WO2023227622A1 - Oligonucleotides conjugated to oleic acid and uses thereof - Google Patents
Oligonucleotides conjugated to oleic acid and uses thereof Download PDFInfo
- Publication number
- WO2023227622A1 WO2023227622A1 PCT/EP2023/063829 EP2023063829W WO2023227622A1 WO 2023227622 A1 WO2023227622 A1 WO 2023227622A1 EP 2023063829 W EP2023063829 W EP 2023063829W WO 2023227622 A1 WO2023227622 A1 WO 2023227622A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- oligonucleotide
- seq
- molecule
- analogue
- mir
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/542—Carboxylic acids, e.g. a fatty acid or an amino acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3515—Lipophilic moiety, e.g. cholesterol
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3521—Methyl
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3525—MOE, methoxyethoxy
Definitions
- the present invention relates to the field of medicine. More specifically, the invention relates to oligonucleotide antagonists of endogenous microRNAs, particularly hsa-miR-218-5p and hsa-miR-23b-3p, that are conjugated to oleic acid, and their uses.
- DM1 Myotonic dystrophy type 1
- DM1 Myotonic dystrophy type 1
- DM1 is a rare genetic disease with no current effective treatment.
- DM1 is associated with a substantial disease burden resulting in impairment across many different patient systems and tissues. Muscle weakness and fatigue constitute the two most common disease manifestations, reported by 93% and 90% of patients, respectively, followed by muscle locking (73%).
- Other phenotypes include cardiac dysfunctions, cataracts, insulin resistance, and cognitive impairment.
- DM1 disease is based on CTG repeat expansions occurring in the DM1 protein kinase (DMPK) gene, which are transcribed into pathogenic mRNAs.
- DMPK DM1 protein kinase
- MBNL1 and MBNL2 proteins control alternative splicing and polyadenylation of several transcripts, specifically by causing a shift from foetal to adult patterns, and act antagonistically to CLIGBP Elav-like family member 1 (CELF) proteins in splice regulation, which are found upregulated and mislocated in DM1. Further, it has been shown that there is genetic redundancy between MBNL1 and 2 genes, as the deletion of only one resulted in the upregulation of the other and occupancy of its binding sites in target RNAs (see Lee 2013. Compound loss of muscleblind-like function in myotonic dystrophy.
- CELF CLIGBP Elav-like family member 1
- MBNL1 protein function has been shown to be a critical factor in the course of the disease. Indeed, MBNL1 loss of function accounts for more than 80% of missplicing events and nearly 70% of expression defects.
- MBNL genes and/or MBNL protein upregulation in DM1 mice and patient-derived fibroblasts is well tolerated and rescues several symptoms, such as myotonia and mis-splicing events, as well as the reduction of foci formation, opening the path for the development of therapeutic approaches aimed at increasing the expression of these genes.
- MBNL1 and MBNL2 depletion also impinge on several other gene expression processes, for example impairing trafficking of membrane- associated mRNAs or miRNA biogenesis.
- MicroRNAs are a class of small non-coding RNAs that play important roles in regulating gene expression, particularly in gene silencing.
- miRNA small non-coding RNAs that play important roles in regulating gene expression, particularly in gene silencing.
- the expression of hsa-miR-23b-3p and hsa-miR-218-5p has been shown to regulate MBNL1 and MBNL2 transcripts directly by luciferase reporter assay (Cerro-Herreros et al. 2018 Nat. Commun. 9, 2482).
- antimiRs are a class of oligonucleotides that prevents other molecules, such as microRNAs, from binding to a target site on an RNA, particularly in messenger RNA (mRNA) molecules.
- mRNA messenger RNA
- antimiRs as therapeutic molecules has limitations in their development as drug candidates, including a short life span due to degradation in the cellular environment, poor cellular intake from extracellular media, and limited therapeutic window expressed as the ratio of the concentrations at which a compound reaches median toxicity and efficacy (TC50/EC50) so that the higher the ratio, the better.
- TC50/EC50 median toxicity and efficacy
- albumin is one of the most abundant proteins in plasma and provides the transport of fatty acids, drugs, ions and other metabolites. Conjugation of the oligonucleotides with fatty acids may increase the albumin binding affinity of the oligonucleotides, enhancing their ability to cross the endothelial barrier and improving their functional uptake into muscles, thereby increasing the oligonucleotide potency in vivo.
- the wide variety of saturated and unsaturated fatty acids that differ in their structure may, in turn, influence protein binding or activity of fatty acid conjugates, leaving unclear what the optimal fatty acid for enhancing oligonucleotide potency is.
- PS linkages continue to show promising results as first-generation antisense oligos, although they present important limitations that are still hampering the development of fully modified (full PS) therapeutic oligonucleotides.
- Said limitations include the toxicity of PS-oligos reported in some studies in mice, rats, monkeys, and humans. In mice and rats, these side effects include thrombocytopenia, the elevation of liver transaminases, hyperplasia of reticuloendothelial cells in various organs, and renal tubular changes (UM Sarmiento, et al.
- the present invention overcomes these limitations by providing improved antimiRs conjugated to oleic acid.
- Figure 1 Evaluation of toxicity and efficacy on DM1 cells. Representation of toxicity (percentage of cell growth inhibition, black) and efficacy (percentage of MBNL1 expression increase, compared to mock-transfected cells, grey) on DM1 myotubes after lipofection with (A) MD23b-2, (B) 5'-23b-Oleic, (C) non-conjugated-23b or (D) 218-D/LNA2 at 5 different concentrations (for MD23b-2, 5'-23b-Oleic and non-conjugated-23b: 10 nM, 50 nM, 200 nM, 1 pM and 5 pM; and for 218-D/LNA2: 0.08 nM, 0.4 nM, 2 nM, 10 nM and 50 nM).
- FIG. 1 Functional efficacy assays in HSA LR mice 5 days after injection of the indicated treatments.
- A Force/Weight and
- B Myotonia grade were analyzed 5 days after a single injection (Al) of different antimiRs at 3 mg/Kg.
- FIG. 3 miRNA levels on muscle tissues.
- HSA LR mice received an IV injection in the tail vein with either PBS or the different antimiRs, all at the same concentration (3 mg/Kg). Mice were sacrificed 5 days after the injection and the muscles were dissected and processed for RNA extraction.
- Statistical comparisons were all performed against PBS-treated HSA LR values with a Student’s t-test.
- p values: ns not significant, *p ⁇ 0.05, **p ⁇ 0.01 , ***p ⁇ 0.001 , ****p ⁇ 0.0001.
- FIG. 4 Expression of MbnH and Mbnl2 on skeletal muscles of treated HSA LR mice.
- A MbnH and
- B Mbnl2 transcript levels were quantified by qRT-PCR relative to Gapdh endogenous control on gastrocnemius (gt) and quadriceps (qd) muscles;
- C MbnH protein levels relative to endogenous tubulin control using quantitative dot blot.
- HSA LR mice received an IV injection in the tail vein with PBS or the different antimiRs, all at the same concentration (3 mg/Kg). Gastrocnemius and quadriceps muscles were dissected 5 days after the injection and the tissues were processed for RNA and protein analysis.
- AntimiRs improved Mbnl-dependent missplicing of transcripts.
- HSA LR mice received an IV injection in the tail vein with PBS or the different antimiRs, all at the same concentration (3 mg/Kg). Gastrocnemius and quadriceps muscles were dissected 5 days after the injection and the tissues were processed for RNA extraction.
- A RT-PCR semiquantitative analyses of the splicing of (A) Atp2a1 exon 22, (B) Nfix exon 7, (C) MbnH exon 5, and (D) Clcnl exon 7a in gastrocnemius (gt) and quadriceps (qd) muscles. Exon inclusion levels of healthy control mice (FVB) are also included for comparison.
- FIG. 6 Representative agarose gels used for the quantifications summarized in Fig 5 of Atp2a1, Clcnl, Nfix, and MbnH transcripts in gastrocnemius and quadriceps muscles. Effect of treatment with the indicated oligonucleotides against miR-23b-3p (A,B) and miR-218-5p (C,D). Splicing patterns of wild-type mice (FVB) and PBS-treated HSA LR mice are also shown for comparison.
- FIG. 7 Spider graphs showing the effect of the indicated treatments on several DM1- related molecular or functional phenotypes in HSA LR mice.
- the values represented are the recovery index (Rl), and they measure how close the different values of treated HSA LR mice are compared to FVB controls' parameters, represented as 1 (solid black line).
- Panel (A) summarizes Rl for antimiRs against miR-23b-3p, while (B) focuses on Rl for antimiRs against miR-218-5p. For more representation details, see “Radar charts” in the Materials and Methods section.
- Figure 8 Chemical structure of different linkers used to connect MD23b-2 V2 oligo and Oleic acid. The draw of the entire resulting molecule, except for the oligonucleotide component, was generated with the ChemDraw software.
- Figure 10 A)Chemical structure of MD23b-2 V2 3’01 oligo. The draw of the complete molecule was generated with the ChemDraw software. B) Chemical structure of MD23b-2- PS/PO 3’01 oligo. The draw of the complete molecule was generated with the ChemDraw software C) Chemical structure of 218 MOE Oleic 3’ oligo. The draw of the complete molecule was generated with the ChemDraw software.
- Fig 12 MBNL1 relative levels. Phase I and Phase II. Quantification of MBNL1 levels by Western Blot in protein extracts from brain of the NHP. Comparison of MBNL1 protein levels in brain NHP from the phase I, two weeks after the last administration and phase II, three weeks after the last administration. In the western blots, GAPDH levels were used as internal standard and the data was normalized to the MBNL1 protein levels in PBS-treated NHP (group 2), which were given the value of 1. Data is mean ⁇ SEM.
- the present invention relates to an oligonucleotide molecule, or a mixture of two or more of said molecules, wherein said oligonucleotide molecule comprises between 10 to 30 nucleotides in length, wherein said oligonucleotide molecule comprises at least two nucleotides chemically linked by a phosphorothioate linkage, and wherein said oligonucleotide molecule is conjugated at its 3' and/or 5' ends to at least one oleic acid molecule.
- the molecule is an antagonist of a microRNA, more preferably wherein the microRNA is the human hsa-miR-23b-3p or the human hsa-miR-218-5p.
- the oligonucleotide molecule according to the first aspect comprises between 15 to 30 nucleotides in length, comprises at least two nucleotides linked by a phosphodiester linkage, wherein the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage.
- the oligonucleotide molecule according to the first aspect comprises between 15 to 30 nucleotides in length, and wherein said oligonucleotide molecule also comprises a fragment composed of a succession of at least 15 consecutive nitrogen bases of nucleotides that are identical in at least 80% to the sequence of a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR-23b-3p), or SEQ ID NO: 52-110.
- the oligonucleotide molecule according to the first aspect comprises between 15 to 30 nucleotides in length, and wherein said oligonucleotide molecule also comprises a fragment composed of a succession of at least 15 consecutive nitrogen bases of nucleotides that are identical to the sequence of a region present in SEQ ID NO: 1 (antimiR- 218-5p) or 2 (antimiR-23b-3p).
- the oligonucleotide molecule according to the first aspect comprises at least one chemical modification, wherein the chemical modification is selected from the group of: i) 2'-O-methyl (2'OMe), ii) 2'-O-Methoxyethyl (2' MOE), and/or iii) an extra bridge connecting the 2' oxygen and 4' carbon (LNA).
- the chemical modification is selected from the group of: i) 2'-O-methyl (2'OMe), ii) 2'-O-Methoxyethyl (2' MOE), and/or iii) an extra bridge connecting the 2' oxygen and 4' carbon (LNA).
- the oligonucleotide molecule according to the first aspect comprises between 15 to 30 nucleotides in length, and wherein said oligonucleotide molecule also comprises a fragment composed of a succession of at least 15 consecutive nitrogen bases of nucleotide that are identical in at least 80% to the sequence of a region present in SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonists of hsa-miR-23b) or SEQ ID NOs: 7, 8, 9, 14, 25, 26, 27, or 28 (antagonists of hsa-miR-218-5p).
- the oligonucleotide molecule according to the first aspect comprises between 15 to 30 nucleotides in length, wherein the nucleotide sequence of said oligonucleotide consists of SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonists of hsa- miR-23b) or SEQ ID NOs: 7, 8, 9, 14, 25, 26, 27, or 28 (antagonists of hsa-miR-218-5p).
- the present invention relates to composition, preferably a pharmaceutical composition, comprising at least an oligonucleotide molecule as defined in the first aspect or any of its embodiments, or a mixture of two or more of them, optionally further comprising a carrier and/or one or more pharmaceutically acceptable excipients.
- the present invention relates to composition as defined in the second aspect or any of its embodiment, for use in therapy.
- the present invention relates to composition as defined in the second aspect or any of its embodiment, for use in targeting muscular cells in a subject in need thereof.
- the present invention relates to composition as defined in the second aspect or any of its embodiment, for use in the prevention or treatment of muscular diseases or in the prevention or treatment of RNAopathies.
- the disease is myotonic dystrophy, more preferably myotonic dystrophy is of type 1.
- a third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term “and/or” as used herein. Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term "and/or.”
- oligonucleotide as referred herein is meant any short segment of DNA, RNA, or DNA/RNA, including both natural and synthetic nucleotides.
- oligonucleotide molecules includes both oligonucleotides as such, as well as the “oligonucleotide analogues”.
- Oligonucleotide analogues are the molecules derived therefrom that incorporate some chemical modification in at least one of the nucleotide units that form them, either in the phosphate group, the pentose or one of the nitrogenous bases; the modifications consisting in the addition of non-nucleotide groups at the 5' and/or 3' ends are also included as well as phosphorodiamidate morpholino oligomers, peptide nucleic acids (PNAs; mimics of DNA in which the deoxyribose phosphate backbone is replaced by a pseudopeptide polymer to which the nucleobases are linked), and the like.
- PNAs peptide nucleic acids
- oligonucleotide molecule and “oligonucleotide analogue” or “oligonucleotide analogue molecule” also include sponges of microRNAs or microRNA sponges, as it can be considered that the main constituent of the same are tandem repeats of oligonucleotides, characterized in that each of these oligonucleotides are in themselves or contain a binding site of a microRNA of interest.
- oligonucleotide sequences disclosed herein and numbered as “SEQ ID NO”, comprise a nucleobase sequence together with chemical modifications and/or fatty acid conjugation, if any.
- SEQ ID NO 3 refers to the nucleobase sequence “ATCCCTGGCAATGTGA”, together with the LNA, phosphorothioate linkages, and 5-Methyl-2'-O-Methyl cytidine, modifications, among others.
- this sequence is represented herein as SEQ ID NO 3: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCms- AbAmTbGbTmsGbsAb(NHC6)(OleicAcid).
- antagonist oligonucleotide is referred herein as an oligonucleotide that is able to block or inhibit the natural function of a molecule, in this case, a microRNA.
- the antagonist oligonucleotides of the present invention are inhibitor molecules that avoid the activation, stability or function of the antimiR to which they bind.
- antagonist is synonymous of “inhibitor” and can thus be used interchangeably.
- an “antagonist oligonucleotide of hsa-miR-23b-3p” refers to an oligonucleotide molecule that inhibits the function of the hsa-miR-23b-3p.
- Percentage of sequence identity for polynucleotides and polypeptides is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the same nucleobase or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
- Optimal alignment of sequences for comparison may be conducted by computerized implementations of known algorithms (BLAST in the resources of the National Center for Biotechnology Information, CLUSTAL in the resources of the European Bioinformatics Institute, GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), or by inspection.
- BLAST in the resources of the National Center for Biotechnology Information
- CLUSTAL in the resources of the European Bioinformatics Institute
- BESTFIT FASTA
- FASTA Altschul et al.
- nucleotide units which mainly affect the ribose moiety and/or phosphate, modifications that are difficult to depict in the usual representations of nucleotide sequences, in which the nucleotide present in a given position is identified by the abbreviation of the nitrogenous base that is part of it.
- microRNA antagonists that refer to the percentage of identity between the sequences of the nitrogenous bases or nucleobases of the nucleotide or nucleotide analogue units present in these units, as this is what indicates whether two molecules or sequence fragments are designed from the same original basic nucleotide sequence, independently of the different chemical modifications that may have been included in the nucleotides in each case.
- nucleotide molecules are 100% complementary when the nucleotide or nucleotide analogue sequence of one of them, read in the 5'-3' sense, is the sequence of nucleotides or nucleotide analogues that present the nitrogenous bases which pair with the nitrogenous bases of nucleotides or nucleotide analogues of the other sequence, read in the 3'-5' sense. That is to say, the sequence 5'- UAGC-3' would be complementary to the sequences 3'-AUCG-5' and 3'-ATCG-5', which would be, respectively, sequences 5'-GCUA-3' and 5'-GCTA-3' read in the 5'-3' sense.
- the antagonist molecule comprises in its sequence a fragment that is identical to the complementary sequence to that of the seed region of the microRNA to be antagonized, at least with regard to the complementarity of the nitrogenous bases.
- antimiRs refer to oligonucleotides, preferably oligoribonucleotides, that are complementary to a microRNA, preferably a mature microRNA, that is their target and they bind to with great affinity inhibiting it. Therefore, antimiRs refer to oligonucleotides, usually chemically modified with respect to the corresponding oligomer composed only of nucleotide units, and that are complementary and thus inhibitors of a target microRNA. In the particular case of the present invention, the antimiRs described herein are preferably at least partially complementary to human microRNAs hsa-miR-23b-3p or hsa-miR-218-5p.
- microRNA sponges are usually designed so that they inhibit microRNAs with a complementary heptameric or octameric fragment (seed region), such that a single sponge construct can be used to block a whole family of microRNAs sharing the same motif, although they may also contain the entire target sequence for a specific microRNA or only a miRNA- specific region, devoid of the seed region, to make it specific.
- pharmaceutically acceptable refers to molecular entities and compositions that do not produce any adverse, allergic or other reactions when administered to an animal or human being.
- pharmaceutically acceptable vehicle includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption retarding agents, fatty acids such as oleic acid, and similar acceptable agents for use in formulation pharmaceuticals, such as pharmaceutical products suitable for administration to human beings.
- Preventing include without limitation, decreasing, reducing or ameliorating the risk of a symptom, disorder, condition, or disease, and protecting an animal from a symptom, disorder, condition, or disease.
- a prevention may be applied or administered prophylactically.
- Treating include without limitation, restraining, slowing, stopping, reducing, ameliorating, or reversing the progression or severity of an existing symptom, clinical sign, disorder, condition, or disease.
- a treatment may be applied or administered therapeutically.
- TC50 or “half-maximal inhibitory concentration” is referred herein as the concentration of an inhibitor administered to test organism or test cell lines that produces toxic effects in 50 percent of a population of exposed organisms or cell lines in a given time period.
- EC50 or “half-maximal effective concentration” is referred herein as the concentration of an antagonist or inhibitor required to obtain a response halfway between the baseline and maximum in a given time period. That is, EC50 is the concentration required to obtain a 50% of the effect caused by the treatment.
- Emax is referred herein as the maximum response achievable from an applied or dosed agent, in this case, an antagonist molecule. Emax is measured as the maximum fold change of the target protein, e.g. MBNL1 protein, obtained after transfection with a specific antimiR- 23b-3p or antimiR-218-5p compared to the mock (transfected with vehicle or non-transfected).
- Tindex or “therapeutic index/ratio” is a quantitative measurement of the relative safety of a drug.
- Tindex is defined as the ratio between the amount of a therapeutic agent that causes 50% toxicity (TC50) and the amount that causes 50% of the therapeutic effect (EC50), multiplied by the maximum response achievable:
- 3 ' end designates the end of a nucleotide strand that has the hydroxyl group of the third carbon in the sugar-ring at its terminus.
- 5' end designates the end of a nucleotide strand that has the fifth carbon in the sugar-ring at its terminus.
- the present invention also provides specific microRNA inhibitors, particularly oligonucleotide molecules or analogues thereof, aimed at correcting the insufficient function of MBNL (Muscleblind-like) proteins, partially originating from overexpression of hsa-miR-23b-3p and hsa-miR-218-5p in patients with myotonic dystrophy (DM), preferably myotonic dystrophy 1 (DM1).
- DM myotonic dystrophy 1
- antagomiR- 23b and antagomiR-218 oligonucleotides were tested in vitro the effects of conjugating previously published antagomiR- 23b and antagomiR-218 oligonucleotides (Cerro-Herreros et al. 2018 Nat. Commun. 9, 2482) with different hydrophobic moieties, (including lipids and fatty acids) (Table 1) in terms of toxicity, efficacy (levels of MBNL1 protein) and therapeutic index (Tindex).
- the antagomiR sequences used in this study contained all 2'OME modified nucleotides and a mix of phosphorothioate (PS) linkages and phosphodiester (PO) linkages.
- PS phosphorothioate
- PO phosphodiester
- oleic acid is an excellent carrier or vehicle to deliver oligonucleotides to tissues such as muscle and central nervous system (CNS).
- Figures 12-13 and Example 10 demonstrate that the vehiculization of the oligonucleotide molecule by the oleic acid does not only occur in an animal model with DM1 phenotype, but also in healthy animals (in this case, monkeys).
- DM1 is a neuromuscular disease that affects muscle tissue, but also central nervous system.
- the inventors screened for the antimiR sequence with the best Tindex in DM1 cells among a pool of antimiRs with lengths ranging between 15 and 22 nucleotides, including nucleotides carrying different chemical modifications such as LNA, 2'OME and 2'MOE.
- the best performing antagonist of human hsa-miR-23b-3p in this study was MD23b-2, and the oligo with the best Tindex for an antagonist of human hsa-miR-218-5p was 218-D/LNA2 (see Tables, 2 and 3, Figure 1).
- the present invention relates to an oligonucleotide and/or oligonucleotide analogue molecule, or a mixture of two or more of said molecules, wherein the oligonucleotide and/or oligonucleotide analogue molecule is conjugated to at least one oleic acid molecule at the 3' and/or 5' ends of said oligonucleotide and/or oligonucleotide analogue molecule.
- the oligonucleotide and/or oligonucleotide analogue is an antagonist of a microRNA.
- the oligonucleotide and/or oligonucleotide analogue is an antagonist of the microRNA selected from the group consisting of human hsa-miR-23b-3p or the human hsa-miR-218-5p.
- microRNAs hsa-miR-23b-3p and hsa-miR-218-5p are repressors of the expression of MBNL genes, among other gene transcripts, and thus it is their repressive capacity that will be diminished by the presence of its antagonists.
- inhibitors, silencers or blockers are compounds that are capable of producing a decrease in the endogenous activity of said hsa-miR-23b-3p and hsa-miR-218-5p, and thus these three terms have been included under the denomination of "antagonist”.
- silencing could be interpreted as the absolute annulment of such activity, since the difference between such annulment or a non-absolute decrease in repressive activity may depend on the concentration of the compound used, it will be sufficient for a compound to result in a decrease in the repressive activity of a microRNA to be considered an inhibitor, silencer, blocker or, in short, an antagonist thereof.
- a compound could be considered a microRNA inhibitor, silencer, blocker or antagonist according to the present invention if it targets the mature microRNA, but also if it targets the precursor microRNA or the primary microRNA transcript, provided that it is capable of producing a decrease in the endogenous activity of said microRNA. Therefore, as used herein, the four terms (inhibitors, silencers, blockers or antagonists) are used as synonyms in this specification.
- Said endogenous molecule is preferably a microRNA molecule, more preferably the hsa-miR-23b-3p or hsa-miR-218-5p molecules.
- Human hsa- miR-218-5p and hsa-miR-23b-3p differ in the sequence of nucleotides which must be taken into account for the design of the sequence of antagonists and their microRNA binding site.
- the “microRNA binding site” is the nucleotide sequence comprised in the antagonist that is complementary or partially complementary to at least a portion of its target microRNA.
- the microRNA binding sites of the antagonists defined herein are complementary or partially complementary to at least a portion of hsa-miR-23b-3p or hsa-miR-218-5p.
- the sequence of the binding site can be a perfect match, meaning that it has perfect complementarity to the microRNA.
- the sequence can be partially complementary, meaning that one or more mismatches may occur when the microRNA is base-paired to the binding site of the antagonist.
- the antagonist is partially complementary to the target microRNAs (preferably hsa-miR-23b-3p or hsa-miR-218-5p) its binding site preferably contains perfect or near-perfect complementarity (90%, 91% 92%, 93%, 94%, 95%, 96%, , 97%, 98%, 99% or preferably 100% complementary) to the seed region of the target microRNAs (preferably hsa-miR-23b-3p or hsa-miR-218-5p).
- the “seed region” of a microRNA normally comprises or consists of nucleotide 2 to nucleotide 7 from the 5' end of the microRNA.
- the sequence of the mature versions of the target microRNAs and their seed region can be considered.
- Hsa (homo sapiens)-miR-218-5p (MIMAT0000275): 5’- UUGUGCUUGAUCUAACCAUGU -3’ (SEQ ID NO: 10); Seed region: UGUGCU (SEQ ID NO: 12) hsa-miR-23b-3p (MIMAT0000418): 5’-AUCACAUUGCCAGGGAUUACCAC-3’ (SEQ ID NO: 11); Seed region: UCACAU (SEQ ID NO: 13)
- the oligonucleotide and/or oligonucleotide analogues molecules are inhibitors, blockers or antagonists of the types known as antimiRs and microRNA sponges.
- the oligonucleotide and/or analogue thereof is an antimiR, more preferably an antimiR of hsa-miR-218-5p or hsa-miR- 23b-3p.
- the oligonucleotide and/or analogue thereof is at least 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 nucleotides in length. In an embodiment, the oligonucleotide and/or analogue thereof is between 10-50 nucleotides in length, more preferably between 10-30 or 15-25 nucleotides in length.
- the oligonucleotide molecule and/or analogue thereof is an antimiR whose sequence comprises, consists, or consists essentially of a fragment composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the complementary sequence of a region present in SEQ ID NOs: 10 (hsa-miR-218-5p) or 11 (hsa-miR-23b-3p).
- sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the complementary sequence of SEQ ID NOs: 10 (hsa-miR-218-5p) or 11 (hsa-miR-23b-3p).
- the antagonist is an antimiR and its sequence comprises a fragment composed of a succession of at least 5-8 nucleotide or nucleotide analogue units wherein the sequence of the nitrogenous bases of said nucleotide or nucleotide analogue units is identical in at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the complementary sequence of the seed region of the hsa-miR-23b-3p as set forth in SEQ ID NO: 13.
- said antimiR comprises a fragment composed of a succession of at least 5-8 nucleotide or nucleotide analogue units that are 100% complementary to the seed region as set forth in SEQ ID NO: 13.
- the antagonist is an antimiR whose sequence comprises a first fragment and a second fragment, wherein the first fragment is composed of a succession of at least 5-8 nucleotide or nucleotide analogue units wherein the sequence of the nitrogenous bases of said first fragment is identical in at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the complementary sequence of the seed region of the hsa-miR-23b-3p as set forth in SEQ ID NO: 13, and wherein the second fragment is adjacent to the first fragment (i.e.
- nucleotide or nucleotide analogue units that are identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the complementary sequence of a region present in SEQ ID NOs: 11.
- adjacent is referred herein as immediately next to the first fragment, i.e., without any nucleotide in between the first and the second fragments.
- the second fragment is located 6, 7, 8, 9, 10, or 11 nucleotides upstream and/or downstream of the first fragment. More preferably, the second fragment is located 1 , 2, 3, 4, or 5 nucleotides upstream and/or downstream of the first fragment.
- the antagonist is an antimiR and its sequence comprises a fragment composed of a succession of at least 5-8 nucleotide or nucleotide analogue units wherein the sequence of the nitrogenous bases of said nucleotide or nucleotide analogue units is identical in at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the complementary sequence of the seed region of the hsa-miR-218-5p as set forth in SEQ ID NO: 12.
- said antimiR comprises a fragment composed of a succession of at least 5-8 nucleotide or nucleotide analogue units that are 100% complementary to the seed region as set forth in SEQ ID NO: 12.
- the antagonist is an antimiR whose sequence comprises a first fragment and a second fragment, wherein the first fragment is composed of a succession of at least 5-8 nucleotide or nucleotide analogue units wherein the sequence of the nitrogenous bases of said first fragment is identical in at least 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the complementary sequence of the seed region of the hsa-miR-218-5p as set forth in SEQ ID NO: 12, and wherein the second fragment is adjacent to the first fragment (i.e., it is located upstream and/or downstream of the first fragment) and it is composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of
- adjacent is referred herein as immediately followed to the first fragment, i.e., without any nucleotide in between the first and the second fragments.
- the second fragment is located 6, 7, 8, 9, 10, or 11 nucleotides upstream and/or downstream of the first fragment. More preferably, the second fragment is located 1 , 2, 3, 4, or 5 nucleotides upstream and/or downstream of the first fragment.
- oligonucleotide and/or oligonucleotide analogue molecules useful for the purpose of the present invention are those microRNA inhibitors, blockers or antagonists that act on pri-microRNAs or pre- microRNAs, usually altering microRNAs biogenesis and having a negative effect on microRNAs activity, mainly due to a decrease of the available active microRNA.
- microRNA inhibitors, blockers or antagonists that act on pri-microRNAs or pre- microRNAs, usually altering microRNAs biogenesis and having a negative effect on microRNAs activity, mainly due to a decrease of the available active microRNA.
- immature pri-miRNAs are processed into pre-miRNAs by the Microprocessor complex in the nucleus, and are then transported into the cytoplasm to undergo further processing into mature miRNAs.
- an antagonist of hsa-miR-23b-3p or an antagonist of hsa- miR-218-5p must be understood to comprise not only those molecules capable of acting the mature forms, but also those molecules capable of acting on the pri-microRNA or the pre- microRNA and decreasing the levels of the mature forms of hsa-miR-23b-3p or hsa-miR-218- 5p. In order to design them, it must be taken into account that:
- the primary microRNA (pri-microRNA) of hsa-miR-23b-3p is the transcripts of gene AOPEP (ENSG00000148120; chr9:97488983-97849441).
- microRNA precursor (pre-microRNA) of hsa-miR-23b-3p corresponds to genomic positions hg19 chr9:97847490-97847586 [+] and to the sequence:
- Pre-hsa-mir-218-1 derives from intramolecular hairpin structures located inside the transcripts of gene SLIT2 (ENSG00000145147: chr4:20254883-20621284) while hsa- miR-218-5p-2 derives from the gene SLIT3 (ENSG00000184347, chr5: 168088745- 168728133 for hsa-miR-218-5p-2), which can be regarded, respectively, as their pri- miRNAs. No other mature microRNAs are part of the same cluster. Then, in the case of hsa-miR-218-5p, both the pre-miRNAs or the pri-miRNAs could be envisaged as targets of antagonists to reduce the mature miRNA and increase MBNL protein levels.
- the authors of the present invention developed and optimized several antimiRs against hsa-miR-23b-3p and hsa-miR- 218-5p, whose Tindex was greatly improved with the addition of oleic acid.
- the specific sequence of the antimiRs comprising the SEQ ID NOs: 1 (antagonist of the human hsa-miR-218-5p) and SEQ ID NO: 2 (antagonist of the human hsa-miR-23b-3p) are specially mentioned due to their optimal characteristic and efficiency in DM1 cells, as shown in the Example section.
- SEQ ID NO: 1 or 2 are also contemplated herein, where specific changes in particular nucleobases would not significantly destabilize the molecule and thus, its therapeutic effect would be maintained.
- Said functional equivalent sequences are set forth in SEQ ID NO: 52-79 (functional equivalents of the antimiR-23b-3p of SEQ ID NO: 2), and SEQ ID NO: 80-110 (functional equivalents of the antimiR-218-5p of SEQ ID NO: 1).
- functional equivalents is referred herein to other oligonucleotides that differ in their nucleobase sequence from that of SEQ ID NO: 1 or 2, but which perform the same function and provide the same utility or technical effect as SEQ ID NO: 1 or 2.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-218-5p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 1 (TTAGATCAAGCACAA) or SEQ ID NO: 80-110.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 1 or SEQ ID NO: 80-110.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-23b-3p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 2 (ATCCCTGGCAATGTGA) or SEQ ID NO: 52-79.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 2 or SEQ ID NO: 52-79.
- each uracil and thymine base within the full length of the oligonucleotide molecule and/or analogue preferably each uracil and thymine base in the seed region, can be optionally replaced, respectively, by a thymine or uracil base.
- each guanosine base within the full length of the oligonucleotide molecule and/or analogue, preferably each guanosine in the seed region can be optionally replaced, respectively, by a hypoxanthine base. This applies for all the oligonucleotides disclosed herein.
- the oligonucleotide and/or oligonucleotide analogue that is an antagonist human hsa-miR-23b-3p or the human hsa-miR-218-5p is capable of increasing the endogenous levels of MBNL proteins, preferably MBNL1 and/or MBNL2 proteins.
- the oligonucleotide and/or oligonucleotide analogue is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the sequence of a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR-23b-3p), or SEQ ID NO: 52-110, and is capable of increasing the endogenous levels of MBNL proteins, preferably MBNL1 and/or MBNL2 proteins.
- the increase in the endogenous levels of MBNL proteins is a statistically significant increase in comparison to untreated cells or untreated tissues, wherein preferably the statistical comparison is performed using a Student’s t-test, see e.g., Fig. 4.
- the increase, preferably statistically significant increase, in the endogenous levels of MBNL proteins is of at least 1 .2-, 1 .3-, 1.4-, or 1 .5-fold change in treated cells of muscular tissues (more preferably quadriceps and gastrocnemius) with respect to untreated cells of muscular tissues.
- the increase in endogenous levels of MBNL proteins in treated cells or tissues is of at least 15%, 20%, 30%, 40%, 50% or more when compared to untreated cells or tissues.
- untreated cell or tissue is referred herein to one or more cells or tissues, including whole animals such as mice, that are healthy or present a DM 1 phenotype, and that have not been treated with the oligonucleotide and/or oligonucleotide analogue of the first aspect or any of its embodiments.
- the untreated cell is a muscular cells and the untreated tissue is muscular tissue.
- the antimiRs of the present invention can be further optimized in order to improve their in vivo stability and efficacy. To do so, several modifications in their chemical architecture have been described (for a review, see Mckenzie et al., Recent progress in non-native nucleic acid modifications. Chem. Soc. Rev., 2021 ,50, 5126-5164). These modifications can be made in the pentose (in the preferred embodiment in which the oligonucleotide is an oligoribonucleotide, the modification would be in the ribose), in the internucleotide linkage, or in the nucleobase, or in a combination thereof.
- the oligonucleotides or oligoribonucleotides of the present invention are chemically modified, they are considered in the context of the present invention as oligonucleotide analogues or oligoribonucleotide analogues, respectively.
- the antimiR is an oligonucleotide analogue and it comprises at least six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen or sixteen chemical modifications along the whole molecule.
- the antimiR is an oligoribonucleotide analogue that comprises all its nucleotides chemically modified.
- Modifications in the internucleotide linkage It is considered included in the possible modifications that give rise to the oligonucleotides analogues of the present invention the modifications that give rise to phosphorothioate linkages, which are modifications that affect phosphate groups that are part of the "skeleton" of the polynucleotide chain, giving rise to the introduction of a sulphur atom in substitution of an oxygen atom of the phosphate group that is not acting as a bridge between nucleotides; these modifications cause the linkages between nucleotides to be resistant to degradation by nucleases, in addition to other desirable pharmacological properties, so they are commonly inserted between the last 3-5 nucleotides at the 5' or 3' ends of oligonucleotides to inhibit degradation by exonucleases, increasing their stability.
- At least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or more than fifteen of the nucleotides comprised in the oligonucleotide or oligonucleotide analogue molecule according to the first aspect or any of its embodiments are chemically linked by a phosphorothioate linkage.
- the oligonucleotide and/or oligonucleotide analogue according to the first aspect or any of its embodiments comprises between 10 to 30 nucleotides in length and comprises at least two nucleotides chemically linked by a phosphorothioate linkage, wherein said oligonucleotide and/or oligonucleotide analogue is conjugated at its 3' and/or 5' ends to at least one oleic acid molecule.
- the oligonucleotide or oligonucleotide analogue molecule comprises a mixture of PS and phosphodiester (PO) linkages, wherein at least two nucleotides of said molecule are chemically linked by a phosphorothioate linkage and at least two nucleotides of said molecule are linked by a phosphodiester linkage.
- the number of nucleotides that are chemically linked by a phosphorothioate (PS) linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage.
- the oligonucleotide molecule and/or analogue thereof is between 13-17 nucleotides long, and comprises at least 7, 8, 9, or 10 nucleotides that are chemically linked by a phosphorothioate (PS) linkage.
- PS phosphorothioate
- the ratio of PS:PO in the oligonucleotide molecule and/or analogue thereof is 1.2:1 , 1.5:1 , 1.7:1 , 2:1 , 2.2:1 , 2.5:1 , 2.7:1 , 3:1.
- the ratio PS:PS in the oligonucleotide molecule and/or analogue thereof is between 1.2:1 and 2.7:1 , more preferably 1.5:1 or 2.5:1.
- ratio PS:PO is referred herein as the number of PS linkages per PO linkage. For instance, when an oligonucleotide molecule consists of 15 nucleotides and has 10 PS linkages and 4 POs linkages (see, e.g., SEQ ID NO: 7), it is said that said molecule has a ratio PS:PO of 2.5:1. In an embodiment, more than 50%, 55%, preferably 60%, 70% or 75% of the linkages between the nucleotides are PS linkages.
- all the nucleotides comprised in the oligonucleotide or oligonucleotide analogue molecule are chemically linked by a phosphorothioate linkage.
- the oligonucleotide or oligonucleotide analogue molecule is an antagonist of a microRNA (i.e. , an antimiR).
- a microRNA i.e. , an antimiR
- the most important ones in the context of the present invention are 2'fluoro (2’F: introduction of a fluorine atom at the ribose 2’ position), 2'-O-methoxyethyl (MOE), or 2'0-methyl (OMe) modifications.
- the oligonucleotide or oligonucleotide analogue molecule, preferably the antimiR, according to the present invention is chemically modified to comprise at least one pentose with one of the following modifications: 2'fluoro (2’F: introduction of a fluorine atom at the ribose 2’ position), 2'-O-methoxyethyl (MOE), and/or 2'0-methyl (OMe).
- all the nucleotides in the oligonucleotide molecule are 2'OME modified nucleotides.
- Another modification that can be performed in the oligonucleotide or oligonucleotide analogue molecule, preferably the antimiR, of the present invention is the formation of Bicyclic 2'-4' modifications.
- Bicyclic 2'-4' modifications There are a variety of ribose derivatives that lock the carbohydrate ring into the 3'-endo conformation by the formation of bicyclic structures with a bridge between the 2' oxygen and the 4' position.
- the formation of a bridge between the 2' oxygen and the 4' carbon locks the ribose in the 3' endo conformation, leading to a modification called locked nucleic acids, or LNA.
- the introduction of LNAs modifications highly increases the stability of the antimiR-target miRNA hybrids making them significantly more thermodynamically stable and resistant to degradation, which especially happens when said modifications are placed at the ends of the molecule.
- the first nucleotide starting from the 3' region comprises an LNA modification.
- each of the two first oligonucleotides starting from the 5' region comprises an LNA modification.
- bicyclic nucleotides More modifications include bridged nucleic acids, ethyl-bridged (ENAs), constrained ethyl (cEt) nucleic acids, bicyclic (bicyclo-DNA) and tricyclic (Tricyclo-DNA)s structures and Conformationally Restricted Nucleotides (CRN) with a varying affinity for target sequences.
- ENAs ethyl-bridged
- cEt constrained ethyl
- Tricyclo-DNA tricyclic
- PMOs nucleic acids where ribose has been substituted by a morpholino group
- morpholino is understood as bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups.
- PNAs Peptide Nucleic Acid 1 : peptide nucleic acid in which the ribose-phosphate group is replaced by an amino acid moiety so that the skeleton of the nucleotide analogue is a structure of repeat units of N-(2-aminoethyl)-glycine linked by peptide linkages).
- an oligonucleotide or oligonucleotide analogue molecule preferably the antimiR, according to the present invention, is chemically modified to comprise at least one pentose of the nucleotides forming the antimiR comprises morpholino nucleic acids (PMOs) or peptide nucleic acids (PNAs).
- PMOs morpholino nucleic acids
- PNAs peptide nucleic acids
- oligonucleotides preferably oligoribonucleotide analogues of the invention, preferably the antimiR
- the antimiR is the 5 methylation of the nitrogenous base cytosine (C), which decreases the detection of the oligonucleotide analogue by the immune system.
- C nitrogenous base cytosine
- at least one, two, three, four, five, or more than five of the nucleotides comprised in the oligonucleotide and/or oligonucleotide analogue molecule, preferably the antimiR, according to the first aspect or any of its embodiments comprises a methylated cytosine.
- all the cytosines in the oligonucleotide or oligonucleotide analogue molecule, preferably the antimiR, according to the first aspect or any of its embodiments are methylated.
- At least one, two, three, four, five, or more than five of the nucleotides comprised in the oligonucleotide and/or oligonucleotide analogue molecule according to the first aspect or any of its embodiments comprises a 2,6 diaminopurine.
- oligonucleotide molecules and that of "oligonucleotide analogues", also included within the definition of oligonucleotide analogues are hybrid molecules, in which some units present modifications and others do not, as well as hybrids between analogues of nucleic acids and peptides or, even, hybrid molecules in which some of the nucleotide units are nucleotides (or analogues thereof) and others are deoxynucleotides (nucleotides in which the sugar is deoxyribose), as well as analogues of the latter, i.e. RNA-DNA hybrids and analogues thereof.
- Other chemical modifications are possible and known, which are also comprised within the possible modifications that give rise to oligonucleotide analogues.
- the first aspect of the present invention provides an oligonucleotide and/or oligonucleotide analogue molecule that is preferably an antimiR, more preferably an antagonist of the human hsa-miR-23b-3p or of the human hsa-miR-218-5p, or a mixture of two or more of said molecules, wherein the oligonucleotide and/or oligonucleotide analogue molecule is conjugated to at least one oleic acid molecule at the 3' and/or 5' ends of said oligonucleotide and/or oligonucleotide analogue molecule.
- all the oligonucleotides included in the present invention are conjugated to at least one oleic acid molecule at their 3’ and/or 5’.
- non-nucleotide molecules such as organic compounds
- Said conjugation can be a direct conjugation or by means of a spacer molecule.
- spacer molecule is referred herein to any molecule or molecules that connect, on the one hand, the oligonucleotide or oligonucleotide analogue and, on the other hand, the non- nucleotide molecule, preferably the oleic acid.
- the spacer molecule or molecules can be coupled at the 3' or 5' end of the oligonucleotide or oligonucleotide analogue.
- the spacer molecule is covalently bound to said oligonucleotide.
- the spacer molecule(s) are bound on one end via a bond between a terminal carbon on the spacer to an oxygen group in the 3’terminal phosphate of the oligonucleotide and on the other end by a bond between the terminal nitrogen group on the linker which forms an amide bond with the carboxy group of oleic acid, e.g. as depicted in Figure 8.
- the spacer molecule is selected from the group consisting of 3- aminopropyl (NHC3), 5-aminopentyl (NHC5), 6-aminohexyl (NHC6), threoninol or a derivative thereof.
- the spacer molecule or molecules may comprise a Thiol- Modifier C6 S-S (C6SSC6).
- the spacer may comprise a Thiol- Modifier C6 S-S (C6SSC6) directly bound to the oligonucleotide, and followed by a 3- aminopropyl (NHC3), 6-aminohexyl (NHC6), threoninol or a derivative thereof (see Fig. 8).
- the oligonucleotide may be provided as a prodrug and may comprise a spacer molecule comprising or consisting of a self-immolative group.
- self-immolative group is referred herein to a molecule that will spontaneous and irreversibly disassembly from the molecule to which it is conjugated, in this case the oligonucleotide.
- the self-immolative group is a disulfide linkage that will be reduced inside the cells by naturally occurring thiols such as glutathione, resulting in the release of the oligonucleotide.
- the spacer may be an aliphatic linear or branched hydrocarbon chain, cyclohexyl phenyl and other aromatic spacers, as well as polar spacers based on one or several units of ethylene glycol, glycerol, amino acid, peptide, or carbohydrates.
- the oleyl derivative can be covalently linked to the amino groups by an amide linkage or directly to the nucleobases with an amine linkage as well as to the phosphate linkage as oleyl phosphate.
- the oleic acid is conjugated to the oligonucleotide at its 3' end. More preferably, the oleic acid is conjugated by means of a spacer molecule, preferably NHC6, threoninol or NHC3, as shown in Fig. 8. Please note that the addition of the spacer molecule as a connector between the oligonucleotide and the oleic acid is not mandatory, see, e.g., SEQ ID NO: 51 wherein the oleic acid is conjugated at the 5' end of the oligonucleotide and/or oligonucleotide analogue molecule by means of direct conjugation.
- all the oligonucleotides molecules disclosed in the present invention are conjugated to at least one oleic acid molecule at their 3’ and/or 5’ ends, wherein the oligonucleotides molecules further comprise at least two nucleotides chemically linked by a phosphorothioate linkage.
- the oligonucleotides molecules further comprise at least two nucleotides chemically linked by a phosphorothioate linkage and at least two nucleotides of said molecule are linked by a phosphodiester linkage. More preferably, the number of nucleotides that are chemically linked by a phosphorothioate (PS) linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester (PO) linkage.
- PS phosphorothioate
- PO phosphodiester
- the oligonucleotides may be synthesized by solid-phase or liquid-phase methods.
- the oligonucleotide functionalized with the spacer molecule as well as the oleyloligonucleotide conjugate may be prepared using solid-phase oligonucleotide synthesis protocols.
- a solid support such as controlled pore glass (CPG) is functionalized with the first nucleotide in the 3’-end of the oligonucleotide sequence and the oligonucleotide is usually synthesized in the 3’ to 5’ direction.
- CPG controlled pore glass
- the introduction of a spacer molecule at the 5’ position is performed by using a phosphoramidite derivative of the spacer molecule that will introduce the spacer molecule through a phosphate linkage to the 5’-position of the oligonucleotide.
- the introduction of the spacer molecule at the 3’ position requires the preparation of a solid support functionalized with a linker molecule, which is a molecule used to bind the nucleotide to the support.
- linker molecules are labile compounds such as phthalimido or succinyl linkers.
- the linker is a temporary conjugation that aims the immobilization of the oligonucleotide when it is being synthesized using solid-phase methods.
- a protecting group may be used, such as benzoyl or acetyl.
- the oligonucleotide and/or oligonucleotide analogue molecule comprises between 10 to 30 nucleotides in length and is an antimiR-type oligonucleotide analogue, wherein at least two nucleotides of said molecule are chemically linked by a phosphorothioate linkage and at least two nucleotides of said molecule are linked by a phosphodiester linkage, preferably wherein the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage, and wherein: a.
- the sequence of the nitrogenous bases of the monomeric units of nucleotides or nucleotide analogues is at least 85%, 90%, 93%, 95%, 98%, or 100% complementary to the endogenous molecules to which they must bind (preferably, a microRNA molecule, more preferably the hsa-miR-23b-3p of SEQ ID NO: 11 or hsa-miR-218-5p of SEQ ID NO: 10), and b. it is conjugated at the 5'-end and/or at the 3'-end with at least one oleic acid molecule, preferably by means of a spacer molecule.
- the oligonucleotide and/or oligonucleotide analogue molecule comprises between 10 to 30 nucleotides in length and is an antimiR-type oligonucleotide analogue, wherein at least two nucleotides of said molecule are chemically linked by a phosphorothioate linkage and at least two nucleotides of said molecule are linked by a phosphodiester linkage, preferably wherein the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage, and wherein: a.
- the sequence of the oligonucleotide comprises a first fragment and a second fragment, wherein the first fragment is composed of a succession of at least 5-8 nucleotide or nucleotide analogue units that is identical in at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the complementary sequence of the seed region of the hsa-miR-23b-3p as set forth in SEQ ID NO: 13, and wherein the second fragment is adjacent to the first fragment (i.e., it is located upstream and/or downstream of the first fragment) and it is composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the complementary sequence of
- the oligonucleotide and/or oligonucleotide analogue molecule comprises between 10 to 30 nucleotides in length and is an antimiR-type oligonucleotide analogue, wherein at least two nucleotides of said molecule are chemically linked by a phosphorothioate linkage and at least two nucleotides of said molecule are linked by a phosphodiester linkage, preferably wherein the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage, and wherein: a.
- the sequence of the oligonucleotide comprises a first fragment and a second fragment, wherein the first fragment is composed of a succession of at least 5-8 nucleotide or nucleotide analogue units that is identical in at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the complementary sequence of the seed region of the hsa-miR-218-5p as set forth in SEQ ID NO: 12, and wherein the second fragment is adjacent to the first fragment (i.e., it is located upstream and/or downstream of the first fragment) and it is composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the complementary sequence of
- the oligonucleotide and/or oligonucleotide analogue molecule comprises between 10 to 30 nucleotides in length, wherein: a. at least two nucleotides of said molecule are chemically linked by a phosphorothioate linkage and at least two nucleotides of said molecule are linked by a phosphodiester linkage, preferably wherein the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage, b.
- nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 1 or 2 or SEQ ID NO: 52-110, and c. it is conjugated at the 5'-end and/or at the 3'-end with at least one oleic acid molecule, preferably by means of a spacer molecule.
- the oligonucleotide and/or oligonucleotide analogue molecule comprises between 10 to 30 nucleotides in length and is an antimiR-type oligonucleotide analogue wherein at least two nucleotides of said molecule are chemically linked by a phosphorothioate linkage and at least two nucleotides of said molecule are linked by a phosphodiester linkage, preferably wherein the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage, and wherein: a.
- At least one of the monomeric units is a nucleotide analogue that presents one or more chemical modifications in the pentose moiety, preferably in the ribose, in the internucleotide linkage, in the nitrogenous base, or in all of them, b.
- the sequence of the nitrogenous bases of the monomeric units of nucleotides or nucleotide analogues is at least 85%, 90%, 93%, 95%, 98%, or 100% identical to the sequence of nitrogenous bases of the monomeric units of nucleotides of the oligonucleotide SEQ ID NO: 1 or of the oligonucleotide SEQ ID NO: 2, or of their functional equivalents SEQ ID NO: 52-110, and that, c. it is conjugated at the 5'-end and/or at the 3'-end with at least one oleic acid molecule, preferably by means of a spacer molecule.
- At least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, or more than fifteen of the nucleotides comprised in the oligonucleotide or oligonucleotide analogue molecule according to the first aspect or any of its embodiments comprise at least one modification selected from the group comprising or consisting of: locked nucleic acids, 2'-methoxy, 2'-O- methoxyethyl-, 2’fluoro, BNA, PMO, PNA, CRN, 2,6 diaminopurine, methylated cytosine and/or any combination thereof.
- the oligonucleotide and/or oligonucleotide analogue molecule comprises between 10 to 30 nucleotides in length and is an antagonist of the human hsa-miR- 23b-3p or hsa-miR-218-5p comprises at least two nucleotides that are chemically linked by a phosphorothioate linkage and at least two nucleotides that are chemically linked by a phosphodiester linkage, wherein preferably the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage, and wherein said oligonucleotide is conjugated to at least one oleic acid molecule, wherein said one oleic acid molecule is conjugated at the 3' and/or 5' ends of said oligonucleotide and/or analogue thereof.
- said oligonucleotide and/or oligonucleotide analogue that is conjugated to at least one molecule of oleic acid at its 3' and/or 5' ends and that comprises more PS linkages than PO linkages comprises, consists, or consists essentially of a fragment composed of a succession of at least 15 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence to a region present in SEQ ID NO: 1 (antimiR-218-5p) or SEQ ID NO: 2 (antimiR-23b-3p), or any of their functional equivalents of SEQ ID NO: 52-110.
- At least three, four, five, six, seven, eight, or more than eight of the nucleotides comprised in the oligonucleotide and/or oligonucleotide analogue molecule are chemically modified, wherein said chemical modification is selected from the group of i) 2'-O- methyl (2'OMe), ii) 2'-O-Methoxyethyl (2' MOE), and/or iii) an extra bridge connecting the 2' oxygen and 4' carbon (LNA), and/or any combination thereof.
- the nucleotides comprised in oligonucleotide analogue molecule are chemically modified so as to include an extra bridge connecting the 2' oxygen and 4' carbon (LNA) of at least the nucleotides located at the 3' and 5' ends of the oligonucleotide. More preferably, the LNA modification is introduced in at least the last 4th, 3rd, preferably 2nd, or last nucleotide(s) located at the 3' and 5' ends of the oligonucleotide.
- LNA 2' oxygen and 4' carbon
- At least one of the nucleotides comprised in the oligonucleotide and/or oligonucleotide analogue molecule is 2,6 diaminopurine and/or at least a methylated cytosine.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-23b-3p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2 V2 3' QI), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the full-length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full-length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 3 or SEQ ID NO: 22 (MD23b-2 V2 3'01), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the oligonucleotide consists of SEQ ID NO: 3 or SEQ ID NO: 22.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-23b-3p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least ?, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2 PS/PO 3' QI), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 4 or SEQ ID NO: 23 (MD23b-2 PS/PO 3' QI), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the oligonucleotide consists of SEQ ID NO: 4 or SEQ ID NO: 23.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-23b-3p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least ?, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2 PS/PO 5' QI), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 5' end.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51 (MD23b-2 PS/PO 5' QI), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at its 5' end.
- the oligonucleotide consists of SEQ ID NO: 5 or SEQ ID NO: 24 or SEQ ID NO: 51.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-23b-3p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least ?, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3' Ol with C6SSC6), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3' Ol with C6SSC6), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at its 5' end.
- the oligonucleotide consists of SEQ ID NO: 49 or SEQ ID NO: 50 (MD23b-2 V2 3' Ol with C6SSC6).
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-218-5p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least ?, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE Oleic 3'), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 7 or SEQ ID NO: 25 (hsa-miR-218-5p MOE Oleic 3'), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the oligonucleotide consists of SEQ ID NO: 7 or SEQ ID NO: 25.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-218-5p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least ?, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD Oleic 3'), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 8 or SEQ ID NO: 26 (hsa-miR-218-5p MOE DD Oleic 3'), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the oligonucleotide consists of SEQ ID NO: 8 or SEQ ID NO: 26.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-218-5p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME/MOE Oleic 3'), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 9 or SEQ ID NO: 27 (hsa-miR-218-5p OME/MOE Oleic 3'), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the oligonucleotide consists of SEQ ID NO: 9 or SEQ ID NO: 27.
- the oligonucleotide molecule and/or analogue thereof is an antagonist of the human hsa-miR-218-5p and it comprises, consists, or consists essentially of a fragment composed of a succession of at least 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16 consecutive nitrogen bases of nucleotide or nucleotide analogue units that are identical in at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% to the sequence of a region present in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218-5p OME/MOE Oleic 3'2), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the full length sequence of the nitrogen bases of the nucleotide or nucleotide analogue units comprised in the oligonucleotide molecule and/or analogue thereof is identical in at least 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to the full length sequence of the nitrogenous bases of the oligonucleotide in SEQ ID NO: 14 or SEQ ID NO: 28 (hsa-miR-218- 5p OME/MOE Oleic 3'2), wherein said oligonucleotide molecule and/or analogue thereof comprises at least an oleic acid conjugated at the 3' end.
- the oligonucleotide consists of SEQ ID NO: 14 or SEQ ID NO: 28.
- the oligonucleotide molecule and/or analogue thereof of the first aspect comprises, or consists of SEQ ID NOs SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonists of hsa- miR-23b) or SEQ ID NOs: 7, 8, 9, 14, 25, 26, 27, or 28 (antagonists of hsa-miR-218-5p), or a sequence that has 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50, 51 , 7, 8, 9, 14, 25, 26, 27, or 28.
- the oligonucleotide and/or oligonucleotide analogue is identical in at least 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100% to any of SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50, 51 , 7, 8, 9, 14, 25, 26, 27, or 28, preferably to SEQ ID NOs: 3, 4, 7, 22, 23 or 25, and is capable of increasing, preferably statistically increasing, the endogenous levels of MBNL proteins, preferably MBNL1 and/or MBNL2 proteins in comparison to untreated cells or tissue.
- the oligonucleotide molecule and/or analogue thereof of the first aspect consists of SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50, 51 , 7, 8, 9, 14, 25, 26, 27, or 28. It is noted that, in the context of the present invention, when a oligonucleotide molecule and/or analogue thereof is said to specifically consists of a specific SEQ ID NO, it is understood that said oligonucleotide molecule and/or analogue thereof also consists of the chemical modifications, spacer molecule, and oleic acid conjugation as set forth in said SEQ ID NO.
- an oligonucleotide molecule and/or analogue thereof consists of SEQ ID NO: 3, 4, or 7, it is interpreted that said oligonucleotide molecule and/or analogue thereof consists of the nucleotide sequence defined in SEQ ID NOs 3, 4, or 7, and the chemical modifications, spacer, and oleic acid conjugation defined in said SEQ ID NOs: 3, 4 or 7.
- the detailed description of the chemical modifications included in each SEQ ID NOs is included in section “Sequence Listing”.
- oligonucleotide molecules and/or analogues thereof in the form of a prodrug, i.e. , in a form or nature that is not fully active but that will be converted or metabolized within the body upon administration to give rise to the fully pharmacologically active oligonucleotides molecules and/or analogues thereof described herein.
- miRGator v3.0 a microRNA portal for deep sequencing, expression profiling and mRNA targeting. Sooyoung Cho et al., Nucleic Acids Research, Volume 41 , Issue D1 , 1 January 2013, Pages D252-D257, https://doi.org/10.1093/nar/gks1168), hsa-miR-218-5p is expressed in: adipose tissue, brain, central nervous system, kidney, heart, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, stem cells, testicle, uterus and joints.
- hsa-miR-23b-3p is expressed in: the central nervous system, gastrointestinal tract, adipose tissue, breast, bladder, heart, keratinocytes, kidney, liver and biliary system, lung, lymphoid cells, nose, pharynx, placenta, prostate, skin, spleen, stem cells, testicle, thyroid gland and uterus.
- a possible embodiment of the invention considered is an oligonucleotide and/or oligonucleotide analogue molecule that is preferably an antimiR, more preferably an antagonist of hsa-miR-218-5p or hsa-miR-23b-3p, or a mixture of two or more of said molecules, and that the target miRNA is expressed at least in one or more organs selected from the group of the brain, cerebellum, hippocampus or other organs of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testicle, uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphoid cells or in one or more cells of a primary culture from one of those organs or of an established cell line derived from one of those organs (including induced pluri
- the choice of the specific microRNA to be antagonized in particular, the choice specifically between the human hsa-miR-218-5p or the human hsa-miR-23b-3pp, will also determine the range of tissues where the antagonistic effect can be exerted.
- the present invention relates to a composition, preferably a pharmaceutical composition, comprising at least an oligonucleotide as defined in the first aspect or any of its embodiments, or a mixture of two or more of them, optionally further comprising a carrier and/or one or more pharmaceutically acceptable excipients.
- the composition comprises an antimiR as defined in the first aspect or any of its embodiments, more preferably an antagonist of the human hsa-miR-218-5p or the human hsa-miR-23b-3p.
- compositions that comprise one of these anti-microRNAs or their mixtures, as well as any other anti-microRNA directed against the human hsa-miR-218-5p or the human hsa-miR-23b-3p or mixtures thereof, or in general any oligonucleotide and/or oligonucleotide analogue molecule that is an inhibitor of one of these microRNAs or of another microRNA that down-regulates the expression of the human gene MBNL1 and/or MBNL2, including compositions which also comprise a pharmaceutically acceptable carrier and/or excipient.
- the pharmaceutical composition comprises an effective dose of an inhibitor or antagonist, preferably an antimiR, more preferably an antagonist of the human hsa-miR-218-5p or of the human hsa-miR-23b-3pp or a mixture thereof, as defined in the first aspect or any of its embodiments.
- an inhibitor or antagonist preferably an antimiR, more preferably an antagonist of the human hsa-miR-218-5p or of the human hsa-miR-23b-3pp or a mixture thereof, as defined in the first aspect or any of its embodiments.
- the inhibitor/antagonist of the human hsa-miR- 218-5p present in the composition is the antimiR type inhibitor used in the examples of this invention represented by SEQ ID NO: 1 or its functional equivalents of SEQ ID NO: 80-110; and the inhibitor/antagonist of the human hsa-miR-23b-3p present in the composition is the antimiR type inhibitor represented by SEQ ID NO: 2 or its functional equivalents of SEQ ID NO: 52-79, where the inhibitor is conjugated at its 3' and/or 5' ends to at least one oleic acid molecule. More preferably, the inhibitor(s)/antagonist(s) comprised in the composition will be present at a concentration that allows the administration of a therapeutically effective dose.
- an “effective dose” or “therapeutically effective dose” is a sufficient amount to achieve a beneficial or desired clinical outcome.
- An effective dose of an inhibitor/antagonist of a microRNA can be from about 0.5 mg/kg to about 100 mg/kg, preferably from about 1.5 mg/kg to 100 mg/kg in mice or from about 0.75 mg/kg to 50 mg/kg in rats.
- the precise determination of what would be considered an effective dose in humans can be based on individual factors for each patient, including size, age, and the nature of the inhibitor or antagonist (for example, if it is an expression construct, an antimiR or oligonucleotide analogue, etc). Nonetheless, the dosages can be easily determined by ordinary experts skilled in the art based on this description and the knowledge of the art.
- compositions according to the uses of this invention will then be considered pharmaceutical compositions of this invention, and they can be prepared in an appropriate form for the desired application. It may be necessary or convenient to administer multiple doses to the subject during a particular treatment period, administering doses daily, weekly, monthly, every two months, every three months or every six months.
- the subject receives an initial dose at the beginning, which is larger than one or more subsequent doses or maintenance doses.
- the subject receives dosis periodically or chronically, especially in the case of treatment of chronic diseases, such as DM1.
- Colloidal dispersion systems such as macromolecule complexes, nanocapsules, micro-spheres, pearls and lipid-based systems that include oil-in-water emulsions, micelles, mixed micelles, other oligonucleotide-based delivery vehicles, and liposomes, can be used as administration vehicles of the inhibitors/antagonists of this invention, with which the pharmaceutical composition of the invention is formed.
- Another possibility is to prepare the pharmaceutical compositions of the invention using appropriate salts and buffers to make the administration vehicles stable and to assist in the capture by the target cells.
- compositions of this invention can be aqueous compositions that comprise an effective amount of the administration vehicle and which comprise either the oligonucleotide molecules of the invention, independently or forming liposomes or other complexes, or expression vectors thereof, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
- compositions may also be incorporated into the compositions, provided that they do not inactivate the molecules of this invention or their expression vectors.
- solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
- Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary storage and use conditions, these preparations generally contain a preservative to prevent the growth of microorganisms.
- the oligonucleotides can also be prepared in a solution of phosphate-buffered saline and sodium chloride.
- the oligonucleotides can be prepared in phosphate-buffered saline at a pH of between 6.5 and 8, preferably at a pH of about 6.8 - 7 and sodium chloride at a concentration of about 150 mM.
- compositions of this invention can usually be formulated in a neutral or salt form.
- Pharmaceutically acceptable salts include, for example, acid addition salts (formed with free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric acids), or organic acids (e.g. acetic, oxalic, tartaric, mandelic acids), and the like. Salts formed with free carboxyl groups of the protein can also be derived from inorganic bases (for example, sodium, potassium, ammonium, calcium, or ferric hydroxides) or organic bases (e.g. isopropylamine, trimethylamine, histidine, procaine, and the like).
- the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiment, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments for use in therapy.
- the oleic acid conjugated to the oligonucleotide molecule and/or analogue thereof acts as a vehicle to deliver said oligonucleotide molecule and/or analogue thereof to relevant tissues, such as muscle and/or CNS.
- the oligonucleotide molecule or analogue thereof according to the first aspect and conjugated at its 3' and/or 5' ends to at least one oleic acid molecule may be for use in a method of treatment by therapy in a human subject in need thereof, wherein said oligonucleotide molecule and/or analogue thereof is an active ingredient of said treatment by therapy, and wherein said oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier of said oligonucleotide molecule and/or analogue thereof.
- active ingredient is used in the present invention to refer the substance which is pharmaceutically active and responsible of the therapeutic effect.
- the active ingredient is the molecule, preferably the oligonucleotide molecule, that targets the endogenous miR.
- the term “active ingredient” is used herein to refer to the oligonucleotide molecule and/or analogue thereof defined in the first aspect of the present invention.
- the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiment, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments for use in the prevention or treatment of muscular and/or nervous system diseases, preferably muscular diseases involving weakness and wasting away of muscle tissue, particularly involving loss of muscular strength, increasing disability, and deformity, and/or preferably nervous system diseases that involve structural and/or functional changes in the brain and/or other tissues of the CNS.
- muscular diseases are muscular dystrophy diseases.
- the muscular dystrophy diseases are selected from the group consisting of Becker muscular dystrophy, congenital muscular dystrophy, Duchenne muscular dystrophy, Distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, Facioscapulohumeral muscular dystrophy, Limb-Girdle muscular dystrophy, Myotonic dystrophy, and Oculopharyngeal muscular dystrophy.
- the muscular disease is myotonic dystrophy, preferably of type 1 and/or 2.
- the use according to the fourth aspect includes the use of the at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and/or analogue thereof to deliver said oligonucleotide molecule and/or analogue thereof to the relevant tissue, such as muscle and/or to CNS.
- the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiment, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments for use in the prevention or treatment of diseases characterized by insufficient amount or function of MBNL genes and/or proteins in a subject in need thereof.
- said use includes the use of the at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and/or analogue thereof to deliver said oligonucleotide molecule and/or analogue thereof to the relevant tissue, such as muscle and/or to CNS.
- the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiment, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments for use in targeting muscular and/or CNS cells in a subject in need thereof, preferably muscular cells in a subject suffering from DM or DM1.
- targeting muscular and/or CNS cells is referred herein as increasing the insufficient amounts of MBNL proteins and/or genes in said cells.
- CNS cells include preferably neurons, but also glial cells (astrocytes, oligodendrocytes, ependymal cells, and microglia), choroid plexus cells, cells related to blood vessels and coverings.
- Muscular cells include smooth, preferably skeletal, and cardiac cells.
- the increase is a statistically significant increase, preferably in comparison to a control cell or an untreated cell.
- the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiment, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments for use in the prevention or treatment of diseases characterized by the expression of toxic RNAs (also called RNAopathies or RNA-mediated/RNA-dominant diseases).
- said use includes the use of the at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and/or analogue thereof to deliver said oligonucleotide molecule and/or analogue thereof to the relevant tissue, such as muscle and/or to CNS.
- Said diseases are usually characterized by the expansion of unstable microsatellite repeats caused by unusual mutation mechanisms, wherein the expression of the expansions of a repetitive element create a sink for RNA-binding proteins by increasing the mass of target RNA per nucleus and also by increasing the avidity of RNA-protein interaction due to a high local concentration of binding sites in each mutant transcript, among other mechanisms.
- the RNAopathies or RNA-mediated/RNA-dominant diseases are neuromuscular or neurodegenerative diseases, more preferably selected from the group consisting of DM type 1 (ORPHA:273) or type 2 (ORPHA:606); Fragile X-Associated Tremor/Ataxia Syndrome (ORPHA:93256; FXTAS); C9ORF72 Amyotrophic Lateral Sclerosis and/or Frontotemporal Dementia(ORPHA:275872; ALS/FTD); Spinocerebellar Ataxias (SCAs) or benign adult familial myoclonic epilepsy (BAFME).
- DM type 1 ORPHA:273
- type 2 ORPHA:606
- Fragile X-Associated Tremor/Ataxia Syndrome ORPHA:93256; FXTAS
- SCAs Spin
- the present invention provides an oligonucleotide as defined in the first aspect or any of its embodiment, or a composition, preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments for use in the prevention or treatment of diseases characterized by an excess in the amount or function of miR-23b-3p and/or miR-218-5p.
- a composition preferably a pharmaceutical composition, as defined in the second aspect or any of its embodiments for use in the prevention or treatment of diseases characterized by an excess in the amount or function of miR-23b-3p and/or miR-218-5p.
- excessive amount or function of miR-23b-3p and/or miR-218-5p is referred herein to statistically significant higher amounts or function of miR-23b-3p and/or miR-218-5p in comparison to those in a healthy subject.
- the disease characterized by an excess in the amount or function of miR-23b-3p and/or miR-218- 5p is myotonic dystrophy, preferably of type 1 and/or 2.
- said use includes the use of the at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and/or analogue thereof to deliver said oligonucleotide molecule and/or analogue thereof to the relevant tissue, such as muscle and/or to CNS.
- the oligonucleotide or oligonucleotide analogue molecule as defined in the first aspect or any of its embodiments, alone or comprised in the pharmaceutical composition, for use according to the third or fourth aspects is an inhibitor of the human hsa-miR-218-5p or of the human hsa-miR-23b-3p with SEQ ID NO: 1 or 2, respectively, or a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 1 or 2.
- the oligonucleotide or oligonucleotide analogue molecule as defined in the first aspect or any of its embodiments, alone or comprised in the pharmaceutical composition, for use according to the third or fourth aspects is an inhibitor of the human hsa-miR-218-5p or of the human hsa-miR-23b-3p with SEQ ID NO: 80-110 or 52-79, respectively, or a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 80-110 or 52-79.
- the oligonucleotide or oligonucleotide analogue molecule as defined in the first aspect or any of its embodiments for use according to the third or fourth aspects is an antagonist comprising or consisting of SEQ ID NO: 3, 4, or 5 (antimiRs against hsa-miR-23b- 3p) or SEQ ID NO: 7, 8, 9 or 14 (antimiRs against hsa-miR-218-5p), or a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3, 4, or 5 (antimiRs against hsa-miR-23b-3p) or with SEQ ID NO: 7, 8, 9 or 14 (antimiRs against hsa-miR-218-5p).
- the oligonucleotide or oligonucleotide analogue molecule as defined in the first aspect or any of its embodiments for use according to the third or fourth aspects is an antagonist comprising or consisting of SEQ ID NO: 22, 23, 24, 49, 50 or 51 (antimiRs against hsa-miR-23b-3p) or SEQ ID NO: 25, 26, 27 or 28 (antimiRs against hsa-miR-218-5p), or a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 3, 4, or 5 (antimiRs against hsa-miR-23b-3p) or with SEQ ID NO: 7, 8, 9 or 14 (antimiRs against hsa-miR-218-5p).
- the oligonucleotides or analogue is an antagonist comprising or consisting of
- the treatment is a palliative treatment of one or more symptoms of myotonic dystrophy type 1 and/or type 2, or a palliative treatment of one or more of the muscular disorders that are part of the symptoms of myotonic dystrophy type 1 and/or type 2.
- the treatment is for chronic myotonic dystrophy type 1 and/or type 2.
- the treatment is a therapeutic treatment.
- said use includes the use of the at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and/or analogue thereof to deliver said oligonucleotide molecule and/or analogue thereof to the relevant tissue, such as muscle and/or to CNS.
- the subject in need thereof is a mammal, preferably a human being, more preferably a human suffering from DM, preferably DM1.
- the administration of the antagonist through a possible expression vector thereof allows to direct the expression to a tissue or group of specific tissues according to the tropism of the base vector itself and/or by choosing control elements that give rise to the expression of the coding sequence linked to them only in specific tissues.
- some specific dosage forms may favour greater access to one or other organs.
- oligonucleotide and/or oligonucleotide analogue molecules of the invention for the manufacture of a medicinal product for the treatment of myotonic dystrophy type 1 by inhibition or antagonism of the action of a human hsa-miR-218-5p or hsa-miR-23b-3p in at least one or more organs selected from the group of the brain, cerebellum, hippocampus, or other central nervous system organs, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testicle, uterus, gastrointestinal tract, breast,
- organs that can also be targeted by the oligonucleotides of the present invention are selected from the group of the brain, cerebellum, hippocampus or another organ of the central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testicle and uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphoid cells or stem cells from one or more of these organs, or combinations thereof, as desired or appropriate.
- direct administration to mammals can be considered, for example via subcutaneous or systemic routes, preferably intravenously or intrathecal, for example dissolved or suspended in a pharmaceutically acceptable carrier, such as water or an aqueous solution such as saline or phosphate buffer, or intraarticular delivery.
- a pharmaceutically acceptable carrier such as water or an aqueous solution such as saline or phosphate buffer, or intraarticular delivery.
- the composition in which they are administered may contain pharmaceutically acceptable excipients.
- compositions of this invention can be administered by any of the common routes, provided that the target tissue is available through that route.
- compositions comprising antimiRs it is common for compositions comprising antimiRs to be formulated for intravenous or subcutaneous administration.
- oleic acid enhances the delivery of the oligonucleotide molecule and/or analogue thereof to muscle and/or CNS cells when the administration is intravenous (see Examples 9 and 10)
- it is a preferred embodiment that the administration is intravenous, intraarterial or subcutaneous.
- said intravenous, intraarterial or subcutaneous administration is a chronic administration, which means that it is carried out periodically (during the entire life of the patient in need thereof).
- the solutions are preferably administered in a form that is compatible with the dosage formulation and in such a quantity that it is therapeutically effective.
- Formulations can be easily administered in a variety of dosage forms such as injectable solutions, drug release capsules, and the like.
- a further aspect provides a method of treating DM, preferably DM1 , in a subject in need thereof, the method comprising administering the oligonucleotides or pharmaceutical compositions of the present invention to a patient in need thereof.
- the oligonucleotides will be present at a concentration that allows the administration of a therapeutically effective dose.
- said method of treatment includes the use of the at least one oleic acid molecule as a vehicle when conjugated to an oligonucleotide molecule and/or analogue thereof to deliver said oligonucleotide molecule and/or analogue thereof to the relevant tissue, such as muscle and/or to CNS.
- oleic acid is capable of increasing the delivery to target issues such as muscle and brain. This lead to the conclusion that oleic acid is capable of not only reducing the toxicity when a higher amount of PS with respect to PO is included in the molecule, but also oleic acid is an efficient vehicle to transport the oligonucleotide molecule and/or analogue thereof to target tissues, such as muscle and/or CNS.
- a fifth aspect of the present invention relates to the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier when said oleic acid is conjugated to a oligonucleotide molecule and/or analogue thereof, preferably conjugated to the 3’ or the 5’ of said oligonucleotide molecule and/or analogue.
- the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier refers to a use in which the oleic acid molecule is responsible of the transport, delivery, carriage, of the oligonucleotide molecule and/or analogue thereof to which it is conjugated, to a specific target tissue, preferably muscle and/or CNS tissue.
- vehicle and “carrier” are considered synonymous and thus are used interchangeably.
- a way of evaluating whether the at elast one oleic acid is being used a vehicle is by measuring the amount of the oligonucleotide molecule and/or analogue thereof that arrives at a target tissue (preferably CNS and/or muscle tissue) after intravenous, intraarterial or subcutaneous administration, and comparing said amount to the amount present in said tissue when the oligonucleotide molecule and/or analogue thereof is administrated not conjugated to the at least one oleic acid.
- a target tissue preferably CNS and/or muscle tissue
- the oligonucleotide molecule and/or analogue thereof to which the oleic acid is conjugated is the oligonucleotide molecule and/or analogue thereof defined in the first aspect of the present invention, or any of its embodiments.
- a preferred embodiment of the fifth aspect refers to the use of at least one oleic acid molecule as a pharmaceutically acceptable vehicle or carrier when said oleic acid conjugated to the 3’ end or the 5’ end of the oligonucleotide molecule and/or analogue thereof defined in the first aspect, preferably wherein said oligonucleotide molecule and/or analogue thereof is the active ingredient of a method of treatment by therapy as defined in the third or fourth aspects of the present invention or any of their embodiments.
- the conjugation between the oligonucleotide molecule and/or analogue thereof may be a direct conjugation or a conjugation throughout a spacer molecule, as described in under the first aspect of the present invention.
- the oleic acid used as a vehicle is conjugated to the oligonucleotide molecule and/or analogue thereof via a spacer molecule selected from the group consisting of of NHC3, NHC5, NHC6, threoninol, and a derivative thereof.
- a spacer molecule selected from the group consisting of of NHC3, NHC5, NHC6, threoninol, and a derivative thereof.
- only one oleic acid molecule is conjugated to the 5’ end or 3’ end of the oligonucleotide molecule and/or analogue thereof of the first aspect or any of its embodiments, so that the single oleic acid molecule acts as a vehicle of said oligonucleotide molecule and/or analogue thereof.
- only one oleic acid molecule is conjugated to the oligonucleotide molecule and/or analogue thereof of the first aspect or any of its embodiments, so that the single oleic acid molecule acts as a vehicle of said oligonucleotide molecule and/or analogue thereof, and the oligonucleotide molecule o and/or analogue thereof defined in the first aspect acts as an active ingredient in a method of treatment by therapy as defined in the third or fourth aspects.
- the at least one oleic acid molecule conjugated to the oligonucleotide molecule and/or analogue thereof as defined in the first aspect of the present invention, or any of its embodiments is capable of transporting said oligonucleotide molecule and/or analogue thereof to tissues of interest, such as muscle and/or CNS, with more efficiency that when the oligonucleotide molecule and/or analogue thereof is not conjugated to oleic acid, as shown in Example 9 or 10.
- the oleic acid molecule is used as an active ingredient delivery vehicle, wherein the active ingredient component is the oligonucleotide molecule and/or analogue thereof as defined in the first aspect or any of its embodiments.
- the at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3’ end or the 5’ end of the oligonucleotide molecule and/or analogue of the first aspect or any of its embodiments, wherein the oligonucleotide molecule and/or analogue thereof comprises a mixture of phosphorothioate and phosphodiester linkages chemically linking the nucleotides, preferably wherein the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage.
- the at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3’ end or the 5’ end of the oligonucleotide molecule and/or analogue of the first aspect or any of its embodiments, wherein said oligonucleotide molecule and/or analogue thereof is an antagonist of a microRNA, preferably an antagonist of the human hsa-miR-23b-3p or the human hsa-miR-218-5p.
- the at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3’ end or the 5’ end of the oligonucleotide molecule and/or analogue of the first aspect or any of its embodiments, wherein the oleic acid used as a vehicle delivers said oligonucleotide molecule and/or analogue thereof to muscular and/or CNS cells in a subject in need thereof when said oligonucleotide molecule and/or analogue thereof is administrated via intravenous, intraarterial or subcutaneous route.
- At least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3’ end or the 5’ end of the oligonucleotide molecule and/or analogue thereof as defined in the first aspect or any of its embodiments, wherein said oligonucleotide molecule and/or analogue thereof is the active ingredient of a method of treatment by therapy that comprises the prevention or treatment of muscular diseases, nervous system diseases, and/or RNAopathies.
- the at least one oleic acid molecule is used as a pharmaceutically acceptable vehicle or carrier when conjugated to the 3’ end or the 5’ end of the oligonucleotide molecule or analogue thereof as defined in the first aspect or any of its embodiments, wherein said oligonucleotide molecule and/or analogue thereof is the active ingredient of a method of treatment by therapy that comprises the prevention or treatment of myotonic dystrophy, preferably myotonic dystrophy is of type 1.
- the invention also provides a conjugate, wherein the conjugate consists of at least one oleic acid conjugated to the 3’ end or 5’ end of the oligonucleotide molecule or analogue thereof as defined in the first aspect or any of its embodiments, wherein said oligonucleotide molecule or analogue thereof is used as an active ingredient in a method of treatment by therapy as defined in the third or fourth aspects or any of their embodients, and wherein the at least one oleic acid is used as a pharmaceutically acceptable vehicle for delivering said oligonucleotide molecule or analogue thereof to the target tissues, such as CNS and/or muscle tissue.
- the target tissues such as CNS and/or muscle tissue.
- An oligonucleotide molecule or a mixture of two or more of said molecules, wherein said oligonucleotide molecule comprises between 10 to 30 nucleotides in length, wherein said oligonucleotide molecule comprises at least two nucleotides chemically linked by a phosphorothioate linkage, and wherein said oligonucleotide molecule is conjugated at its 3' and/or 5' ends to at least one oleic acid molecule.
- oligonucleotide molecule according to any of clauses 1 to 3, wherein said oligonucleotide molecule comprises between 15 to 30 nucleotides in length, wherein at least two nucleotides of said molecule are linked by a phosphodiester linkage and wherein the number of nucleotides that are chemically linked by a phosphorothioate linkage is greater than the number of nucleotides that are chemically linked by a phosphodiester linkage.
- oligonucleotide molecule according to of any of clauses 1 to 4, wherein said oligonucleotide molecule comprises between 15 to 30 nucleotides in length, and wherein said oligonucleotide molecule comprises a fragment composed of a succession of at least 15 consecutive nitrogen bases of nucleotides that are identical in at least 80% to the sequence of a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR-23b-3p), or SEQ ID NO: 52-110.
- oligonucleotide molecule according to any of clauses 1 to 5, wherein said oligonucleotide molecule comprises between 15 to 30 nucleotides in length, and wherein said oligonucleotide molecule comprises a fragment composed of a succession of at least 15 consecutive nitrogen bases of nucleotides that are identical to the sequence of a region present in SEQ ID NO: 1 (antimiR-218-5p) or 2 (antimiR- 23b-3p).
- oligonucleotide molecule comprising at least one chemical modification, wherein the chemical modification is selected from the group of: i) 2'-O-methyl (2'OMe), ii) 2'-O-Methoxyethyl (2' MOE), and/or iii) an extra bridge connecting the 2' oxygen and 4' carbon (LNA).
- the chemical modification is selected from the group of: i) 2'-O-methyl (2'OMe), ii) 2'-O-Methoxyethyl (2' MOE), and/or iii) an extra bridge connecting the 2' oxygen and 4' carbon (LNA).
- oligonucleotide molecule according to any of clauses 1 to 7, wherein said oligonucleotide molecule comprises between 15 to 30 nucleotides in length, and wherein said oligonucleotide molecule comprises a fragment composed of a succession of at least 15 consecutive nitrogen bases of nucleotide that are identical in at least 80% to the sequence of a region present in SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonists of hsa-miR-23b) or SEQ ID NOs: 7, 8, 9, 14, 25, 26, 27, or 28 (antagonists of hsa-miR-218-5p).
- oligonucleotide molecule according to any of clauses 1 to 8, wherein said oligonucleotide molecule comprises between 15 to 30 nucleotides in length, and wherein the nucleotide sequence of said oligonucleotide consists of SEQ ID NOs: 3, 4, 5, 22, 23, 24, 49, 50 or 51 (antagonists of hsa-miR-23b) or SEQ ID NOs: 7, 8, 9, 14, 25, 26, 27, or 28 (antagonists of hsa-miR-218-5p).
- a composition preferably a pharmaceutical composition, comprising at least an oligonucleotide molecule as defined in any of clauses 1 to 9, or a mixture of two or more of them, optionally further comprising a carrier and/or one or more pharmaceutically acceptable excipients.
- a composition preferably a pharmaceutical composition, comprising at least an oligonucleotide molecule as defined in any of clauses 1 to 9, or a mixture of two or more of them, optionally further comprising a carrier and/or one or more pharmaceutically acceptable excipients, for use in therapy.
- a composition preferably a pharmaceutical composition, comprising at least an oligonucleotide as defined in any of clauses 1 to 9, or a mixture of two or more of them, optionally further comprising a carrier and/or one or more pharmaceutically acceptable excipients, for use in targeting muscular cells in a subject in need thereof.
- a composition preferably a pharmaceutical composition, comprising at least an oligonucleotide as defined in any of clauses 1 to 9, or a mixture of two or more of them, optionally further comprising a carrier and/or one or more pharmaceutically acceptable excipients, for use in the prevention or treatment of muscular diseases or in the prevention or treatment of RNAopathies.
- composition preferably a pharmaceutical composition, for use according to clause
- composition preferably a pharmaceutical composition, for use according to clause
- the SEQ ID NOs listed below and as referred throughout the application comprise a nucleobase sequence and, for those of the oligonucleotides that depart from their natural chemistry, also their chemical modifications and/or fatty acid conjugation.
- the following nomenclature has been used throughout the entire specification to define the chemical modifications included in the SEQ ID NOs disclosed herein: LNA nucleotides are indicated by the combinations of a capital letter and a small letter: Ab, Gb, Tb, Cb,
- RNA nucleotides are indicated by a combination of a capital letter and a small letter: Am, Cm, Gm, Tm,
- 2’-O-Methyl-nucleotides are represented by the small letters: a, g, c, u,
- 2'-Fluoro RNA nucleotides are indicated by a combination of a capital letter and a small letter: Af, Cf, Gf, Tf,
- 2'-O-Methyl-2,6-diaminopurine modification is indicated with the expression (dap)
- deoxynucleotides are indicated by the combination of small letter and capital letter: dA, dC, dG, dT,
- 2’-OMe-5-methyluridine or 2’-OMe-ribothymidine is represented by small “t” letter
- 5-Methyl-2'-O-Methyl cytidine are represented by the expression (5Mc)
- the expression (OleicAcid) means that the oligonucleotide is conjugated to Oleic Acid
- the expression (PalmiticAcid) means that the oligonucleotide is conjugated to Palmitic Acid
- the (spacer molecule) is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or a derivative thereof.
- the spacer molecule is NHC6 or NHC3,
- Y is used for any pyrimidine (C or ll/T)
- hypoxanthine is the nucleobase of inosine.
- SEQ ID NO 1 Antagonist of the human hsa-miR-218-5p: TTAGATCAAGCACAA
- SEQ ID NO 2 Antagonist of the human hsa-miR-23b-3p: ATCCCTGGCAATGTGA
- SEQ ID NO: 10 hsa-miR-218-5p: UUGUGCUUGAUCUAACCAUGU
- SEQ ID NO: 11 hsa-miR-23b-3p: AUCACAUUGCCAGGGAUUACCAC
- SEQ ID NO: 12 seed region of hsa-miR-218-5p: UGUGCU
- SEQ ID NO: 13 seed region of hsa-miR-23b-3p: UCACAll
- SEQ ID NO: 18 MD23 MOE: AbsTbsCmsCmCmsTmsGmGmsCmAmAmsTbGmsTmGbsAb
- SEQ ID NO: 19 The microRNA precursor (pre-microRNA) of hsa-miR-23b-3p:
- SEQ ID NO: 21 Pre-miR-218-2 (chr5:1681951 SI- 168195260): GACCAGUCGCUGCGGGGCUUUCCUUUGUGCUUGAUCUAACCAUGUGGUGGAACGAU GGAAACGGAACAUGGUUCUGUCAAGCACCGCGGAAAGCACCGUGCUCUCCUGCA
- SEQ ID NO: 27 218 OME/MOE oleic 3’ without specific spacer molecule:
- SEQ ID NO: 29 MD23b-2 V2 3’Pal without specific spacer molecule: AbsTbs(5Mc)s(5Mc)sCmTbGmsgsCmsAbAmTbGbTmsGbsAb(Spacer molecule)(PalmiticAcid), wherein the spacer molecule is preferably selected from the group consisting of NHC3, NHC5, NHC6, threoninol, or a derivative thereof.
- SEQ ID NO 52 functional equivalent sequence of antimiR-23b-3p: YTCCCTGGCAATGTGA
- SEQ ID NO 53 functional equivalent sequence of antimiR-23b-3p: ATCCCTYGCAATGTGA
- SEQ ID NO 54 functional equivalent sequence of antimiR-23b-3p: ATCCCTGYCAATGTGA
- SEQ ID NO 55 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCYATGTGA
- SEQ ID NO 56 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAYTGTGA
- SEQ ID NO 57 functional equivalent sequence of antimiR-23b-3p:
- SEQ ID NO 59 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTGY
- SEQ ID NO 60 functional equivalent sequence of antimiR-23b-3p: GTCCCTGGCAATGTGA
- SEQ ID NO 61 functional equivalent sequence of antimiR-23b-3p: ATUCCTGGCAATGTGA
- SEQ ID NO 62 functional equivalent sequence of antimiR-23b-3p: ATCUCTGGCAATGTGA
- SEQ ID NO 64 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGUAATGTGA
- SEQ ID NO 65 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCGATGTGA
- SEQ ID NO 66 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAGTGTGA
- SEQ ID NO 67 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTGG
- SEQ ID NO 68 functional equivalent sequence of antimiR-23b-3p: ITCCCTGGCAATGTGA
- SEQ ID NO 69 functional equivalent sequence of antimiR-23b-3p:
- SEQ ID NO 71 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTG I
- SEQ ID NO 72 functional equivalent sequence of antimiR-23b-3p: AICCCTGGCAATGTGA
- SEQ ID NO 73 functional equivalent sequence of antimiR-23b-3p: ATCCCIGGCAATGTGA
- SEQ ID NO 74 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAAIGTGA
- SEQ ID NO 75 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGIGA
- SEQ ID NO 76 functional equivalent sequence of antimiR-23b-3p: ATCCCTI GCAATGTGA
- SEQ ID NO 77 functional equivalent sequence of antimiR-23b-3p: ATCCCTGICAATGTGA
- SEQ ID NO 78 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATITGA
- SEQ ID NO 79 functional equivalent sequence of antimiR-23b-3p: ATCCCTGGCAATGTIA
- SEQ ID NO 80 functional equivalent sequence of antimiR-218-5p: TTYGATCAAGCACAA
- SEQ ID NO 81 functional equivalent sequence of antimiR-218-5p:
- TTAYATCAAGCACAA SEQ ID NO 82: functional equivalent sequence of antimiR-218-5p: TTAGYTCAAGCACAA
- SEQ ID NO 83 functional equivalent sequence of antimiR-218-5p: TTAGATCYAGCACAA
- SEQ ID NO 84 functional equivalent sequence of antimiR-218-5p: TTAGATCAYGCACAA
- SEQ ID NO 85 functional equivalent sequence of antimiR-218-5p: TTAGATCAAYCACAA
- SEQ ID NO 86 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCYCAA
- SEQ ID NO 87 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACYA
- SEQ ID NO 88 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACAY
- SEQ ID NO 89 functional equivalent sequence of antimiR-218-5p: TTGGATCAAGCACAA
- SEQ ID NO 90 functional equivalent sequence of antimiR-218-5p: TTAGGTCAAGCACAA
- SEQ ID NO 91 functional equivalent sequence of antimiR-218-5p: TTAGATUAAGCACAA
- SEQ ID NO 92 functional equivalent sequence of antimiR-218-5p: TTAGATCGAGCACAA
- SEQ ID NO 93 functional equivalent sequence of antimiR-218-5p:
- TTAGATCAGGCACAA SEQ ID NO 94: functional equivalent sequence of antimiR-218-5p:
- SEQ ID NO 95 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCGCAA
- SEQ ID NO 96 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCAUAA
- SEQ ID NO 97 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACGA
- SEQ ID NO 98 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACAG
- SEQ ID NO 99 functional equivalent sequence of antimiR-218-5p: TTIGATCAAGCACAA
- SEQ ID NO 100 functional equivalent sequence of antimiR-218-5p: TTAGITCAAGCACAA
- SEQ ID NO 101 functional equivalent sequence of antimiR-218-5p: TTAGATCIAGCACAA
- SEQ ID NO 102 functional equivalent sequence of antimiR-218-5p: TTAGATCAIGCACAA
- SEQ ID NO 103 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCICAA
- SEQ ID NO 104 functional equivalent sequence of antimiR-218-5p: TTAGATCAAGCACIA
- SEQ ID NO 105 functional equivalent sequence of antimiR-218-5p:
- TTAGATCAAGCACAI SEQ ID NO 106 functional equivalent sequence of antimiR-218-5p:
- SEQ ID NO 107 functional equivalent sequence of antimiR-218-5p: TIAGATCAAGCACAA
- SEQ ID NO 108 functional equivalent sequence of antimiR-218-5p: TTAGAICAAGCACAA
- SEQ ID NO 109 functional equivalent sequence of antimiR-218-5p: TTAIATCAAGCACAA
- SEQ ID NO 110 functional equivalent sequence of antimiR-218-5p: TTAGATCAAICACAA
- SEQ ID NO 111 TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-Digoxigenin NHS ester
- Immortalized MyoD-inducible (doxycycline) DM1 and control fibroblasts were grown in DMEM with 4.5 g/L glucose, 1% P/S, and 10% FBS (Sigma, Saint Louis, Misuri). Fibroblast transdifferentiation into myotubes was according to (Cerro-Herreros et al. (2016). “miR-23b and miR-218 silencing increase Muscleblind-like expression and alleviate myotonic dystrophy phenotypes in mammalian models”. Nat.
- Transdifferentiation was induced at day 0, and test compounds were added to the cell culture medium at different concentrations (for MD23b-2, MD23b-8, MD23b-4, MD23b-13, MD23b-7, MD23b-14, MD-23b-1 , 23-LNA4, MD23b-10, MD23b-3, AntimiR-23b, MD23b-6, , MD23b-12, MD23b-9, MD23b-5, MD23b-11, 23-LNA6, non-conjugated-23b, 5’-23b-Oleic, 5’-23b-Linoleic, 5’-23b-MeToc, 5’-23b-MeChol, 5’-23b- MePal, 5’-23b-Elaidic, 5’-23b-Estearic, OL-MD23b-2, MD23b-2- PS/PO, MD23b-2- PS/PO 5'01, non-conjugated-218, Ax-218, 5’-218
- Cells seeded at 10 5 cells/ml in 96-well plates were transfected 24 h later with antimiRs, as previously explained; after 96 h, cell proliferation was measured using the CellTiter 96® Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Madison, Wisconsin).
- the TC50 was calculated using non-linear least-squares regression, and absorbance levels were determined using an Infinite M200 PRO plate reader (Tecan, Mannedorf, Switzerland).
- QDB Quantitative Dot Blot
- mice samples 1 pg/well of cell samples and 2 pg/well of mice samples were denatured (100°C for 5 min) and loaded in QDB plates (Quanticision Diagnostics Inc, Research Triangle Park, North Carolina). Each cell sample was loaded in quadruplicate on two different plates; one was used to detect MBNL1 and the other for GAPDH, which was used here as an endogenous control. In the case of mouse samples, each sample was loaded in quadruplicate on three different plates, one for detection of MBNL1 , one for Tubulin, which was used as endogenous control, and the other for anti-mouse IgG secondary antibody as a negative control to subtract background.
- the protein is prepared at 2 pg/well.
- Each sample is loaded in quadruplicate on two different plates, one is used for the detection of MBNL1 and the other for GAPDH, which is used here as an endogenous control.
- For the preparation of the sample mix (enough for 10 samples, to account for pipetting errors) put the protein extract at the indicated concentration, add 10.4 pl of loading buffer 4X and finally complete to 50 pl of ddH2O.
- Once the sample is prepared boil it for 5 min in water and after protein denaturation, leave it on ice.
- To load the samples place the QDB plates (Quanticision Diagnostics, Inc) upside down. On each membrane circle, put 5 pl of the protein mix previously prepared.
- the loaded QDB plates are allowed to dry at room temperature for 30 minutes in a well-ventilated space to dry the membrane completely.
- the QDB plate After the dry, dip the QDB plate in the transfer buffer (0.039 M Glycine, 0.048 M Tris, 0.37% SDS, 20% methyl alcohol) and gently shake the plate for 1 min.
- the plate was rinsed with TBST (137 mM NaCI, 2.7mM KOI, 20 mM Tris, pH7.4, plus 0.1 % Tween-20) for 3 times, and blotted with blocking buffer (5% non-fat milk in TBST) in one container.
- the plate was incubated with primary mouse anti-MBNL1 (1 :1000, ab77017, Abeam) or mouse anti-GAPDH (1 :500, clone G-9, Santa Cruz) overnight at 4°C into a 96 well plate.
- the plate was washed three times with TBST and incubated again with the secondary antibody anti-mouse-POD (1 :200, Sigma-Aldrich) for 2 hours before the plate was washed again for three times with TBST.
- the plate was inserted into a 96 well plate loaded with 100 pL/well ECL substrate (Pierce) solution for 1 minute before it was inserted into a white 96 well plate for chemiluminescence signal quantification using a Tecan Infiniti 200 pro microplate reader with the option “plate with cover” chosen in the user interface.
- RNA extraction Reverse Transcription PCR (RT-PCR) and Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)
- RNA from murine gastrocnemius and quadriceps muscle was isolated using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.
- One microgram of RNA was digested with DNase I (Invitrogen, Carlsbad, California) and reverse-transcribed with SuperScript II (Invitrogen, Carlsbad, California) using random hexanucleotides.
- DNase I Invitrogen, Carlsbad, California
- SuperScript II Invitrogen, Carlsbad, California
- 20 ng of cDNA was used with GoTaq polymerase (Promega, Madison, Wisconsin).
- Specific primers were used to analyze the alternative splicing of Atp2a 1, Nfix, MbnH and Clcnl in mouse samples (both muscles).
- Gapdh levels established the endogenous reference levels using 0.2 ng of cDNA. PCR products were separated on a 2% agarose gel and quantified using Imaged software (NIH, Bethesda, Maryland). Percentage splice recovery index (PSR) was defined as value % Si minus X%DSI, divided by X%DSI minus X%HSI (SI: splicing inclusion of each sample; DSI: disease splicing inclusion; HSI: healthy splicing inclusion; in all cases splicing refers to the inclusion of the indicated alternative exon). This ratio was calculated for ATP2A 1 , NFIX, MBNL1 and CLCN1. The primer sequences and exons analyzed are available in (Cerro-Herreros et al. 2018 2018 Jun 26;9(1):2482. doi: 10.1038/s41467-018-04892-4.) and are reproduced below:
- SEQ ID NO: 30 Gapdh Fwd: ATCAACGGGAAGCCCATCAC
- SEQ ID NO: 31 Gapdh Rv: CTTCCACAATGCCAAAGTTGT
- SEQ ID NO: 32 Atp2a Fwd: GCTCATGGTCCTCAAGATCTCAC
- SEQ ID NO: 34 Clcnl Fwd: GTCCTCAGCAAGTTTATGTCC
- SEQ ID NO: 36 Nfix Fwd: TCGACGACAGTGAGATGGAG
- SEQ ID NO: 37 Nfix Rv: CAAACTCCTTCAGCGAGTCC
- mice tissue cDNA was used as a template for multiplex qRT-PCR using the QuantiFast Probe PCR Kit reagent.
- Commercial TaqMan probes (Qiagen, Hilden, Germany) were used for mouse (MBNL1 and MBNL2', FAM-labeled probes) and reference (GAPDH', MAX-labeled probe) genes. Results were normalized to Gapdh endogenous gene expression.
- the primers used are the following:
- SEQ ID NO: 40 Probe MbnH: /5Q-
- SEQ ID NO: 41 MbnH F: TACCGATTGCACCACCAAAC
- SEQ ID NO: 43 Mbnl2 probe:/56-FAM/CCCGGCAGACAGCACCATGATCGA/3IAbRQSp/
- SEQ ID NO: 45 Mbnl2 R: GGTTACGGTGTTGTCGTTTGT
- SEQ ID NO: 46 Gapdh probe: /5MAXN/-CGCCTGGTCACCAGGGCTGCT-/3BHQ_1/
- SEQ ID NO: 47 Gapdh _For: CAACGGATTTGGTCGTATTGG
- SEQ ID NO: 48 Gapdh _Rev: TGATGGCAACAATATCCACTTTACC
- MiRNA expression in muscle tissues was quantified using specific miRCURYTM-locked nucleic acid microRNA PCR primers (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Relative gene expression was normalized to U1 (YP00203909) and U6 (YP00203907) snRNAs.
- mice Mankodi et al. 2000 Science: 289(5485): 1769-73. doi: 10.1126/science.289.5485.1769 ) were provided by Prof. C. Thornton (University of Rochester Medical Center, Rochester, NY, USA).
- Experimental groups were FVB as normal control and HSALR treated with PBS as a negative control, in addition to HSALR mice treated with all experimental oligonucleotides.
- the sample size was four mice per treatment group, twelve mice for PBS, and eighteen mice for the FVB group. All the groups were injected intravenously (tail vein) with 150 pl of 1 * PBS (vehicle) or the specific oligonucleotides (see Fig 2-5) with a single dose of 3 mg/kg. Four days after injection, the mice were sacrificed, and the tissues of interest were frozen in liquid nitrogen for the molecular assays.
- Electromyography was performed before the treatment and at the time of sacrifice under general anaesthesia, as previously described (Kanadia et al. 2006 Proc Natl Acad Sci U S A . 2006 Aug 1 ;103(31):11748-53. doi: 10.1073/pnas.0604970103). The determination was performed blindly to eliminate bias.
- the forelimb grip strength was measured with a Grip Strength Meter (BIO-GS3; Bioseb, Pinellas Park, Florida).
- the peak pull force (measured in grams) was recorded on a digital force transducer when the mouse grasped the bar.
- the gauge of the force transducer was reset to 0 g after each measurement.
- Tension was recorded by the gauge at the time the mouse released its forepaws from the bar.
- the bodyweight measurement was performed in parallel. The final value is obtained by dividing the average value of the grip force by the bodyweight of each mouse.
- the bodyweight measurement was performed in parallel, and the experiment was performed with animals identified by a code to eliminate experimental bias.
- the values obtained are represented as the recovery index (Rl), and it measures how close the different parameter values obtained with treated HSA LR mice are from those of FVB controls.
- This Rl is obtained for the different parameters (Mbnll protein, Mbnl1/2 expression level, Splicing recovery, Mbnll ex5 inclusion recovery, and functional recovery) of each mouse after treatment according to this formula: value % MT minus X% MNT, divided by X% MH minus X% MNT (where MT is the value of each mice treated (PBS or oligonucleotide), MNT is HSA LR mice treated with PBS (PBS), and MH is healthy mice value (FVB)). These values range from 0 to 1 , where 0 are untreated mice (HSA LR -PBS) and 1 are healthy mice (FVB).
- Mbnll protein refers to the average of the values obtained by Quantitative dot blot of both muscles (quadriceps and gastrocnemius) of each treatment group.
- Mbnl1/2 expression level refers to the average of the mRNA values of genes Mbnll and Mbnl2 obtained by real-time PCR in both muscles (quadriceps and gastrocnemius) and of each group of treatment applying the previous formula.
- Splicing recovery refers to the average percentage of inclusion for Nfix exon 7, Atp2a1 exon 22 and Clcnl exon 7a of both muscles of each group treatment.
- Mbnll ex5 inclusion recovery refers to the percentage of inclusion for Mbnll exon 5 of both muscles of each group treatment.
- Functional recovery refers to the average of the values obtained by force/weight of each mouse after treatment and the grade of myotonic discharges of each group treatment.
- the Forelimb grip strength test was used to obtain the force and the electromyography was used to obtain the grade of myotonic discharges.
- the antagomiRs used were long (22 nt), contained almost the entire complementary sequence to the miRNA, and were all composed of 2'OME nucleotides. They carried phosphorothioate linkages between the nucleotides in the 3' and 5' ends to improve stability of the nucleotidic part of the molecule and were bound to cholesterol in 3' as a carrier to enhance the pharmacokinetic behavior and cellular internalization.
- Tl therapeutic index
- TC50 is the concentration of compound that reduces the cell viability to 50% of the mock EC50 is the concentration of compound that produces 50% of Emax
- Emax is the maximum fold change of MBNL1 protein obtained after transfection with a specific antimiR compared to the mock (transfected with the vehicle).
- oleic acid has a good safety profile and has been used as a food additive with beneficial effects in humans (see FDA Response Letter to the Health Claim Petition Concerning Oleic Acid, November 19, 2018 available at https://www.fda.gov/food/cfsan-constituent-updates/fda- completes-review-qualified-health-claim-petition-oleic-acid-and-risk-coronary-heart-disease).
- the molecules included in this screening carried different chemical modifications, including LNA, 2'OME and 2'MOE oligonucleotide, and all the linkages between nucleotides were phosphorothioate (PS) (list of molecules tested in Tables 2 and 3).
- PS phosphorothioate
- the molecule with a better Tindex score against miR-23b-3p was MD23b-2, and in the case of the antimiR molecules designed to inhibit miR-218-5p, the best scoring molecule was 218- D/LNA2 (see Tables 2 and 3).
- MD23b-2 showed significantly higher effects on MBNL1 levels (Emax), and Tindex, than 218-D/LNA2.
- the curves of toxicity and efficacy (levels of MBNL1 protein) of these molecules are shown in Fig. 1 A and D.
- (Pro)(Chol) stands for hydroxyprolinol C5-alkyl cholesterol.
- (Teg)(Chol) stands for 15 atom triethyleneglycol cholesterol depending on the spacer used.
- Methylation of Cytosines is a well-known method of inhibiting immune system activation by in vivo treatment with antisense oligos (Joseph J. Senn, et al. Non-CpG- Containing Antisense 2'-Methoxyethyl Oligonucleotides Activate a Proinflam matory Response Independent of Toll-Like Receptor 9 or Myeloid Differentiation Factor 88. Journal of Pharmacology and Experimental Therapeutics September 1 , 2005, 314 (3) 972-979; DOI: https://doi.org/10.1124/jpet.105.084004).
- phosphodiester (PO) linkages between nucleotides have been substituted by phosphorothioate (PS) linkages in order to increase their stability and efficacy.
- PS phosphorothioate
- Fully modified PS oligos are widely used in in vitro studies. However, some toxicity in vivo associated with an excess of PS linkages in a single molecule has been previously reported (e.g., Smith and Zain. 2019.
- Therapeutic oligonucleotides State of the Art. Annual Review of Pharmacology and T oxicology, and Hu et al. 2020.
- Therapeutic siRNA state of the art. Signal transduction and targeted therapy), and mixed oligos PS/PO have proven to be more stable in vivo (Zhang, et al.
- -MD23b-2 PS/PO which conserves the same chemical modifications found in MD23b- 2 but with lower PS content and all cytosines methylated.
- -MD23b-2 V2 with the same sequence as MD23b-2 but with some OME modifications in 2' substituted by MOE, lower PS content, and all cytosines methylated.
- MD23b-2 PS/PO was used non-conjugated, conjugated with oleic acid in 3'(MD23b 2 PS/PO 3'01 ) and conjugated with oleic acid in 5'(MD23b-2 PS/PO 5'01) in order to assess the effect of the conjugation site with the oleic acid on the therapeutic effect.
- MD23b-2 V2 was used non-conjugated, conjugated to Oleic acid in 3' (MD23b-2 V2 3’01), and conjugated with palmitic acid in 3'(MD23b-2 V2 3’Palm) to confirm whether the conjugation with oleic acid produced stronger effects of the antimiRs than the conjugation with palmitic acid, also in vivo.
- the two antimiRs against miR-218-5p were both conjugated with oleic acid in 3'.
- EXAMPLE 4 qRT-PCR was used to quantify the levels of expression of MbnH (Fig. 4A) and Mbnl2 (Fig. 4B) transcripts in quadriceps and gastrocnemius, and the total protein extracted from these muscles was processed for protein MbnH detection by quantitative dot blot analysis (Fig. 4C). Although small differences were detected between antimiR-23b-3p and antimiR-218-5p regarding the level of MbnH transcripts, miR-23b-3b antimiRs had a stronger effect on Mbnl protein.
- MbnH protein such as Atp2a1 exon 22, Nfix exon 7, MbnH exon 5, and Chloride channel (Clcnl) exon 7a (Fig. 5 and 6).
- Nfix, Clcnl, Atp2a1 and Mbn transcripts showed abnormally increased inclusion of exon 7, 7a, 22, and 5, respectively, in HSA LR mice, but they recovered between 30%-50% of normal values in muscles after being treated with 3 mg/kg with MD23-b V2 3’01 and other similar molecules.
- Mbnll protein refers to the average of the values obtained by Quantitative dot blot of both muscles (quadriceps and gastrocnemius) of each group treatment.
- Mbnl1/2 expression level refers to the average of the values obtained by real-time PCR of both muscles (quadriceps and gastrocnemius) and genes (Mbnll and Mbnl2) of each group treatment applying the previous formula.
- Splicing recovery refers to the average percentage of inclusion for Nfix exon 7, Atp2a1 exon 22 and Clcnl exon 7a of both muscles of each group treatment.
- Mbnll ex5 inclusion recovery refers to the percentage of inclusion for Mbnll exon 5 of both muscles of each group treatment. Functional recovery refers to the average of the values obtained by force/weight of each mouse after treatment and the grade of myotonic discharges of each treatment group.
- EXAMPLE 7 In all the antimiRs tested, we have always conjugated oleic acid either in 3' or 5' using a spacer that contains an amino group to form an amide linkage between the oleic acid and the oligonucleotide.
- the first spacer was the 6-aminohexyl group (NHC6 spacer) that was introduced both at the 3’ and the 5’-ends.
- MD23b-2 V2 3’01 is a 16 nt long oligonucleotide consisting of LNA, 2’-0-M0E and 2’-0-Me modified building blocks that are linked by phosphodiester or phosphorothioate linkages. Its 3’ end is modified with an oleic acid moiety ( Figure 10). This oleic acid is introduced by coupling the activated carboxylic acid to a hexyl amino spacer at the 3’-end of a precursor oligonucleotide.
- the synthesis of the MD23b- 2 V2 3’01 is based on solid-phase synthesis using building blocks and spacers-GPG. This process consists of two main steps.
- the manufacture involves the following steps: cleavage and deprotection, purification, desalting
- the oleic acid is conjugated. Once the desalted unconjugated oligonucleotide from the last step is conjugated with the oleic acid, it is purified, desalted and lyophilized.
- MD23b-2 V2 and MD23b-2 V2 3'01 were used.
- a dose of 12 mg/kg of the compounds was administered intravenously to the HSA LR mice. After 14 days, all mice were euthanized, and their brain, kidney, liver, gastrocnemius, and quadriceps muscles were removed, weighed, and frozen for further processing. The experiments were conducted in a blinded manner by the investigator, who was unaware of the group assignment. Samples from brain, muscle (quadriceps and gastrocnemius), kidney and liver were collected during the necropsy procedure from all the experimental groups. Samples were weighed upon collection in gram units to a minimum of 3 decimal places. Each piece was placed in RNase-free tubes and snap frozen (e.g., 2 ml Eppendorf tube RNase-free).
- a control tissue homogenate is needed to prepare the standard dilution. Then, to prepare the serial dilution, 1 pM of the desired compound was denatured at 65°C for 15 min and vortexed for 30 s at least. Then 32 pL of this denatured compound was diluted in 968 pL of control homogenate. This is the first point of the standard curve (32000 pM). Then for the next point, 500 pL of 32000 pM was diluted in 500 pL of compound diluting buffer (16000 pM). By this similar fashion 8000 pM, 4000 pM, 2000 pM, and 1000 pM were made.
- the probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-Digoxigenin NHS ester (stock is 100 pM in water, and prepare 1uM for this stock in water) need to be heated at 65°C for 15 min and vortex for 30s.
- micrococcal nuclease in micrococcal nuclease dilution buffer (1 ,6 pL of nuclease+ 16 ml of the buffer) during the incubation step. This calculation is made for the whole plate.
- Attophos substrate dilute 36 mg of powder (which came in the bottle) by adding 60 ml of the Attophos buffer and keep in the refrigerator protected from the light (preferably wrapped up with an aluminum foil). Take out the liquid, wash the plate 6 times with 100 pL of washing buffer, dry the plate and add 150 pL of Attophos substrate (Diluted 1 :1 ratio in Attophos buffer).
- Table 10 Mean values of MD23b-2 V2 3’01 and MD23b-2 V2 (ng/g) in brain, gastrocnemius, quadriceps, kidney and liver.
- oleic acid improves the delivery of our compound, and above all, it improves it to tissues such as muscle and brain involved in the pathology.
- EXAMPLE 10 DETERMINATION OF MD23b-2 V2 3’0L AND MBNL1 PROTEIN LEVELS IN NON-HUMAN PRIMATE BRAIN
- the objective of this study was the determination of the exposure of the brain of the animals treated with MD23b-2 V2 3’0L was determined using Enzyme-Linked Immunosorbent Assay (ELISA). Furthermore, target engagement on the brain of treated animals was measured by quantification of Muscleblind-like type 1 (MBNL1) protein levels from the No Human Primate brain.
- ELISA Enzyme-Linked Immunosorbent Assay
- Phase 1 maximal-tolerated dose [MTD] phase
- one male and one female cynomolgus monkey of Asian origin were assigned to Group 1 and administered a single dose of MD23b-2 V2 3’01 under non fasted conditions at 5, 10, 15, and 20 mg/kg intravenously (slow bolus [10 minutes]) on Days 1 , 15, 29, and 43 of the MTD phase at a dose volume of 5 mL/kg in an ascending dose design.
- Table 12 Phase 1: Maximum Tolerated dose (MTD) Group Assignment
- the brain of all animals from Groups 1 to 3 were collected for ELISA quantification, MBNL1 investigations and determination of potential off targets. Two weeks after the last administration for the animals from the phase 1 and 3 weeks after the end of the treatment period for animals from phase 2. Each piece was placed in a separate RNase-free Eppendorf tube, frozen in liquid nitrogen and stored at (-80 ⁇ 10 °C). A total 8 brain samples were generated. 2.1.2 ELISA Quantification 2.1.2.1 Sample Preparation
- the probe miR-23b TbsCsAsCbsAsTsTbsGsCsCbsAsGsGbsGsAsTb-Digoxigenin NHS ester (stock is 100 pM in water, and prepare 1uM for this stock in water) need to be heated at 65°C for 15 min and vortex for 30s.
- micrococcal nuclease in micrococcal nuclease dilution buffer (1 ,6 pL of nuclease+ 16 ml of the buffer) during the incubation step. This calculation is made for the whole plate. Take out the liquid first, wash the plate 6 times with 100 pL of washing buffer, then dry the plate using an absorbent paper by keeping the plate upside down and add 150 pL of micrococcal nuclease per well (Final amount of 30 ll/well)
- Attophos substrate dilute 36 mg of powder (which came in the bottle) by adding 60 ml of the Attophos buffer and keep them in the fridge protected from the light (preferably wrapped up with an aluminum foil).
- the accuracy of an analytical method describes the closeness of mean test results obtained by the method to the true value (concentration) of analytic. Accuracy is estimated by the relative error of measurement (RE%).
- the true values of the reference controls for both ELISA assays did not correspond with the theoretical concentration based only in calculation. Therefore, the nominal concentration for the controls would be calculated as the mean of the pool of all the references for each concentration level form all the analytical batches
- Theoretical concentration The precision of an analytical method describes the closeness of individual measures of an analyte when the procedure is applied repeatedly to multiple aliquots of a single homogeneous volume of biological matrix. Precision is estimated by the coefficient of variation (CV%).
- NHP brain samples were mechanically disaggregated with a TissueLyser II (QIAGEN) and homogenized in RIPA Buffer (Thermo Scientific, Cat. No. 89900) supplemented with protease and phosphatase inhibitors (Roche, Cat. No. 11873580001 and 4906845001).
- Total protein was quantified with PierceTM BCA Protein Assay Kit (Cat. No. 23225) using bovine serum albumin as standard.
- 2.1.3.2 Western blot:
- the membranes were blocked using 5% skim milk in PBS-T (8 mM Na2HPO4, 150 mM NaCI, 2 mM KH2PO4, 3 mM KCI, 1 % Tween 20, pH 7.4) for 1 h.
- the membranes were incubated with the primary anti-MBNL1 mouse antibody (1 : 200, MB1a (4A8) (DSHB, Iowa City, Iowa)) overnight at 4°C.
- Incubation with the primary antibody was followed by incubation with horseradish peroxidase-conjugated anti- mouse secondary antibody (1 : 3500, (HRP) - conjugated anti-Mouse-IgG secondary antibody, Sigma- Aldrich, Saint Louis, Missouri), during 1h at room temperature.
- visualization was carried out using an enhanced chemiluminescence substrate (ECL, Pierce), and images were acquired using ImageQuant 800 Amersham equipment (GE Healthcare).
- Table 16 Concentrations of MD23b-2 V2 3’OL (nM, ng/mg, ng/g) in Cynomolgus Monkey Brain 14 days (Group 1) and 21 days (Groups 2 and 3) after last treatment.
- Table 17 MBNL1 relative levels. Mean values Phase I and Phase II.
- MBNL1 protein levels from group 1 were quantified in samples collected two weeks after the last administration. Results showed higher MBNL1 protein levels in the brain tested compared with samples from untreated animals (Table 18, Figure 12). The protein level in brain was 2- fold higher than the control group. The test item generated a pharmacology effect in the brain that led to an increase of MBNL protein when compare with untreated animals and the increase was still present two and three weeks after the administration. The results were similar in males and females. 4. Discussion and Conclusions
- results from the quantification by ELISA showed that two and three weeks after the last intravenous administration of MD23b-2 V2 3’OL, the treated groups (group 1 and 3) have quantifiable levels of MD23b -2 V2 3’OL in the brain.
- treated animals have higher MBNL1 protein levels in the brain compared with untreated animals two and three weeks after the last administration.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Public Health (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physical Education & Sports Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Neurology (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP23724333.2A EP4486891A1 (en) | 2022-05-23 | 2023-05-23 | Oligonucleotides conjugated to oleic acid and uses thereof |
| JP2024569113A JP2025522282A (ja) | 2022-05-23 | 2023-05-23 | オレイン酸にコンジュゲートしたオリゴヌクレオチド及びその使用 |
| CA3255781A CA3255781A1 (en) | 2022-05-23 | 2023-05-23 | Conjugated Oligonucleotides with Oleic Acid and Their Uses |
| CN202380056273.5A CN119816594A (zh) | 2022-05-23 | 2023-05-23 | 缀合油酸的寡核苷酸及其用途 |
| AU2023277730A AU2023277730A1 (en) | 2022-05-23 | 2023-05-23 | Oligonucleotides conjugated to oleic acid and uses thereof |
| IL317141A IL317141A (en) | 2022-05-23 | 2023-05-23 | Oleic acid-conjugated oligonucleotides and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP22382493.9 | 2022-05-23 | ||
| EP22382493.9A EP4282964A1 (en) | 2022-05-23 | 2022-05-23 | Oligonucleotides conjugated to oleic acid and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023227622A1 true WO2023227622A1 (en) | 2023-11-30 |
Family
ID=81941129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2023/063829 Ceased WO2023227622A1 (en) | 2022-05-23 | 2023-05-23 | Oligonucleotides conjugated to oleic acid and uses thereof |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US12116575B2 (https=) |
| EP (3) | EP4282964A1 (https=) |
| JP (2) | JP2025522282A (https=) |
| CN (1) | CN119816594A (https=) |
| AU (1) | AU2023277730A1 (https=) |
| CA (1) | CA3255781A1 (https=) |
| IL (1) | IL317141A (https=) |
| TW (1) | TW202411424A (https=) |
| WO (1) | WO2023227622A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4486891A1 (en) * | 2022-05-23 | 2025-01-08 | Universitat de València | Oligonucleotides conjugated to oleic acid and uses thereof |
| WO2025114442A1 (en) * | 2023-11-28 | 2025-06-05 | Arthex Biotech S.L. | Oligonucleotides conjugated to oleic acid and uses thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2530157A2 (en) * | 2003-07-31 | 2012-12-05 | Regulus Therapeutics, Inc | Oligomeric compounds and compositions for use in modulation of small non-coding rnas |
| WO2016011080A2 (en) * | 2014-07-14 | 2016-01-21 | The Regents Of The University Of California | Crispr/cas transcriptional modulation |
| WO2016201272A1 (en) * | 2015-06-12 | 2016-12-15 | King Abdulaziz City For Science And Technology | Method of diagnosing patients with conditions caused by mendelian mutations |
| WO2021133941A1 (en) * | 2019-12-23 | 2021-07-01 | University Of Massachusetts | Oligonucleotides for tissue specific gene expression modulation |
| US20220098581A1 (en) * | 2018-07-20 | 2022-03-31 | Regulus Therapeutics Inc. | Methods for Oral Delivery of Oligonucleotides |
| US20220133774A1 (en) * | 2016-09-19 | 2022-05-05 | Universitat De Valencia | Modulation of micrornas against myotonic dystrophy type 1 and antagonists of micrornas therefor |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104837996A (zh) * | 2012-11-15 | 2015-08-12 | 罗氏创新中心哥本哈根有限公司 | 抗apob反义缀合物化合物 |
| IL295755A (en) * | 2015-10-09 | 2022-10-01 | Wave Life Sciences Ltd | Oligonucleotide compositions and methods thereof |
| EP4282964A1 (en) * | 2022-05-23 | 2023-11-29 | Universitat de Valéncia | Oligonucleotides conjugated to oleic acid and uses thereof |
-
2022
- 2022-05-23 EP EP22382493.9A patent/EP4282964A1/en not_active Withdrawn
-
2023
- 2023-05-23 CA CA3255781A patent/CA3255781A1/en active Pending
- 2023-05-23 JP JP2024569113A patent/JP2025522282A/ja active Pending
- 2023-05-23 IL IL317141A patent/IL317141A/en unknown
- 2023-05-23 TW TW112119205A patent/TW202411424A/zh unknown
- 2023-05-23 JP JP2023084942A patent/JP7663873B2/ja active Active
- 2023-05-23 WO PCT/EP2023/063829 patent/WO2023227622A1/en not_active Ceased
- 2023-05-23 AU AU2023277730A patent/AU2023277730A1/en active Pending
- 2023-05-23 US US18/322,487 patent/US12116575B2/en active Active
- 2023-05-23 EP EP23724333.2A patent/EP4486891A1/en active Pending
- 2023-05-23 EP EP23174951.6A patent/EP4282966A1/en active Pending
- 2023-05-23 CN CN202380056273.5A patent/CN119816594A/zh active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2530157A2 (en) * | 2003-07-31 | 2012-12-05 | Regulus Therapeutics, Inc | Oligomeric compounds and compositions for use in modulation of small non-coding rnas |
| WO2016011080A2 (en) * | 2014-07-14 | 2016-01-21 | The Regents Of The University Of California | Crispr/cas transcriptional modulation |
| WO2016201272A1 (en) * | 2015-06-12 | 2016-12-15 | King Abdulaziz City For Science And Technology | Method of diagnosing patients with conditions caused by mendelian mutations |
| US20220133774A1 (en) * | 2016-09-19 | 2022-05-05 | Universitat De Valencia | Modulation of micrornas against myotonic dystrophy type 1 and antagonists of micrornas therefor |
| US20220098581A1 (en) * | 2018-07-20 | 2022-03-31 | Regulus Therapeutics Inc. | Methods for Oral Delivery of Oligonucleotides |
| WO2021133941A1 (en) * | 2019-12-23 | 2021-07-01 | University Of Massachusetts | Oligonucleotides for tissue specific gene expression modulation |
Non-Patent Citations (23)
| Title |
|---|
| "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds", DIS MODEL MECH, vol. 10, no. 4, pages 487 - 497 |
| AGRAWAL, SUDHIR ET AL.: "Novel enzymatic and immunological responses to oligonucleotides", TOXICOLOGY LETTERS, vol. 82, 1995, pages 431 - 434, XP000671488, DOI: 10.1016/0378-4274(95)03573-7 |
| ARANDEL L ET AL., DIS MODEL MECH, vol. 10, no. 4, 2017, pages 487 - 497 |
| ARANDEL L.: "Immortalized human myotonic dystrophy muscle cell lines to assess therapeutic compounds", DIS MODEL MECH, vol. 10, no. 4, 2017, pages 487 - 497, XP055637340, DOI: 10.1242/dmm.027367 |
| CERRO-HERREROS ESTEFANIA ET AL: "miR-23b and miR-218 silencing increase Muscleblind-like expression and alleviate myotonic dystrophy phenotypes in mammalian models", vol. 9, no. 1, 1 December 2018 (2018-12-01), XP055896179, Retrieved from the Internet <URL:https://www.nature.com/articles/s41467-018-04892-4.pdf> DOI: 10.1038/s41467-018-04892-4 * |
| CERRO-HERREROS ET AL., NAT. COMMUN., vol. 9, no. 1, 2018, pages 2482 |
| CERRO-HERREROS ET AL.: "miR-23b and miR-218 silencing increase Muscleblind-like expression and alleviate myotonic dystrophy phenotypes in mammalian models", NAT. COMMUN., vol. 9, 2018, pages 2482, XP055896179, DOI: 10.1038/s41467-018-04892-4 |
| CHOLESTEROL REGISTRATION DOSSIER ECHA, 4 April 2017 (2017-04-04), Retrieved from the Internet <URL:https://echa.europa.eu/es/registration-dossier/-/registered-dossier/11031/7/6/1#> |
| FDA RESPONSE LETTER TO THE HEALTH CLAIM PETITION CONCERNING OLEIC ACID, 19 November 2018 (2018-11-19), Retrieved from the Internet <URL:https://www.fda.gov/food/cfsan-constituent-updates/fda-completes-review-qualified-health-claim-petition-oleic-acid-and-risk-coronary-heart-disease> |
| HU ET AL.: "Therapeutic siRNA: state of the art", SIGNAL TRANSDUCTION AND TARGETED THERAPY, 2020 |
| JOSEPH J. SENN ET AL.: "Non-CpG-Containing Antisense 2'-Methoxyethyl Oligonucleotides Activate a Proinflammatory Response Independent of Toll-Like Receptor 9 or Myeloid Differentiation Factor 88", JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS, vol. 314, no. 3, 1 September 2005 (2005-09-01), pages 972 - 979, XP055092723, Retrieved from the Internet <URL:https://doi.org/10.1124/jpet.105.084004> DOI: 10.1124/jpet.105.084004 |
| KANADIA ET AL., PROC NATL ACAD SCI U S A, vol. 103, no. 31, 1 August 2006 (2006-08-01), pages 11748 - 53 |
| LEE: "Compound loss of muscleblind-like function in myotonic dystrophy", EMBO MOL MED, vol. 5, 2013, pages 1887 - 900 |
| MANKODI, A. ET AL.: "Myotonic dystrophy in transgenic mice expressing an expanded CUG repeat", SCIENCE, vol. 289, no. 5485, 2000, pages 1769 - 1773, XP002507412, DOI: 10.1126/science.289.5485.1769 |
| MARUYAMA T ET AL: "Directed aggregation and fusion of lipid vesicles induced by DNA-surfactants", COLLOIDS AND SURFACES B: BIOINTERFACES, ELSEVIER AMSTERDAM, NL, vol. 66, no. 1, 1 October 2008 (2008-10-01), pages 119 - 124, XP022939869, ISSN: 0927-7765, [retrieved on 20080604], DOI: 10.1016/J.COLSURFB.2008.05.017 * |
| MCKENZIE ET AL.: "Recent progress in non-native nucleic acid modifications", CHEM. SOC. REV., vol. 50, 2021, pages 5126 - 5164, XP093031161, DOI: 10.1039/D0CS01430C |
| RUMP E T ET AL: "PREPARATION OF CONJUGATES OF OLIGODEOXYNICLEOTIDES AND LIPID STRUCTURES AND THEIR INTERACTION WITH LOW-DENSITY LIPOPROTEIN", BIOCONJUGATE CHEMISTRY, AMERICAN CHEMICAL SOCIETY, US, vol. 9, no. 3, 1 May 1998 (1998-05-01), pages 341 - 349, XP000750902, ISSN: 1043-1802, DOI: 10.1021/BC970176Z * |
| S AGRAWAL ET AL.: "Mixed-backbone oligonucleotides as second generation antisense oligonucleotides: In vitro and in vivo studies", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 94, no. 6, March 1997 (1997-03-01), pages 2620 - 2625, XP002376373, DOI: 10.1073/pnas.94.6.2620 |
| See also references of EP4486891A1 |
| SMITHZAIN: "Therapeutic oligonucleotides: State of the Art", ANNUAL REVIEW OF PHARMACOLOGY AND TOXICOLOGY, 2019 |
| SOOYOUNG CHO ET AL.: "miRGator v3.0: a microRNA portal for deep sequencing, expression profiling and mRNA targeting", NUCLEIC ACIDS RESEARCH, vol. 41, 1 January 2013 (2013-01-01), pages D252 - D257, Retrieved from the Internet <URL:https://doi.org/10.1093/nar/gks1168> |
| UM SARMIENTO ET AL.: "In vivo toxicological effects of rel A antisense phosphorothioates in CD-1 mice", ANTISENSE RES DEV, vol. 4, no. 2, 1994, pages 99 - 107 |
| ZHANG ET AL.: "In vivo stability, disposition and metabolism of a ''hybrid'' oligonucleotide phosphorothioate in rats", BIOCHEMICAL PHARMACOLOGY, vol. 50, 1995, pages 545 - 556, XP000644798, ISSN: 0006-2952, Retrieved from the Internet <URL:https://doi.org/10.1016/0006-2952(95)00159-W> DOI: 10.1016/0006-2952(95)00159-W |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4486891A1 (en) * | 2022-05-23 | 2025-01-08 | Universitat de València | Oligonucleotides conjugated to oleic acid and uses thereof |
| WO2025114442A1 (en) * | 2023-11-28 | 2025-06-05 | Arthex Biotech S.L. | Oligonucleotides conjugated to oleic acid and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| IL317141A (en) | 2025-01-01 |
| EP4486891A1 (en) | 2025-01-08 |
| JP2025522282A (ja) | 2025-07-15 |
| TW202411424A (zh) | 2024-03-16 |
| US12116575B2 (en) | 2024-10-15 |
| JP2023172954A (ja) | 2023-12-06 |
| CA3255781A1 (en) | 2023-11-30 |
| US20230407305A1 (en) | 2023-12-21 |
| EP4282964A1 (en) | 2023-11-29 |
| JP7663873B2 (ja) | 2025-04-17 |
| EP4282966A1 (en) | 2023-11-29 |
| AU2023277730A1 (en) | 2025-01-02 |
| CN119816594A (zh) | 2025-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2862628C (en) | Rna modulating oligonucleotides with improved characteristics for the treatment of duchenne and becker muscular dystrophy | |
| CN109072238B (zh) | 使用靶向结缔组织生长因子的rna复合物治疗特发性肺纤维化 | |
| CN101980726A (zh) | 治疗与dna重复不稳定性相关的遗传病症的方法和装置 | |
| US20230348906A1 (en) | Dux4 inhibitors and methods of use thereof | |
| US12116575B2 (en) | Oligonucleotides conjugated to oleic acid and uses thereof | |
| US20170218376A1 (en) | TREATMENT OF ATOPIC DERMATITIS AND ASTHMA USING RNA COMPLEXES THAT TARGET IL4Ra, TRPA1, OR F2RL1 | |
| JP2019525918A (ja) | Smn2の調節のための化合物及び方法 | |
| WO2022031237A1 (en) | Modulation of signal transducer and activator of transcription 3 (stat3) expression | |
| TW201730341A (zh) | 抑制補體b因子之表現之反義寡核苷酸 | |
| JP2019527549A (ja) | 転写プロセシングの調節のための化合物及び方法 | |
| US20260124308A1 (en) | Oligonucleotides conjugated to oleic acid and uses thereof | |
| KR20200014320A (ko) | Apcs의 발현을 억제하는 핵산 | |
| WO2025114442A1 (en) | Oligonucleotides conjugated to oleic acid and uses thereof | |
| CN115698290A (zh) | 用于治疗神经系统疾病的补体组分4抑制剂以及使用它们的相关组合物、系统和方法 | |
| EP4149486A1 (en) | Complement component c1s inhibitors for treating a neurological disease, and related compositions, systems and methods of using same | |
| EP4046631A1 (en) | Msi2 as a therapeutic target for the treatment of myotonic dystrophy | |
| EP4446414A1 (en) | Antisense oligonucleotide complex | |
| HK40084486A (en) | Complement component c1s inhibitors for treating a neurological disease, and related compositions, systems and methods of using same | |
| WO2026078062A1 (en) | Antisense oligonucleotides targeting tert and uses thereof in the treatment of cancers | |
| CN115605592A (zh) | 用于治疗神经系统疾病的补体组分c1r抑制剂以及相关的组合物、系统和使用它们的方法 | |
| WO2023168202A2 (en) | Certain dux4 inhibitors and methods of use thereof | |
| HK40085370A (en) | Complement component 4 inhibitors for treating neurological diseases, and related compositons, systems and methods of using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23724333 Country of ref document: EP Kind code of ref document: A1 |
|
| DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2023724333 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2023724333 Country of ref document: EP Effective date: 20241002 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 317141 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024569113 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2023277730 Country of ref document: AU |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023277730 Country of ref document: AU Date of ref document: 20230523 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380056273.5 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 202380056273.5 Country of ref document: CN |