WO2023229403A1

WO2023229403A1 - Ydjc inhibitor screening method

Info

Publication number: WO2023229403A1
Application number: PCT/KR2023/007202
Authority: WO
Inventors: 이창훈; 이병일
Original assignee: 동국대학교 산학협력단; 국립암센터
Priority date: 2022-05-26
Filing date: 2023-05-25
Publication date: 2023-11-30

Abstract

The present invention relates to a method for screening a YDJC inhibitor, the method comprising the steps of: treating a substrate selected from GalNAc (N-Acetylgalactosamine) or a derivative thereof with a candidate substance in an enzyme reaction buffer containing YdjC Chitooligosaccharide deacetylase homolog (YDJC) to perform an enzymatic reaction; terminating the enzymatic reaction and then separating the supernatant; and adding a fluorescent substance to the supernatant, allowing same to react, and then measuring the fluorescence. The method can be utilized for the development of YDJC inhibitors and can be used to inhibit the onset and metastasis of lung cancer involving YDJC.

Description

YDJC inhibitor screening method

The present invention provides a method for screening YDJC (YdjC Chitooligosaccharide deacetylase homolog) inhibitors.

Lung cancer refers to a malignant tumor that occurs in the lung. It can be divided into primary lung cancer, in which cancer cells arise from the tissues that make up the lung itself, and metastatic lung cancer, in which cancer cells originate in other organs and then migrate to the lungs through blood vessels or lymphatic vessels and proliferate.

In 2015, 214,701 cases of cancer occurred in Korea, of which lung cancer ranked 4th with 24,267 cases for both men and women, accounting for 11.3% of all cancer cases. The crude incidence rate per 100,000 population (the number of newly occurring patients in the target population group during the relevant observation period. The crude mortality rate is also calculated based on the same criteria) was 47.6 cases, and the male-to-female sex ratio was 2.3:1, occurring more frequently in men. The number of cases in men is 17,015, ranking second among male cancers, and in women, with 7,252 cases, it ranks fifth among female cancers. By age group, including men and women, those in their 70s were the largest at 36.2%, followed by those in their 60s at 26.8% and those in their 80s or older at 17.3%.

Histologically (International Classification of Diseases (ICD-10 code C34)), among the 24,235 lung cancer cases in 2017, carcinoma accounted for 86.6%, sarcoma accounted for 0.2%, and among carcinomas, adenocarcinoma accounted for 43.7%. was the most common, with squamous cell carcinoma accounting for 23.1% and small cell carcinoma accounting for 11.2%.

As mentioned above, lung cancer is the leading cause of cancer-related death in the world, and appropriate diagnostic indicators and new targets for lung cancer are needed. YDJC (YdjC Chitooligosaccharide deacetylase homolog) catalyzes the deacetylation of acetylated carbohydrates and is known to be involved in sphingosylphosphorylcholine (SPC)-induced keratin phosphorylation and reorganization in A549 lung cancer cells. However, the role of YDJC in lung cancer progression is largely unknown. In-depth research is still needed.

The purpose of the present invention is to provide a YDJC inhibitor screening method.

Another object of the present invention is to provide a composition for inhibiting YDJC containing disulfiram as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity, containing disulfiram as an active ingredient.

Another object of the present invention is a YDJC inhibitor screened by the above screening method; and an anticancer agent as an active ingredient, to provide a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity.

In order to achieve the above object, the present invention includes the steps of treating a candidate material and a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog) to perform an enzyme reaction; Separating the supernatant after terminating the enzyme reaction; And it provides a YDJC inhibitor screening method comprising; adding a fluorescent substance to the supernatant, reacting it, and then measuring fluorescence.

Additionally, the present invention provides a composition for inhibiting YDJC containing disulfiram as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity, comprising disulfiram as an active ingredient.

In addition, the present invention provides a YDJC inhibitor screened by the above screening method; and an anticancer agent as an active ingredient, and provides a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity.

According to the present invention, the present invention relates to a YDJC inhibitor screening method using a YDJC-substrate complex, which can be used in the development of YDJC inhibitors and is used to inhibit the development and metastasis of lung cancer involving YDJC, making it effective against lung cancer. It can be used as a treatment.

Figure 1 shows the YDJC tertiary structure.

Figure 2 shows a schematic diagram of the YDJC inhibitor screening method.

Figure 3 shows data exploring the YDJC substrate.

Figure 4 shows the structure of the complex between YDJC and the substrate.

Figure 5 shows the results of YDJC inhibitor screening.

Figure 6 shows the results of an experiment in which the YDJC inhibitor inhibits proliferation of lung cancer cell lines by disulfiram (hereinafter referred to as DSF).

Figure 7 shows the effect of YDJC inhibitor on cell cycle proteins upon treatment with DSF (500 nM).

Figure 8 shows the results confirming cell death of lung cancer cell lines by YDJC inhibitors.

Figure 9 shows the effect of YDJC inhibitors on apoptosis proteins.

Figure 10 shows the results of analyzing CD8+ T cell expression in lung cancer tissues obtained by injecting LLC-1 lung cancer cell line into mice lacking YDJC (YDJC ^-/- ).

Figure 11 shows the results of analyzing CD8+ T cell expression in mice obtained by crossing YDJC-deficient mice (YDJC ^-/- ) and Kras ^LSL ^- ^G12D lung cancer-prone mice (Kras ^LSL-G12D ;YDJC ^-/- ).

Figure 12 shows the results showing proteoglycan-related genes obtained by analyzing genetic changes in cells in which YDJC expression was suppressed through RNAseq.

Figure 13 shows the results showing immune-related genes obtained by analyzing genetic changes in cells in which YDJC expression was suppressed through RNAseq.

Hereinafter, the present invention will be described in more detail.

As a result of research efforts to identify appropriate diagnostic indicators and new treatment targets for lung cancer, the present inventors discovered GalNAc (N-Acetylgalactosamine) or a variant thereof as a new substrate for YDJC (YdjC Chitooligosaccharide deacetylase homolog) and screened YDJC treatments using it. Through this, it was discovered that a new treatment for lung cancer could be developed, and the present invention was completed.

The present invention includes the steps of performing an enzyme reaction by treating a candidate material and a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog); Separating the supernatant after terminating the enzyme reaction; And it provides a YDJC inhibitor screening method comprising; adding a fluorescent substance to the supernatant, reacting it, and then measuring fluorescence.

The YDJC may have a base sequence consisting of SEQ ID NO: 1.

The GalNAc variant may be selected from GalNAc-6P (N-Acetyl-D-galactosamine 6-phosphate) or GalNAc-6S (N-Acetyl-D-galactosamine 6-sulfate).

The screening method includes the steps of treating a candidate material and a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog) and performing an enzyme reaction for 20 to 40 minutes; adding an equal amount of borate solution to the enzyme reaction solution to terminate the enzyme reaction and then separating the supernatant; And it may include adding a fluorescent substance to the supernatant, reacting at 20 to 24° C. for 18 to 22 minutes, and then measuring fluorescence.

The fluorescent substance may be fluorescamine, but is not limited thereto.

In addition, the present invention provides a pharmaceutical composition for preventing or treating a cancer disease with increased YDJC expression or activity, comprising disulfiram as an active ingredient, and the cancer disease may be lung cancer.

In another embodiment of the present invention, the pharmaceutical composition may contain suitable carriers, excipients, disintegrants, sweeteners, coating agents, bulking agents, lubricants, lubricants, flavoring agents, antioxidants, buffers, bacteriostatic agents, etc. commonly used in the preparation of pharmaceutical compositions. It may further include one or more additives selected from the group consisting of diluents, dispersants, surfactants, binders, and lubricants.

Specifically, carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, and microcrystalline. Cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil can be used. Solid preparations for oral administration include tablets, pills, powders, granules, and capsules. agents, etc., and such solid preparations can be prepared by mixing the composition with at least one or more excipients, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium styrate and talc can also be used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, etc. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogenatin, etc. can be used.

According to one embodiment of the present invention, the pharmaceutical composition is intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, inhalational, topical, rectal, oral, intraocular or It can be administered to a subject in a conventional manner via the intradermal route.

The dosage of the active ingredient according to the present invention may vary depending on the subject's condition and weight, type and degree of disease, drug form, administration route and period, and may be appropriately selected by a person skilled in the art, and the daily dosage is 0.01 mg. /kg to 200 mg/kg, preferably 0.1 mg/kg to 200 mg/kg, more preferably 0.1 mg/kg to 100 mg/kg. Administration may be administered once a day or divided into several administrations, and the scope of the present invention is not limited thereby.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity, comprising the YDJC inhibitor and anticancer agent screened by the above screening method as active ingredients.

The anticancer agent may be one or more selected from the group consisting of a chemotherapy agent, a tyrosine kinase inhibitor, an anaplastic lymphoma kinase (ALK) inhibitor, and an immune checkpoint inhibitor, and the chemotherapy agent is cisplatin ( Cisplatin, Carboplatin, Paclitaxel (Taxol), Albumin-bound paclitaxel (nab-paclitaxel; Abraxane), Docetaxel (Taxotere), Gemcitabine (Gemzar), Vinorelbine (Vinorelbine; Navelbine), etoposide (VP-16), and pemetrexed (Alimta) may be one or more selected from the group, and the tyrosine kinase inhibitor is Afatinib, Dacomitinib. It may be one or more selected from the group consisting of Dacomitinib, Erlotinib, Gefitinib, and Osimertinib, and the ALK inhibitor is Crizotinib (Xalkori), Ceritinib ( It may be one or more selected from the group consisting of Ceritinib (Zykadia), Alectinib (Alecensa), Brigatinib (Alunbrig), and Lorlatinib (Lorbrena), and the immune checkpoint inhibitor is nivolumab or It may be pembrolizumab, but is not limited thereto.

Hereinafter, to aid understanding of the present invention, it will be described in detail through examples. However, the following examples only illustrate the content of the present invention, and the scope of the present invention is not limited to the following examples. Examples of the present invention are provided to more completely explain the present invention to those with average knowledge in the art.

[Experimental Example 1] Determination of YDJC 3D structure

After securing the YDJC gene and expressing it in large quantities, crystals were obtained and tested to determine the structure using X-ray. The gene that synthesizes the human YDJC protein was synthesized as a codon-optimized DNA sequence in E. coli to ensure high expression in E. coli, and cloned into the pET28b(+) vector. Two types of YDJC were cloned: YDJC (1-323) consisting of the full length and YDJC (YDJC_deltaC; 1-302) with the C-terminal portion that does not form a three-dimensional structure removed. Two YDJC recombinant proteins. got it The sequence of the synthesized human YDJC gene (SEQ ID NO: 1) is as follows (TAA stop codon is indicated separately).

(SEQ ID NO: 1)

ATGAGCCGGCCGCGGATGCGGCTGGTTGTTACCGCAGATGATTTTGGTTATTGTCCTCGCCGGGATGAAGGTATTGTTGAAGCATTTCTGGCAGGTGCAGTTACCTCTGTAAGCCTGTTAGTTAATGGTGCAGCAACCGAAAGTGCTGCAGAACTGGCACGGCGCCATAGTATTCCGACCGGTCTGCATGCTAATCTGTCTGAAGGTCGGCCGGTTGGTCCGGCTCGGCGGGGTGCAAGCAGTCTGCTGGGT CCGGAAGGCTTTTTTCTGGGTAAAATGGGTTTCGGAAGCAGTTGCAGCAGGTGATGTTGATCTGCCGCAGGTTCGGGAAGAACTGGAAGCCCAGCTCAGTTGTTTTCGGGAACTGCTGGGTCGCGCACCGACCATGCGGATGGTCATCAGCATGTTCATGTTCTGCCGGGTGTTTGTCAGGTTTTTGCAGAAGCACTGCAGGCCTATGGCGTTCGGTTTACACGGTTACCGCTGGAACGGGGCGTTGG TGGATGTACCTGGTTGGAAGCACCGGCCCGAGCTTTTGCGTGCGCCGTCGAACGCGACGCTCGGGCAGCTGTAGGTCCTTTTTCACGCCATGGCCTGCGGTGGACGGATGCATTTGTCGGTCTTAGCACTTGTGGGCGCCACATGAGTGCACATCGCGTTAGTGGTGCACTGGCAGCGCGTTCTGGAAGGTACTCTGGCAGGTCATACCCTGACCGCAGAACTGATGGCACATCCGGGTTATCCGAGTGTTCC GCCGACCGGTGGTTGTGGTGAAGGTCCGGATGCGTTTAGCTGTAGTTGGGAACGCCTGCATGAGCTCCGGGTGCTGACCGCCCCGACCCTGCGCGCACAGCTGGCACAGGATGGTGTTCAGCTGTGTGCCCTGGATGATCTGGATAGCAAACGCCCGGGTGAAGAAGTTCCGTGTGAACCGACCCTGGAACCGTTTCTGGAACCGAGTCTGCTGTAA

Protein expression was performed in the E. coli strain Rosetta2(DE3)pLysS. O.D. at 37℃ After culturing E. coli to 0.6, the culture temperature was lowered to 18°C and protein expression was performed using 0.5mM IPTG (Isopropyl β- D -1-thiogalactopyranoside). After pulverizing and centrifuging the protein-expressing E. coli using a Microfluidizer (MFD), the supernatant was filtered through Ni-NTA column, Thrombin cleavage, 2nd Ni-NTA column (to remove unseparated YDJC), and gel filtration (Gel It was purified using a filtration (Supderdex 75 prep grade) column. The final protein storage conditions were 10 mg/ml in 20mM Tris-HCl pH 7.5, 400mM sodium chloride, 10 uM magnesium chloride, and 1mM TCEP buffer.

As a result, according to Figure 1, YDJC crystals were obtained under various conditions, and native and seleno-methionine crystals were obtained under the three conditions in Table 1.

결정화 조건 #1 Crystallization Condition #1	20 mM Sodium formate, 20 mM Ammonium acetate, 20 mM Sodium citrate tribasic dihydrate, 20 mM Potassium sodium tartrate tetrahydrate, 20 mM Sodium oxamate, 100 mM Tris (base); BICINE pH 8.5, 20% v/v PEG 500MME, 10% PEG 20K20mM Sodium formate, 20mM Ammonium acetate, 20mM Sodium citrate tribasic dihydrate, 20mM Potassium sodium tartrate tetrahydrate, 20mM Sodium oxamate, 100mM Tris (base); BICINE pH 8.5, 20% v/v PEG 500MME, 10% PEG 20K
결정화 조건 #2 Crystallization Condition #2	20 mM 1,6-Hexanediol, 20 mM 1-Butanol, 20 mM 1,2-Propanediol, 20 mM 2-Propanol, 20 mM 1,4-Butanediol, 20 mM 1,3-Propanediol, 100 mM Bis-Tris propane pH9.0, 20% v/v PEG 500MME, 10% v/v PEG 20K 20mM 1,6-Hexanediol, 20mM 1-Butanol, 20mM 1,2-Propanediol, 20mM 2-Propanol, 20mM 1,4-Butanediol, 20mM 1,3-Propanediol, 100mM Bis-Tris propane pH9.0, 20% v/v PEG 500MME, 10% v/v PEG 20K
결정화 조건 #3Crystallization Condition #3	20 mM 1,6-Hexanediol, 20 mM 1-Butanol, 20 mM 1,2-Propanediol, 20 mM 2-Propanol, 20mM 1,4-Butanediol, 20mM 1,3-Propanediol, 100 mM Tris (base); BICINE pH 8.5, 20% v/v PEG 500MME, 10% v/v PEG 20K 20mM 1,6-Hexanediol, 20mM 1-Butanol, 20mM 1,2-Propanediol, 20mM 2-Propanol, 20mM 1,4-Butanediol, 20mM 1,3-Propanediol, 100mM Tris (base); BICINE pH 8.5, 20% v/v PEG 500MME, 10% v/v PEG 20K

Since there was no three-dimensional structure structurally similar to YDJC, YDJC crystals substituted with seleno-methionine were obtained, and after solving the topology problem using SAD (Single-wavelength anomalous dispersion) method, native and later crystals were obtained. The structure of the YDJC-substrate complex was confirmed. The Coot program was used to create the 3D model, and the Phenix program package was used for precision.

[Experimental Example 2] YDJC substrate search

YDJC is expected to have deacetylase activity for sugar-based substances, so after searching for acetyl carbohydrate on the PubChem DB site, purchasable substances were secured, and as shown in Figure 2, deacetylase (deacetylase) test was performed. YDJC utilizes divalent metal ions ⁱⁿ enzyme reactions, and magnesium (Mg ²⁺ ) ions were also bound in the 3D structure of YDJC. However, since the metal ion with the greatest activity is not precise, representative divalent metal ions, MgCl _2, MnCl ₂ , FeCl ₂ , NiCl _2, and ZnCl ₂ , were used in enzyme reaction buffer (100 mM HEPES-NaOH pH 7.0, 200 mM sodium chloride, and Enzyme activity was measured by adding 10% (v/v) glycerol). The enzyme reaction was performed by adding a substrate candidate (1mM) to the enzyme reaction buffer containing YDJC protein, reacting for 20 hours, and then ending the reaction by adding an equal amount of 500mM borate buffer (pH 9.1). After removing the precipitate by centrifugation, the supernatant was transferred to a 96 assay plate, 1/5 volume of a 2 mg/ml fluorescamine solution dissolved in dimethylformamide (DMF) was added, and incubated at 22°C. After reaction for 20 minutes, the fluorescence intensity was measured (excitation 360 nm, emission 465 nm). As an experimental control, YDJC inactivated by heat (boiling) and an enzyme reaction without substrate were applied. As a result, according to Figure 3, the fluorescence intensity in GalNAc (N-Acetylgalactosamine), GalNAc-6P (N-Acetyl-D-galactosamine 6-phosphate), and GalNAc-6S (N-Acetyl-D-galactosamine 6-sulfate) appeared strongly, confirming that it was a YDJC substrate.

In order to confirm the three-dimensional structure of the YDJC-substrate complex, a mutant was created in which Aspartate 13, which is expected to be important for the enzyme reaction, was replaced with Asparagine to prevent the enzyme reaction from occurring while the substrate binds to the protein. This was crystallized (YDJC_deltaC/D13N mutant). Expression and purification were performed in the same manner as the wild type. Specifically, the protein was expressed in the E. coli strain Rosetta2(DE3)pLysS. O.D. at 37℃ After culturing E. coli to 0.6, the culture temperature was lowered to 18°C and protein expression was performed using 0.5mM IPTG (Isopropyl β-D-1-thiogalactopyranoside). After pulverizing and centrifuging the protein-expressing E. coli using a Microfluidizer (MFD), the supernatant was subjected to Ni-NTA column, thrombin cleavage, and a second Ni-NTA column (to remove unseparated YDJC). and purified using a gel filtration (Supderdex 75 prep grade) column. The final protein storage conditions were concentrated to 15 mg/ml in 20mM Tris-HCl pH 7.5, 400mM sodium chloride, 10 μM magnesium chloride, and 1mM TCEP buffer, followed by crystallization conditions (30mM diethylene glycol, 30mM triethylene glycol). , 30 mM tetraethylene glycol, 30 mM pentaethylene glycol, 100 mM Tris (base); BICINE pH 8.5, 40 % v/v ethylene glycol, 20 % w/v PEG 8000), X-ray diffraction data was collected. Using the apo-YDJC_deltaC structure, the structure was confirmed by molecular substitution method, and clear substrate electron density was observed. According to Figure 4, it was confirmed that GalNAc is the YDJC substrate through confirmation of the three-dimensional structure of the YDJC-substrate complex. .

[Experimental Example 3] Search for YDJC inhibitors

DSF (differential scanning fluorimetry; thermal shift assay) method by high throughput screening (HTS); and an enzyme activity search method described later; YDJC inhibitors were explored using two methods, and tests were conducted to derive various substances.

3 μM YDJC was mixed with 3 μM of a substance expected to be a YDJC inhibitor from an FDA-approved library, 1X Sypro Orange (Thermo Fisher) was added, and the temperature was gradually increased using real-time PCR to measure the Tm value of the protein.

Substances predicted to be YDJC inhibitors from the FDA-approved library were screened using the DSF method to select four substances with the greatest change in Tm value, and their activity was measured using the enzyme activity search method. . The enzyme activity search method is a deacetylase activity search method of YDJC using GalNAc, a YDJC substrate derived in Experimental Example 2, and 10 μM YDJC is mixed with 100 mM HEPES-NaOH pH 7.0, 200 mM sodium chloride, and 10 μM YDJC. It was diluted in an enzyme reaction buffer consisting of % (v/v) glycerol, GalNAc (6.5 mM) was added to the reaction solution, and the enzyme reaction was performed for 30 minutes (at this time, the total volume of the enzyme reaction was 50 μl), then the same amount as the enzyme reaction solution was added. The reaction was terminated by adding 50 μl of 500 mM borate (pH 10.0), and the precipitate was removed by centrifugation. After transferring the supernatant to a 96-well assay plate, 20 μl of 2 mg/ml fluorescamine was added and reacted at 22°C for 20 minutes to reveal fluorescence, and then the fluorescence was measured (excitation 360 nm, emission 465 nm).

As a result, according to Figure 5, DSF (Hit no. 23) was significantly less reactive than other materials, so it could be judged as a YDJC inhibitor.

[Experimental Example 4] Lung cancer cell inhibition properties of YDJC inhibitor

We confirmed whether inhibitors of YDJC regulate cancer-related characteristics of lung cancer cells. Cell culture conditions in the laboratory (A549, a representative lung cancer cell line, was cultured using RPMI-1640 medium containing 10% FBS and 100 U/ml penicillin-streptomycin, 5% CO ₂ , and constant temperature and humidity at 37°C. After treatment with DSF, a YDJC inhibitor, lung cancer cells cultured in a maintained incubator are treated with tetrazolium (which is reduced by dehydrogenase produced by living cells to produce a coloring substance called formazan). tetrazolium salt), and the amount of reduced formazan was measured using a spectrophotometer. Since the production of formazan has a linear correlation with the number of living cells, the difference in the number of living cells can be confirmed through the difference in absorbance. As a result, according to Figure 6, DSF, an inhibitor of YDJC, inhibits overexpression of YDJC. It was confirmed that apoptosis was effectively induced in the induced cells. It was confirmed that inhibition of YDJC using siRNA-YDJC showed approximately 40% cell death activity, and in the case of DSF, a YDJC inhibitor, it showed approximately 50% cell death activity at a concentration of 500 nM.

After treating lung cancer cell lines with DSF, a YDJC inhibitor, intracellular proteins were separated, and the obtained proteins were separated by size using an SDS-PAGE gel, and changes in expression of proteins involved in cell proliferation were confirmed through Western blot. . As a result, according to Figure 7, it was confirmed that the expression of representative cell cycle proteins, cyclinA and cyclinB, was significantly reduced in cells treated with 500 nM of DSF compared to the control group (0 nM). did. In addition, it was confirmed that the expression of p21, one of the well-known cell cycle arrest proteins, was also noticeably increased.

In lung cancer cells treated with 0, 250, and 500 nM of DSF, a YDJC inhibitor, Annexin V-FITC (a protein that specifically binds to phosphatidylserine) and PI (propidium iodide) cannot pass through the intact plasma membrane, but when the permeability of the cell membrane increases, Annexin V-FITC bound to phosphatidylserine exposed outside the cell membrane during the apoptosis process and PI bound to the nucleus were measured using flow cytometry (based on the cross-shaped dividing line in the graph). Therefore, Annexin V-FITC single staining is considered to be early-apoptosis [lower right], Annexin V-FITC and PI double staining is considered to be late-apoptosis [upper right], and PI single staining is considered to be necrotic cells [upper left]. As a result, according to Figure 8, in the case of the control group (0 nM), normal cells were 89.6%, early-apoptosis was 5.4%, and late-apoptosis was 3.3% of the total cells. When treated with 250 nM of DSF, 84.5% of normal cells, 5% of early-apoptosis, and 7.1% of late-apoptosis were observed. When treated with 500 nM, 22.4% of normal cells, 10% of early-apoptosis, and 10% of late-apoptosis were observed. Cell death was measured at 37.9%. Through this experiment, it was confirmed that compared to lung cancer cells not treated with DSF, approximately 5.5 times higher cell death occurred when treated with 500 nM of DSF.

Western blot was used to determine whether the expression of proteins activated during the apoptosis stage was changed by YDJC inhibition. As a result, according to Figure 9, Western-blot showed that the expression of cleaved-caspase3 and cleaved-PARP, proteins that induce apoptosis, increased in cells treated with 500 nM DSF compared to cells treated with 0 or 100 nM DSF. It was confirmed that the expression of p53, a representative cancer suppressor protein and known to induce apoptosis, increased in cells treated with DSF.

[Experimental Example 5] Analysis of expression of CD8 ⁺ T immune cells through tail-vein experiment using LLC-1 in mice lacking YDJC (YDJC ^-/- )

The expression of CD8 ⁺ T immune cells, which are important in anticancer immune therapy, was examined in lung cancer tissues obtained by injecting LLC-1 mouse lung cancer cell line into YDJC ^-/- mice using an antibody that detects CD8. . As a result, as shown in Figure 10, it was confirmed that the infiltration of CD8 ⁺ T immune cells increased around lung cancer tissue obtained by injecting LLC-1 into mice lacking YDJC (YDJC ^-/- ). From the above results, it was confirmed that the YDJC inhibitor can be used as a new type of anticancer immunotherapy agent that increases CD8 ⁺ T-based immune activity.

[Experimental Example 6] CD8 ⁺ T immune cells in lung cancer tissue obtained from Kras ^LSL ^- ^G12D ;YDJC ^-/- mice obtained by crossing YDJC-deficient mice (YDJC ^-/- ) with Kras ^LSL ^- ^G12D lung cancer-prone mice Expression analysis

The expression of CD8 ⁺ T immune cells, which are important in anticancer immunotherapy, was examined in lung cancer tissues obtained from Kras ^LSL ^- ^G12D ;YDJC ^-/- mice using an antibody that detects CD8. As a result, as shown in Figure 11, it was confirmed that the infiltration of CD8 ⁺ T immune cells increased around lung cancer tissues obtained from Kras ^LSL ^- ^G12D ;YDJC ^-/- mice. From the above results, it was confirmed that the YDJC inhibitor can be used as a new type of anticancer immunotherapy agent that increases CD8 ⁺ T-based immune activity.

[Experimental Example 7] RNAseq analysis in A549 cells suppressing the expression of YDJC

A cell line lacking YDJC was created through gene silencing in A549 lung cancer cells, and RNA was extracted from this cell line and RNAseq analysis was performed to investigate which genes were altered. As a result, according to FIGS. 12 and 13, it was confirmed that there was significant variation in genes of the proteoglycan pathway (FIG. 12) and the immune response pathway (FIG. 13). From the above results, YDJC inhibition causes changes in proteoglycans containing N-acetylgalactosamine (e.g., containing chondroitin sulfate), and changes in immunity occur due to changes in these proteoglycans. This occurred was confirmed.

The description of the present invention described above is for illustrative purposes, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical idea or essential features of the present invention. will be. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive.

The scope of the present invention is indicated by the claims described below, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts should be construed as being included in the scope of the present invention.

Claims

Performing an enzyme reaction by treating a candidate material and a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof in an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog);

Separating the supernatant after terminating the enzyme reaction; and

A YDJC inhibitor screening method comprising: adding a fluorescent substance to the supernatant, reacting it, and then measuring fluorescence.
The YDJC inhibitor screening method according to claim 1, wherein the YDJC has a base sequence consisting of SEQ ID NO: 1.
YDJC according to claim 1 or 2, wherein the GalNAc variant is selected from GalNAc-6P (N-Acetyl-D-galactosamine 6-phosphate) or GalNAc-6S (N-Acetyl-D-galactosamine 6-sulfate) Inhibitor screening method.
The method according to claim 1 or 2, wherein the screening method involves treating the candidate material with an enzyme reaction buffer containing YDJC (YdjC Chitooligosaccharide deacetylase homolog) and a substrate selected from GalNAc (N-Acetylgalactosamine) or a variant thereof to carry out the enzyme reaction for 20 to 40 minutes. Steps performed for minutes;

adding an equal amount of borate solution to the enzyme reaction solution to terminate the enzyme reaction and then separating the supernatant; and

A YDJC inhibitor screening method comprising adding a fluorescent substance to the supernatant, reacting at 20 to 24° C. for 18 to 22 minutes, and then measuring fluorescence.
The YDJC inhibitor screening method according to claim 4, wherein the fluorescent substance is fluorescamine.
The YDJC inhibitor screening method according to claim 1 or 2, wherein the YDJC inhibitor is a lung cancer treatment.
A composition for inhibiting YDJC containing disulfiram as an active ingredient.
A pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity, comprising disulfiram as an active ingredient.
The pharmaceutical composition according to claim 8, wherein the disulfiram inhibits the expression of proteoglycan containing N-acetylgalactosamine.
The pharmaceutical composition according to claim 8, wherein the cancer disease is lung cancer.
A YDJC inhibitor screened by the screening method of claim 1; And a pharmaceutical composition for preventing or treating cancer diseases with increased YDJC expression or activity, comprising an anticancer agent as an active ingredient.
The method of claim 11, wherein the anticancer agent is Cisplatin, Carboplatin, Paclitaxel (Taxol), Albumin-bound paclitaxel (nab-paclitaxel; Abraxane), Docetaxel (Taxotere), Gemcitabine (Gemzar), Vinorelbine (Navelbine), Etoposide (VP-16), Pemetrexed (Alimta), Afatinib, Dacomitinib, Elo Erlotinib, Gefitinib, Osimertinib, Crizotinib (Xalkori), Ceritinib (Zykadia), Alectinib (Alecensa), Brigatinib A pharmaceutical composition comprising at least one selected from the group consisting of Alunbrig, Lorlatinib (Lorbrena), nivolumab, and pembrolizumab.