WO2023229403A1 - Ydjc 억제제 스크리닝 방법 - Google Patents

Ydjc 억제제 스크리닝 방법 Download PDF

Info

Publication number
WO2023229403A1
WO2023229403A1 PCT/KR2023/007202 KR2023007202W WO2023229403A1 WO 2023229403 A1 WO2023229403 A1 WO 2023229403A1 KR 2023007202 W KR2023007202 W KR 2023007202W WO 2023229403 A1 WO2023229403 A1 WO 2023229403A1
Authority
WO
WIPO (PCT)
Prior art keywords
ydjc
screening method
inhibitor
enzyme reaction
galnac
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2023/007202
Other languages
English (en)
French (fr)
Inventor
이창훈
이병일
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Cancer Center Japan
National Cancer Center Korea
Industry Academic Cooperation Foundation of Dongguk University
Original Assignee
National Cancer Center Japan
National Cancer Center Korea
Industry Academic Cooperation Foundation of Dongguk University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Cancer Center Japan, National Cancer Center Korea, Industry Academic Cooperation Foundation of Dongguk University filed Critical National Cancer Center Japan
Priority claimed from KR1020230067450A external-priority patent/KR102909685B1/ko
Publication of WO2023229403A1 publication Critical patent/WO2023229403A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/145—Amines having sulfur, e.g. thiurams (>N—C(S)—S—C(S)—N< and >N—C(S)—S—S—C(S)—N<), Sulfinylamines (—N=SO), Sulfonylamines (—N=SO2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances

Definitions

  • the present invention provides a method for screening YDJC (YdjC Chitooligosaccharide deacetylase homolog) inhibitors.
  • Lung cancer refers to a malignant tumor that occurs in the lung. It can be divided into primary lung cancer, in which cancer cells arise from the tissues that make up the lung itself, and metastatic lung cancer, in which cancer cells originate in other organs and then migrate to the lungs through blood vessels or lymphatic vessels and proliferate.
  • YDJC YdjC Chitooligosaccharide deacetylase homolog
  • SPC sphingosylphosphorylcholine
  • the purpose of the present invention is to provide a YDJC inhibitor screening method.
  • Another object of the present invention is to provide a composition for inhibiting YDJC containing disulfiram as an active ingredient.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity, containing disulfiram as an active ingredient.
  • Another object of the present invention is a YDJC inhibitor screened by the above screening method; and an anticancer agent as an active ingredient, to provide a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity.
  • the present invention includes the steps of treating a candidate material and a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog) to perform an enzyme reaction; Separating the supernatant after terminating the enzyme reaction; And it provides a YDJC inhibitor screening method comprising; adding a fluorescent substance to the supernatant, reacting it, and then measuring fluorescence.
  • a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog)
  • the present invention provides a composition for inhibiting YDJC containing disulfiram as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity, comprising disulfiram as an active ingredient.
  • the present invention provides a YDJC inhibitor screened by the above screening method; and an anticancer agent as an active ingredient, and provides a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity.
  • the present invention relates to a YDJC inhibitor screening method using a YDJC-substrate complex, which can be used in the development of YDJC inhibitors and is used to inhibit the development and metastasis of lung cancer involving YDJC, making it effective against lung cancer. It can be used as a treatment.
  • Figure 1 shows the YDJC tertiary structure.
  • Figure 2 shows a schematic diagram of the YDJC inhibitor screening method.
  • Figure 3 shows data exploring the YDJC substrate.
  • Figure 4 shows the structure of the complex between YDJC and the substrate.
  • Figure 5 shows the results of YDJC inhibitor screening.
  • FIG. 6 shows the results of an experiment in which the YDJC inhibitor inhibits proliferation of lung cancer cell lines by disulfiram (hereinafter referred to as DSF).
  • Figure 7 shows the effect of YDJC inhibitor on cell cycle proteins upon treatment with DSF (500 nM).
  • Figure 8 shows the results confirming cell death of lung cancer cell lines by YDJC inhibitors.
  • Figure 9 shows the effect of YDJC inhibitors on apoptosis proteins.
  • Figure 10 shows the results of analyzing CD8+ T cell expression in lung cancer tissues obtained by injecting LLC-1 lung cancer cell line into mice lacking YDJC (YDJC -/- ).
  • Figure 11 shows the results of analyzing CD8+ T cell expression in mice obtained by crossing YDJC-deficient mice (YDJC -/- ) and Kras LSL - G12D lung cancer-prone mice (Kras LSL-G12D ;YDJC -/- ).
  • Figure 12 shows the results showing proteoglycan-related genes obtained by analyzing genetic changes in cells in which YDJC expression was suppressed through RNAseq.
  • Figure 13 shows the results showing immune-related genes obtained by analyzing genetic changes in cells in which YDJC expression was suppressed through RNAseq.
  • GalNAc N-Acetylgalactosamine
  • YDJC YdjC Chitooligosaccharide deacetylase homolog
  • the present invention includes the steps of performing an enzyme reaction by treating a candidate material and a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog); Separating the supernatant after terminating the enzyme reaction; And it provides a YDJC inhibitor screening method comprising; adding a fluorescent substance to the supernatant, reacting it, and then measuring fluorescence.
  • a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog)
  • YDJC YdjC Chitooligosaccharide deacetylase homolog
  • the YDJC may have a base sequence consisting of SEQ ID NO: 1.
  • the GalNAc variant may be selected from GalNAc-6P (N-Acetyl-D-galactosamine 6-phosphate) or GalNAc-6S (N-Acetyl-D-galactosamine 6-sulfate).
  • the screening method includes the steps of treating a candidate material and a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog) and performing an enzyme reaction for 20 to 40 minutes; adding an equal amount of borate solution to the enzyme reaction solution to terminate the enzyme reaction and then separating the supernatant; And it may include adding a fluorescent substance to the supernatant, reacting at 20 to 24° C. for 18 to 22 minutes, and then measuring fluorescence.
  • GalNAc N-Acetylgalactosamine
  • YDJC YdjC Chitooligosaccharide deacetylase homolog
  • the fluorescent substance may be fluorescamine, but is not limited thereto.
  • the present invention provides a composition for inhibiting YDJC containing disulfiram as an active ingredient.
  • the present invention provides a pharmaceutical composition for preventing or treating a cancer disease with increased YDJC expression or activity, comprising disulfiram as an active ingredient, and the cancer disease may be lung cancer.
  • the pharmaceutical composition may contain suitable carriers, excipients, disintegrants, sweeteners, coating agents, bulking agents, lubricants, lubricants, flavoring agents, antioxidants, buffers, bacteriostatic agents, etc. commonly used in the preparation of pharmaceutical compositions. It may further include one or more additives selected from the group consisting of diluents, dispersants, surfactants, binders, and lubricants.
  • carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, and microcrystalline.
  • Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil can be used.
  • Solid preparations for oral administration include tablets, pills, powders, granules, and capsules.
  • Such solid preparations can be prepared by mixing the composition with at least one or more excipients, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, etc.
  • lubricants such as magnesium styrate and talc can also be used.
  • Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups.
  • various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • injectable ester such as ethyl oleate.
  • As a base for suppositories witepsol, macrogol, tween 61, cacao, laurin, glycerogenatin, etc. can be used.
  • the pharmaceutical composition is intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, inhalational, topical, rectal, oral, intraocular or It can be administered to a subject in a conventional manner via the intradermal route.
  • the dosage of the active ingredient according to the present invention may vary depending on the subject's condition and weight, type and degree of disease, drug form, administration route and period, and may be appropriately selected by a person skilled in the art, and the daily dosage is 0.01 mg. /kg to 200 mg/kg, preferably 0.1 mg/kg to 200 mg/kg, more preferably 0.1 mg/kg to 100 mg/kg. Administration may be administered once a day or divided into several administrations, and the scope of the present invention is not limited thereby.
  • the present invention provides a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity, comprising the YDJC inhibitor and anticancer agent screened by the above screening method as active ingredients.
  • the anticancer agent may be one or more selected from the group consisting of a chemotherapy agent, a tyrosine kinase inhibitor, an anaplastic lymphoma kinase (ALK) inhibitor, and an immune checkpoint inhibitor, and the chemotherapy agent is cisplatin ( Cisplatin, Carboplatin, Paclitaxel (Taxol), Albumin-bound paclitaxel (nab-paclitaxel; Abraxane), Docetaxel (Taxotere), Gemcitabine (Gemzar), Vinorelbine (Vinorelbine; Navelbine), etoposide (VP-16), and pemetrexed (Alimta) may be one or more selected from the group, and the tyrosine kinase inhibitor is Afatinib, Dacomitinib.
  • the tyrosine kinase inhibitor is Afatinib, Dacomitinib.
  • the ALK inhibitor is Crizotinib (Xalkori), Ceritinib ( It may be one or more selected from the group consisting of Ceritinib (Zykadia), Alectinib (Alecensa), Brigatinib (Alunbrig), and Lorlatinib (Lorbrena), and the immune checkpoint inhibitor is nivolumab or It may be pembrolizumab, but is not limited thereto.
  • the gene that synthesizes the human YDJC protein was synthesized as a codon-optimized DNA sequence in E. coli to ensure high expression in E. coli, and cloned into the pET28b(+) vector.
  • Two types of YDJC were cloned: YDJC (1-323) consisting of the full length and YDJC (YDJC_deltaC; 1-302) with the C-terminal portion that does not form a three-dimensional structure removed.
  • Two YDJC recombinant proteins. got it
  • the sequence of the synthesized human YDJC gene (SEQ ID NO: 1) is as follows (TAA stop codon is indicated separately).
  • Protein expression was performed in the E. coli strain Rosetta2(DE3)pLysS. O.D. at 37°C After culturing E. coli to 0.6, the culture temperature was lowered to 18°C and protein expression was performed using 0.5mM IPTG (Isopropyl ⁇ - D -1-thiogalactopyranoside). After pulverizing and centrifuging the protein-expressing E. coli using a Microfluidizer (MFD), the supernatant was filtered through Ni-NTA column, Thrombin cleavage, 2nd Ni-NTA column (to remove unseparated YDJC), and gel filtration (Gel It was purified using a filtration (Supderdex 75 prep grade) column. The final protein storage conditions were 10 mg/ml in 20mM Tris-HCl pH 7.5, 400mM sodium chloride, 10 uM magnesium chloride, and 1mM TCEP buffer.
  • Crystallization Condition #1 20mM Sodium formate, 20mM Ammonium acetate, 20mM Sodium citrate tribasic dihydrate, 20mM Potassium sodium tartrate tetrahydrate, 20mM Sodium oxamate, 100mM Tris (base); BICINE pH 8.5, 20% v/v PEG 500MME, 10% PEG 20K Crystallization Condition #2 20mM 1,6-Hexanediol, 20mM 1-Butanol, 20mM 1,2-Propanediol, 20mM 2-Propanol, 20mM 1,4-Butanediol, 20mM 1,3-Propanediol, 100mM Bis-Tris propane pH9.0, 20% v/v PEG 500MME, 10% v/v PEG 20K Crystallization Condition #3 20mM 1,6-Hexanediol, 20mM 1-Butanol, 20mM 1,2-Propanediol, 20mM 2-Propanol
  • YDJC is expected to have deacetylase activity for sugar-based substances, so after searching for acetyl carbohydrate on the PubChem DB site, purchasable substances were secured, and as shown in Figure 2, deacetylase (deacetylase) test was performed.
  • YDJC utilizes divalent metal ions in enzyme reactions, and magnesium (Mg 2+ ) ions were also bound in the 3D structure of YDJC.
  • the culture temperature was lowered to 18°C and protein expression was performed using 0.5mM IPTG (Isopropyl ⁇ -D-1-thiogalactopyranoside).
  • IPTG Isopropyl ⁇ -D-1-thiogalactopyranoside.
  • MFD Microfluidizer
  • the supernatant was subjected to Ni-NTA column, thrombin cleavage, and a second Ni-NTA column (to remove unseparated YDJC). and purified using a gel filtration (Supderdex 75 prep grade) column.
  • the final protein storage conditions were concentrated to 15 mg/ml in 20mM Tris-HCl pH 7.5, 400mM sodium chloride, 10 ⁇ M magnesium chloride, and 1mM TCEP buffer, followed by crystallization conditions (30mM diethylene glycol, 30mM triethylene glycol). , 30 mM tetraethylene glycol, 30 mM pentaethylene glycol, 100 mM Tris (base); BICINE pH 8.5, 40 % v/v ethylene glycol, 20 % w/v PEG 8000), X-ray diffraction data was collected.
  • the apo-YDJC_deltaC structure the structure was confirmed by molecular substitution method, and clear substrate electron density was observed. According to Figure 4, it was confirmed that GalNAc is the YDJC substrate through confirmation of the three-dimensional structure of the YDJC-substrate complex. .
  • DSF differential scanning fluorimetry; thermal shift assay
  • HTS high throughput screening
  • YDJC inhibitors were explored using two methods, and tests were conducted to derive various substances.
  • 3 ⁇ M YDJC was mixed with 3 ⁇ M of a substance expected to be a YDJC inhibitor from an FDA-approved library, 1X Sypro Orange (Thermo Fisher) was added, and the temperature was gradually increased using real-time PCR to measure the Tm value of the protein.
  • the enzyme activity search method is a deacetylase activity search method of YDJC using GalNAc, a YDJC substrate derived in Experimental Example 2, and 10 ⁇ M YDJC is mixed with 100 mM HEPES-NaOH pH 7.0, 200 mM sodium chloride, and 10 ⁇ M YDJC.
  • DSF (Hit no. 23) was significantly less reactive than other materials, so it could be judged as a YDJC inhibitor.
  • a YDJC inhibitor a protein that specifically binds to phosphatidylserine
  • PI propidium iodide
  • Annexin V-FITC single staining is considered to be early-apoptosis [lower right]
  • Annexin V-FITC and PI double staining is considered to be late-apoptosis [upper right]
  • PI single staining is considered to be necrotic cells [upper left].
  • Western blot was used to determine whether the expression of proteins activated during the apoptosis stage was changed by YDJC inhibition.
  • Western-blot showed that the expression of cleaved-caspase3 and cleaved-PARP, proteins that induce apoptosis, increased in cells treated with 500 nM DSF compared to cells treated with 0 or 100 nM DSF. It was confirmed that the expression of p53, a representative cancer suppressor protein and known to induce apoptosis, increased in cells treated with DSF.
  • CD8 + T immune cells which are important in anticancer immune therapy, was examined in lung cancer tissues obtained by injecting LLC-1 mouse lung cancer cell line into YDJC -/- mice using an antibody that detects CD8. .
  • FIG 10 it was confirmed that the infiltration of CD8 + T immune cells increased around lung cancer tissue obtained by injecting LLC-1 into mice lacking YDJC (YDJC -/- ). From the above results, it was confirmed that the YDJC inhibitor can be used as a new type of anticancer immunotherapy agent that increases CD8 + T-based immune activity.
  • CD8 + T immune cells which are important in anticancer immunotherapy, was examined in lung cancer tissues obtained from Kras LSL - G12D ;YDJC -/- mice using an antibody that detects CD8.
  • FIG 11 it was confirmed that the infiltration of CD8 + T immune cells increased around lung cancer tissues obtained from Kras LSL - G12D ;YDJC -/- mice. From the above results, it was confirmed that the YDJC inhibitor can be used as a new type of anticancer immunotherapy agent that increases CD8 + T-based immune activity.
  • a cell line lacking YDJC was created through gene silencing in A549 lung cancer cells, and RNA was extracted from this cell line and RNAseq analysis was performed to investigate which genes were altered.
  • FIGS. 12 and 13 it was confirmed that there was significant variation in genes of the proteoglycan pathway (FIG. 12) and the immune response pathway (FIG. 13).
  • YDJC inhibition causes changes in proteoglycans containing N-acetylgalactosamine (e.g., containing chondroitin sulfate), and changes in immunity occur due to changes in these proteoglycans. This occurred was confirmed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 YDJC (YdjC Chitooligosaccharide deacetylase homolog)를 포함하는 효소반응 버퍼에 후보물질과 GalNAc (N-Acetylgalactosamine) 또는 이의 변형체에서 선택된 기질을 처리하여 효소반응을 수행하는 단계; 상기 효소반응을 종료시킨 후 상청액을 분리하는 단계; 및 상기 상청액에 형광물질을 첨가하고 반응시킨 후 형광을 측정하는 단계;를 포함하는 YDJC 억제제 스크리닝 방법에 관한 것으로, YDJC 억제제의 개발에 활용될 수 있으며, YDJC가 관여하는 폐암의 발생 및 전이를 억제하는데 사용될 수 있다.

Description

YDJC 억제제 스크리닝 방법
본 발명은 YDJC (YdjC Chitooligosaccharide deacetylase homolog) 억제제 스크리닝 방법을 제공한다.
폐암이란 폐에 생긴 악성 종양을 말하며, 폐를 구성하는 조직 자체에서 암세포가 생겨난 원발성 폐암과, 암세포가 다른 기관에서 생긴 뒤 혈관이나 림프관을 타고 폐로 옮겨 와서 증식하는 전이성 폐암으로 나눌 수 있다.
2015년에 우리나라에서는 214,701건의 암이 발생했는데, 그 중 폐암은 남녀를 합쳐서 24,267건, 전체 암 발생의 11.3 %로 4위를 차지했다. 인구 10만명 당 조(粗)발생률 (해당 관찰 기간 중 대상 인구 집단에서 새롭게 발생한 환자 수. 조사망률도 산출 기준이 동일)은 47.6건으로, 남녀의 성비는 2.3 : 1로 남자에게 더 많이 발생하였으며, 발생 건수는 남자가 17,015건으로 남성의 암 중에서 2위를 차지했고, 여자는 7,252건으로 여성의 암 중 5위이다. 남녀를 합쳐서 연령대별로 보면 70대가 36.2 %로 가장 많았고, 60대가 26.8 %, 80대 이상이 17.3 %이다.
조직학적 (국제질병분류ICD-10 코드 C34)으로는 2017년의 폐암 전체 발생 건수 24,235건 가운데 암종 (carcinoma)이 86.6 %, 육종 (sarcoma)이 0.2 %를 차지했으며, 암종 중에서는 선암이 43.7 %로 가장 많았고, 편평상피세포암이 23.1 %, 소세포암이 11.2 %를 차지하고 있다.
상기와 같이, 폐암은 세계에서 암 관련 사망의 주요 원인이므로, 적절한 진단 지표와 폐암의 새로운 표적이 필요한 현실이다. YDJC (YdjC Chitooligosaccharide deacetylase homolog)는 아세틸화 탄수화물의 탈아세틸화를 촉매하며, A549 폐암 세포에서 sphingosylphosphorylcholine (SPC) 유도 각질 인산화와 재조직에 관여한다고 알려져 있으나, 폐암 진행에 YDJC의 역할은 크게 알려지지 않아 이에 대한 심도 깊은 연구가 여전히 필요한 실정이다.
본 발명의 목적은 YDJC 억제제 스크리닝 방법을 제공하는 데에 있다.
본 발명의 또 다른 목적은 다이설피람 (Disulfiram)을 유효성분으로 포함하는 YDJC 억제용 조성물을 제공하는 데에 있다.
본 발명의 또 다른 목적은 다이설피람 (Disulfiram)을 유효성분으로 포함하는, YDJC 발현 또는 활성이 증가된 암 질환 예방 또는 치료용 약학조성물을 제공하는 데에 있다.
본 발명의 또 다른 목적은 상기 스크리닝 방법에 의해 스크리닝된 YDJC 억제제; 및 항암제를 유효성분으로 포함하는, YDJC 발현 또는 활성이 증가된 암 질환 예방 또는 치료용 약학 조성물을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 YDJC (YdjC Chitooligosaccharide deacetylase homolog)를 포함하는 효소반응 버퍼에 후보물질과 GalNAc (N-Acetylgalactosamine) 또는 이의 변형체에서 선택된 기질을 처리하여 효소반응을 수행하는 단계; 상기 효소반응을 종료시킨 후 상청액을 분리하는 단계; 및 상기 상청액에 형광물질을 첨가하고 반응시킨 후 형광을 측정하는 단계;를 포함하는 YDJC 억제제 스크리닝 방법을 제공한다.
또한, 본 발명은 다이설피람 (Disulfiram)을 유효성분으로 포함하는 YDJC 억제용 조성물을 제공한다.
또한, 본 발명은 다이설피람 (Disulfiram)을 유효성분으로 포함하는, YDJC 발현 또는 활성이 증가된 암 질환 예방 또는 치료용 약학조성물을 제공한다.
또한, 본 발명은 상기 스크리닝 방법에 의해 스크리닝된 YDJC 억제제; 및 항암제를 유효성분으로 포함하는, YDJC 발현 또는 활성이 증가된 암 질환 예방 또는 치료용 약학 조성물을 제공한다.
본 발명에 따르면, 본 발명은 YDJC-기질 복합체를 활용한 YDJC 억제제 스크리닝 방법에 관한 것으로, YDJC 억제제의 개발에 활용될 수 있으며, YDJC가 관여하는 폐암의 발생 및 전이를 억제하는데 사용되어, 효과적인 폐암 치료제로 활용될 수 있다.
도 1은 YDJC 3차 구조를 나타낸다.
도 2는 YDJC 억제제 스크리닝 방법을 도식화한 것을 나타낸다.
도 3은 YDJC 기질을 탐색한 데이터를 나타낸다.
도 4는 YDJC 및 기질 간의 복합체 구조를 나타낸다.
도 5는 YDJC 억제제 스크리닝한 결과를 나타낸다.
도 6은 YDJC 억제제가 다이설피람 (Disulfiram; 이하 DSF라 함)에 의한 폐암 세포주의 증식 억제 실험한 결과를 나타낸다.
도 7은 YDJC 억제제가 DSF (500 nM) 처리 시에 세포주기 단백질에 미치는 영향을 나타낸다.
도 8은 YDJC 억제제에 의한 폐암 세포주의 세포 사멸을 확인한 결과를 나타낸다.
도 9는 YDJC 억제제가 세포 사멸 단백질에 미치는 영향을 나타낸다.
도 10은 YDJC를 결여시킨 마우스(YDJC-/-)에 LLC-1 폐암세포주를 주입하고 얻은 폐암조직에서 CD8+ T cell 발현을 분석한 결과이다.
도 11은 YDJC를 결여시킨 마우스(YDJC-/-) 및 KrasLSL - G12D 폐암 호발 마우스를 교배시켜 얻은 마우스(KrasLSL-G12D;YDJC-/-)에서 CD8+ T cell 발현을 분석한 결과이다.
도 12는 YDJC 발현을 억제한 세포에서 유전자 변동을 RNAseq를 통해 분석하여 얻은 프로테오글리칸(proteoglycan) 관련 유전자들을 나타낸 결과이다.
도 13은 YDJC 발현을 억제한 세포에서 유전자 변동을 RNAseq를 통해 분석하여 얻은 면역 관련 유전자들을 나타낸 결과이다.
이하, 본 발명을 보다 상세하게 설명한다.
본 발명자들은 폐암에 대한 적절한 진단 지표와 새로운 치료 표적을 밝혀내기 위해 연구 노력한 결과, YDJC (YdjC Chitooligosaccharide deacetylase homolog)의 새로운 기질로서 GalNAc (N-Acetylgalactosamine) 또는 이의 변형체를 발굴함으로써 이를 이용한 YDJC 치료제 스크리닝을 통해 폐암 신규 치료제를 개발할 수 있다는 점을 밝혀내어 본 발명을 완성하였다.
본 발명은 YDJC (YdjC Chitooligosaccharide deacetylase homolog)를 포함하는 효소반응 버퍼에 후보물질과 GalNAc (N-Acetylgalactosamine) 또는 이의 변형체에서 선택된 기질을 처리하여 효소반응을 수행하는 단계; 상기 효소반응을 종료시킨 후 상청액을 분리하는 단계; 및 상기 상청액에 형광물질을 첨가하고 반응시킨 후 형광을 측정하는 단계;를 포함하는 YDJC 억제제 스크리닝 방법을 제공한다.
상기 YDJC는 서열번호 1로 이루어진 염기서열을 가질 수 있다.
상기 GalNAc 변형체는 GalNAc-6P (N-Acetyl-D-galactosamine 6-phosphate) 또는 GalNAc-6S (N-Acetyl-D-galactosamine 6-sulfate)에서 선택된 것일 수 있다.
상기 스크리닝 방법은 YDJC (YdjC Chitooligosaccharide deacetylase homolog)를 포함하는 효소반응 버퍼에 후보물질과 GalNAc (N-Acetylgalactosamine) 또는 이의 변형체에서 선택된 기질을 처리하여 효소반응을 20 내지 40분 동안 수행하는 단계; 상기 효소반응 용액과 동량의 보레이트 용액을 첨가하여 효소반응을 종료시킨 후 상청액을 분리하는 단계; 및 상기 상청액에 형광물질을 첨가하고, 20 내지 24 ℃에서 18 내지 22분 동안 반응시킨 후 형광을 측정하는 단계를 포함할 수 있다.
상기 형광물질은 플루오레사민 (fluorescamine)일 수 있지만, 이에 한정되는 것은 아니다.
또한, 본 발명은 다이설피람 (Disulfiram)을 유효성분으로 포함하는 YDJC 억제용 조성물을 제공한다.
또한, 본 발명은 다이설피람 (Disulfiram)을 유효성분으로 포함하는, YDJC 발현 또는 활성이 증가된 암 질환 예방 또는 치료용 약학조성물을 제공하며, 상기 암 질환은 폐암일 수 있다.
본 발명의 다른 구체예에서, 약학 조성물은 약학 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제, 붕해제, 감미제, 피복제, 팽창제, 윤활제, 활택제, 향미제, 항산화제, 완충액, 정균제, 희석제, 분산제, 계면활성제, 결합제 및 윤활제로 이루어진 군에서 선택되는 하나 이상의 첨가제를 추가로 포함할 수 있다.
구체적으로 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 사용할 수 있으며, 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 칼슘카보네이트, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제할 수 있다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용할 수 있다. 경구를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제 등이 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜, 폴리에틸렌 글리콜, 올리브오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기재로는 위텝솔 (witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 일실시예에 따르면, 상기 약학 조성물은 정맥내, 동맥내, 복강내, 근육내, 동맥내, 복강내, 흉골내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적인 방식으로 대상체로 투여할 수 있다.
본 발명에 따른 유효성분의 투여량은 대상체의 상태 및 체중, 질환의 종류 및 정도, 약물 형태, 투여경로 및 기간에 따라 달라질 수 있으며 당업자에 의해 적절하게 선택될 수 있고, 1일 투여량이 0.01 mg/kg 내지 200 mg/kg, 바람직하게는 0.1 mg/kg 내지 200 mg/kg, 보다 바람직하게는 0.1 mg/kg 내지 100 mg/kg 일 수 있다. 투여는 하루에 한번 투여할 수도 있고 수회로 나누어 투여할 수도 있으며, 이에 의해 본 발명의 범위가 제한되는 것은 아니다.
또한, 본 발명은 상기 스크리닝 방법에 의해 스크리닝된 YDJC 억제제 및 항암제를 유효성분으로 포함하는, YDJC 발현 또는 활성이 증가된 암 질환 예방 또는 치료용 약학 조성물을 제공한다.
상기 항암제는 화학요법제, 티로신 키네이스 억제제(tyrosin kinase inhibitor), ALK(anaplastic lymphoma kinase) 억제제 및 면역관문 억제제(Immune checkpoint inhibitor)로 이루어진 군에서 선택된 하나 이상일 수 있고, 상기 화합요법제는 시스플라틴(Cisplatin), 카보플라틴(Carboplatin), 파클리탁셀(Paclitaxel; Taxol), 알부민 결합 파클리탁셀(Albumin-bound paclitaxel; nab-paclitaxel; Abraxane), 도세탁셀(Docetaxel; Taxotere), 젬시타빈(Gemcitabine; Gemzar), 비노렐빈(Vinorelbine; Navelbine), 에토포시드(Etoposide; VP-16) 및 페메트렉시드(Pemetrexed; Alimta)로 이루어진 군에서 선택된 하나 이상일 수 있고, 상기 티로신 키네이스 억제제는 아파티닙(Afatinib) 다코미티닙(Dacomitinib), 엘로티닙(Erlotinib), 제피티닙(Gefitinib) 및 오시머티닙(Osimertinib)으로 이루어진 군에서 선택된 하나 이상일 수 있고, 상기 ALK 억제제는 크리조티닙(Crizotinib; Xalkori), 세리티닙(Ceritinib; Zykadia), 알렉티닙(Alectinib; Alecensa), 브리가티닙(Brigatinib; Alunbrig) 및 로란티닙(Lorlatinib; Lorbrena)으로 이루어진 군에서 선택된 하나 이상일 수 있으며, 상기 면역관문 억제제는 니볼루맙(nivolumab) 또는 펨브로리주맙(penbrolizumab)일 수 있으나, 이에 한정되는 것은 아니다.
이하, 본 발명의 이해를 돕기 위하여 실시예 등을 들어 상세하게 설명하기로 한다. 다만 하기의 실시예 등은 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예 등에 한정되는 것은 아니다. 본 발명의 실시예 등은 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
[실험예 1] YDJC 3차원 구조의 결정
YDJC 유전자를 확보하여 대량 발현시킨 후에 결정을 얻어서 X-ray로 구조를 결정하는 시험을 하였다. 인간 YDJC 단백질을 합성하는 유전자를 대장균에서 높은 발현이 되도록 대장균에 코돈 최적화 (codon optimized)를 한 DNA 서열로 합성하여 pET28b(+) 벡터에 클로닝했다. 두 종류의 YDJC를 클로닝 하였는데, 전체 길이 (full length)로 구성된 YDJC (1-323)와 C-말단의 3차원 구조를 형성하지 않는 부분을 제거한 YDJC (YDJC_deltaC; 1-302) 두 가지 YDJC 재조합 단백질을 얻었다. 합성된 인간 YDJC 유전자의 서열 (서열번호 1)은 하기와 같다 (TAA 종결코돈을 별도 표시함).
(서열번호 1)
ATGAGCCGGCCGCGGATGCGGCTGGTTGTTACCGCAGATGATTTTGGTTATTGTCCTCGCCGGGATGAAGGTATTGTTGAAGCATTTCTGGCAGGTGCAGTTACCTCTGTAAGCCTGTTAGTTAATGGTGCAGCAACCGAAAGTGCTGCAGAACTGGCACGGCGCCATAGTATTCCGACCGGTCTGCATGCTAATCTGTCTGAAGGTCGGCCGGTTGGTCCGGCTCGGCGGGGTGCAAGCAGTCTGCTGGGTCCGGAAGGCTTTTTTCTGGGTAAAATGGGTTTTCGGGAAGCAGTTGCAGCAGGTGATGTTGATCTGCCGCAGGTTCGGGAAGAACTGGAAGCCCAGCTCAGTTGTTTTCGGGAACTGCTGGGTCGCGCACCGACCCATGCGGATGGTCATCAGCATGTTCATGTTCTGCCGGGTGTTTGTCAGGTTTTTGCAGAAGCACTGCAGGCCTATGGCGTTCGGTTTACACGGTTACCGCTGGAACGGGGCGTTGGTGGATGTACCTGGTTGGAAGCACCGGCCCGAGCTTTTGCGTGCGCCGTCGAACGCGACGCTCGGGCAGCTGTAGGTCCTTTTTCACGCCATGGCCTGCGGTGGACGGATGCATTTGTCGGTCTTAGCACTTGTGGGCGCCACATGAGTGCACATCGCGTTAGTGGTGCACTGGCACGCGTTCTGGAAGGTACTCTGGCAGGTCATACCCTGACCGCAGAACTGATGGCACATCCGGGTTATCCGAGTGTTCCGCCGACCGGTGGTTGTGGTGAAGGTCCGGATGCGTTTAGCTGTAGTTGGGAACGCCTGCATGAGCTCCGGGTGCTGACCGCCCCGACCCTGCGCGCACAGCTGGCACAGGATGGTGTTCAGCTGTGTGCCCTGGATGATCTGGATAGCAAACGCCCGGGTGAAGAAGTTCCGTGTGAACCGACCCTGGAACCGTTTCTGGAACCGAGTCTGCTGTAA
단백질 발현은 대장균주인 Rosetta2(DE3)pLysS에서 발현시켰다. 37 ℃에서 O.D. 0.6까지 대장균을 배양한 후, 18 ℃로 배양 온도를 낮춘 후 0.5 mM IPTG (Isopropyl β- D -1-thiogalactopyranoside)를 이용하여 단백질 발현시켰다. 단백질이 발현된 대장균을 마이크로플루다이저 (Microfluidizer; MFD)로 분쇄 및 원심분리 후, 상청액을 Ni-NTA 컬럼, Thrombin cleavage, 2nd Ni-NTA 컬럼 (분리되지 않은 YDJC 제거 용도) 및 겔 여과 (Gel filtration; Supderdex 75 prep grade) 컬럼을 이용하여 정제하였다. 최종 단백질 보관 조건은 20 mM Tris-HCl pH 7.5, 400 mM 염화나트륨, 10 uM 염화마그네슘 및 1 mM TCEP 버퍼 조건에서 10 mg/ml로 보관 했다.
그 결과, 도 1에 따를 때, 다양한 조건에서 YDJC 결정이 얻어졌는데, 표 1의 3가지 조건에서 네이티브 (native) 및 셀레노-메티오닌 (seleno-methionine) 결정을 얻었다.
결정화 조건 #1 20 mM Sodium formate, 20 mM Ammonium acetate, 20 mM Sodium citrate tribasic dihydrate, 20 mM Potassium sodium tartrate tetrahydrate, 20 mM Sodium oxamate, 100 mM Tris (base); BICINE pH 8.5, 20% v/v PEG 500MME, 10% PEG 20K
결정화 조건 #2 20 mM 1,6-Hexanediol, 20 mM 1-Butanol, 20 mM 1,2-Propanediol, 20 mM 2-Propanol, 20 mM 1,4-Butanediol, 20 mM 1,3-Propanediol, 100 mM Bis-Tris propane pH9.0, 20% v/v PEG 500MME, 10% v/v PEG 20K
결정화 조건 #3 20 mM 1,6-Hexanediol, 20 mM 1-Butanol, 20 mM 1,2-Propanediol, 20 mM 2-Propanol, 20mM 1,4-Butanediol, 20mM 1,3-Propanediol, 100 mM Tris (base); BICINE pH 8.5, 20% v/v PEG 500MME, 10% v/v PEG 20K
YDJC와 구조적으로 유사한 3차원 구조가 없었기 때문에 셀레노-메티오닌 (seleno-methionine)으로 치환한 YDJC 결정을 얻었고, SAD (Single-wavelength anomalous dispersion) 방법으로 위상문제를 해결 후, 네이티브 (native) 및 후술할 YDJC-기질 복합체 구조를 확인했다. 3차원 모델 제작은 Coot 프로그램을 이용하였으며, 정밀화는 Phenix 프로그램 패키지를 활용했다.
[실험예 2] YDJC 기질 탐색
YDJC는 당 계열 물질의 디아세틸라제 (deacetylase) 활성이 있을 것으로 예상되어, PubChem DB 사이트에서 아세틸 카보하이드레이트 (acetyl carbohydrate)를 검색한 후, 구매 가능한 물질들을 확보하여, 도 2와 같이, 디아세틸라제 (deacetylase) 시험을 수행했다. YDJC는 효소반응에 2가 (divalent) 금속 이온을 활용되는데, YDJC 3차원 구조에서도 마그네슘 (Mg2 +) 이온이 결합되어 있었다. 그러나 활성을 가장 크게 하는 금속이온이 정확하지 않아 대표적인 2가 금속이온인 MgCl2, MnCl2, FeCl2, NiCl2 및 ZnCl2을 효소 반응 버퍼 (100 mM HEPES-NaOH pH 7.0, 200 mM 염화나트륨, 및 10% (v/v) 글리세롤)에 추가하여 효소 활성을 측정했다. 효소 반응은 YDJC 단백질이 들어 있는 효소반응 버퍼에 기질 후보 물질 (1 mM)을 추가 후, 20시간 동안 반응시킨 후 동량의 500 mM 붕산염 버퍼 (Borate buffer; pH 9.1)을 넣어 반응을 종료시켰다. 원심분리로 침전물을 제거 후, 상청액을 96 검정 플레이트에 옮겼고, 1/5 부피 분량의 다이메틸폼아마이드 (dimethylformamide; DMF)에 녹인 2 mg/ml 플루오레사민 (fluorescamine) 용액을 넣고, 22 ℃에서 20분간 반응 후, 형광 세기를 측정했다 (excitation 360 nm, emission 465 nm). 실험 대조군으로 열 (boiling)로 불활성화한 YDJC 및 기질을 넣지 않은 효소 반응 등을 적용하였다. 그 결과, 도 3에 따를 때, GalNAc (N-Acetylgalactosamine), GalNAc-6P (N-Acetyl-D-galactosamine 6-phosphate) 및 GalNAc-6S (N-Acetyl-D-galactosamine 6-sulfate)에서 형광 세기가 강하게 나타나, YDJC 기질임을 확인했다.
YDJC-기질 복합체 3차원 구조를 확인하기 위하여, 기질이 단백질과 결합하면서 효소 반응은 일어나지 않도록 효소 반응에 중요할 것으로 예상되는 아스파르트산염 13 (Aspartate 13)을 아스파라긴 (Asparagine)으로 치환한 돌연변이체를 만들어 이를 결정화했다 (YDJC_deltaC/D13N mutant). 야생형과 동일하게 발현 및 정제를 하였다. 구체적으로 단백질 발현은 대장균주인 Rosetta2(DE3)pLysS에서 발현시켰다. 37 ℃에서 O.D. 0.6까지 대장균을 배양한 후, 18 ℃로 배양 온도를 낮춘 후 0.5 mM IPTG (Isopropyl β-D-1-thiogalactopyranoside)를 이용하여 단백질 발현시켰다. 단백질이 발현된 대장균을 마이크로플루다이저 (Microfluidizer; MFD)로 분쇄 및 원심분리 후, 상청액을 Ni-NTA 컬럼, 트롬빈 클리비지 (Thrombin cleavage), 2번째 Ni-NTA 컬럼 (분리되지 않은 YDJC 제거 용도) 및 겔 여과 (Gel filtration; Supderdex 75 prep grade) 컬럼을 이용하여 정제하였다. 최종 단백질 보관 조건은 20 mM Tris-HCl pH 7.5, 400 mM 염화나트륨, 10 μM 염화마그네슘 및 1 mM TCEP 버퍼 조건에서 15 mg/ml로 농축 후, 결정화 조건 (30 mM 디에틸렌 글리콜, 30 mM 트리에틸렌 글리콜, 30 mM 테트라에틸렌 글리콜, 30 mM 펜타에틸렌 글리콜, 100 mM Tris (base); BICINE pH 8.5, 40 % v/v 에틸렌 글리콜, 20 % w/v PEG 8000)에서 결정화에 성공하여 X-선 회절 데이터를 수집하였다. apo-YDJC_deltaC 구조를 이용하여, 분자치환법으로 구조를 확인하고, 명확한 기질 전자밀도가 관찰한 결과, 도 4에 따를 때, YDJC-기질 복합체의 3차원 구조 확인을 통한 GalNAc이 YDJC 기질임을 확인했다.
[실험예 3] YDJC 억제제의 탐색
고속대량스크리닝 (High throughput screening; HTS)에 의한 DSF (differential scanning fluorimetry; thermal shift assay) 방법; 및 후술할 효소활성 검색법; 2가지를 활용하여 YDJC 억제제를 탐색하여, 다양한 물질들을 도출하는 시험을 하였다.
3 μM YDJC에 3 μM의 FDA 승인 라이브러리에서 YDJC 억제제로 예상되는 물질을 섞어 1X Sypro Orange (Thermo Fisher)를 넣어 실시간 PCR을 이용하여 온도를 서서히 높여 단백질의 Tm 값을 측정했다.
상기 FDA 승인 라이브러리에서 YDJC 억제제로 예상되는 물질들을 DSF 방법으로 스크리닝하여 Tm 값의 변화가 있는 물질 중 가장 변화가 컸던 4개 물질을 선별했고, 이를 대상으로 상기 효소활성 검색법을 통하여 활성을 측정하였다. 효소활성 검색법은 상기 실험예 2에서 도출된 YDJC 기질인 GalNAc을 이용하여, YDJC의 디아세틸라제 (deacetylase) 활성 검색법으로, 10 μM YDJC를 100 mM HEPES-NaOH pH 7.0, 200 mM 염화나트륨 및 10 % (v/v) 글리세롤로 구성된 효소 반응 버퍼에 묽히고, GalNAc (6.5 mM)를 반응액에 추가하여 30분간 효소반응을 한후 (이때 효소반응의 총 부피는 50 μl), 효소 반응 용액과 동량인 50 μl 500 mM 붕산염 (pH 10.0)을 추가하여 반응을 종료시키고, 원심분리로 침전물을 제거했다. 상청액을 96 웰 검정 플레이트에 옮긴 후, 2 mg/ml 플루오레사민 (fluorescamine)을 20 μl 넣어 22 ℃에서 20분간 반응하여 형광이 나타나게 한 후 형광을 측정했다 (excitation 360 nm, emission 465 nm).
그 결과, 도 5에 따를 때, DSF (Hit no. 23)가 다른 물질들에 비해 반응성이 현저히 떨어져서, YDJC 억제제로 판단할 수 있었다.
[실험예 4] YDJC 억제제의 폐암세포 억제 특성
YDJC의 억제제가 폐암세포의 암에 관련된 특징들을 조절하는지를 확인했다. 실험실 내 세포 배양조건 (대표적인 폐암세포주인 A549를 10 % FBS, 100 U/ml 페니실린(penicillin)-스트렙토마이신(streptomycin)이 포함된 RPMI-1640 배지를 이용하여 5 % CO2, 37 ℃ 항온항습이 유지되는 배양기에서 계대배양 함)에서 배양한 폐암세포에 YDJC 억제제인 DSF를 처리한 후 살아 있는 세포가 생성하는 탈-수소효소에 의해 환원되어 포르마잔 (formazan)이라는 발색물질을 생성하는 테트라졸륨 (tetrazolium salt)를 처리하여, 환원된 포르마잔의 양을 분광광도계를 이용하여 측정했다. 포르마잔의 생성은 살아있는 세포 수와 직선 상관관계를 가지므로, 흡광도의 차이를 통해 생존 세포 수의 차이를 확인할 수 있어, 그 결과, 도 6에 따를 때, YDJC의 억제제인 DSF가 YDJC의 과발현을 유도한 세포에서 효과적으로 세포사멸을 유도함을 확인했다. siRNA-YDJC를 이용한 YDJC의 억제를 통해 약 40 %의 세포 사멸능을 보였음을 확인했고, YDJC 억제제인 DSF의 경우 500 nM의 농도에서 약 50 % 정도의 세포-사멸능을 보였다.
폐암세포주에 YDJC 억제제인 DSF를 처리한 후, 세포 내 단백질을 분리하고, 얻어진 단백질을 SDS-PAGE 겔을 이용하여 크기별로 분리한 후 세포 증식에 관여하는 단백질의 발현 변화를 웨스턴 블랏을 통해 확인했다. 그 결과, 도 7에 따를 때, 대조군 (0 nM)과 비교하여 DSF 500 nM를 처리한 세포에서 대표적인 세포주기 단백질인 사이클린A (cyclinA) 및 사이클린B (cyclinB)의 발현이 현저하게 감소하는 것을 확인했다. 또한, 잘 알려진 세포주기 정지 단백질 중 하나인 p21의 발현도 눈에 띄게 증가한 것을 확인할 수 있었다.
YDJC 억제제인 DSF를 0, 250 및 500 nM 처리한 폐암세포에 Annexin V-FITC (포스파티딜세린에 특이적으로 결합하는 단백질) 및 PI (propidium Iodide, 온전한 원형질막은 통과할 수 없지만 세포막의 침투성이 증가되면 세포 내부로 침투하여 핵을 염색함)를 처리하여 세포사멸 과정 중 세포막 외부로 노출되는 포스파티딜세린에 결합한 Annexin V-FITC와 핵에 결합한 PI를 유세포 분석기를 통해 측정했다 (그래프의 십자모양 분할선 기준으로 Annexin V-FITC 단일염색은 초기-세포사멸 [우하단], Annexin V-FITC와 PI 이중염색은 후기-세포사멸 [우상단], PI 단일 염색은 괴사 세포 [좌상단]로 봄). 그 결과, 도 8에 따를 때, 대조군 (0 nM)의 경우 전체 세포 비중에서 정상세포가 89.6 %, 초기-세포사멸이 5.4 %이고, 후기-세포사멸이 3.3 %로 나타났다. DSF 250 nM를 처리하였을 때는 정상세포 84.5 %, 초기-세포사멸 5 % 및 후기-세포사멸 7.1 %로 나타났으며, 500 nM를 처리하였을 때는 정상세포 22.4 %, 초기-세포사멸 10 % 및 후기-세포사멸 37.9 %로 측정됐다. 본 실험을 통해 DSF를 처리하지 않은 폐암세포와 비교하였을 때, DSF 500 nM을 처리하였을 때 약 5.5배 높은 세포사멸이 일어남을 확인했다.
웨스턴 블랏을 이용하여 세포사멸 단계에서 활성화되는 단백질이 YDJC 억제에 의해 발현이 변화하는지 확인했다. 그 결과, 도 9에 따를 때, DSF 0 또는 100 nM을 처리 한 세포와 비교해 500 nM을 처리 한 세포에서 세포사멸을 유도하는 단백질인 cleaved-caspase3와 cleaved-PARP의 발현이 증가하는 것을 웨스턴-블랏을 통해 확인했고, 대표적인 암억제 단백질이면서 세포사멸을 유도하는 것으로 알려진 p53의 발현이 DSF를 처리한 세포에서 증가했다.
[실험예 5] YDJC를 결여시킨 마우스 (YDJC-/-)에서 LLC-1을 이용한 tail-vein 실험을 통한 CD8+ T 면역세포의 발현 분석
항암 면역 치료(Anticancer immune therapy)에서 중요한 CD8+ T 면역세포의 발현을 YDJC-/- 마우스에 LLC-1 마우스 폐암세포주를 주입하여 얻은 폐암조직에서의 발현을 CD8을 검출하는 항체를 활용하여 조사하였다. 그 결과, 도 10에 따를 때, YDJC를 결여시킨 마우스 (YDJC-/-)에 LLC-1을 주입하여 얻은 폐암 조직 주위에 CD8+ T 면역세포의 침윤이 증가됨을 확인하였다. 상기 결과로부터, YDJC 억제제가 CD8+ T 기반 면역 활성을 증가시키는 새로운 타입의 항암 면역 치료제로 활용될 수 있음을 확인하였다.
[실험예 6] YDJC를 결여시킨 마우스 (YDJC-/-)를 KrasLSL - G12D 폐암 호발 마우스와 교배하여 얻은 KrasLSL - G12D;YDJC-/- 마우스에서 얻은 폐암 조직에서의 CD8+ T 면역세포의 발현 분석
항암 면역 치료에서 중요한 CD8+ T 면역세포의 발현을 KrasLSL - G12D;YDJC-/- 마우스에서 얻은 폐암 조직에서의 발현을 CD8을 검출하는 항체를 활용하여 조사하였다. 그 결과, 도 11에 따를 때, KrasLSL - G12D;YDJC-/- 마우스에서 얻은 폐암 조직 주위에 CD8+ T 면역세포의 침윤이 증가됨을 확인하였다. 상기 결과로부터, YDJC 억제제가 CD8+ T 기반 면역 활성을 증가시키는 새로운 타입의 항암 면역 치료제로 활용될 수 있음을 확인하였다.
[실험예 7] YDJC의 발현을 억제한 A549 세포에서 RNAseq 분석
A549 폐암 세포에서 유전자 발현중지 (gene silencing)을 통해 YDJC를 결여시킨 세포주를 만들고, 이세포주에서 RNA를 뽑아 RNAseq 분석을 수행하여 어떤 유전자들의 변동이 나타나는지 조사하였다. 그 결과, 도 12 및 13에 따를 때, 프로테오글리칸 (proteoglycan) 경로(도 12)와 면역 반응 (immune response) 경로의 유전자(도 13)들의 변동이 현저함을 확인하였다. 상기 결과로부터, YDJC 억제로 인하여 N-아세틸갈락토사민 (N-acetylgalactosamine)을 함유한 프로테오글리칸 (예를 들어 콘드로이틴 황산 (chondroitin sulfate)를 함유한)의 변동이 일어나고, 이러한 프로테오글리칸들의 변동에 의해 면역 변동이 일어남을 확인하였다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 범위는 후술하는 청구범위에 의하여 나타내어지며, 청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (12)

  1. YDJC (YdjC Chitooligosaccharide deacetylase homolog)를 포함하는 효소반응 버퍼에 후보물질과 GalNAc (N-Acetylgalactosamine) 또는 이의 변형체에서 선택된 기질을 처리하여 효소반응을 수행하는 단계;
    상기 효소반응을 종료시킨 후 상청액을 분리하는 단계; 및
    상기 상청액에 형광물질을 첨가하고 반응시킨 후 형광을 측정하는 단계;를 포함하는 YDJC 억제제 스크리닝 방법.
  2. 청구항 1에 있어서, 상기 YDJC는 서열번호 1로 이루어진 염기서열을 갖는 것을 특징으로 하는 YDJC 억제제 스크리닝 방법.
  3. 청구항 1 또는 청구항 2에 있어서, 상기 GalNAc 변형체는 GalNAc-6P (N-Acetyl-D-galactosamine 6-phosphate) 또는 GalNAc-6S (N-Acetyl-D-galactosamine 6-sulfate)에서 선택된 것을 특징으로 하는 YDJC 억제제 스크리닝 방법.
  4. 청구항 1 또는 청구항 2에 있어서, 상기 스크리닝 방법은 YDJC (YdjC Chitooligosaccharide deacetylase homolog)를 포함하는 효소반응 버퍼에 후보물질과 GalNAc (N-Acetylgalactosamine) 또는 이의 변형체에서 선택된 기질을 처리하여 효소반응을 20 내지 40분 동안 수행하는 단계;
    상기 효소반응 용액과 동량의 보레이트 용액을 첨가하여 효소반응을 종료시킨 후 상청액을 분리하는 단계; 및
    상기 상청액에 형광물질을 첨가하고, 20 내지 24 ℃에서 18 내지 22분 동안 반응시킨 후 형광을 측정하는 단계를 포함하는 것을 특징으로 하는 YDJC 억제제 스크리닝 방법.
  5. 청구항 4에 있어서, 상기 형광물질은 플루오레사민 (fluorescamine)인 것을 특징으로 하는 YDJC 억제제 스크리닝 방법.
  6. 청구항 1 또는 청구항 2에 있어서, 상기 YDJC 억제제는 폐암 치료제인 것을 특징으로 하는 YDJC 억제제 스크리닝 방법.
  7. 다이설피람 (Disulfiram)을 유효성분으로 포함하는 YDJC 억제용 조성물.
  8. 다이설피람 (Disulfiram)을 유효성분으로 포함하는, YDJC 발현 또는 활성이 증가된 암 질환 예방 또는 치료용 약학 조성물.
  9. 청구항 8에 있어서, 상기 다이설피람은 N-아세틸갈락토사민 (N-acetylgalactosamine)이 포함된 프로테오글리칸 (proteoglycan) 발현을 억제하는 것을 특징으로 하는 약학 조성물.
  10. 청구항 8에 있어서, 상기 암 질환은 폐암인 것을 특징으로 하는 약학 조성물.
  11. 청구항 1의 스크리닝 방법에 의해 스크리닝된 YDJC 억제제; 및 항암제를 유효성분으로 포함하는, YDJC 발현 또는 활성이 증가된 암 질환 예방 또는 치료용 약학 조성물.
  12. 청구항 11에 있어서, 상기 항암제는 시스플라틴(Cisplatin), 카보플라틴(Carboplatin), 파클리탁셀(Paclitaxel; Taxol), 알부민 결합 파클리탁셀(Albumin-bound paclitaxel; nab-paclitaxel; Abraxane), 도세탁셀(Docetaxel; Taxotere), 젬시타빈(Gemcitabine; Gemzar), 비노렐빈(Vinorelbine; Navelbine), 에토포시드(Etoposide; VP-16), 페메트렉시드(Pemetrexed; Alimta), 아파티닙(Afatinib) 다코미티닙(Dacomitinib), 엘로티닙(Erlotinib), 제피티닙(Gefitinib), 오시머티닙(Osimertinib), 크리조티닙(Crizotinib; Xalkori), 세리티닙(Ceritinib; Zykadia), 알렉티닙(Alectinib; Alecensa), 브리가티닙(Brigatinib; Alunbrig), 로란티닙(Lorlatinib; Lorbrena), 니볼루맙(nivolumab) 및 펨브로리주맙(penbrolizumab)으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 약학 조성물.
PCT/KR2023/007202 2022-05-26 2023-05-25 Ydjc 억제제 스크리닝 방법 Ceased WO2023229403A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20220064406 2022-05-26
KR10-2022-0064406 2022-05-26
KR10-2023-0067450 2023-05-25
KR1020230067450A KR102909685B1 (ko) 2022-05-26 2023-05-25 Ydjc 억제제 스크리닝 방법

Publications (1)

Publication Number Publication Date
WO2023229403A1 true WO2023229403A1 (ko) 2023-11-30

Family

ID=88919726

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/007202 Ceased WO2023229403A1 (ko) 2022-05-26 2023-05-25 Ydjc 억제제 스크리닝 방법

Country Status (1)

Country Link
WO (1) WO2023229403A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015120254A1 (en) * 2014-02-06 2015-08-13 Texas Tech University System Disulfiram compositions and treatments for brain tumors
KR20200050761A (ko) * 2018-11-02 2020-05-12 고려대학교 산학협력단 다이설피람을 포함하는 항암용 조성물
KR20200089377A (ko) * 2019-01-16 2020-07-27 동국대학교 산학협력단 폐암에서 ydjc의 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015120254A1 (en) * 2014-02-06 2015-08-13 Texas Tech University System Disulfiram compositions and treatments for brain tumors
KR20200050761A (ko) * 2018-11-02 2020-05-12 고려대학교 산학협력단 다이설피람을 포함하는 항암용 조성물
KR20200089377A (ko) * 2019-01-16 2020-07-27 동국대학교 산학협력단 폐암에서 ydjc의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BUTCHER KATE, KANNAPPAN VINODH, KILARI RAJAGOPAL SHARADA, MORRIS MARK R., MCCONVILLE CHRISTOPHER, ARMESILLA ANGEL L., WANG WEIGUAN: "Investigation of the key chemical structures involved in the anticancer activity of disulfiram in A549 non-small cell lung cancer cell line", BMC CANCER, BIOMED CENTRAL, LONDON, GB, vol. 18, no. 1, 1 December 2018 (2018-12-01), LONDON, GB , XP093112111, ISSN: 1471-2407, DOI: 10.1186/s12885-018-4617-x *
CHIN CHUI-YOKE, GREGG KELSEY A., NAPIER BROOKE A., ERNST ROBERT K., WEISS DAVID S.: "A PmrB-Regulated Deacetylase Required for Lipid A Modification and Polymyxin Resistance in Acinetobacter baumannii", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 59, no. 12, 1 December 2015 (2015-12-01), US , pages 7911 - 7914, XP093112104, ISSN: 0066-4804, DOI: 10.1128/AAC.00515-15 *
KIM EUN JI, PARK MI KYUNG, BYUN HYUN JUNG, KANG GYEOUNG JIN, YU LU, KIM HYUN JI, SHIM JAE GAL, LEE HO, LEE CHANG HOON: "YdjC chitooligosaccharide deacetylase homolog induces keratin reorganization in lung cancer cells: involvement of interaction between YDJC and CDC16", ONCOTARGET, IMPACT JOURNALS LLC, UNITED STATES, vol. 9, no. 33, 1 May 2018 (2018-05-01), United States , pages 22915 - 22928, XP093112114, ISSN: 1949-2553, DOI: 10.18632/oncotarget.25145 *
TORO TASHA B., WATT TERRY J.: "KDAC8 substrate specificity quantified by a biologically relevant, label‐free deacetylation assay", PROTEIN SCIENCE, WILEY, US, vol. 24, no. 12, 1 December 2015 (2015-12-01), US , pages 2020 - 2032, XP093112107, ISSN: 0961-8368, DOI: 10.1002/pro.2813 *

Similar Documents

Publication Publication Date Title
CA3059210C (en) Triple drug combination (metformin, simvastatin, digoxin) for targeted treatment of pancreatic cancer
Tu et al. Targeting stem cells-clinical implications for cancer therapy
Wang et al. The CK1δ/ε-AES axis regulates tumorigenesis and metastasis in colorectal cancer
CN114917359B (zh) 针对细胞周期多时空分布抗癌靶点的protac组合物
Hua et al. Antitumor effects of flavokawain-B flavonoid in gemcitabine-resistant lung cancer cells are mediated via mitochondrial-mediated apoptosis, ROS production, cell migration and cell invasion inhibition and blocking of PI3K/AKT Signaling pathway
Wang et al. Mutational landscape of primary pulmonary salivary gland-type tumors through targeted next-generation sequencing
Wang et al. Biomarkers of peripheral blood neutrophil extracellular traps in the diagnosis and progression of malignant tumors
WO2017217796A1 (ko) Rhoa 억제제 및 이의 용도
CN111281873A (zh) Dna甲基转移酶3a抑制剂及其应用
Guo et al. SERPINE1 as an independent prognostic marker and therapeutic target for nicotine-related oral carcinoma
CN105063196B (zh) 蛋白酶体抑制剂与细胞自噬激活剂联合在胆管癌治疗中的应用
Li et al. Clinical and molecular cytogenetic studies in seven patients with myeloid diseases characterized by i (20q−)
Bi et al. Phycocyanin inhibits Helicobacter pylori-induced hyper-proliferation in AGS cells via activation of the ROS/MAPK signaling pathway
Xing et al. Clonality analysis of synchronous gastro‐oesophageal junction carcinoma and distal gastric cancer by whole‐exome sequencing
WO2023229403A1 (ko) Ydjc 억제제 스크리닝 방법
Fang et al. Emerging roles of intratumoral microbiota: A key to novel cancer therapies
Duan et al. Genomic heterogeneity and clonal evolution in gastroesophageal junction cancer revealed by single cell DNA sequencing
US20170342503A1 (en) Xrn2 as a determinant of sensitivity to dna damage
KR102909685B1 (ko) Ydjc 억제제 스크리닝 방법
Aypar et al. Rare and novel RUNX1 fusions in myeloid neoplasms: A single‐institute experience
Uchida et al. Genomic profiling of gastric carcinoma in situ and adenomas by array‐based comparative genomic hybridization
Li et al. Mitochondrial Calcium Uniporter Drives Chemoresistance in Pancreatic Cancer via Glutathione‐Mediated Stemness Maintenance
CN109529041B (zh) 脾酪氨酸激酶作为肝内胆管细胞癌治疗靶点的应用
CN110684844B (zh) RBPJL基因的p.P476S突变作为PD-1抗体用药指导标志物中的应用
Yu et al. A novel signature based on twelve programmed cell death patterns to predict the prognosis of lung adenocarcinoma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23812177

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 23812177

Country of ref document: EP

Kind code of ref document: A1