WO2023224327A1 - 오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법 - Google Patents

오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법 Download PDF

Info

Publication number
WO2023224327A1
WO2023224327A1 PCT/KR2023/006493 KR2023006493W WO2023224327A1 WO 2023224327 A1 WO2023224327 A1 WO 2023224327A1 KR 2023006493 W KR2023006493 W KR 2023006493W WO 2023224327 A1 WO2023224327 A1 WO 2023224327A1
Authority
WO
WIPO (PCT)
Prior art keywords
nls
cas protein
cas
protein
sequence
Prior art date
Application number
PCT/KR2023/006493
Other languages
English (en)
French (fr)
Inventor
김희식
이용재
김지원
최홍일
티 레트랑
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority claimed from KR1020230061795A external-priority patent/KR20230163295A/ko
Publication of WO2023224327A1 publication Critical patent/WO2023224327A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • This relates to a system and method for increasing the gene editing efficiency of microalgae using autolysin.
  • Algae are single-celled organisms that photosynthesize using carbon dioxide and water as raw materials. Because their cell division and growth cycles are much shorter than those of higher plants, they are useful high-value industrial materials such as anti-aging ingredients, health supplements, DHA, and cosmetic raw materials. It is a biological resource that can be used. Among them , Chlamydomonas reinhardtii has been the most studied as a model species in microalgae research, and its genome project has now been completed and is easily used for genetic manipulation and related genetic engineering research. In addition to academic research, various studies are underway for use in industrial fields.
  • CRISPR/Cas Since its first development in 2013, CRISPR/Cas has developed rapidly and is widely used for various species, including human cells, livestock, insects, plant cells such as rice and wheat, and pathogens.
  • This method uses the CRISPR immune system formed by bacteria to prevent invasion of foreign DNA using genetic scissors.
  • a base sequence fragment CRISPR part
  • the paired CRISPR system attaches to the target DNA base sequence and cuts it.
  • microalgae are known to have significantly lower transformation and gene editing efficiencies than other biological organisms such as yeast. According to recent academic reports (Doron et al., 2016, Zhang et al., 2019, Kang et al., 2020), gene editing of microalgae was conducted using ribonucleoprotein (RNP) obtained by hybridizing Cas9 protein and sgRNA. There are limited reports of successful cases, but it shows very low efficiency. Accordingly, research is needed to increase the gene editing efficiency of microalgae.
  • RNP ribonucleoprotein
  • One aspect includes treating algae with autolysin
  • the present invention provides a method for editing genes in birds, comprising the step of editing genes by introducing CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system) into the autolysin-treated algae.
  • CRISPR/Cas Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system
  • CRISPR/Cas system for gene editing in algae, comprising a Cas protein, a polynucleotide encoding it; Nuclear Localization Sequence (NLS) VirD2, VirE2 or SV40 linked to the Cas protein, or a polynucleotide encoding the same; and a target nucleic acid and a hybridization guide sequence or a polynucleotide encoding the same, wherein the algae are treated with autolysin.
  • NLS Nuclear Localization Sequence
  • One aspect includes treating algae with autolysin
  • CRISPR/Cas Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system
  • the algae may include microalgae. More specifically, the algae include Chlamydomonas reinhardtii , Anacystis nidulans , Ankistrodesmus sp., Biddulpha aurita , and Botryocco.
  • Botryococcus braunii Chaetoceros sp., Chlamydomonas applanata , Chlorella sp., Chlorella ellipsoidea , Chlorella emersonii , Chlorella Protothecoides, Chlorella pyrenoidosa, Chlorella sorokiniana , Chlorella vulgaris , Chlorella minutissima , Chlorococcu littorale , Cyclotella cryptica , Dunaliella bardawil , Dunaliella salina, Dunaliella tertiolecta , Dunaliella primolecta , Gymnodinum sp., Hymenomonas carterae , Isochrysis galbana , Isochrysis sp., Microcystis aeruginosa , Micromonas pusilla , Monodus subterraneous , Nanochloris sp
  • Gloeocapsa sp. Myxosarcina sp., Nostoc sp., Oscillatoria sp., Phormidium corium , Pleurocapsa ( Pleurocapsa sp.), Prochlorococcus sp., Pseudanabaena sp., Synechococcus sp., Synechocystis sp., Tolypothrix sp. And it may be any one selected from the group consisting of Xenococcus sp.
  • the autolysin may be obtained by mixing Chlamydomonas reinhardtii CC-620 and CC-621.
  • the step of increasing the cell wall permeability of algae may be further included.
  • the introduction of CRISPR/Cas includes a CRISPR protein or a polynucleotide encoding the same; and a guide polynucleotide comprising a guide sequence capable of hybridizing with a target nucleic acid; Alternatively, it may be introducing a polynucleotide encoding it.
  • the introduction of CRISPR/Cas may be the introduction of a Cas protein-RNA RNP (ribonucleoprotein) in which the Cas protein and guide RNA are pre-combined.
  • Cas protein-RNA RNP ribonucleoprotein
  • the CRISPR protein may be Cas9, Cas12, Cas13, or Cas14.
  • the CRISPR protein may be a wild-type Cas protein or an engineered Cas protein expressed by engineering by adding one or more nucleotide sequences to the nucleotide encoding the wild-type Cas protein.
  • the engineered and expressed Cas protein may further include a nuclear localization sequence (NLS) at the N or C terminus of the nucleotide encoding the Cas protein.
  • NLS nuclear localization sequence
  • the nuclear localization sequence may be derived from Agrobacterium.
  • the nuclear localization sequence may be VirD2, VirE2, or SV40.
  • the nuclear localization sequence may be any one selected from VirD2, VirE2, and SV40 linked to the N-terminus of the Cas protein.
  • the nuclear localization sequence may be any one selected from VirD2, VirE2, and SV40 linked to the C-terminus of the Cas protein.
  • a step of increasing the efficiency of nuclear localization of the wild-type Cas protein may be further included.
  • CRISPR/Cas system for gene editing in algae, comprising a Cas protein, a polynucleotide encoding it; Nuclear Localization Sequence (NLS) VirD2, VirE2 or SV40 linked to the Cas protein, or a polynucleotide encoding the same; and a hybridization guide sequence with a target nucleic acid or a polynucleotide encoding the same, wherein the algae is treated with autolysin.
  • NLS Nuclear Localization Sequence
  • the nuclear localization sequence may be any one selected from VirD2, VirE2, and SV40 linked to the N-terminus of the Cas protein.
  • the nuclear localization sequence may be any one selected from VirD2, VirE2, and SV40 linked to the C-terminus of the Cas protein.
  • Figure 1 is an image showing the occurrence of mating during mixed culture of Chlamydomonas reinhardtii strains according to one embodiment; Arrow: mating occurs
  • Figure 2 is an image confirming the extraction of autolysin according to one embodiment.
  • Figure 3 is an image showing the effect of increasing cell wall permeability of autolysin according to one embodiment.
  • Figure 4 is a graph showing the results of gene editing efficiency upon autolysin treatment according to one embodiment.
  • Figure 5 is a confocal microscope image of the nuclear localization effect of NLS fused to the N or C terminus of the fluorescent protein mCherry; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion DIC: Differential interference contrast channel.
  • Figure 6 is a schematic image showing a Cas 9 plasmid in which an NLS is fused to the N or C terminus of the Cas9 protein; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion.
  • Figure 7 is a graph showing the number of colonies generated through transformation according to the type of Cas9 protein after autolysin treatment according to one embodiment; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion.
  • One aspect includes treating algae with autolysin
  • CRISPR/Cas Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system
  • algae includes “algae” or “micro algae.” As used herein, the term “algae” refers to Chlamydomonas reinhardtii , Anacystis nidulans , Ankistrodesmus sp., Biddulpha aurita , and Botri.
  • Botryococcus braunii Chaetoceros sp., Chlamydomonas applanata , Chlorella sp., Chlorella ellipsoidea , Chlorella emersonii , Chlorella protothecoides, Chlorella pyrenoidosa , Chlorella sorokiniana , Chlorella vulgaris , Chlorella minutissima , Chlorococcu littorale ), Cyclotella cryptica , Dunaliella bardawil , Dunaliella salina, Dunaliella tertiolecta , Dunaliella primolecta , Gymnodinum sp., Hymenomonas carterae , Isochrysis galbana , Isochrysis sp., Microcystis aeruginosa , Micromonas pusilla , Monodus subterraneous , Nanochloris sp
  • Gloeocapsa sp. Myxosarcina sp., Nostoc sp., Oscillatoria sp., Phormidium corium , Pleuro Pleurocapsa sp., Prochlorococcus sp., Pseudanabaena sp., Synechococcus sp., Synechocystis sp., Tolypothrix sp. ) and Xenococcus ( Xenococcus sp.).
  • the autolysin is an enzyme that specifically decomposes the beta-1,4 glycosidic bond of peptidoglycan.
  • the autolysin is an endogenous lytic enzyme secreted during separation of daughter cells after cell division.
  • the autolysin may be obtained by mixing Chlamydomonas reinhardtii CC-620 and CC-621.
  • the introduction of CRISPR/Cas includes a CRISPR protein or a polynucleotide encoding the same; and a guide polynucleotide comprising a guide sequence capable of hybridizing with a target nucleic acid; Alternatively, it may be to introduce a polynucleotide encoding it.
  • CRISPR/Cas system or “CRISPR/Cas” used herein may refer to a gene editing system using a Cas protein (eg, Cas9) as an effector protein.
  • the system is a complex containing a nucleic acid degrading enzyme such as a gene editing protein or endonuclease and a nucleic acid targeting molecule corresponding to the nucleic acid degrading enzyme, and binds to the target nucleic acid or target gene to transform the target nucleic acid or gene. This refers to a complex that can cut or edit the target region.
  • the cleavage of the target region may be done by cutting the outer part of the target nucleic acid or 1 to 5 bp inside the 3' end of the target nucleic acid, thereby causing a double-strand break (DSB).
  • the system can be of various types depending on the gene editing protein and the nucleic acid targeting molecule, which is a guide RNA (gRNA) corresponding to the protein.
  • gRNA guide RNA
  • the function and efficiency of the gene editing protein may vary depending on the type of nucleic acid targeting molecule.
  • Gene editing proteins use nucleic acid targeting molecules to bind to a target nucleic acid or target gene and perform double-strand or single-strand cleavage or base correction of DNA at that site.
  • Genome editing technology using a gene editing system can introduce mutations into the genes of various organisms such as humans, animals, and plants, and through this, research to reveal the function of genes, production of transformants with new traits, and gene-related It is used as a treatment method for diseases.
  • the system does not require the creation of a customized protein to target a specific sequence, and a diverse repertoire of systems can be created by changing the spacer sequence, which is the target site binding sequence within the guide molecule.
  • the CRISPR/Cas system herein may be an engineered or non-naturally occurring system.
  • guide RNA generally refers to an RNA molecule (or collectively a group of RNA molecules) that can bind to a Cas protein and help target the Cas protein to a specific location within a target nucleic acid. can refer to.
  • the guide RNA may be any polynucleotide sequence that has sufficient complementarity with the target gene sequence to hybridize with all or part of the sequence of the target nucleic acid and induce sequence-specific binding of the CRISPR complex to the target sequence.
  • target nucleic acid refers to a target nucleic acid or a sequence present in a target gene, a sequence recognized by the guide RNA of the CRISPR/Cas system, or a target sequence modified by the CRISPR/Cas system.
  • the target nucleic acid refers to a sequence that is complementary to the guide sequence included in the guide RNA or a sequence that binds complementary to the guide sequence.
  • “Target strand” refers to the strand containing the target sequence. If the target nucleic acid or target gene is single stranded, that strand may be the target strand.
  • the target nucleic acid or target gene when the target nucleic acid or target gene is double stranded, one of the double strands may be the target strand, and a strand complementary to the target strand may exist.
  • the strand complementary to the target strand is referred to as the “non-target strand.”
  • the non-target strand includes a Protospacer Adjacent Motif (PAM) sequence and a protospacer sequence.
  • the PAM sequence is a sequence recognized by the Cas protein of the CRISPR/Cas system.
  • the protospacer sequence is a sequence located at the 5' end or 3' end of the PAM sequence.
  • the protospacer sequence is a sequence that is complementary to the target sequence or a sequence that binds complementary to the target sequence.
  • the correlation between the protospacer sequence and the target sequence is similar to the correlation between the target sequence and the guide sequence. Due to these characteristics, the guide sequence can generally be designed using a protospacer sequence. That is, when designing a guide sequence that binds complementary to the target sequence, the guide sequence can be designed as a nucleotide sequence having the same base sequence as the protospacer sequence. At this time, T in the nucleotide sequence of the protospacer sequence is replaced with U to design the guide sequence.
  • the guide sequence may be capable of hybridizing to a contiguous target sequence of 10 to 40 bp in length located adjacent to the 5' or 3' end of the PAM (proto-spacer-adjacent motif) sequence recognized by the Cas protein.
  • the target sequence may be a 10 to 40 nucleotide sequence.
  • the target sequence may be a 15 to 20, 15 to 25, 15 to 30, 15 to 35, or 15 to 40 nucleotide sequence.
  • the target sequence may be a 20 to 25, 20 to 30, 20 to 35 or 20 to 40 nucleotide sequence.
  • the target sequence may be a 25 to 30, 25 to 35 or 25 to 40 nucleotide sequence.
  • the target sequence may be a 30 to 35 or 30 to 40 nucleotide sequence.
  • the target sequence may be a 35 to 40 nucleotide sequence.
  • the target sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, It may be a sequence of 36, 37, 38, 39 or 40 nucleotides.
  • the guide sequence is at least 70% to 75%, at least 70% to 80%, at least 70% to 85%, at least 70% to 90%, at least 70% to 95%, at least 70% of the target sequence. % to 100%, at least 75% to 80%, at least 75% to 85%, at least 75% to 90%, at least 75% to 95%, or at least 75% to 100% complementary sequences. or the guide sequence is at least 80% to 85%, at least 80% to 90%, at least 80% to 95%, at least 80% to 100%, at least 85% to 90%, at least 85% to 95% of the target sequence. Or it may be a sequence that is at least 85% to 100% complementary.
  • the guide sequence may be a sequence that is at least 90% to 95%, at least 90% to 100%, or at least 95% to 100% complementary to the target sequence. or the guide sequence is at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, It may be 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% complementary sequence.
  • Cas protein used herein may be a wild type Cas protein that exists in nature.
  • the Cas protein may be a variant of the wild-type Cas protein, and the Cas variant may be a variant having the same function as the wild-type Cas protein, a variant with some or all of the functions modified, and/or a variant with additional functions added. .
  • the Cas protein can recognize the Protospacer Adjacent Motif (PAM) sequence present in the target nucleic acid or target gene.
  • PAM sequence is a unique sequence determined by the Cas protein.
  • PAM sequences for the Cas protein include T-rich sequences, AT-rich sequences, and G-rich sequences, such as 5'-TTTA-3', 5'-TTTG-3', 5'-TTTC-3', 5'-TTT-3', 5'-TTA-3', 5'-TTC-3', 5'-TTG-3', 5'-GGG-3', 5'-TGG-3', 5' -AGG-3', or 5'-CGG-3'.
  • base G may be required at the Protospacer Flaking Site (PFS) instead of the PAM sequence.
  • the Cas protein may be a Cas variant.
  • the Cas variant may be one in which at least one amino acid in the amino acid sequence of the wild-type Cas protein has been modified. At this time, the modification may be deletion and/or substitution. Alternatively, the Cas variant may have at least one amino acid sequence added to both ends and/or within the amino acid sequence of the wild-type Cas protein. At this time, the modification may be an insertion. At this time, the Cas variant is referred to as a “Cas mutant.”
  • the Cas mutant may be a variant having the same function as the wild-type Cas protein or a variant in which part or all of the function is modified.
  • the Cas mutation may be altered to cleave only one strand of the double strands of the target nucleic acid.
  • the Cas mutation may be modified to recognize a PAM sequence other than 5'-TTTA-3' or 5'-TTTG-3'.
  • the Cas variant may be a wild-type Cas protein or a Cas mutant in which a domain, peptide, or protein with an additional function is added.
  • the variant to which the domain, peptide or protein having the additional function is added is referred to as an “engineered and expressed Cas protein.”
  • the domains, peptides or proteins having the additional functions can be added within the N-terminus, C-terminus and/or amino acid sequence of the wild-type Cas protein or Cas mutant.
  • the domain, peptide, or protein having the additional function may be a domain, peptide, or protein having the same or different function as the wild-type Cas protein.
  • domains, peptides or proteins with the above additional functions include methylase activity, demethylase activity, transcription activation activity, transcription repression activity, and transcription release factor. It may be a domain, peptide, or protein with transcription release factor activity, histone modification activity, RNA cleavage activity, or nucleic acid binding activity, or separation and purification of proteins (including peptides). It may be a tag or reporter protein, but is not limited thereto. Alternatively, the domain, peptide or protein having the additional function may be a reverse transcriptase or deaminase.
  • the Cas variant may be a wild-type Cas protein, a Cas mutant, or an engineered Cas protein that selectively further contains a Nuclear Localization Sequence (NLS).
  • the NLS is a signal peptide for determining the position of the Cas protein within the cell, contains all meanings that can be recognized by a person skilled in the art, and can be appropriately interpreted depending on the context.
  • the NLS is the NLS of SV40 virus large T-antigen; NLS from nucleoplasmin; c-myc NLS; hRNPA1 M9 NLS; Alternatively, it may be an NLS sequence derived from Agrobacterium, but is not limited thereto.
  • the Cas variant may be a wild-type Cas protein, a Cas mutant, or an engineered Cas protein that optionally further contains a tag.
  • the tag is a functional domain, peptide, or protein for separation, purification, and/or tracking of Cas protein, and the tag includes a histidine (His) tag, V5 tag, FLAG tag, influenza hemagglutinin (HA) tag, Myc tag, Tag proteins such as VSV-G tag and thioredoxin (Trx) tag; Fluorescent proteins such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), blue fluorescent protein (BFP), HcRED, and DsRed; and reporters such as glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, and luciferase. Includes,
  • the engineered and expressed Cas protein may include one NLS at the N-terminus or/and C-terminus of the wild-type Cas protein, and six histidine (His) tags at the C-terminus.
  • the NLS may be one selected from VirD2, VirE2, and SV40.
  • the engineered and expressed Cas protein is a Cas protein with VirD2 NLS fused to the N terminus (DN), a Cas protein with VirD2 NLS fused to the C terminus (DC), and a VirE2 NLS fused to the N terminus (EN).
  • It may be a Cas protein, a Cas protein with a VirE2 NLS fused to the C terminus (EC), a Cas protein with an SV40 NLS fused to the N terminus (SN), or a Cas protein with an SV40 NLS fused to the C terminus (SC).
  • EC Cas protein
  • SN Cas protein with an SV40 NLS fused to the N terminus
  • SC Cas protein with an SV40 NLS fused to the C terminus
  • CRISPR/Cas involves introducing a vector containing DNA encoding the Cas protein and DNA encoding the guide RNA, or Cas protein-guide RNA RNP (ribonucleoprotein) in which the Cas protein and guide RNA are pre-assembled.
  • Cas protein-guide RNA RNP ribonucleoprotein
  • a person skilled in the art may select an appropriate introduction method according to technical knowledge known in the art, including, but not limited to, introducing Cas RNA and guide RNA.
  • the vector When introducing Cas protein and guide RNA into autolysin-pretreated algae using a plasmid vector, the vector is a chromosomal integration vector that can integrate an exogenous gene into the avian chromosome, or is used to temporarily express the exogenous gene. It may be a transient vector for transient expression that is induced (i.e., not integrated into the chromosome). More preferably, it may be a transient expression vector, and may be delivered to the cytoplasm of the algae by a conventional transformation method (e.g., gene gun, chemical delivery, injection, etc.).
  • a conventional transformation method e.g., gene gun, chemical delivery, injection, etc.
  • chromosomal integration does not occur through Agrobacterium-mediated transformation, and the vector size is smaller than that for chromosomal integration vectors, allowing for introduction into the cytoplasm and gene correction. It has the advantage of higher efficiency.
  • Introduction of the vector can be performed using suitable standard techniques as known in the art, for example, Agrobacterium-mediated transformation, gene gun, microinjection, electroporation. ), DEAE-dextran treatment, lipofection, nanoparticle-mediated transfection, protein transduction domain-mediated introduction, and PEG-mediated transfection.
  • electroporation can be used.
  • the Cas protein and guide RNA can correct genes by introducing a pre-assembled Cas protein guide RNA RNP (ribonucleoprotein).
  • RNP ribonucleoprotein
  • introducing RNP into protoplasts is characterized by directly introducing Cas protein and guide RNA into the cytoplasm without using an intracellular expression system such as a vector system.
  • Cas protein and guide RNA are introduced into the cytoplasm in the form of RNP using gene gun, microinjection, electroporation, DEAE-dextran treatment, lipofection, and nanoparticle-mediated transfection.
  • protein transfer domain-mediated introduction, and PEG-mediated transfection, etc. can be delivered to cells by various methods known in the art, but are not limited thereto.
  • Cas protein can be delivered into cells in the form of a complex with a guide RNA or in an independent form.
  • Chlamydomonas reinhardtii C. reinhardtii
  • Chlamydomonas reinhardtii C. reinhardtii
  • Autolysin is a cell wall dissolving substance produced during mating of microalgae and can be used to increase the efficiency of transformation.
  • centrifugation was performed at 4°C, 10,000 rpm for 20 minutes, and the supernatant was collected and filtered through a 0.45 ⁇ m syringe filter.
  • SDS-PAGE SDS-PAGE
  • Figure 1 is an image showing the occurrence of mating during mixed culture of Chlamydomonas reinhardtii strains according to one embodiment; Arrow: mating occurs
  • Figure 2 is an image confirming the extraction of autolysin according to one embodiment.
  • Chlamydomonas reinhardtii Chlamydomonas reinhardtii CC-124 strain was cultured in TAP liquid medium at 25°C, 120 rpm, 120 ⁇ mol m -2 s -1 for about 4 days.
  • the rapid growth phase Exponential growth phase
  • 250 ⁇ L of the culture medium was taken, spread on TAP solid medium, and then cultured again for 4 days under the same conditions.
  • 10mL TAP-N liquid medium was added to recover the cells, and then washed twice with TAP-N liquid medium. After resuspension by adding 7 mL of harvested autolysin, it was stirred slowly and treated for 1 hour under light conditions.
  • the control group that was not treated with autolysin was treated with the same amount of 7 mL of TAP-N medium, and the positive control group was treated with MAX EfficiencyTM Transformation Reagent for Algae (A24229), a commercial buffer from Invitrogen TM used to weaken cell walls in existing microalgae transformation. It was done as follows. Samples treated with autolysin and samples treated with TAP-N medium or commercial buffer MAX EfficiencyTM Transformation Reagent for Algae (A24229) were further divided into a group treated with Triton X-100 and a group not treated with Triton X-100. The Triton X-100 treatment group was mixed with 10 ⁇ L of 0.5% Triton X-100 solution. Referring to Figure 3, Triton When treated with dissolved cells, the shape of the cells disappears. The reaction to Triton
  • Figure 3 is an image showing the effect of increasing cell wall permeability of autolysin according to one embodiment.
  • Gene MAA7 is a gene encoding tryptophan ⁇ -synthase and plays an important role in the tryptophan biosynthetic pathway. If this gene is deleted, tryptophan (Trp), one of the essential amino acids, cannot be synthesized, leading to auxotrophy. Additionally, gene MAA7 has the activity of metabolizing 5-FI (5-fluoroindole) and converting it into a toxic substance called 5-Fluorotryptophan. Therefore, when KO (knock-out) of MAA7 is induced using genetic scissors and the cells are plated on solid medium containing both tryptophan and 5-FI, colonies with MAA7 KO (knock-out) are supplied with tryptophan.
  • 5-FI 5-fluoroindole
  • Gene MAA7 has been used several times as a model gene in gene editing studies of microalgae using these characteristics (Ma et al., 2013, Shin et al., 2016).
  • Example 2 the steps of culturing and treating the Chlamydomonas reinhardtii CC-124 strain with autolysin were performed in the same manner as in Example 2. Afterwards, it was stored at constant temperature for 30 minutes at 40°C to increase the gene editing efficiency by Cas9-RNP. The obtained sample was centrifuged at 20°C, 2,500 rpm for 5 minutes to separate cells, washed once with TAP + 2% sucrose solution, and then resuspended with the same solution to a concentration of 10 8 cells/110 ⁇ L. 110 ⁇ L of the sample obtained through this was taken and mixed with Cas9 RNP complex for electroporation (350 V, 25 ⁇ F and 600 ⁇ ).
  • the autolysin-untreated group was a negative control group, and 7 mL of TAP-N liquid medium was used instead of autolysin. After electroporation, store at 16°C for 1 hour, add 10 mL TAP + 2% sucrose, and recover for 24 hours at 25°C, 70 rpm, 20 ⁇ mol m -2 s -1 .
  • the Cas9 RNP complex was tested by mixing 7.5 ⁇ g of commercially available Cas9 and 10 ⁇ g of sgRNA (TCCAGCCACGGTCTGGCCTCCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC CGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU, ToolGen, Inc.) and storing it at 37°C for 30 minutes. Results Table 1 below and It is shown in Figure 4.
  • Figure 4 is a graph showing the results of gene editing efficiency upon autolysin treatment according to one embodiment.
  • Agrobacterium tumefaciens is a bacterium commonly used in the transformation of plant cells, and produces various proteins to effectively transfer foreign genes into the nucleus of the infected host.
  • VirD2 and VirE2 proteins are key proteins involved in this.
  • NLS nuclear localization sequence
  • the present invention is Agrobacterium tumefacien Two NLSs shown in VirD2 (AAACGACGTAATGACGAGGAGGCAGGTCCGCGGAGCAAACCGTAAAGGATTGAA, SEQ ID NO: 1) and VirE2 (AAACTAAGACCTGAAGACCGATACGTACAAACAGAGAGATACGGGGCCCG, SEQ ID NO: 2) derived from LBA4404 were obtained and used. Specifically, in order to compare the nuclear localization effect of NLS, mCherry fused with SV40 NLS (CCCAAGAAGAAGAGGAAGGT, SEQ ID NO.
  • Cas9 expression plasmids were created by fusing NLS from VirD2 and VirE2 and SV40 NLS to the N or C terminus of Cas9 protein, respectively.
  • the prepared plasmid was transformed into E. coli BL21(DE3) strain, cultured, and then purified with TALON resin using a poly histidine tag and used in the experiment.
  • the plasmid constructed so that each NLS was fused to both ends of the Cas 9 protein is shown in Figure 6.
  • Figure 5 is a confocal microscope image of the nuclear localization effect of NLS fused to the N or C terminus of the fluorescent protein mCherry; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion DIC: Differential interference contrast channel.
  • Figure 6 is a schematic image showing a Cas 9 plasmid in which an NLS is fused to the N or C terminus of the Cas9 protein.
  • Figure 7 is a graph showing the number of colonies generated through transformation according to the type of Cas9 protein after autolysin treatment according to one embodiment; DN: VirD2 NLS N-terminal fusion; DC: VirD2 NLS C-terminal fusion; EN: VirE2 NLS N-terminal fusion; EC: VirE2 NLS C-terminal fusion; SN: SV40 NLS N-terminal fusion; SC: SV40 NLS C-terminal fusion.
  • the above results show that when processing autolysin and using the Cas9 protein (DN-Cas9) in which VirD2 NLS is fused to the N terminus, the gene editing efficiency is compared to the general conditions of NLS (using Invitrogen TM commercial buffer, using Takara's commercial Cas9). It was confirmed that the gene editing efficiency was increased by up to 560 times by increasing from 0.20 ⁇ 10 -7 to 1.12 ⁇ 10 -5 .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법에 관한 것으로, 일 양상에 따른 오토라이신과 NLS가 도입된 Cas 단백질에 의하면, 유전자 교정 효율이 현저하게 개선되어 종국적으로 유전자 교정 조류 생산의 효율을 증대시킬 수 있다.

Description

오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법
오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법에 관한 것이다.
조류(algae)는 이산화탄소와 물을 원료로 광합성을 하는 단세포 생물로서 고등식물보다 세포분열 및 성장의 주기가 매우 짧기 때문에 항노화 성분, 건강보조식품, DHA, 화장품 원료 등의 유용한 고부가가치산업용 소재로 이용될 수 있는 생물자원이다. 그 중에서 클라미도모나스 레인하티(Chlamydomonas reinhardtii)는 미세조류 연구에서 모델종으로서 가장 많이 연구가 되어 왔으며, 현재 이의 게놈 프로젝트가 완성되어 유전자 조작 및 관련 유전 공학 연구에 용이하게 활용되고 있다. 학술적 연구뿐만 아니라 산업분야에서 활용하기 위한 다양한 연구가 진행 중이다.
크리스퍼 유전자 가위(CRISPR/Cas)는 2013년 처음 개발된 이래, 비약적으로 발전하여 인간세포는 물론, 가축, 곤충, 벼, 밀과 같은 식물세포, 병원균 등 다양한 종에 대하여 폭넓게 이용되고 있다. 이 방법은 박테리아가 외부 DNA의 침입을 막고자 형성한 크리스퍼 면역시스템을 유전자가위로 차용한 것이다. 즉, 특정 유전자의 염기서열을 찾아가는 염기서열 조각(크리스퍼 부분)을 제작해 Cas9 단백질과 짝을 이루게 하면, 짝을 이룬 크리스퍼 시스템은 표적이 되는 DNA 염기서열에 달라붙어 절단한다.
한편, 미세조류는 형질전환 및 유전자 교정 효율이 효모 등 다른 생물학적 유기물에 비해 현저히 낮은 것으로 알려져 있다. 최근 학계의 보고 (Doron et al., 2016, Zhang et al., 2019, Kang et al., 2020)에 의하면 Cas9 단백질과 sgRNA를 hybridization 하여 얻어지는 리보핵단백질(RNP)을 이용하여 미세조류의 유전자 교정에 성공한 사례는 제한적으로 보고되고 있으나 매우 낮은 효율을 보인다. 이에, 미세조류의 유전자 교정 효율을 증대하기 위한 연구가 필요한 실정이다.
일 양상은 조류(algae)에 오토라이신(autolysin)을 처리하는 단계;
상기 오토라이신이 처리된 조류에 CRISPR/Cas(Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system)를 도입하여 유전자를 편집하는 단계를 포함하는, 조류의 유전자를 편집하는 방법을 제공하는 것이다.
다른 양상은 조류(algae)의 유전자 교정을 위한 CRISPR/Cas 시스템으로서, Cas 단백질, 이를 암호화하는 폴리뉴클레오티드; 상기 Cas 단백질에 연결된 핵 위치화 서열(Nuclear Localization Sequence:NLS) VirD2, VirE2 또는 SV40, 또는 이를 암호화하는 폴리뉴클레오티드; 및 타켓 핵산과 혼성화 가이드서열 또는 이를 암호화하는 폴리뉴클레오티드를 포함하고, 상기 조류는 오토라이신(autolysin)으로 처리된 시스템을 제공하는 것이다.
일 양상은 조류(algae)에 오토라이신(autolysin)을 처리하는 단계;
상기 오토라이신이 처리된 조류에 CRISPR/Cas(Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system)를 도입하여 유전자를 편집하는 단계를 포함하는, 조류의 유전자를 편집하는 방법을 제공한다.
일 구체예에 있어서, 상기 조류는 미세조류(microalgae)를 포함할 수 있다. 더욱 상세하게는 상기 조류는 클라미도모나스 레인하티(chlamydomonas reinhardtii), 아나시스티스 니둘란스(Anacystis nidulans), 안키스트로데스무스(Ankistrodesmus sp.), 비둘파 아우리타(Biddulpha aurita), 보트리오코쿠스 브라우니(Botryococcus braunii), 키토세라스(Chaetoceros sp.), 클라미도모나스 아플란타(Chlamydomonas applanata), 클로렐라(Chlorella sp.), 클로렐라 엘립소이데아(Chlorella ellipsoidea), 클로렐라 에멀소니(Chlorella emersonii), 클로렐라 프로토세코이드(Chlorella protothecoides), 클로렐라 피레노이도사(Chlorella pyrenoidosa), 클로렐라 소로키니아나(Chlorella sorokiniana), 클로렐라 불가리스(Chlorella vulgaris), 클로렐라 미누티시마(Chlorella minutissima), 클로로코쿠 리토레일(Chlorococcu littorale), 시클로텔라 크립티카(Cyclotella cryptica), 두날리엘라 바르다윌(Dunaliella bardawil), 두날리엘라 살리나(Dunaliella salina), 두날리엘라 테르티오렉타(Dunaliella tertiolecta), 두날리엘라 프리모렉타(Dunaliella primolecta), 짐노디움(Gymnodinum sp.), 헤머노모나스 카테라에(Hymenomonas carterae), 이소크리시스 갈베나(Isochrysis galbana), 이소크리시스(Isochrysis sp.), 마이크로시스티스 아에루기노사(Microcystis aeruginosa), 마이크로모나스 푸실라(Micromonas pusilla), 모노두스 서브테라네우스(Monodus subterraneous), 나노클로리스(Nannochloris sp.), 나노클로롭시스(Nannochloropsis sp.), 나노클로롭시스 아토무스(Nannochloropsis atomus), 나노클로롭시스 살리나(Nannochloropsis salina), 나비쿨라 필리쿨로사(Navicula pelliculosa), 니츠시아(Nitzschia sp.), 니츠시아 클로스테리움(Nitzscia closterium), 니츠시아 팔레아(Nitzscia palea), 오시스티스 폴리모피아(Oocystis polymorpha), 아우로코커스(Ourococcus sp.), 오실라토리아 루베스켄스(Oscillatoria rubescens), 파브로바 루테리(Pavlova lutheri), 패오닥트리움 트리코누툼(Phaeodactylum tricornutum), 피크노코커스 프로바솔리(Pycnococcus provasolii), 피라미노나스 코르다타(Pyramimonas cordata), 스피눌라 플라텐시스(Spirulina platensis), 스테파노디스커스 미누투루스(Stephanodiscus minutulus), 스티코커스(Stichococcus sp.), 시네드라 우르나(Synedra ulna), 스케네데스무스 오브리쿼스(Scenedesmus obliquus), 스켈레나스트럼 그라시레(Selenastrum gracile), 스켈레토노마 코스타럼(Skeletonoma costalum), 테트라셀미스 추이(Tetraselmis chui), 테트라셀미스 마쿠라타(Tetraselmis maculata), 테트라셀미스(Tetraselmis sp.), 테트라셀미스 수에시카(Tetraselmis suecica), 탈라시오스트라 프세우도모나(Thalassiostra pseudomona), 아나배나(Anabaena sp.), 칼로드릭스(Calothrix sp.), 카마에시폰(Chaemisiphon sp.), 코로코시디옵시스(Chroococcidiopsis sp.), 차노데세(Cyanothece sp.), 실린더로스페멈(Cylindrospermum sp.), 데모카펠라(Dermocarpella sp.), 피셔렐라(Fischerella sp.), 글로에오캅사(Gloeocapsa sp.), 믹소사시나(Myxosarcina sp.), 노스톡(Nostoc sp.), 오스실라토리아(Oscillatoria sp.), 포르미디움 코리움(Phormidium corium), 플레우로캅사(Pleurocapsa sp.), 프로콜로코코스(Prochlorococcus sp.), 페세우다나바에나(Pseudanabaena sp.), 시네코코스(Synechococcus sp.), 시네코시스티스(Synechocystis sp.), 톨리포트릭스(Tolypothrix sp.) 및 제노코코스(Xenococcus sp.)로 이루어진 군으로부터 선택된 어느 하나인 것일 수 있다.
일 구체예에 있어서, 상기 오토라이신은 클라미도모나스 레인하티(Chlamydomonas reinhardtii) CC-620 및 CC-621을 혼합 배양하여 얻은 것일 수 있다.
일 구체예에 있어서, 조류의 세포벽 투과성을 높이는 단계를 더 포함하는 것일 수 있다.
일 구체예에 있어서, CRISPR/Cas의 도입은, CRISPR 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 타켓 핵산과 혼성화할 수 있는 가이드 서열을 포함한 가이드 폴리뉴클레오티드; 또는 이를 암호화하는 폴리뉴클레오티드를 도입하는 것일 수 있다.
일 구체예에 있어서, 상기 CRISPR/Cas의 도입은 Cas 단백질과 가이드 RNA가 미리 조합된 Cas 단백질-RNA RNP(ribonucleoprotein)를 도입하는 것일 수 있다.
일 구체예에 있어서, 상기 CRISPR 단백질은 Cas9, Cas12, Cas13, 또는 Cas14인 것일 수 있다.
일 구체예에 있어서, 상기 CRISPR 단백질은 야생형 Cas 단백질 또는 야생형 Cas 단백질을 암호화하는 뉴클레오티드에서 하나 이상의 뉴클레오티드 서열이 추가되어 엔지니어링 되어 발현된 Cas 단백질(engineered Cas protein)인 것일 수 있다.
일 구체예에 있어서, 상기 엔지니어링 되어 발현된 Cas 단백질은 Cas 단백질을 암호화하는 뉴클레오티드에서 N 또는 C 말단에 핵 위치화 서열(Nuclear Localization Sequence:NLS)을 더 포함하는 것일 수 있다.
일 구체예에 있어서, 상기 핵 위치화 서열(Nuclear Localization Sequence, NLS)은 아그로박테리움(Agrobacterium)에서 유래된 것일 수 있다.
일 구체예에 있어서, 상기 핵 위치화 서열(Nuclear Localization Sequence, NLS)은 VirD2, VirE2, 또는 SV40인 것일 수 있다.
일 구체예에 있어서, 상기 핵 위치화 서열(Nuclear Localization Sequence, NLS)은 Cas 단백질의 N-말단에 연결된 VirD2, VirE2 및 SV40 중 선택된 어느 하나인 것일 수 있다.
일 구체예에 있어서, 상기 핵위치화 서열(Nuclear Localization Sequence, NLS)은 Cas 단백질의 C-말단에 연결된 VirD2, VirE2 및 SV40 중 선택된 어느 하나일 수 있다.
일 구체예에 있어서, 야생형 Cas 단백질의 핵 위치화(nuclear localization)의 효율을 높이는 단계를 더 포함하는 것일 수 있다.
다른 양상은 조류(algae)의 유전자 교정을 위한 CRISPR/Cas 시스템으로서, Cas 단백질, 이를 암호화하는 폴리뉴클레오티드; 상기 Cas 단백질에 연결된 핵 위치화 서열(Nuclear Localization Sequence, NLS) VirD2, VirE2 또는 SV40, 또는 이를 암호화하는 폴리뉴클레오티드 ; 및 타켓 핵산과 혼성화 가이드서열 또는 이를 암호화하는 폴리뉴클레오티드를 포함하고, 상기 조류는 오토라이신(autolysin)으로 처리된 것인 시스템을 제공한다.
일 구체예에 있어서, 상기 핵 위치화 서열(Nuclear Localization Sequence, NLS)은 Cas 단백질의 N-말단에 연결된 VirD2, VirE2 및 SV40 중 선택된 어느 하나인 것일 수 있다.
일 구체예에 있어서, 상기 핵위치화 서열(Nuclear Localization Sequence, NLS)은 Cas 단백질의 C-말단에 연결된 VirD2, VirE2 및 SV40 중 선택된 어느 하나인 것일 수 있다.
일 양상에 따른 오토라이신과 NLS가 도입된 Cas 단백질에 의하면, 유전자 교정 효율이 현저하게 개선되어 종국적으로 유전자 교정 조류 생산의 효율을 증대시킬 수 있다.
도 1은 일 구체예에 따른 클라미도모나스 레인하티(Chlamydomonas reinhardtii) 균주의 혼합 배양시 mating의 발생을 나타낸 이미지이다; 화살표: mating 발생
도 2는 일 구체예에 따른 오토라이신의 추출을 확인한 이미지이다.
도 3은 일 구체예에 따른 오토라이신의 세포벽 투과성 증대 효과를 나타낸 이미지이다.
도 4는 일 실시예에 따른 오토라이신 처리시 유전자 교정 효율 결과를 나타낸 그래프이다.
도 5는 형광 단백질 mCherry의 N 또는 C 말단에 융합하여 NLS의 핵 위치화 효과를 공초점 현미경으로 촬영한 이미지이다; DN: VirD2 NLS N 말단 융합; DC: VirD2 NLS C 말단 융합; EN: VirE2 NLS N 말단 융합; EC: VirE2 NLS C 말단 융합; SN: SV40 NLS N 말단 융합; SC: SV40 NLS C 말단 융합 DIC: 미분간섭대비채널.
도 6은 Cas9 단백질의 N 또는 C 말단에 NLS를 융합한 Cas 9 플라스미드를 도식화하여 나타낸 이미지이다; DN: VirD2 NLS N 말단 융합; DC: VirD2 NLS C 말단 융합; EN: VirE2 NLS N 말단 융합; EC: VirE2 NLS C 말단 융합; SN: SV40 NLS N 말단 융합; SC: SV40 NLS C 말단 융합.
도 7은 일 실시예에 따른 오토라이신 처리 후, Cas9 단백질 종류에 따라 형질전환을 통해 생성된 콜로니의 수를 나타낸 그래프이다; DN: VirD2 NLS N 말단 융합; DC: VirD2 NLS C 말단 융합; EN: VirE2 NLS N 말단 융합; EC: VirE2 NLS C 말단 융합; SN: SV40 NLS N 말단 융합; SC: SV40 NLS C 말단 융합.
일 양상은 조류(algae)에 오토라이신(autolysin)을 처리하는 단계;
상기 오토라이신이 처리된 조류에 CRISPR/Cas(Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system)를 도입하여 유전자를 편집하는 단계를 포함하는, 조류의 유전자를 편집하는 방법을 제공한다.
본 명세서에서 "조류"는 "조류(algae)" 또는 "미세 조류(micro algae)"를 포함한다. 본 명세서에서 용어 "조류"는 클라미도모나스 레인하티(chlamydomonas reinhardtii), 아나시스티스 니둘란스(Anacystis nidulans), 안키스트로데스무스(Ankistrodesmus sp.), 비둘파 아우리타(Biddulpha aurita), 보트리오코쿠스 브라우니(Botryococcus braunii), 키토세라스(Chaetoceros sp.), 클라미도모나스 아플란타(Chlamydomonas applanata), 클로렐라(Chlorella sp.), 클로렐라 엘립소이데아(Chlorella ellipsoidea), 클로렐라 에멀소니(Chlorella emersonii), 클로렐라 프로토세코이드(Chlorella protothecoides), 클로렐라 피레노이도사(Chlorella pyrenoidosa), 클로렐라 소로키니아나(Chlorella sorokiniana), 클로렐라 불가리스(Chlorella vulgaris), 클로렐라 미누티시마(Chlorella minutissima), 클로로코쿠 리토레일(Chlorococcu littorale), 시클로텔라 크립티카(Cyclotella cryptica), 두날리엘라 바르다윌(Dunaliella bardawil), 두날리엘라 살리나(Dunaliella salina), 두날리엘라 테르티오렉타(Dunaliella tertiolecta), 두날리엘라 프리모렉타(Dunaliella primolecta), 짐노디움(Gymnodinum sp.), 헤머노모나스 카테라에(Hymenomonas carterae), 이소크리시스 갈베나(Isochrysis galbana), 이소크리시스(Isochrysis sp.), 마이크로시스티스 아에루기노사(Microcystis aeruginosa), 마이크로모나스 푸실라(Micromonas pusilla), 모노두스 서브테라네우스(Monodus subterraneous), 나노클로리스(Nannochloris sp.), 나노클로롭시스(Nannochloropsis sp.), 나노클로롭시스 아토무스(Nannochloropsis atomus), 나노클로롭시스 살리나(Nannochloropsis salina), 나비쿨라 필리쿨로사(Navicula pelliculosa), 니츠시아(Nitzschia sp.), 니츠시아 클로스테리움(Nitzscia closterium), 니츠시아 팔레아(Nitzscia palea), 오시스티스 폴리모피아(Oocystis polymorpha), 아우로코커스(Ourococcus sp.), 오실라토리아 루베스켄스(Oscillatoria rubescens), 파브로바 루테리(Pavlova lutheri), 패오닥트리움 트리코누툼(Phaeodactylum tricornutum), 피크노코커스 프로바솔리(Pycnococcus provasolii), 피라미노나스 코르다타(Pyramimonas cordata), 스피눌라 플라텐시스(Spirulina platensis), 스테파노디스커스 미누투루스(Stephanodiscus minutulus), 스티코커스(Stichococcus sp.), 시네드라 우르나(Synedra ulna), 스케네데스무스 오브리쿼스(Scenedesmus obliquus), 스켈레나스트럼 그라시레(Selenastrum gracile), 스켈레토노마 코스타럼(Skeletonoma costalum), 테트라셀미스 추이(Tetraselmis chui), 테트라셀미스 마쿠라타(Tetraselmis maculata), 테트라셀미스(Tetraselmis sp.), 테트라셀미스 수에시카(Tetraselmis suecica), 탈라시오스트라 프세우도모나(Thalassiostra pseudomona), 아나배나(Anabaena sp.), 칼로드릭스(Calothrix sp.), 카마에시폰(Chaemisiphon sp.), 코로코시디옵시스(Chroococcidiopsis sp.), 차노데세(Cyanothece sp.), 실린더로스페멈(Cylindrospermum sp.), 데모카펠라(Dermocarpella sp.), 피셔렐라(Fischerella sp.), 글로에오캅사(Gloeocapsa sp.), 믹소사시나(Myxosarcina sp.), 노스톡(Nostoc sp.), 오스실라토리아(Oscillatoria sp.), 포르미디움 코리움(Phormidium corium), 플레우로캅사(Pleurocapsa sp.), 프로콜로코코스(Prochlorococcus sp.), 페세우다나바에나(Pseudanabaena sp.), 시네코코스(Synechococcus sp.), 시네코시스티스(Synechocystis sp.), 톨리포트릭스(Tolypothrix sp.) 및 제노코코스(Xenococcus sp.)로 이루어진 군으로부터 선택된 어느 하나인 것일 수 있다.
상기 오토라이신(autolysin)은 펩티도글리칸(peptidoglycan)의 베타-1,4 글리코사이드 결합(β-1,4 glycosidic bond)을 특이적으로 분해하는 효소다.
상기 오토라이신(autolysin)은 세포 분열 후 딸 세포(daughter cells)의 분리시에 분비되는 내인성 용해효소다.
일 구체예에 있어서, 상기 오토라이신(autolysin)은 클라미도모나스 레인하티(Chlamydomonas reinhardtii) CC-620 및 CC-621을 혼합 배양하여 얻은 것일 수 있다.
일 구체예에 있어서, 상기 CRISPR/Cas의 도입은, CRISPR 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및 타켓 핵산과 혼성화할 수 있는 가이드 서열을 포함한 가이드 폴리뉴클레오티드; 또는 이를 암호화하는 폴리뉴클레오티드를 도입하는 것일 수 있다.
본 명세서에서 사용되는 용어 "CRISPR/Cas 시스템"또는 "CRISPR/Cas"는 Cas 단백질(예를 들면, Cas9)를 이펙터 단백질로 하는 유전자 편집 시스템을 의미할 수 있다. 상기 시스템은 유전자 편집 단백질 또는 엔도뉴클레아제(endonuclease) 등의 핵산분해 효소 및 상기 핵산분해 효소에 대응하는 핵산 타켓화 분자가 포함된 복합체로써, 타켓 핵산 또는 타켓 유전자에 결합하여 타켓 핵산 또는 유전자의 타켓 부위를 절단 또는 편집할 수 있는 복합체를 의미한다. 이 때, 상기 타켓 부위의 절단은 상기 타켓 핵산 바깥 부분 또는 타켓 핵산의 3' 말단의 1 내지 5 bp 안쪽을 절단하여 이중가닥 절단(Double-strand break, DSB)을 일으키는 것일 수 있다. 상기 시스템은 유전자 편집 단백질 및 상기 단백질에 대응하는 가이드 RNA(gRNA)인 핵산 타켓화 분자에 따라 다양한 종류가 가능하며, 핵산 타켓화 분자의 종류에 따라 상기 유전자 편집 단백질의 기능 및 효율은 달라질 수 있다. 유전자 편집 단백질은 핵산 타켓화 분자를 이용하여 타켓 핵산 또는 타켓 유전자에 결합하고, 그 부위에서 DNA 이중 가닥 또는 단일 가닥 절단이나 염기 교정 등을 수행한다. 유전자 편집 시스템을 이용하는 유전체 교정(genome editing) 기술은 인간이나 동식물 등 다양한 개체의 유전자에 변이를 도입할 수 있고, 이를 통해 유전자의 기능을 밝히는 연구, 새로운 형질을 가지는 형질전환체의 제조 및 유전자 관련 질병의 치료 방법으로 사용되고 있다. 상기 시스템은 특정 서열을 표적화하기 위해 맞춤형 단백질의 생성을 필요로 하지 않고, 가이드 분자 내의 표적 부위 결합 서열인 스페이서 서열의 변경을 통해서 다양한 레퍼토리의 시스템을 제작할 수 있다. 본 명세서에서 CRISPR/Cas 시스템은 엔지니어링된(engineered), 또는 비-천연 발생(non-naturally occurring)의 시스템일 수 있다.
본 명세서에서 용어 "가이드 RNA(guide RNA)"는, 일반적으로 Cas 단백질에 결합할 수 있고 Cas 단백질을 타켓 핵산 내의 특정 위치에 표적화하는 것을 도울 수 있는 RNA 분자(또는 집합적으로 RNA 분자들의 그룹)를 지칭할 수 있다. 가이드 RNA는 타켓 핵산의 서열의 전부 또는 일부와 혼성화하고, 타켓 서열로의 CRISPR 복합체의 서열-특이적 결합을 유도하기에 충분한, 타켓 유전자 서열과의 상보성을 갖는 임의의 폴리뉴클레오티드 서열일 수 있다.
본 명세서에서 용어 “타켓 핵산"은 타켓 핵산 또는 타켓 유전자 내에 존재하는 서열로, CRISPR/Cas 시스템의 가이드 RNA에 의해 인식되는 서열 또는 CRISPR/Cas 시스템에 의해 변형되는 대상 서열을 의미한다. 구체적으로, 상기 타켓 핵산은 가이드 RNA에 포함된 가이드 서열에 상보성을 가지는 서열 또는 가이드 서열과 상보적으로 결합하는 서열을 의미한다. “표적 가닥(target strand)"는 타켓 서열을 포함하는 가닥을 의미한다. 타켓 핵산 또는 타켓 유전자가 단일 가닥인 경우, 해당 가닥은 표적 가닥일 수 있다. 또는 타켓 핵산 또는 타켓 유전자가 이중 가닥인 경우, 상기 이중 가닥 중 하나는 표적 가닥일 수 있으며, 상기 표적 가닥에 상보적인 가닥이 존재할 수 있다. 이때, 상기 표적 가닥에 상보적인 가닥은 "비표적 가닥(non-target strand)"로 지칭된다. 비표적 가닥(non-target strand)은 PAM(Protospacer Adjacent Motif) 서열 및 프로토스페이서(protospacer) 서열을 포함한다. 상기 PAM 서열은 CRISPR/Cas 시스템의 Cas 단백질이 인식하는 서열이다. 상기 프로토스페이서 서열은 PAM 서열의 5' 말단 또는 3' 말단에 위치하는 서열로, 상기 프로토스페이서 서열은 표적 서열에 상보성을 가지는 서열 또는 표적 서열과 상보적인 결합을 하는 서열이다. 프로토스페이서 서열과 표적 서열 간의 상관관계는 표적 서열과 가이드 서열 간의 상관관계와 유사하다. 이러한 특징에 의해, 일반적으로 가이드 서열 설계시 프로토스페이서 서열을 이용하여 설계할 수 있다. 즉, 표적 서열에 상보적으로 결합하는 가이드 서열을 설계시, 가이드 서열은 프로토스페이서 서열과 동일한 염기서열을 가지는 뉴클레오타이드 서열로 설계할 수 있다. 이때, 프로토스페이서 서열의 염기서열 중 T는 U로 대체하여 가이드 서열을 설계한다.
상기 가이드 서열은 Cas 단백질이 인식하는 PAM(proto-spacer-adjacent Motif) 서열의 5' 말단 또는 3' 말단에 인접하여 위치하는 연속하는 10bp 내지 40bp 길이의 표적 서열에 혼성화 가능한 것일 수 있다.
상기 표적 서열은 10 내지 40개의 뉴클레오타이드 서열일 수 있다. 일 예로, 상기 표적 서열은 15 내지 20개, 15 내지 25개, 15 내지 30개, 15 내지 35개 또는 15 내지 40개의 뉴클레오타이드 서열일 수 있다. 또는 상기 표적 서열은 20 내지 25개, 20 내지 30개, 20 내지 35개 또는 20 내지 40개의 뉴클레오타이드 서열일 수 있다. 또는 상기 표적 서열은 25 내지 30개, 25 내지 35개 또는 25 내지 40개의 뉴클레오타이드 서열일 수 있다. 또는 상기 표적 서열은 30 내지 35개 또는 30 내지 40개의 뉴클레오타이드 서열일 수 있다. 또는 상기 표적 서열은 35 내지 40개의 뉴클레오타이드 서열일 수 있다. 다른 일 예로, 상기 표적 서열은 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 또는 40개의 뉴클레오타이드 서열일 수 있다.
일 구현예로서, 상기 가이드 서열은 표적 서열에 대해 적어도 70% 내지 75%, 적어도 70% 내지 80%, 적어도 70% 내지 85%, 적어도 70% 내지 90%, 적어도 70% 내지 95%, 적어도 70% 내지 100%, 적어도 75% 내지 80%, 적어도 75% 내지 85%, 적어도 75% 내지 90%, 적어도 75% 내지 95% 또는 적어도 75% 내지 100% 상보적인 서열일 수 있다. 또는 상기 가이드 서열은 표적 서열에 대해 적어도 80% 내지 85%, 적어도 80% 내지 90%, 적어도 80% 내지 95%, 적어도 80% 내지 100%, 적어도 85% 내지 90%, 적어도 85% 내지 95% 또는 적어도 85% 내지 100% 상보적인 서열일 수 있다. 또는 상기 가이드 서열은 표적 서열에 대해 적어도 90% 내지 95%, 적어도 90% 내지 100% 또는 적어도 95% 내지 100% 상보적인 서열일 수 있다. 또는 상기 가이드 서열은 표적 서열에 대해 적어도 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 또는 100% 상보적인 서열일 수 있다.
본 명세서에서 사용되는 용어 "Cas 단백질"은 자연계에 존재하는 야생형(wildtype) Cas 단백질일 수 있다. 또는, Cas 단백질은 야생형 Cas 단백질의 변이체(variant)일 수 있으며, Cas 변이체는 야생형 Cas 단백질과 동일한 기능을 가지는 변이체, 기능 일부 또는 전부가 변형된 변이체 및/또는 추가적인 기능이 부가된 변이체일 수 있다.
상기 Cas 단백질은 타켓 핵산 또는 타켓 유전자 내에 존재하는 Protospacer Adjacent Motif(PAM) 서열을 인식할 수 있다. 이때, PAM 서열은 상기 Cas 단백질에 따라 정해지는 고유한 서열이다. 상기 Cas 단백질을 위한 PAM 서열은 T-rich 서열, AT-rich 서열, G-rich 서열, 예를 들면 5'-TTTA-3', 5'-TTTG-3', 5'-TTTC-3', 5'-TTT-3', 5'-TTA-3', 5'-TTC-3', 5'-TTG-3', 5'-GGG-3', 5'-TGG-3', 5'-AGG-3', 또는 5'-CGG-3'일 수 있다. 또는 PAM 서열 대신 PFS(Protospacer Flaking Site)에 염기 G이 필요할 수 있다.
상기 Cas 단백질은 Cas 변이체일 수 있다. 상기 Cas 변이체는 야생형 Cas 단백질의 아미노산 서열 중 적어도 하나 이상의 아미노산이 변형된 것일 수 있다. 이때, 상기 변형은 결실(deletion) 및/또는 치환(substitution)일 수 있다. 또는 상기 Cas 변이체는 야생형 Cas 단백질의 아미노산 서열의 양 말단 및 또는 서열 내에 적어도 하나 이상의 아미노산 서열이 추가된 것일 수 있다. 이때, 상기 변형은 삽입(insertion)일 수 있다. 이때, 상기 Cas 변이체는 "Cas 돌연변이(Cas mutant)"로 지칭한다.
상기 Cas 돌연변이는 야생형 Cas 단백질과 동일한 기능을 가지는 변이체 또는 기능 일부 또는 전부가 변형된 변이체일 수 있다. 예를 들어, 상기 Cas 돌연변이는 표적 핵산의 이중 가닥 중 하나의 가닥만 절단하도록 변경된 것일 수 있다. 또는 상기 Cas 돌연변이는 5'-TTTA-3' 또는 5'-TTTG-3'이 아닌 다른 PAM 서열을 인식하도록 변형된 것일 수 있다.
상기 Cas 변이체는 야생형 Cas 단백질 또는 Cas 돌연변이에 추가적인 기능을 가지는 도메인, 펩타이드 또는 단백질이 부가된 변이체일 수 있다. 이때, 상기 추가적인 기능을 가지는 도메인, 펩타이드 또는 단백질이 부가된 변이체는 "엔지니어링 되어 발현된 Cas 단백질"로 지칭된다. 상기 추가적인 기능을 가지는 도메인, 펩타이드 또는 단백질은 야생형 Cas 단백질 또는 Cas 돌연변이의 N 말단, C 말단 및/또는 아미노산 서열 내에 부가될 수 있다. 상기 추가적인 기능을 가지는 도메인, 펩타이드 또는 단백질은 야생형 Cas 단백질과 동일하거나 다른 기능을 가지는 도메인, 펩타이드 또는 단백질일 수 있다. 예를 들어, 상기 추가적인 기능을 가지는 도메인, 펩타이드 또는 단백질은 메틸라아제(methylase) 활성, 디메틸라아제(demethylase) 활성, 전사촉진(transcription activation) 활성, 전사 저해(transcription repression) 활성, 전사 방출 인자(transcription release factor) 활성, 히스톤 변형(histone modification) 활성, RNA 절단(cleavage) 활성 또는 핵산 결합(nucleic acid binding) 활성을 가지는 도메인, 펩타이드 또는 단백질 일 수 있으며, 또는 단백질(펩타이드 포함)의 분리정제를 위한 태그(tag) 또는 리포터 단백질일 수 있으나, 이에 제한되지 않는다. 또는, 상기 추가적인 기능을 가지는 도메인, 펩타이드 또는 단백질은 역전사 효소(reverse transcriptase) 또는 디아미네이즈(deaminase)일 수 있다.
상기 Cas 변이체는 야생형 Cas 단백질, Cas 돌연변이 또는 엔지니어링 되어 발현된 Cas 단백질에 선택적으로 NLS(Nuclear Localization Sequence)가 더 포함된 것일 수 있다. 상기 NLS는 세포 내에서 Cas 단백질의 위치 결정을 위한 시그널 펩타이드로, 통상의 기술자가 인식할 수 있는 의미를 모두 포함하며, 문맥에 따라 적절하게 해석될 수 있다. 예를 들어, 상기 NLS는 SV40 바이러스 대형 T-항원의 NLS; 뉴클레오플라스민(nucleoplasmin)으로부터의 NLS; c-myc NLS; hRNPA1 M9 NLS; 또는 아그로박테리움(Agrobacterium)에서 유래된 NLS 서열일 수 있으나, 이에 제한되지 않는다.
또한, 상기 Cas 변이체는 야생형 Cas 단백질, Cas 돌연변이 또는 엔지니어링 되어 발현된 Cas 단백질에 선택적으로 태그가 더 포함된 것일 수 있다. 상기 태그는 Cas 단백질의 분리 정제 및/또는 추적을 위한 기능적 도메인, 펩타이드 또는 단백질로, 상기 태그는 히스티딘(His) 태그, V5 태그, FLAG 태그, 인플루엔자 헤마글루티닌(HA) 태그, Myc 태그, VSV-G 태그 및 티오레독신(Trx) 태그 등의 태그 단백질; 녹색 형광 단백질(GFP), 황색 형광 단백질(YFP), 청록색 형광 단백질(CFP), 청색 형광 단백질(BFP), HcRED, DsRed 등의 형광 단백질; 및 글루타티온-S-트랜스퍼라제(GST), 호스라디시(horseradish) 과산화효소(HRP), 클로람페니콜아세틸트랜스퍼라제(CAT) 베타-갈락토시다제, 베타-글루쿠로니다제, 루시퍼라제 등의 리포터 단백질(효소)를 포함하나, 이에 제한되는 것은 아니다.
일 구체예에 있어서, 상기 엔지니어링 되어 발현된 Cas 단백질은 야생형 Cas 단백질의 N 말단 또는/및 C말단에 1개의 NLS를 포함하고, C말단에 6개의 히스티딘(His)태그를 포함하는 것일 수 있다. 이 때, 구체적으로 NLS는 VirD2, VirE2, 및 SV40 중 선택된 어느 하나 일 수 있다. 구체적으로, 상기 엔지니어링 되어 발현된 Cas 단백질은 VirD2 NLS가 N 말단에 융합(DN)된 Cas 단백질, VirD2 NLS가 C 말단에 융합(DC)된 Cas 단백질, VirE2 NLS가 N 말단에 융합(EN)된 Cas 단백질, VirE2 NLS가 C 말단에 융합(EC)된 Cas 단백질, SV40 NLS가 N 말단에 융합된(SN) Cas 단백질, 또는 SV40 NLS가 C 말단에 융합된(SC) Cas 단백질일 수 있다.
구체적으로, CRISPR/Cas의 도입은, Cas 단백질을 코딩하는 DNA 및 가이드 RNA를 코딩하는 DNA를 포함하는 벡터를 도입하거나, Cas 단백질과 가이드 RNA가 미리 조립된 Cas 단백질-가이드 RNA RNP(ribonucleoprotein)를 도입하거나, Cas RNA 및 가이드 RNA를 도입하는 것을 포함하나, 이에 제한되지 않고 당업계에 공지된 기술상식에 따라 당업자가 적절한 도입 수단을 선택할 수 있다.
오토라이신 전처리된 조류에 Cas 단백질 및 가이드 RNA를 플라스미드 벡터를 이용하여 도입하는 경우, 상기 벡터는 외인성 유전자를 조류 염색체에 통합시킬 수 있는 염색체 통합용 벡터(integration vector)이거나, 외인성 유전자의 일시적 발현을 유도하는(즉, 염색체에 통합되지 않음) 일시적 발현용 벡터(transient vector)일 수 있다. 좀더 바람직하게는 일시적 발현용 벡터(transient vector)일 수 있으며, 통상적인 형질전환 방식으로(예, 유전자총, 화학적 전달, 주입 등) 조류의 세포질에 전달될 수 있다. 일시적 발현용 벡터의 경우 염색체 통합에 필요한 구성요소들이 빠져 있으므로 아그로박테리움-매개 형질전환을 통해 염색체 통합이 되지 않으며, 염색체 통합용 벡터에 비해 벡터의 크기가 더 작기 때문에 세포질로의 도입 및 유전자 교정 효율이 보다 높아지는 장점이 있다.
상기 벡터의 도입은 당 분야에서 공지된 바와 같이 적합한 표준 기술을 이용하여 수행할 수 있고, 예를 들어, 아그로박테리움-매개 형질전환법, 유전자총, 미세주입법(microinjection), 전기천공법(electroporation), DEAE-덱스트란 처리, 리포펙션(lipofection), 나노파티클-매개 형질주입, 단백질 전달 도메인 매개 도입, 및 PEG-매개 형질주입 등을 예시할 수 있다. 바람직하게는, 전기천공법(electroporation)을 이용할 수 있다.
한편, 본원에서 제공하는 식물의 유전자 교정 방법에서, Cas 단백질과 가이드 RNA는 미리 조립된 Cas 단백질가이드 RNA RNP(ribonucleoprotein)를 도입하여 유전자를 교정할 수 있다. 이와 같이 RNP를 원형질체에 도입하는 것은, 벡터 시스템과 같은 세포 내 발현 시스템을 이용하지 않고, Cas 단백질 및 가이드 RNA를 직접 세포질에 도입하는 것을 특징으로 한다.
여기에서, Cas 단백질 및 가이드 RNA를 RNP 형태로 세포질에 도입하는 것은 유전자총, 미세주입법(microinjection), 전기천공법(electroporation), DEAE-덱스트란 처리, 리포펙션(lipofection), 나노파티클매개 형질주입, 단백질 전달 도메인 매개 도입, 및 PEG-매개 형질주입 등과 같은 당업계의 다양한 방법에 의해 세포로 전달될 수 있지만, 이에 제한되는 것은 아니다. Cas 단백질은 가이드 RNA와의 복합체의 형태 또는 독립된 형태로 세포 안으로 전달될 수 있다.
또한 본원의 오토라이신을 활용한 미세조류의 유전자 교정 효율 증대 방법에 관한 기술은 일반적인 CRISPR/Cas뿐만 아니라, 이를 변형한 다양한 형태의 CRISPR/Cas에도 적용될 수 있다. 예를 들어, Base Editor (BE 또는 염기교정 유전자가위)는 기존 CRISPR/Cas9의 가이드 RNA를 이용한 시스템은 그대로 이용하면서, DNA의 한 쪽 가닥을 자르는 nCas9 (nickase Cas9) 및 탈 아미노효소(deaminase)를 포함하여, 유전자 삽입/결실(insertion/deletion, indel)을 유도하는 기존 CRISPR/Cas9 시스템과는 달리 단일 염기 치환만이 가능한 특징이 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. 오토라이신(Autolysin)의 합성
오토라이신(Autolysin)을 합성하기 위해 클라미도모나스 레인하티(C. reinhardtii) CC-620 및 CC-621 균주의 혼합배양을 수행하였다. 클라미도모나스 레인하티(C. reinhardtii) CC-620, CC-621 균주를 각각 250 mL 플라스크에서 5시간 동안 배양(25℃, 70 rpm, TAP-N 배지, working volume=20 mL)한 후, 혼합하여 1시간 동안 동일 조건에서 추가 배양하였다. 도 1을 참고하여 설명하면, CC-620 및 CC-621 두 균주를 혼합 배양 시 mating이 일어나는 것을 확인하였다. 오토라이신(autolysin)은 미세조류가 mating 하면서 생산되는 세포벽 용해물질로서 형질전환의 효율 증대에 활용될 수 있다. 혼합 배양 종료 후 오토라이신을 수확하기 위하여 4℃, 10,000 rpm, 20 분간 원심분리하여 상등액을 취하여 0.45μm syringe filter로 여과하였다. 수확된 용액을 SDS-PAGE를 통해 분석한 결과 정상적으로 오토라이신(Autolysin)이 생산된 것을 확인하였고, 그 결과는 도 2에 나타내었다.
도 1은 일 구체예에 따른 클라미도모나스 레인하티(Chlamydomonas reinhardtii) 균주의 혼합 배양시 mating의 발생을 나타낸 이미지이다; 화살표: mating 발생
도 2는 일 구체예에 따른 오토라이신의 추출을 확인한 이미지이다.
실시예 2. 오토라이신(Autolysin)의 세포벽 투과성 증대 효과 확인
오토라이신(Autolysin)의 미세조류 세포벽 투과성 증대 효과를 확인하기 위해 하기의 실험을 수행하였다.
클라미도모나스 레인하티(Chlamydomonas reinhardtii) CC-124 균주를 TAP 액체 배지에서 25℃, 120 rpm, 120μmol m-2 s-1 조건에서 약 4일간 배양하였다. 일 구체예에 따른 균주가 급속생장기(Exponential growth phase)에 도달하였을 때, 250μL의 배양액을 취하여 TAP 고체 배지에 도말한 후 다시 동일한 조건에서 4일간 정치 배양하였다. 이 후, 10mL TAP-N 액체 배지를 가하여 세포를 회수한 후 TAP-N 액체 배지로 2번 세척하였다. 수확한 오토라이신 7mL을 가하여 resuspension 한 후 천천히 교반하며 광조건 하에서 1시간 동안 처리하였다. 오토라이신을 처리하지 않은 대조군은 동일한 양 7mL의 TAP-N 배지를 처리하였고, 기존의 미세조류 형질전환에서 세포벽 약화를 위해 사용하는 InvitrogenTM사 상용 버퍼 MAX EfficiencyTM Transformation Reagent for Algae(A24229)를 양성대조군으로 하였다. 각각 오토라이신을 처리한 시료와 TAP-N배지 또는 상용 버퍼 MAX EfficiencyTM Transformation Reagent for Algae(A24229)를 처리한 시료는 다시 Triton X-100 처리한 군과 Triton X-100을 처리하지 않은 군으로 나누었다. Triton X-100 처리군은 0.5% Triton X-100용액을 10μL 혼합하였다. 도 3을 참조하여 설명하면, Triton X-100은 세포막에 존재하는 인지질 이중막 구조를 용해시키는 계면활성제로써, 세포벽이 있는 세포에 처리할 경우 세포의 형태를 변형시키지 못하지만, 오토라이신에 의해 세포벽이 용해된 세포에 처리할 경우 세포의 형태가 사라지게 된다. 각각 TAP-N배지, 상용 버퍼 MAX EfficiencyTM Transformation Reagent for Algae(A24229), 또는 오토라이신을 처리한 각 군에 대한 Triton X-100에 대한 반응을 현미경으로 관찰하였고, 그 결과를 도 3에 나타내었다.
도 3은 일 구체예에 따른 오토라이신의 세포벽 투과성 증대 효과를 나타낸 이미지이다.
도 3에 나타낸 바와 같이, 배지 또는 상용 버퍼가 처리된 군과 비교하여, 오토라이신과 Triton X-100을 모두 처리한 실험군에서 대부분의 세포의 형태가 사라진 것을 관찰하였고, 이는 오토라이신에 의해 세포벽의 투과성이 증대되는 것을 확인하였다.
실험예 1. 오토라이신(Autolysin)처리에 의한 유전자 교정 효율 증대 확인
유전자 교정 효율을 측정하기 위해 클라미도모나스 레인하티(C. reinhardtii)의 타켓 유전자는 MAA7로 하였다.
유전자 MAA7는 tryptophan β-synthase를 암호화하는 유전자로 트립토판 생합성 경로에서 중요한 역할을 하고, 이 유전자가 결실되면 필수아미노산 중 하나인 트립토판(Trp)을 합성하지 못하게 되어 auxotrophy가 유도된다. 또한, 유전자 MAA7은 5-FI (5-fluoroindole)를 대사하여 5-Fluorotryptophan이라는 독성 물질로 전환시키는 활성이 있다. 따라서, 유전자가위를 이용하여 MAA7의 KO(knock-out)을 유도한 후 트립토판과 5-FI가 동시에 포함된 고체배지에 세포를 도말하면 MAA7이 KO(knock-out)된 콜로니는 트립토판의 공급에 의해 생존하게 되며, 그렇지 않은 콜로니는 5-FI의 대사에 따른 세포 독성으로 인해 사멸한다. 유전자 MAA7은 이러한 특성을 이용하여 미세조류의 유전자 교정 연구에서 모델 유전자로 여러 차례 활용된 바 있다(Ma et al., 2013, Shin et al., 2016).
먼저, 클라미도모나스 레인하티(C. reinhardtii)CC-124 균주의 배양 및 오토라이신을 처리하는 단계는 상기 실시예2.와 동일한 방법으로 처리하였다. 그 후, Cas9-RNP에 의한 유전자 교정 효율을 증대시키기 위하여 40℃에서 30분간 항온 보관하였다. 상기 얻은 시료를 20℃, 2,500 rpm, 5 분간 원심분리하여 세포를 분리하였으며, TAP + 2% sucrose 용액으로 1번 세척 후 동일 용액으로 108 cells/110 μL의 농도가 되도록 resuspension 하였다. 이를 통해 얻은 시료를 110μL 취한 후 Cas9 RNP complex와 혼합하여 전기천공(electroporation) 하였다(350 V, 25μF and 600 Ω). 오토라이신 비처리군은 음성대조군으로 오토라이신을 대신하여 7mL의 TAP-N 액체 배지를 대신 사용하였다. 전기천공(electroporation) 이후 16℃, 1시간 항온 보관한 이후 10 mL TAP + 2% sucrose 첨가하여, 24시간 25℃, 70 rpm, 20 μmol m-2 s-1에서 회복기(recovery)를 가진 후, 20℃, 2,500 rpm, 5 분간 원심분리하여 세포를 분리하여 0.5% TAP-agar 배지 1.5 mL 와 혼합하여 1.5% TAP-agar 배지 (25μM 5-FI 및 1.5 mM tryptophan 포함)에 도말한(3개의 plate에 분할하여 0.5 mL씩 도말) 이후, 25℃, 120 μmol m-2 s-1에서 7~10일간 정치 배양 후 얻어진 콜로니를 사용하여 실험 진행하였다.
구체적으로, 상기 Cas9 RNP complex는 상업적으로 구매가능한 Cas9 7.5μg과 10μg의 sgRNA(TCCAGCCACGGTCTGGCCTCCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC CGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU, ToolGen, Inc.)를 혼합하여 37℃, 30 분 항온 보관하여 실험을 진행하였고, 결과를 아래 표 1과 도 4에 나타내었다.
전처리 방법 형질전환 전
최초 세포 수		 전체 콜로니수 유전자 교정된 콜로니수 콜로니 수득 효율 유전자 교정 효율
Invitrogen TM 상용버퍼
(Shin et al., 2016)		 0.9 x 108 5 2 0.56×10-6 0.22×10-7
Invitrogen TM 상용버퍼 (본 발명) 1.0 x 108 13 2 0.13×10-6 0.20×10-7
오토라이신
(본 발명)		 2.0 x 107 75 73 0.38×10-5 0.37×10-5
도 4는 일 실시예에 따른 오토라이신 처리시 유전자 교정 효율 결과를 나타낸 그래프이다.
도 4 및 표 1에 나타낸 바와 같이, 오토라이신을 처리하지 않은 실험군에서는 총 13개의 콜로니를 확보하였으며 이 중 2개의 콜로니에 on-target mutation이 발생하였다. 반면, 오토라이신을 처리한 실험군에서는 75개의 콜로니가 확보되었으며, 유전자서열 분석 결과 73개의 콜로니에서 on-target mutation이 발견되었다. 오토라이신 처리에 의해 유전자 교정 효율은 0.20Х10-7에서 0.37Х10-5으로 약 185배 개선되었으며, 이는 기존에 유사한 조건으로 학술지에 보고된 사례(0.22Х10-7)에 비해서도 약 168배 개선된 효율임을 알 수 있었다.
실험예 2. 핵위치 서열(NLS)를 이용한 신규 Cas9 단백질 제작
아그로박테리움 투메파시엔(Agrobacterium tumefaciens)은 식물 세포의 형질전환에 흔히 활용되는 박테리아로, 외래 유전자를 감염 숙주의 핵 내로 효과적으로 전달하기 위해서 다양한 단백질들이 생산한다. 이에 관련된 핵심단백질 중 VirD2 및 VirE2 단백질이 있다. 상기 단밸질에 내에 포함된 핵위치 서열(NLS)이 타겟 유전자를 숙주의 핵내로 위치시키는 것에 핵심 역할을 하는 것으로 알려져 있으며, 상기 핵위치 서열에 대한 유전자 및 단백질의 서열은 보고되어있다. 본 발명은 아그로박테리움 투메파시엔 LBA4404 유래의 VirD2(AAACGACGTAATGACGAGGAGGCAGGTCCGCGGAGCAAACCGTAAAGGATTGAA, 서열번호 1)과 VirE2(AAACTAAGACCTGAAGACCGATACGTACAAACAGAGAGATACGGGCGCCG, 서열번호 2)에서 나타낸 NLS 2종을 확보하여 활용하였다. 구체적으로, NLS의 핵위치 효과를 비교하기 위하여 기존에 생물의 형질전환에 널리 활용되는 SV40 NLS(CCCAAGAAGAAGAGGAAGGT, 서열번호 3)를 융합한 mCherry와 VirD2 및 VirE2 유래의 NLS를 융합한 mCherry 형광 단백질을 각각 생산 및 분리 정제하여 C. reinhardtii CC-124에 형질전환 후 공초점 현미경를 통해 관찰하였다. 그 결과는 도 5에 나타내었다. 단, NLS가 없는 mCheery의 경우 대조군으로 하였다.
또한, VirD2 및 VirE2 유래의 NLS와 SV40 NLS를 Cas9 단백질의 N 또는 C 말단에 각각 융합하는 방법으로 다양한 Cas9 발현 플라스미드를 제작하였다. 제작한 플라스미드를 대장균 BL21(DE3) 균주에 형질전환하여 배양한 후 각각 poly histidine tag을 이용하여 TALON resin으로 정제하여 실험에 사용하였다. 각각의 NLS가 Cas 9 단백질의 양 말단에 융합되도록 제작한 플라스미드는 도 6에 나타내었다.
도 5는 형광 단백질 mCherry의 N 또는 C 말단에 융합하여 NLS의 핵 위치화 효과를 공초점 현미경으로 촬영한 이미지이다; DN: VirD2 NLS N 말단 융합; DC: VirD2 NLS C 말단 융합; EN: VirE2 NLS N 말단 융합; EC: VirE2 NLS C 말단 융합; SN: SV40 NLS N 말단 융합; SC: SV40 NLS C 말단 융합 DIC: 미분간섭대비채널.
도 6은 Cas9 단백질의 N 또는 C 말단에 NLS를 융합한 Cas 9 플라스미드를 도식화하여 나타낸 이미지이다.
도 5에 나타낸 바와 같이, N 말단 또는 C 말단에 융합된 것과 상관없이, VirD2 및 VirE2 모두 기존의 SV40 NLS 융합의 경우와 마찬가지로 단백질들을 미세조류 핵 내로 위치시키는 것을 확인하였다.
실험예 3. 오토라이신(Autolysin) 처리 및 핵위치 서열의 종류 및 위치별 유전자 교정 효율 비교
상기 실험예 2에서 제작한 6종의 Cas9 단백질을 활용하여 실시예 2와 동일한 방법으로 유전자 교정 효율을 분석하였고(모든 실험군에 대하여 오토라이신을 처리함), 그 결과는 아래 표 2 및 도 7에 나타내었다.
Cas9 종류 형질전환 전 최초 세포 수 전체 콜로니수 임의 표본 추출 후 유전자형 분석 콜로니 수득 효율 유전자 교정 효율
유전자형 분석 수 유전자 교정된 콜로니수 유전자 교정 확률(%)
DN-Cas9 2.0×107 230 166 161 96.99 1.15×10-5 1.12×10-5
DC-Cas9 176 127 123 96.85 0.88×10-5 0.85×10-5
EN-Cas9 104 75 70 93.33 0.52×10-5 0.49×10-5
EC-Cas9 113 81 80 98.77 0.57×10-5 0.56×10-5
SN-Cas9 95 68 66 97.06 0.48×10-5 0.46×10-5
SC-Cas9 99 72 71 98.61 0.50×10-5 0.49×10-5
도 7은 일 실시예에 따른 오토라이신 처리 후, Cas9 단백질 종류에 따라 형질전환을 통해 생성된 콜로니의 수를 나타낸 그래프이다; DN: VirD2 NLS N 말단 융합; DC: VirD2 NLS C 말단 융합; EN: VirE2 NLS N 말단 융합; EC: VirE2 NLS C 말단 융합; SN: SV40 NLS N 말단 융합; SC: SV40 NLS C 말단 융합.
도 7 및 표 2에 나타낸 바와 같이, N 말단에 VirD2 유래의 NLS를 처리한 경우 가장 높은 유전자 교정 효율을 보였고, 오토라이신 처리 후 N 말단에 SV40 NLS가 융합된 것으로 Takara의 상용 Cas9인 Guide-itTM Recombinant Cas9 (카탈로그 632641)을 활용하여 형질전환을 한 경우와의 비교를 통해, VirD2 NLS가 N 말단에 융합된 Cas9 단백질 (DN-Cas9)을 활용할 경우 핵내 Cas9 RNP 복합체 물질 이동을 증대시킴으로써 유전자 교정 효율이 0.37Х10-5에서 1.12Х10-5으로 증대하여, 3배 이상의 형질전환 효율이 상승되는 것을 확인하였다. 또한, 이상의 결과는 오토라이신의 처리 및 VirD2 NLS가 N 말단에 융합된 Cas9 단백질 (DN-Cas9)을 활용할 경우 NLS의 일반 조건(InvitrogenTM 상용 버퍼 활용, Takara의 상용 Cas9 활용) 대비, 유전자 교정 효율이 0.20Х10-7에서 1.12Х10-5로 증대되어 최대 560배의 유전자 교정 효율이 개선되었음을 확인하였다.
이상의 결과를 통해, 오토라이신의 전처리와 NLS가 도입된 Cas9 단백질에 의해 조류에서의 유전자 교정 효율이 현저하게 향상된 효과를 확인할 수 있었다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.

Claims (17)

  1. 조류(algae)에 오토라이신(autolysin)을 처리하는 단계;
    상기 오토라이신이 처리된 조류에 CRISPR/Cas(Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR associated system)를 도입하여 유전자를 편집하는 단계를 포함하는, 조류의 유전자를 편집하는 방법.
  2. 청구항 1에 있어서, 상기 조류는 클라미도모나스 레인하티(chlamydomonas reinhardtii), 아나시스티스 니둘란스(Anacystis nidulans), 안키스트로데스무스(Ankistrodesmus sp.), 비둘파 아우리타(Biddulpha aurita), 보트리오코쿠스 브라우니(Botryococcus braunii), 키토세라스(Chaetoceros sp.), 클라미도모나스 아플란타(Chlamydomonas applanata), 클로렐라(Chlorella sp.), 클로렐라 엘립소이데아(Chlorella ellipsoidea), 클로렐라 에멀소니(Chlorella emersonii), 클로렐라 프로토세코이드(Chlorella protothecoides), 클로렐라 피레노이도사(Chlorella pyrenoidosa), 클로렐라 소로키니아나(Chlorella sorokiniana), 클로렐라 불가리스(Chlorella vulgaris), 클로렐라 미누티시마(Chlorella minutissima), 클로로코쿠 리토레일(Chlorococcu littorale), 시클로텔라 크립티카(Cyclotella cryptica), 두날리엘라 바르다윌(Dunaliella bardawil), 두날리엘라 살리나(Dunaliella salina), 두날리엘라 테르티오렉타(Dunaliella tertiolecta), 두날리엘라 프리모렉타(Dunaliella primolecta), 짐노디움(Gymnodinum sp.), 헤머노모나스 카테라에(Hymenomonas carterae), 이소크리시스 갈베나(Isochrysis galbana), 이소크리시스(Isochrysis sp.), 마이크로시스티스 아에루기노사(Microcystis aeruginosa), 마이크로모나스 푸실라(Micromonas pusilla), 모노두스 서브테라네우스(Monodus subterraneous), 나노클로리스(Nannochloris sp.), 나노클로롭시스(Nannochloropsis sp.), 나노클로롭시스 아토무스(Nannochloropsis atomus), 나노클로롭시스 살리나(Nannochloropsis salina), 나비쿨라 필리쿨로사(Navicula pelliculosa), 니츠시아(Nitzschia sp.), 니츠시아 클로스테리움(Nitzscia closterium), 니츠시아 팔레아(Nitzscia palea), 오시스티스 폴리모피아(Oocystis polymorpha), 아우로코커스(Ourococcus sp.), 오실라토리아 루베스켄스(Oscillatoria rubescens), 파브로바 루테리(Pavlova lutheri), 패오닥트리움 트리코누툼(Phaeodactylum tricornutum), 피크노코커스 프로바솔리(Pycnococcus provasolii), 피라미노나스 코르다타(Pyramimonas cordata), 스피눌라 플라텐시스(Spirulina platensis), 스테파노디스커스 미누투루스(Stephanodiscus minutulus), 스티코커스(Stichococcus sp.), 시네드라 우르나(Synedra ulna), 스케네데스무스 오브리쿼스(Scenedesmus obliquus), 스켈레나스트럼 그라시레(Selenastrum gracile), 스켈레토노마 코스타럼(Skeletonoma costalum), 테트라셀미스 추이(Tetraselmis chui), 테트라셀미스 마쿠라타(Tetraselmis maculata), 테트라셀미스(Tetraselmis sp.), 테트라셀미스 수에시카(Tetraselmis suecica), 탈라시오스트라 프세우도모나(Thalassiostra pseudomona), 아나배나(Anabaena sp.), 칼로드릭스(Calothrix sp.), 카마에시폰(Chaemisiphon sp.), 코로코시디옵시스(Chroococcidiopsis sp.), 차노데세(Cyanothece sp.), 실린더로스페멈(Cylindrospermum sp.), 데모카펠라(Dermocarpella sp.), 피셔렐라(Fischerella sp.), 글로에오캅사(Gloeocapsa sp.), 믹소사시나(Myxosarcina sp.), 노스톡(Nostoc sp.), 오스실라토리아(Oscillatoria sp.), 포르미디움 코리움(Phormidium corium), 플레우로캅사(Pleurocapsa sp.), 프로콜로코코스(Prochlorococcus sp.), 페세우다나바에나(Pseudanabaena sp.), 시네코코스(Synechococcus sp.), 시네코시스티스(Synechocystis sp.), 톨리포트릭스(Tolypothrix sp.) 및 제노코코스(Xenococcus sp.)로 이루어진 군으로부터 선택된 어느 하나인 것인, 방법.
  3. 청구항 1에 있어서, 상기 오토라이신은 클라미도모나스 레인하티(Chlamydomonas reinhardtii) CC-620 및 CC-621을 혼합 배양하여 얻은 것인, 방법.
  4. 청구항 1에 있어서, 조류의 세포벽 투과성을 높이는 단계를 더 포함하는 것인, 방법.
  5. 청구항 1에 있어서, CRISPR/Cas의 도입은, CRISPR 단백질 또는 이를 암호화하는 폴리뉴클레오티드; 및
    타켓 핵산과 혼성화할 수 있는 가이드 서열을 포함한 가이드 폴리뉴클레오티드; 또는 이를 암호화하는 폴리뉴클레오티드를 도입하는 것인, 방법.
  6. 청구항 1에 있어서, 상기 CRISPR/Cas의 도입은 Cas 단백질과 가이드 RNA가 미리 조합된 Cas 단백질-RNA RNP(ribonucleoprotein)를 도입하는 것인, 방법.
  7. 청구항 5에 있어서, 상기 CRISPR 단백질은 Cas9, Cas12, Cas13, 또는 Cas14인 것인, 방법.
  8. 청구항 5에 있어서, 상기 CRISPR 단백질은 야생형 Cas 단백질 또는 야생형 Cas 단백질을 암호화하는 뉴클레오티드에서 하나 이상의 뉴클레오티드 서열이 추가되어 엔지니어링 되어 발현된 Cas 단백질(engineered Cas protein)인 것인, 방법.
  9. 청구항 8에 있어서, 상기 엔지니어링 되어 발현된 Cas 단백질은 Cas 단백질을 암호화하는 뉴클레오티드에서 N 또는 C 말단에 핵 위치화 서열(Nuclear Localization Sequence, NLS)을 더 포함하는 것인, 방법.
  10. 청구항 9에 있어서, 상기 핵 위치화 서열(Nuclear Localization Sequence:NLS)은 아그로박테리움(Agrobacterium)에서 유래된 것인, 방법.
  11. 청구항 9에 있어서, 상기 핵 위치화 서열(Nuclear Localization Sequence:NLS)은 VirD2, VirE2, 또는 SV40인 것인, 방법.
  12. 청구항 9에 있어서, 상기 핵 위치화 서열(Nuclear Localization Sequence, NLS)은 Cas 단백질의 N-말단에 연결된 VirD2, VirE2 및 SV40 중 선택된 어느 하나인 것인, 방법.
  13. 청구항 9에 있어서, 상기 핵위치화 서열(Nuclear Localization Sequence, NLS)은 Cas 단백질의 C-말단에 연결된 VirD2, VirE2 및 SV40 중 선택된 어느 하나인 것인, 방법.
  14. 청구항 5 내지 13 중 어느 한 항에 있어서, 상기 야생형 Cas 단백질의 핵 위치화(nuclear localization)의 효율을 높이는 단계를 더 포함하는, 방법.
  15. 조류(algae)의 유전자 교정을 위한 CRISPR/Cas 시스템으로서,
    Cas 단백질, 또는 이를 암호화하는 폴리뉴클레오티드;
    상기 Cas 단백질에 연결된 핵 위치화 서열(Nuclear Localization Sequence, NLS) VirD2, VirE2 또는 SV40 또는 이를 암호화하는 폴리뉴클레오티드; 및
    타켓 핵산과 혼성화 가이드서열 또는 이를 암호화하는 폴리뉴클레오티드를 포함하고, 상기 조류는 오토라이신(autolysin)으로 처리된 것인, 시스템.
  16. 청구항 15에 있어서, 상기 핵 위치화 서열(Nuclear Localization Sequence, NLS)은 Cas 단백질의 N-말단에 연결된 VirD2, VirE2 및 SV40 중 선택된 어느 하나인 것인, 시스템.
  17. 청구항 15에 있어서, 상기 핵위치화 서열(Nuclear Localization Sequence, NLS)은 Cas 단백질의 C-말단에 연결된 VirD2, VirE2 및 SV40 중 선택된 어느 하나인 것인, 시스템.
PCT/KR2023/006493 2022-05-20 2023-05-12 오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법 WO2023224327A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2022-0062144 2022-05-20
KR20220062144 2022-05-20
KR10-2023-0061795 2023-05-12
KR1020230061795A KR20230163295A (ko) 2022-05-20 2023-05-12 오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법

Publications (1)

Publication Number Publication Date
WO2023224327A1 true WO2023224327A1 (ko) 2023-11-23

Family

ID=88835772

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/006493 WO2023224327A1 (ko) 2022-05-20 2023-05-12 오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법

Country Status (1)

Country Link
WO (1) WO2023224327A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130065314A1 (en) * 2011-08-25 2013-03-14 Phytocentric Biotech Inc. Algal transformation systems, compositions and methods
KR20150084148A (ko) * 2014-01-13 2015-07-22 재단법인 탄소순환형 차세대 바이오매스 생산전환 기술연구단 미세조류의 바이오매스와 지질 생산성을 증가시키기 위한 재조합 벡터 및 이의 용도
KR102004076B1 (ko) * 2015-03-13 2019-07-25 더 잭슨 래보라토리 3-성분 crispr/cas 복합체 시스템 및 그 용도
US20210371883A1 (en) * 2015-01-28 2021-12-02 Caribou Biosciences, Inc. Crispr hybrid dna/rna polynucleotides and methods of use
WO2022082179A2 (en) * 2020-10-14 2022-04-21 Pioneer Hi-Bred International, Inc. Engineered cas endonuclease variants for improved genome editing

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130065314A1 (en) * 2011-08-25 2013-03-14 Phytocentric Biotech Inc. Algal transformation systems, compositions and methods
KR20150084148A (ko) * 2014-01-13 2015-07-22 재단법인 탄소순환형 차세대 바이오매스 생산전환 기술연구단 미세조류의 바이오매스와 지질 생산성을 증가시키기 위한 재조합 벡터 및 이의 용도
US20210371883A1 (en) * 2015-01-28 2021-12-02 Caribou Biosciences, Inc. Crispr hybrid dna/rna polynucleotides and methods of use
KR102004076B1 (ko) * 2015-03-13 2019-07-25 더 잭슨 래보라토리 3-성분 crispr/cas 복합체 시스템 및 그 용도
WO2022082179A2 (en) * 2020-10-14 2022-04-21 Pioneer Hi-Bred International, Inc. Engineered cas endonuclease variants for improved genome editing

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
NIEVERGELT ADRIAN P., DIENER DENNIS R., BOGDANOVA ALIONA, PIGINO GAIA: "Efficient precision genome editing of Chlamydomonas reinhardtii with CRISPR/Cas", BIORXIV, 24 July 2022 (2022-07-24), pages 1 - 12, XP093108178, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2022.07.24.501283v1.full.pdf> [retrieved on 20231203], DOI: 10.1101/2022.07.24.501283 *

Similar Documents

Publication Publication Date Title
KR102339365B1 (ko) 키메라 게놈 조작 분자 및 방법
Fan et al. Multiple applications of a transient CRISPR-Cas9 coupled with electroporation (TRACE) system in the Cryptococcus neoformans species complex
US20160060637A1 (en) Improved Gene Targeting and Nucleic Acid Carrier Molecule, In Particular for Use in Plants
US20140294773A1 (en) Modified cascade ribonucleoproteins and uses thereof
WO2012093833A2 (en) Genome engineering via designed tal effector nucleases
Lacroix et al. Beyond Agrobacterium-mediated transformation: horizontal gene transfer from bacteria to eukaryotes
CN113831395B (zh) 一种重组抗菌肽TrSub、制备方法及其应用
WO2018226853A1 (en) Enhancement of crispr gene editing or target destruction by co-expression of heterologous dna repair protein
WO2022193849A1 (zh) 液态酵母单双杂高通量筛库方法及其应用
CN105121649A (zh) 靶向修饰藻基因组的方法
Kawai et al. Highly efficient transformation of the model zygnematophycean alga Closterium peracerosum‐strigosum‐littorale complex by square‐pulse electroporation
EP4085133A1 (en) Rna-guided nucleases and active fragments and variants thereof and methods of use
US20240084285A1 (en) Method for producing target dna sequence and cloning vector
CN104818287B (zh) 棉花黄萎病菌的致病相关基因VdPR1作为抗棉花黄萎病菌靶标基因的应用
Weinthal et al. Characterization of nuclear localization signals in the type III effectors HsvG and HsvB of the gall-forming bacterium Pantoea agglomerans
CN107868798A (zh) 一种基于基因敲除细胞的阳性筛选体系的建立方法
WO2023224327A1 (ko) 오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법
CN107338262B (zh) 用于表达红色荧光蛋白的无乳链球菌质粒及其构建方法和应用
US20160186196A1 (en) Method and composition for generating programmed cell death resistant algal cells
Wilson et al. CRISPR-cas9-mediated genome editing in the filamentous ascomycete Huntiella omanensis
KR20230163295A (ko) 오토라이신을 활용한 미세조류의 유전자 교정 효율을 증대시키기 위한 시스템 및 방법
CN111386343A (zh) 用于克鲁维酵母宿主细胞基因组整合的方法
Fukuda et al. High-efficiency transformation of the chlorarachniophyte Amorphochlora amoebiformis by electroporation
CN108130314A (zh) 一种单克隆细胞培养方法
WO2015182941A1 (ko) 신규 카탈라아제 신호서열 및 이를 이용한 카탈라아제 발현방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23807847

Country of ref document: EP

Kind code of ref document: A1