double gene knockdown was performed using the antisense RNA designed by Example 15.
  • the company prepares lentivirus (Gimma) with antisense RNA sequences of TRAC gene and HLA-A gene.
  • CD3 + T cells were prepared according to the method in Example 2 (D0 days), and activated with CD3/CD28 antibody magnetic beads, and the activated T cells were transfected with lentiviruses carrying the antisense RNA sequences of the TRAC gene and the HLA-A gene (D1 day), wash off the lentiviral vector on D2, and continue to culture until D5.
  • the T cells cultured to D5 days were collected, and the gene knockdown efficiency was detected by quantitative PCR or Western Blot and other methods.
  • T cells with TRAC gene and HLA-A gene knockdown can be obtained by flow sorting or magnetic bead sorting.
  • the results showed that the mRNA and protein expression levels of TRAC and HLA-A were down-regulated in the TRAC and HLA-A gene knockdown group.
  • Figures 25A-25B sequentially show the knockout status of TRAC and HLA-A mRNA levels.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.
  • the knockout levels of TRAC and HLA-A protein levels can be referred to the results in FIG. 24 .
  • T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 12, 14 and 16 compare the cell counts of several T cell activities in each group and take them respectively 1*10 6 cells were inoculated in a 24-well plate, and PHA (0.3 ⁇ g/ml) (ionomycin +) or 5 ng/ml PMA and 50 ng/ml ionomycin were added to the cells in each well, and after continuing to culture for 5 hours, use CD69 (early activation) (purchased from BD Biosciences, catalog number: FN50) and CD137 (late stage) (purchased from BD Biosciences, catalog number: 4B4-1) antibodies were used to detect the activation status of cells by flow cytometry. The results showed that the activity of T cells with double gene knockout and double gene knockout was better than that of triple gene knockout T cells.
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to TRAC
  • the result of the T cells of HLA-A and CIITA triple gene knockout wherein TRAC+B2M+CIITA triple knockout refers to the result of B2M, CIITA and TRAC triple gene knockout of T cells
  • TRAC+HLA-A knockdown refers to Example 16 Results of preparation of TRAC and HLA-A knockdown T cells.
  • T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 12, 14 and 16 were labeled with CFSE (invitrogen, C34554), and the cell counts were taken as 1 *10 6 cells were co-cultured with NK cells (NK92MI) at a ratio of 1:1. After 24 hours, the co-cultured cells were collected, and the ratio of CFSE-positive cells in the mixed cells was detected by flow cytometry.
  • NK+T refers to the situation in which NK cells are co-cultured with T cells without any knockout treatment
  • NK+TRAC+HLA-A knockdown refers to the combination of NK cells with the TRAC gene and HLA-A gene prepared in Example 16
  • the results of the knockdown T cells co-culture NK+TRAC+HLA-A double knockout refers to the co-culture of NK cells and T cells with TRAC gene and HLA-A gene double gene knockout
  • NK+TRAC+HLA -A+CIITA triple knockout refers to the situation where NK cells are co-cultured with TRAC, HLA-A and CIITA triple knockout T cells
  • NK+TRAC+B2M+CIITA triple knockout refers to the situation where NK cells are combined with B2M
  • No gene knockout, double gene knockout, three gene knockout and double gene knockdown T cells in Examples 2, 12, 14 and 16 were prepared from peripheral blood from donor 1.
  • CD3 + T cells were prepared from peripheral blood from donor 2.
  • Each group of cells prepared from the peripheral blood of donor 1 was mixed with the CD3 + T cells prepared from the peripheral blood of donor 2 in equal proportions, and the expression level of IFN- ⁇ in the cell mixed system was detected 24 hours later. The results showed that the expression level of IFN- ⁇ in the double gene knockout T cell group was lower than that in the triple gene knockout T cell group.
  • TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA Triple knockout refers to the result of T cells knocked out by three genes of TRAC, HLA-A and CIITA
  • TRAC+B2M+CIITA triple knockout refers to the result of T cells knocked out by three genes of B2M, CIITA and TRAC
  • TRAC+HLA-A knockout Low refers to the result of TRAC gene and HLA-A gene knockdown T cells prepared in Example 16.
  • Example 20 Preparation of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout of TRAC gene, HLA-A gene and CIITA gene, and knockout of TRAC gene, B2M gene and CIITA gene Removed CAR-T cells
  • TRAC gene and HLA-A gene double gene knockout cells according to the methods in Example 12 and Example 14 respectively, TRAC gene, HLA-A gene and CIITA gene as well as TRAC gene, B2M gene and CIITA gene knockout CAR-T cells.
  • the double-gene knockout and triple-gene knockout CAR-T cells can be obtained through flow cytometry detection, and the yield of double-gene knockout CAR-T cells is higher than that of triple-gene knockout CAR-T cells.
  • Figures 29A-29D show the knockout status of TRAC, HLA-A and B2M protein levels in sequence.
  • Figure 29D shows the knockdown of CIITA protein levels.
  • WT refers to the situation without any knockout treatment
  • TRAC+HLA-A double knockout refers to the result of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene
  • TRAC+HLA-A+CIITA triple knockout refers to The results of CAR-T cells with triple gene knockout of TRAC, HLA-A and CIITA
  • TRAC+B2M+CIITA triple knockout refers to the results of CAR-T cells with triple gene knockout of B2M, CIITA and TRAC.
  • the transfection efficiency of CD19CAR is shown in Figure 30A-30B.
  • CAR30%+ represents the transfection efficiency of CD19CAR.
  • Figure 31 shows the expansion factor of different cells. Among them, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene had the highest amplification factor.
  • Figure 32 shows the killing effect of Raji-Luciferase on CD19 target cells, among which the killing effect of CAR-T cells with double knockout of TRAC gene and HLA-A gene is the most significant.
  • each E/T ratio is the result corresponding to the legend of A-D from left to right.
  • NSG mice were injected with tumor cells intravenously. After the tumor was successfully established, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout, or CAR-T cells without gene knockout were reinfused into the mice. T cells, monitoring tumor volume in mice.
  • the tumor growth rate was significantly slowed down in mice transfused with double-gene knockout CAR-T cells.
  • Figure 33 shows the administration method to mice, i.v. means intravenous injection, and CAR-T cells represent double-gene knockout CAR-T cells expressing CD19 CAR and triple-gene knockout CAR-T cells.
  • Figure 34 shows the volume of tumors in mice after administration of CAR-T cells. Among them, from left to right in Figure 34, the CD19 CAR-T cells, TRAC, HLA-A and CIITA three genes were administered with normal saline, unmodified T cells, TRAC gene and HLA-A gene double gene knockout respectively. Tumor volume in mice after knockout CD19 CAR-T cells, B2M, CIITA and TRAC knockout CD19 CAR-T cells. The results showed that the growth rate of tumors was significantly slowed down in mice transfused with CAR-T cells with double gene knockout of TRAC gene and HLA-A gene.
  • This application prepares a chimeric antigen receptor targeting B7H3.
  • the antigen-binding domain of the recombinant receptor is derived from a nanobody, which has the characteristics of small molecular weight and stable structure.
  • the present application provides a lentiviral expression vector.
  • pCDH-CMV-MCS-EF1-copGFP as the backbone, the ampicillin resistance gene ⁇ -lactamase of the vector was replaced with aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance;
  • the potentially threatening CMV promoter and its adjacent downstream multiple cloning sites in in vivo applications; delete the copGFP gene expressed by the EF1 promoter in the original vector, retain the SalI restriction site, and add it at the 5' end of SalI
  • the SmaI restriction site is used for vector construction to form the final destination vector.
  • This application optimizes the protein-RNA complex electrotransfection technology. A double gene knockout efficiency of more than 90% in primary T cells was obtained.
  • the source of donors for this application is based on the high frequency of HLA-B homozygotes in the population.
  • One allele of the patient’s HLA-B is consistent with the donor’s homozygosity.
  • Cells from these donors can cover a high number of patients population, and can reduce the rejection caused by HLA-B.
  • This application screened out the HLA-A molecules that are highly related to rejection and knocked them out, while retaining other HLA-I molecules, which not only reduced the rejection of allogeneic cells, but also avoided the complete knockout of HLA molecules being NK
  • the occurrence of cell clearance greatly prolongs the half-life of allogeneic CAR-T cells in vivo.
  • This application is the first to construct high-efficiency double-knockout TCR, HLA-A anti-B7H3-UCAR-T cells, to achieve a safe shelf-type ready-to-use therapeutic agent, improve anti-tumor effect, and is used for including adrenal gland Cortical cancer, bladder cancer, breast cancer, cholangiocarcinoma, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, sarcoma, melanoma tumor, gastric cancer, thymus cancer, endometrial cancer and other diseases.
  • adrenal gland Cortical cancer bladder cancer, breast cancer, cholangiocarcinoma, colorectal cancer, lymphoma, esophageal cancer, glioma, head and neck squamous cell carcinoma, kidney cancer, liver cancer, lung cancer, ovarian cancer, pancreatic cancer,

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/CN2022/103070 2021-07-01 2022-06-30 靶向b7h3的抗原结合多肽及其应用 Ceased WO2023274384A1 (zh)

Priority Applications (9)

Application Number Priority Date Filing Date Title
AU2022301099A AU2022301099A1 (en) 2021-07-01 2022-06-30 Antigen-binding polypeptide targeting b7h3 and application thereof
JP2023580778A JP2024527557A (ja) 2021-07-01 2022-06-30 B7h3を標的とする抗原結合ポリペプチド及びその応用
KR1020247003777A KR20240027117A (ko) 2021-07-01 2022-06-30 B7h3을 표적으로 하는 항원 결합 폴리펩티드 및 이의 응용
MX2023015153A MX2023015153A (es) 2021-07-01 2022-06-30 Polipéptido de unión a antígeno que se dirige a b7h3 y aplicación del mismo.
CA3224476A CA3224476A1 (en) 2021-07-01 2022-06-30 Antigen-binding polypeptide targeting b7h3 and application thereof
CN202280004519.XA CN115916833B (zh) 2021-07-01 2022-06-30 靶向b7h3的抗原结合多肽及其应用
US18/575,650 US12133890B2 (en) 2021-07-01 2022-06-30 Antigen-binding polypeptide targeting B7H3 and application thereof
EP22832196.4A EP4365203A4 (en) 2021-07-01 2022-06-30 ANTIGEN-BINDING POLYPEPTIDE TARGETING B7H3 AND ITS APPLICATION
ZA2024/01043A ZA202401043B (en) 2021-07-01 2024-01-31 Antigen-binding polypeptide targeting b7h3 and application thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202110749481.6 2021-07-01
CN202110749481 2021-07-01

Publications (1)

Publication Number Publication Date
WO2023274384A1 true WO2023274384A1 (zh) 2023-01-05

Family

ID=84690474

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/103070 Ceased WO2023274384A1 (zh) 2021-07-01 2022-06-30 靶向b7h3的抗原结合多肽及其应用

Country Status (10)

Country Link
US (1) US12133890B2 (https=)
EP (1) EP4365203A4 (https=)
JP (1) JP2024527557A (https=)
KR (1) KR20240027117A (https=)
CN (1) CN115916833B (https=)
AU (1) AU2022301099A1 (https=)
CA (1) CA3224476A1 (https=)
MX (1) MX2023015153A (https=)
WO (1) WO2023274384A1 (https=)
ZA (1) ZA202401043B (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117924518A (zh) * 2024-01-05 2024-04-26 苏州艾凯利元生物科技有限公司 用于nk细胞的嵌合抗原受体及工程化的nk细胞
WO2024094165A1 (zh) * 2022-11-04 2024-05-10 茂行制药(苏州)有限公司 靶向b7h3的通用型car-t细胞及其制备方法和应用
WO2024193450A1 (en) * 2023-03-17 2024-09-26 Beigene Switzerland Gmbh Anti-b7h3 antibodies and methods of use
WO2025219520A1 (en) * 2024-04-18 2025-10-23 Match Medicines Gmbh MODIFIED HUMAN T CELL WITH A REDUCED HLA-Ia REPERTOIRE AND METHOD OF PRODUCTION

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119486745A (zh) * 2023-05-24 2025-02-18 茂行制药(苏州)有限公司 用于靶向b7h3的同种异体嵌合抗原受体t细胞的给药的方法和组合物
CN118829656B (zh) * 2023-12-01 2026-04-24 苏州智核生物医药科技有限公司 B7h3结合多肽及其用途
WO2025255308A1 (en) * 2024-06-07 2025-12-11 Intellia Therapeutics, Inc. Cd8 co-receptor chimeric polypeptides in tcr cell therapy

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002048193A2 (en) * 2000-12-13 2002-06-20 Unilever N.V. Camelidae antibody arrays
WO2009068631A1 (en) * 2007-11-27 2009-06-04 Ablynx N.V. Method for obtaining polypeptide constructs comprising two or more single domain antibodies
WO2014072888A1 (en) 2012-11-07 2014-05-15 Pfizer Inc. Anti-il-13 receptor alpha 2 antibodies and antibody-drug conjugates
WO2020076970A1 (en) * 2018-10-11 2020-04-16 Inhibrx, Inc. B7h3 single domain antibodies and therapeutic compositions thereof
WO2021041725A1 (en) 2019-08-27 2021-03-04 The Trustees Of The Univeristy Of Pennsylvania SYNTHETIC CARS TO TREAT IL13Rα2 POSITIVE HUMAN AND CANINE TUMORS
WO2021081052A1 (en) * 2019-10-22 2021-04-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services High affinity nanobodies targeting b7h3 (cd276) for treating multiple solid tumors
CN113061580A (zh) * 2020-01-02 2021-07-02 江苏茂行科技有限公司 一种经修饰的免疫效应细胞及其制备方法

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190136230A1 (en) * 2016-05-06 2019-05-09 Juno Therapeutics, Inc. Genetically engineered cells and methods of making the same
EP4029943A1 (en) * 2017-05-08 2022-07-20 Precision Biosciences, Inc. Nucleic acid molecules encoding an engineered antigen receptor and an inhibitory nucleic acid molecule and methods of use thereof
KR20200075851A (ko) * 2017-10-19 2020-06-26 셀렉티스 개선된 면역 세포들 치료를 위한 nk 억제제들의 타겟인 유전자 통합
WO2020010239A1 (en) * 2018-07-06 2020-01-09 The Board Of Trustees Of The Leland Stanford Junior University Chimeric antigen receptor polypeptides and methods of using same
CN112390892B (zh) * 2019-08-14 2024-01-12 博源润生医药(杭州)有限公司 一种嵌合抗原受体以及表达该嵌抗原受体的免疫效应细胞

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002048193A2 (en) * 2000-12-13 2002-06-20 Unilever N.V. Camelidae antibody arrays
WO2009068631A1 (en) * 2007-11-27 2009-06-04 Ablynx N.V. Method for obtaining polypeptide constructs comprising two or more single domain antibodies
WO2014072888A1 (en) 2012-11-07 2014-05-15 Pfizer Inc. Anti-il-13 receptor alpha 2 antibodies and antibody-drug conjugates
WO2020076970A1 (en) * 2018-10-11 2020-04-16 Inhibrx, Inc. B7h3 single domain antibodies and therapeutic compositions thereof
WO2021041725A1 (en) 2019-08-27 2021-03-04 The Trustees Of The Univeristy Of Pennsylvania SYNTHETIC CARS TO TREAT IL13Rα2 POSITIVE HUMAN AND CANINE TUMORS
WO2021081052A1 (en) * 2019-10-22 2021-04-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services High affinity nanobodies targeting b7h3 (cd276) for treating multiple solid tumors
CN113061580A (zh) * 2020-01-02 2021-07-02 江苏茂行科技有限公司 一种经修饰的免疫效应细胞及其制备方法

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877 - 883
CHOTHIALESK, J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
FASEB J., vol. 9, 1995, pages 133 - 139
HUSTON ET AL.: "Protein Engineering of Antibody Binding Sites: Recovery of Specific Activity in an Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichia coli", PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 5879 - 5883, XP000872837, DOI: 10.1073/pnas.85.16.5879
KANG XIAOZHEN ET AL., CHINESE JOURNAL OF BIOTECHNOLOGY, vol. 34, no. 12, 2018, pages 1974 - 1984
LEE, M. ET AL.: "Advanced Genetic Engineering to Achieve In Vivo Targeting of Adenovirus Utilizing Camelid Single Domain Antibody", JOURNAL OF CONTROLLED RELEASE, vol. 334, 16 April 2021 (2021-04-16), XP086603144, DOI: 10.1016/j.jconrel.2021.04.009 *
MACCALLUM, J MOL BIOL, vol. 262, no. 5, 1996, pages 732 - 45
MILLER ET AL., JOUR, OF IMMUNOLOGY, vol. 170, 2003, pages 4854 - 4861
MUYLDERMANS S., JBIOTECHNOL., vol. 74, 2001, pages 277 - 302
NGUYEN V.K. ET AL., THE EMBO JOURNAL, vol. 19, 2000, pages 921 - 930
P. ET AL., ANTIVIRAL RESEARCH, vol. 92, 2011, pages 389 - 407
See also references of EP4365203A4
TANG XIN, WANG YUELONG, HUANG JIANHAN, ZHANG ZONGLIANG, LIU FUJUN, XU JIANGUO, GUO GANG, WANG WEI, TONG AIPING, ZHOU LIANGXUE: "Administration of B7-H3 targeted chimeric antigen receptor-T cells induce regression of glioblastoma", SIGNAL TRANSDUCTION AND TARGETED THERAPY, vol. 6, no. 1, XP093018820, DOI: 10.1038/s41392-021-00505-7 *
WARD ET AL.: "Binding Activities of a Repertoire of Single Immunoglobulin Variable Domains Secreted From Escherichia coli", NATURE, vol. 341, 1989, pages 544 - 546
ZHANG GUIZHEN, YU ZUJIANG; HAN SHUANGYIN: "Progress in B7-H3 targeted CAR-T cells for immunotherapy of solid tumors", ZHONGGUO MIANYIXUE ZAZHI = CHINESE JOURNAL OF IMMUNOLOGY, JILIN SHENG YIXUE QIKANSHE, CN, 23 June 2021 (2021-06-23), CN , pages 2650 - 2655, XP093018819, ISSN: 1000-484X, DOI: 10.3969/j.issn.1000-484X.2022.21.018 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024094165A1 (zh) * 2022-11-04 2024-05-10 茂行制药(苏州)有限公司 靶向b7h3的通用型car-t细胞及其制备方法和应用
WO2024193450A1 (en) * 2023-03-17 2024-09-26 Beigene Switzerland Gmbh Anti-b7h3 antibodies and methods of use
CN117924518A (zh) * 2024-01-05 2024-04-26 苏州艾凯利元生物科技有限公司 用于nk细胞的嵌合抗原受体及工程化的nk细胞
WO2025219520A1 (en) * 2024-04-18 2025-10-23 Match Medicines Gmbh MODIFIED HUMAN T CELL WITH A REDUCED HLA-Ia REPERTOIRE AND METHOD OF PRODUCTION

Also Published As

Publication number Publication date
US20240269283A1 (en) 2024-08-15
US12133890B2 (en) 2024-11-05
CN115916833B (zh) 2023-10-03
JP2024527557A (ja) 2024-07-25
CA3224476A1 (en) 2023-01-05
CN115916833A (zh) 2023-04-04
KR20240027117A (ko) 2024-02-29
AU2022301099A1 (en) 2024-02-15
EP4365203A4 (en) 2025-09-24
EP4365203A1 (en) 2024-05-08
ZA202401043B (en) 2025-04-30
MX2023015153A (es) 2024-04-16

Similar Documents

Publication Publication Date Title
US20250230217A1 (en) Methods for improving the efficacy and expansion of immune cells
CN115916833B (zh) 靶向b7h3的抗原结合多肽及其应用
JP7303749B2 (ja) Tim-1を標的とするキメラ抗原受容体
US20210347851A1 (en) Cd19 chimeric antigen receptor (car) and cd22 car combination therapies
US20220047633A1 (en) Cd22 chimeric antigen receptor (car) therapies
US9573988B2 (en) Effective targeting of primary human leukemia using anti-CD123 chimeric antigen receptor engineered T cells
KR102859548B1 (ko) 메소텔린 양성 암을 치료하기 위한 조성물 및 방법
CN114269372A (zh) 嵌合抗原受体t细胞和nk细胞抑制剂用于治疗癌症的用途
WO2023274385A1 (zh) 靶向her2的通用型car-t细胞及其制备方法
EP4620978A1 (en) Universal car-t cell targeting b7h3, and preparation method therefor and use thereof
EP4364746A1 (en) UNIVERSAL CAR-T CELL TARGETING IL13Ra2, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF
US20240139321A1 (en) Universal car-t cell targeting gd2, preparation method therefor, and application thereof
WO2023274386A1 (zh) 靶向egfr的通用型car-t细胞及其制备方法
EA050876B1 (ru) Антигенсвязывающий полипептид, нацеленный на b7h3, и его применение
HK40087387A (zh) 靶向b7h3的抗原结合多肽及其应用
HK40087387B (zh) 靶向b7h3的抗原结合多肽及其应用
HK40111889A (en) UNIVERSAL CAR-T CELL TARGETING IL13Rα2, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF
HK40085140A (en) UNIVERSAL CAR-T CELL TARGETING IL13Rα2, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF
TWI915404B (zh) 用於治療egfr陽性癌症之組合物及方法
HK40109832A (zh) 靶向b7h3的通用型car-t细胞及其制备方法和应用
CN118271440A (zh) 靶向IL13Rα2的抗体以及靶向IL13Rα2的免疫效应细胞
WO2024240248A1 (zh) 用于靶向b7h3的同种异体嵌合抗原受体t细胞的给药的方法和组合物
HK40072740A (en) Use of chimeric antigen receptor t cells and nk cell inhibitors for treating cancer
TW202214846A (zh) 用於治療egfr陽性癌症之組合物及方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22832196

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/015153

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2023580778

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12023553553

Country of ref document: PH

Ref document number: 202393549

Country of ref document: EA

Ref document number: 3224476

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 202417005664

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 20247003777

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022832196

Country of ref document: EP

Ref document number: AU2022301099

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022832196

Country of ref document: EP

Effective date: 20240201

ENP Entry into the national phase

Ref document number: 2022301099

Country of ref document: AU

Date of ref document: 20220630

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 11202309897V

Country of ref document: SG