WO2023217005A1 - Tandem-type hybrid trimeric sars-cov-2 vaccine - Google Patents

Abstract

Disclosed in the present invention are a recombinant chimeric antigen of the prototype strain and Delta and Omicron variant strains of SARS-CoV-2, a preparation method therefor, and the use thereof. The recombinant chimeric antigen is formed by directly tandemly linking, or tandemly linking by an appropriate linking sequence, the amino acid sequences or derived sequences thereof from the RBDs of the prototype strain of and the Delta and Omicron variant strains of SARS-CoV-2. Compared with an RBD homotrimer of the SARS-CoV-2 prototype strain, the recombinant chimeric antigen has higher immunogenicity and can efficiently activate a broadly protective antibody.

Description

Tandem hybrid trimer COVID-19 vaccine

cross reference

This application claims priority to the Chinese patent application with application number 202210510493.8 and the invention name "Tandem Hybrid Trimer COVID-19 Vaccine" submitted on May 11, 2022, the entire content of which is incorporated herein by reference.

Technical field

This application belongs to the field of biomedicine and relates to a tandem hybrid trimer COVID-19 vaccine. Specifically, it relates to a recombinant chimeric antigen of the new coronavirus prototype strain, Delta and Omicron variant strains, its related products, preparation methods and application.

Background technique

The new coronavirus (SARS-CoV-2) belongs to the genus β-coronavirus of the family Coronaviridae. It is a positive-stranded RNA enveloped virus that can widely infect humans and animals. A total of seven coronaviruses that can infect humans have been identified. Among them, severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East respiratory syndrome coronavirus (MERS-CoV), and new coronavirus, which belong to the genus βcoronavirus. The virus (SARS-CoV-2) is highly lethal and has caused three serious disease epidemics in human history.

At the end of 2019, SARS-CoV-2 infection cases were reported and spread rapidly, causing widespread epidemics in my country and around the world. On January 31, 2020, WHO announced that the novel coronavirus pneumonia (COVID-19) epidemic constituted a Public Health Emergency of International Concern (PHEIC) of international concern. According to data released on the WHO website, as of May 5, 2022, there have been a total of 513,384,685 confirmed cases and 6,246,828 deaths of COVID-19 worldwide, which has caused huge damage to the global social economy.

The pathogen that causes COVID-19 is named SARS-CoV-2. Its spike protein S has a high degree of sequence homology with that of SARS-CoV and uses the same receptor angiotensin as SARS-CoV. Convertase 2 (ACE2) enters cells and triggers respiratory symptoms that may progress to severe pneumonia and death. SARS-CoV-2 is more contagious, facilitating its triggering of a global pandemic. SARS-CoV-2 is mainly transmitted through respiratory droplets and contact, and there is a risk of fecal-oral transmission and aerosol transmission. The population is generally susceptible to SARS-CoV-2. The source of infection is mainly patients infected with the new coronavirus. Asymptomatic infected persons can also become the source of infection. Since there are no obvious symptoms after infection, it is difficult to be diagnosed and isolated in time, which can easily lead to the accumulation of infection sources in the community and increase the difficulty of disease prevention and control. Based on the current development trend of the global epidemic, COVID-19 is at risk of recurrence and is likely to coexist with humans for a long time. Therefore, it is of great significance to develop a COVID-19 vaccine.

The SARS-CoV-2 surface spike protein (S protein) mediates the attachment, fusion and entry of the virus into host cells. The receptor binding domain (RBD) located at the C-terminus of the S protein is considered to be the main target for inducing the body to produce neutralizing antibodies. Region is the epidemic target for vaccine development. As a vaccine, RBD can stimulate the body to produce neutralizing antibodies, which can effectively inhibit the binding of viruses to receptors, thereby inhibiting viral infection and invasion of host cells.

With the global pandemic of SARS-CoV-2, a variety of popular mutant strains have gradually evolved, mainly including Alpha, Beta, Gamma, Delta, and by the end of 2021 The Omicron variant was first discovered in South Africa. At present, the Omicron variant has become the mainstream epidemic strain at home and abroad. These newly emerged circulating mutant strains have a significant or significant reduction in the protective effect of the new coronavirus vaccine using the prototype strain spike protein S or RBD as the immunogen. In particular, the Omicron mutant strain has as many as 32 mutation sites in its S protein. It has serious immune evasion against the humoral immune response activated by new coronavirus neutralizing antibody drugs and vaccines, which has brought great consequences to the current epidemic prevention and control. faced serious challenges. However, some studies have reported that although the immune response activated by vaccines developed with Omicron sequences is strong against Omicron mutant strains, the cross-reactivity against prototype strains and other mutant strains is very weak, and is not suitable for the coexistence of multiple current popular mutant strains. The situation is still changing rapidly. Therefore, there is an urgent need to develop a new coronavirus vaccine that can respond to multiple circulating mutant strains. The neutralizing effect against Omicron and other mutant strains is a new generation of new coronavirus. Important indicators of vaccines.

The information disclosed in this Background section is merely intended to increase understanding of the general context of the application and should not be considered an admission or in any way implied that the information constitutes prior art that is already known to a person of ordinary skill in the art.

Contents of the invention

Purpose of invention

The purpose of this application is to provide a recombinant chimeric antigen of the new coronavirus prototype strain, Delta and Omicron variants, its related products, and its preparation methods and applications. The recombinant chimeric antigen according to the present application is composed of (1) the amino acid sequence of the S protein RBD domain of the new coronavirus prototype strain or a part thereof or has at least 90%, 92%, 95%, 96%, 97%, 98% of the amino acid sequence thereof Or an amino acid sequence that is 99% identical, (2) the amino acid sequence of the RBD domain of the S protein of the new coronavirus Delta variant strain or a part thereof or has at least 90%, 92%, 95%, 96%, 97%, 98% of the same amino acid sequence or an amino acid sequence that is 99% identical and (3) an amino acid sequence that is at least 90%, 92%, 95%, 96%, 97%, 98% or A trimer formed by connecting amino acid sequences with 99% identity directly or through appropriate connecting sequences, which can efficiently activate broad-spectrum protective antibodies against the original strain as well as various currently prevalent mutant strains. Very good preventive or therapeutic effect.

solution

In order to achieve the purpose of this application, this application provides the following technical solutions:

In the first aspect, this application provides a recombinant chimeric antigen of the new coronavirus prototype strain, Delta and Omicron variants. The amino acid sequence of the recombinant chimeric antigen includes: (AB)-C1-(A-B' )-C2-(AB”) pattern arranged amino acid sequence, where:

A-B represents the amino acid sequence of the RBD domain of the S protein of the new coronavirus prototype strain or a part thereof, or has at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with it and is the same or Substantially identical immunogenic amino acid sequences,

A-B' represents the amino acid sequence of the RBD domain of the S protein of the new coronavirus Delta variant strain or a part thereof, or has at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with it and having the same or substantially the same immunogenic amino acid sequence,

A-B” represents the amino acid sequence of the RBD domain of the S protein of the new coronavirus Omicron variant strain or a part thereof, or has at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with it and has the same The same or substantially the same immunogenic amino acid sequence, and

C1 and C2 are the same or different, and each independently represents the linker (GGS) _n , where n=0, 1, 2, 3, 4 or 5.

For the above recombinant chimeric antigen, in a preferred embodiment, a part of the RBD domain of the S protein of the new coronavirus prototype strain is at least 70%, 80%, 85%, 90%, 92% of its entire amino acid sequence. 95%, 96%, 97%, 98% or 99%;

And/or, a part of the RBD domain of the S protein of the new coronavirus Delta variant strain is at least 70%, 80%, 85%, 90%, 92%, 95%, 96%, 97% of its entire amino acid sequence. 98% or 99%;

And/or, a part of the RBD domain of the S protein of the new coronavirus Omicron variant is at least 70%, 80%, 85%, 90%, 92%, 95%, 96%, 97% of its entire amino acid sequence. 98% or 99%;

and/or, n=0,1,2 or 3.

For the above-mentioned recombinant chimeric antigen, in a preferred embodiment, the amino acid sequence of the S protein RBD domain of the new coronavirus prototype strain or a part thereof is as shown in SEQ ID NO: 1, or as shown in SEQ ID NO: 1 An amino acid sequence obtained by substituting, deleting or adding one or several amino acids to the amino acid sequence and having the same or substantially the same immunogenicity;

And/or, the amino acid sequence of the S protein RBD domain of the new coronavirus Delta variant strain or a part thereof is as shown in SEQ ID NO:2, or the amino acid sequence as shown in SEQ ID NO:2 is substituted, deleted or added An amino acid sequence derived from one or several amino acids and having the same or substantially the same immunogenicity;

And/or, the amino acid sequence of the S protein RBD domain of the new coronavirus Omicron variant strain or a part thereof is as shown in SEQ ID NO:3, or the amino acid sequence as shown in SEQ ID NO:3 is substituted, deleted or added An amino acid sequence derived from one or several amino acids and having the same or substantially the same immunogenicity;

and/or, n=0, 1 or 2.

In a preferred embodiment, A-B represents the amino acid sequence shown in SEQ ID NO:1, A-B' represents the amino acid sequence shown in SEQ ID NO:2, and A-B" represents the amino acid sequence shown in SEQ ID NO:3 amino acid sequence;

Further preferably, the recombinant chimeric antigen includes the amino acid sequence shown in SEQ ID NO:4.

In a second aspect, the present application provides a method for preparing a recombinant chimeric antigen as described in the first aspect, which includes Includes the following steps:

Add the Kozak sequence and the coding sequence of the signal peptide to the 5' end of the nucleotide sequence encoding the recombinant chimeric antigen as described in the first aspect above, and add the coding sequence of the histidine tag and the stop codon to the 3' end, Carry out cloning and expression, screen the correct recombinant, then transfect it into expression system cells for expression, collect the cell culture supernatant, and isolate the recombinant antigen therefrom.

In a feasible implementation of the above preparation method, the cells of the expression system are mammalian cells, insect cells, yeast cells or bacterial cells;

Optionally, the mammalian cells are HEK293T cells, 293F series cells or CHO cells; further optionally, the 293F series cells are HEK293F cells, Freestyle293F cells or Expi293F cells;

Alternatively, the insect cells are sf9 cells, Hi5 cells, sf21 cells or S2 cells;

Optionally, the yeast cell is a Pichia pastoris cell or a yeast cell modified therefrom;

Optionally, the bacterial cells are E. coli cells.

In a third aspect, the present application provides a polynucleotide encoding the recombinant chimeric antigen as described in the first aspect.

The polynucleotide is a nucleotide sequence optimized by human codons, and can be DNA or mRNA;

Preferably, the polynucleotide is the DNA sequence shown in SEQ ID NO:5;

Preferably, the polynucleotide is the mRNA sequence shown in SEQ ID NO:6.

In a fourth aspect, the present application provides a nucleic acid construct comprising the polynucleotide as described in the third aspect above, and optionally, at least one expression control element operably linked to the polynucleotide.

In a fifth aspect, the present application provides an expression vector comprising the nucleic acid construct described in the fourth aspect.

In a sixth aspect, the present application provides a host cell, which is transformed or transfected with the polynucleotide as described in the third aspect, the nucleic acid construct as described in the fourth aspect, or the polynucleotide as described in the fifth aspect. Expression vector.

In the seventh aspect, the present application provides the recombinant chimeric antigen as described in the first aspect, the polynucleotide as described in the third aspect, the nucleic acid construct as described in the fourth aspect, the fifth aspect as described above Use of the expression vector or the host cell as described in the sixth aspect above in the preparation of drugs for preventing and/or treating novel coronavirus infection.

Preferably, the drug is a vaccine;

Preferably, the new coronavirus is one or more selected from the following: original strain of SARS-CoV-2, mutant strain of SARS-CoV-2 Alpha (B.1.1.7), Beta (B.1.351 ), Gamma(P.1), Kappa(B.1.617.1), Delta(B.1.617.2), Omicron subtype BA.1, BA.1.1, BA.2, BA.2.12.1, BA. 3. BA.4, BA.5.

In the eighth aspect, the present application provides a vaccine or immunogenic composition, which includes the recombinant chimeric antigen as described in the above first aspect, the polynucleotide as described in the above third aspect, the above fourth aspect The nucleic acid construct, the expression vector as described in the fifth aspect above or the host cell as described in the sixth aspect above, and physiologically acceptable vehicles, adjuvants, excipients, carriers and/or diluents.

In a preferred embodiment, the vaccine or immunogenic composition is a novel coronavirus recombinant protein vaccine, which includes the recombinant chimeric antigen and adjuvant as described in the first aspect above;

Optionally, the adjuvant is one or more selected from the following adjuvants: aluminum adjuvant, MF59 adjuvant and MF59-like adjuvant.

In another preferred embodiment, the vaccine or immunogenic composition is a novel coronavirus DNA vaccine, which includes:

(1) Eukaryotic expression vector; and

(2) The DNA sequence encoding the recombinant chimeric antigen described in the first aspect is constructed into the eukaryotic expression vector;

Optionally, the eukaryotic expression vector is selected from pGX0001, pVAX1, pCAGGS and pcDNA series vectors.

In another preferred embodiment, the vaccine or immunogenic composition is a novel coronavirus mRNA vaccine, and the mRNA vaccine includes:

(I) an mRNA sequence encoding a recombinant chimeric antigen as described in the first aspect above; and

(II) Lipid nanoparticles.

In another preferred embodiment, the vaccine or immunogenic composition is a novel coronavirus-viral vector vaccine, which includes:

(1) Viral backbone vector; and

(2) The DNA sequence encoding the recombinant chimeric antigen described in the first aspect is constructed into the viral backbone vector;

Optionally, the viral backbone vector is selected from one or more of the following viral vectors: adenovirus vector, poxvirus vector, influenza virus vector, and adeno-associated virus vector.

In a feasible implementation, the vaccine or immunogenic composition is in the form of a nasal spray, oral preparation, suppository or parenteral preparation;

Preferably, the nasal spray is selected from aerosols, sprays and powder sprays;

Preferably, the oral preparation is selected from tablets, powders, pills, powders, granules, fine granules, soft/hard capsules, film-coated agents, pellets, sublingual tablets and ointments;

Preferably, the parenteral preparation is a transdermal preparation, an ointment, a plaster, a topical liquid, an injectable or a pushable preparation.

In the ninth aspect, the present application provides a kit, which includes the recombinant chimeric antigen as described in the first aspect, the polynucleotide as described in the third aspect, and the nucleic acid construct as described in the fourth aspect. The body, the expression vector as described in the fifth aspect, the host cell as described in the sixth aspect, and/or the vaccine or immunogenic composition as described in the eighth aspect, and optionally other types of novel Coronavirus vaccine.

In the tenth aspect, the present application provides a method for preventing and/or treating novel coronavirus infectious diseases, which method includes: administering a preventive and/or therapeutically effective amount of the following substances to a subject in need: as described above The recombinant chimeric antigen described in the first aspect, the polynucleotide described in the third aspect, the nucleic acid construct described in the fourth aspect, the expression vector described in the fifth aspect, the sixth aspect described above The host cells described in the aspect and/or the vaccine or immunogenic composition described in the eighth aspect above.

The "preventive and/or therapeutically effective dose" may vary depending on the subject of administration, the subject's organ, symptoms, administration method, etc., and may take into account the type of dosage form, administration method, patient's age and weight, patient's Symptoms, etc., are determined based on the doctor’s judgment.

beneficial effects

The inventor of the present application has designed a recombinant chimeric antigen of the new coronavirus prototype strain, Delta and Omicron variants. The recombinant chimeric antigen is composed of the RBD domain or other components from the new coronavirus prototype strain, Delta and Omicron variants. A part of the amino acid sequence (or its derivative sequence) is directly connected in series or connected in series through appropriate connecting sequences. It has high immunogenicity and can induce a high level of neutralization against the original virus strain and a series of mutant strains. Antibodies are expected to become a broad-spectrum vaccine to prevent the new coronavirus.

Description of the drawings

One or more embodiments are exemplified by the pictures in the corresponding drawings, and these exemplary illustrations do not constitute limitations to the embodiments. The word "exemplary" as used herein means "serving as an example, example, or illustrative." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or superior to other embodiments.

Figure 1 is the protein immunoblot of the cell supernatant collected five days after the expression plasmid pCAGGS-PPP was transfected into Expi293F ^TM cells (under non-reduced or reduced conditions) as described in Example 2 of the present application. Bottom) Result graph.

Figure 2 is a picture of the results of protein immunoblotting (under non-reducing or reducing conditions) of the cell supernatant collected five days after the expression plasmid pCAGGS-PDO was transfected into Expi293F ^TM cells as described in Example 2 of the present application.

Figure 3 is a diagram of the SDS-PAGE identification results of the molecular sieve chromatography curve of the PPP trimer protein and the eluent at the elution peak (under non-reducing or reducing conditions) described in Example 2 of the present application.

Figure 4 is a diagram of the SDS-PAGE identification results of the molecular sieve chromatography curve of the PDO trimer protein and the eluate at the elution peak (under non-reducing or reducing conditions) described in Example 2 of the present application.

Figure 5 is a graph showing the identification of the molecular weight of PPP trimer protein using analytical ultracentrifugation as described in Example 2 of the present application.

Figure 6 is a graph showing the identification of the molecular weight of PDO trimer protein using analytical ultracentrifugation as described in Example 2 of the present application.

Figure 7 is a molecular sieve chromatography curve diagram of the complex of PPP protein and CB6 Fab protein as described in Example 3 of the present application, as well as a diagram of the SDS-PAGE identification results of the eluate at the two elution peaks.

Figure 8 is a molecular sieve chromatography curve diagram of the complex of PDO protein and CB6 Fab protein as described in Example 3 of the present application, as well as a diagram of the SDS-PAGE identification results of the eluate at the two elution peaks.

Figure 9 is a schematic diagram of the electron microscope structure of the complex of PPP protein and CB6 Fab protein as described in Example 3 of the present application.

Figure 10 is a schematic diagram of the electron microscope structure of the complex of PDO protein and CB6 Fab protein described in Example 3 of the present application.

Figure 11 is the detection of PPP, PDO, and the new coronavirus prototype strain RBD, Delta variant RBD, Omicron BA.1 variant RBD and human receptor molecules hACE2 and human receptor molecules hACE2 and The results of affinity testing of seven types of RBD epitope neutralizing antibodies.

Figure 12 is a statistical chart of the affinity detection results shown in Figure 11 (K _D value unit is nM).

Figure 13 is a schematic diagram of the experimental flow chart of immunizing mice with PPP or PDO trimer protein vaccine and sample collection as described in Example 5 of the present application.

Figure 14 is a graph showing the results of detecting the titers of RBD-binding antibodies stimulated by PPP or PDO trimer protein vaccines in mice as described in Example 6 of the present application through enzyme-linked immunosorbent assay (ELISA).

Figure 15 shows the results of the PPP or PDO trimer protein vaccine against the new coronavirus prototype strain, Delta and Omicron (BA.1, BA. 2. Neutralizing antibody titer test results of pseudoviruses of BA.2.75, BA.4/5 subtype) mutant strains.

Figure 16 shows the detection results of the secretion of three cytokines IL-2, IL-4, and IFNγ after stimulation by the RBD polypeptide library in the splenocytes of mice immunized twice with the vaccine, as described in Example 8 of the present application through ELISpot detection.

Figure 17 shows the determination of the antigen-binding antibody titer of the immune mouse serum used in the challenge experiment by ELISA as described in Example 9 of the present application.

Figure 18 shows the pseudovirus neutralizing titers of the immunized mouse serum used in the challenge experiment against Delta, OmicronBA.1, BA.2 and BA.4/5 mutant strains as described in Example 9 of the present application.

Figure 19 shows the viral load in the lungs and turbinate bone tissues of mice collected after challenge with the new coronavirus as described in Example 10 of the present application.

Figure 20 is an experimental flow chart of immunized mice and sample collection described in Example 11 of the present application.

Figure 21 shows the mouse serum of the PPP or PDO trimer protein vaccine against the new coronavirus prototype strain, Delta and Omicron (BA.1, BA. 2. Neutralizing antibody titer test results of pseudoviruses of BA.2.75, BA.4/5 subtype) mutant strains.

Figure 22 is a radar chart created based on Figure 21.

Figure 23 shows the ELISpot detection of the spleen of mice immunized three times with the vaccine described in Example 13 of the present application. Detection results of secretion of three cytokines IL-2, IL-4, and IFNγ after cells were stimulated by RBD peptide library.

Detailed ways

In order to make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present application, not all of them. Embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of this application.

In addition, in order to better explain the present application, numerous specific details are given in the following detailed description. It will be understood by those skilled in the art that the present application may be practiced without certain specific details. In some embodiments, raw materials, components, methods, means, etc. that are well known to those skilled in the art are not described in detail in order to highlight the gist of the present application.

Unless expressly stated otherwise, throughout the specification and claims, the term "comprises" or its variations such as "comprises" or "comprising" will be understood to include the stated elements or components, and to Other elements or other components are not excluded.

Example 1: Design of SARS-CoV-2 prototype strain RBD trimer (i.e., PPP) and prototype strain-Delta-Omicron chimeric RBD trimer (i.e., PDO) constructs

In this example, the constructs of the new coronavirus prototype strain RBD trimer (referred to as PPP) and the prototype strain-Delta-Omicron chimeric RBD trimer (referred to as PDO) were designed respectively. The specific protocols are as follows:

(1) Directly connect the sequences of the R319-K537 segment of the RBD domain of the three new coronavirus prototype strains, connect the signal peptide (MIHSVFLLMFLLTPTES, SEQ ID NO. 7) to the N-terminal, and add 6 histidines to the C-terminal Acid (HHHHHH) was used to obtain the construct of the prototype strain RBD trimer PPP (its amino acid sequence is shown in SEQ ID NO: 8);

(2) The sequence of the RBD domain R319-L533 segment of the new coronavirus prototype strain (SEQ ID NO:1), the sequence of the RBD domain V320-L533 segment of the Delta variant strain (SEQ ID NO:2), and the Omicron variant strain The sequences of the V320-K537 segment of the RBD domain (SEQ ID NO:3) are directly connected in series, with a signal peptide (MSSSSWLLLSLVAVTAAQS, SEQ ID NO.9) connected to its N-terminal, and 6 histidines added to its C-terminal ( HHHHHH) tag to obtain the construct of the prototype strain-Delta-Omicron chimeric RBD trimer PDO (its amino acid sequence is shown in SEQ ID NO: 10);

Example 2: Expression and purification of SARS-CoV-2 prototype strain RBD trimer (ie, PPP) and prototype strain-Delta-Omicron chimeric RBD trimer (ie, PDO) protein

Construction of expression plasmid:

The amino acid sequences of the two constructs designed in the above Example 1 were optimized using human codons, and the corresponding DNA coding sequences are shown in SEQ ID NO: 11 and SEQ ID NO: 12 respectively; in 3 of these DNA coding sequences Add a stop codon to the 'end and add the Kozak sequence gccacc upstream to its 5' end. These two DNAs contain the Kozak sequence. The sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd.; the two synthesized DNA sequences were cloned into the pCAGGS plasmid through the EcoRI and XhoI restriction sites, and the expression prototype strain RBD trimer and the prototype strain -Delta-Omicron chimera were obtained respectively. The expression plasmids pCAGGS-PPP and pCAGGS-PDO of RBD trimers.

Protein expression and purification:

Expi293F cells were used to express PPP and PDO single-chain heterotrimers.

The expression plasmids pCAGGS-PPP and pCAGGS-PDO constructed above were transfected into Expi293F ^TM cells respectively. After 5 days, the supernatant was collected, centrifuged to remove the precipitate, and then filtered through a 0.22 μm filter to further remove impurities. The obtained cell supernatant was identified by Western blotting, in which histidine tag-specific antibodies were used for detection. The experimental results are shown in Figures 1 and 2 respectively; as can be seen from Figures 1 and 2, expression in Expi239F cells PPP and PDO were correctly folded and secreted into the supernatant, and since they were tandem trimers, both dithiothreitol-containing (reduced) and non-dithiothreitol-free (Non-reduced) loadings were used. The target band of the correct size can be detected by gel electrophoresis using buffer solution, which is about 75KDa.

In addition, the obtained cell supernatant was purified through nickel affinity column chromatography; specifically, the cell supernatant was passed through a nickel affinity column (Histrap, GE Healthcare) at 4°C, and buffer A (20 mM Tris , 150mM NaCl, pH 8.0) to wash to remove non-specific binding proteins; then, use low concentration imidazole (20mM Tris, 150mM NaCl, pH 8.0, 20mM imidazole) to elute impurity proteins, and use buffer B (20mM Tris, 150mM NaCl, pH 8.0, 300mM imidazole), elute the target protein from HisTrap, and use a 10kDa concentrator tube to concentrate the eluate more than 30 times and change the medium to buffer A, with the final volume less than 1ml; finally, use Superdex ^TM 200 Increase 10/300GL Column (GE Healthcare) was used for molecular sieve chromatography to further purify the target protein. The molecular sieve chromatography buffer is PBS buffer (8mM Na ₂ HPO ₄ , 136mM NaCl, 2mM KH ₂ PO ₄ , 2.6mM KCl, pH 7.4).

The molecular sieve chromatography curves of PPP and PDO trimer proteins and the SDS-PAGE identification results of the eluate at the elution peak are shown in Figure 3 and Figure 4 respectively. It can be seen from Figure 3 and Figure 4 that PPP, PDO has an elution peak at around 13.5 mL. SDS-PAGE analysis of the eluate at this elution peak shows that non-reducing (loading buffer without dithiothreitol DTT) and reducing (containing Under the conditions of dithiothreitol (DTT) loading buffer), the sizes of the eluted proteins are all around 75KDa, which is consistent with the molecular sizes of the above two trimer proteins. The analytical ultracentrifugation method was used to identify the protein molecular weights of PPP and PDO as 80.5KDa (shown in Figure 5) and 72.5KDa (shown in Figure 6), respectively. Combined with the results of molecular sieves and SDS-PAGE pictures, it showed that the two proteins were Exists stably in the form of trimers. It was proved that PPP and PDO trimer proteins were purified, and the electrophoresis band was single, indicating that the purified protein had higher purity. In addition, PPP and PDO trimer proteins also had higher yields.

Example 3: Electron microscopy structural analysis of PPP and PDO trimer vaccines

PPP protein and CB6 Fab protein (for its preparation method, see Example 4 below) were mixed and incubated at 4°C for 12 hours. Then perform molecular sieve chromatography (pH8.0) through a Superdex ^TM 200 Increase 10/300GL column (GE Healthcare) to purify the complex of PPP protein and CB6 Fab protein. The molecular sieve chromatography curve is shown in Figure 7; In addition, the eluates at the two elution peaks were collected and subjected to SDS-PAGE identification. From the SDS-PAGE identification results, it can be seen that one of the elution peaks in Figure 7 is the complex of PPP protein and CB6 Fab, and the other One peak is excess CB6Fab, which indicates that PPP protein can bind to CB6Fab and form a complex. Using the same method, a complex protein of PDO homotrimeric protein and CB6 Fab was prepared (shown in Figure 8).

In addition, the eluate of the complex of PPP and CB6 Fab and the complex of PDO protein and CB6 Fab collected above were concentrated and used for cryo-electron microscopy analysis after concentration. The procedure is as follows:

Prepare the Quantifoil grid (specification 1.2/1.3) for sample preparation in advance and perform glow discharge hydrophilization treatment. Then, the prepared complex of PPP homologous RBD-Trimer protein and CB6 Fab and the complex of PDO chimeric RBD-Trimer protein and CB6 Fab were dropped on the prepared carrier network, and the automatic sample preparation machine Vitrobot Mark IV was used. Quickly insert the carrier grid into liquid ethane to complete sample preparation.

Data collection was performed using a 300 kV Titan Krios transmission electron microscope (Thermo Fisher Company) with a K3 direct electron detector camera, using the Serial-EM automated collection program to collect a large number of photos. Then, MotionCor2 software was used to perform drift correction on the collected raw data, CTFFIND4.1 software was used to perform contrast transfer function correction on the images, and Relion-3.1 software was used for further processing and final three-dimensional reconstruction of the images.

The cryo-electron microscope of the complex of PPP homotrimer and CB6 Fab is shown in Figure 9. It can be seen from Figure 9: In the complex structure of PPP homotrimer and CB6 Fab, the RBDs of the three prototypes are basically each The angle between the RBDs is about 120° and they are evenly dispersed. Each RBD can bind a CB6 Fab, indicating that each RBD can expose important immune epitopes, thereby stimulating specific immune responses in mice.

The cryo-electron microscopy image of the complex of PDO protein and CB6 Fab is shown in Figure 10. It can be seen from Figure 10: In the complex of PDO heterotrimeric protein and CB6 Fab, Prototype RBD, Delta RBD and Omicron RBD are relatively symmetrically distributed. ; And Prototype RBD and Delta RBD can each bind to a CB6 Fab, while Omicron RBD does not bind to CB6 Fab, indicating that the main epitope of the PDO heterotrimeric protein is fully exposed, which is conducive to activating specific immune responses.

Example 4: Detection of multiple antigenic epitopes of trimeric protein vaccine PPP or PDO through surface plasmon resonance experiment (SPR)

In this example, BIAcore 8k was used to conduct a surface plasmon resonance binding characteristic measurement experiment; specifically, a CM5 chip was used to fix the PPP and PDO trimer proteins expressed in 293F cells on the surface of the CM5 chip using the amino coupling method. The affinity to the human receptor molecule hACE2 and the Fab of multiple epitope antibody molecules of RBD was determined and compared with the monomeric RBD protein.

According to literature reports (Huang, M., et al., Atlas of currently available human neutralizing antibodies against SARS-CoV-2 and escape by Omicron sub-variants BA.1/BA.1.1/BA.2/BA.3.Immunity , 2022.55(8):p.1501-1514e3), the antigenic epitopes in the RBD region of the new coronavirus spike protein can be divided into 7 categories. In this example, one antibody is selected for each of the 7 categories of antibodies, including category 1. CB6 antibody (its heavy, The amino acid sequences of the light chain variable region are shown in SEQ ID NO: 13 and 14 respectively), REGN10933 of class 2 (the amino acid sequences of the heavy and light chain variable regions are shown in SEQ ID NO: 15 and 16 respectively) , ADI-56046 in Class 3 (the amino acid sequences of its heavy and light chain variable regions are shown in SEQ ID NO: 17 and 18 respectively), CV07-270 in Class 4 (the amino acid sequences of its heavy and light chain variable regions are shown in SEQ ID NO: 17 and 18 respectively), The amino acid sequences are shown in SEQ ID NO: 19 and 20 respectively), S309 of class 5 (the amino acid sequences of the heavy and light chain variable regions are shown in SEQ ID NO: 21 and 22 respectively), C022 of class 6 (The amino acid sequences of the heavy and light chain variable regions are shown in SEQ ID NO: 23 and 24 respectively), CR3022 of Class 7 (the amino acid sequences of the heavy and light chain variable regions are shown in SEQ ID NO: 25 and 24 respectively). shown in 26). The antibodies used in this experiment were all expressed and purified from the eukaryotic system 293F cells. Since the antibodies are all bivalent molecules, and the mobile phase must be in a monomeric state, we digested these antibodies with papain, and then purified them with a ProteinA affinity column to obtain the digested antibodies. Fab molecules thus flow through the CM5 chip surface as the mobile phase to determine the affinity of PPP and PDO to the antibodies. Use 10mM glycine buffer pH 1.5 as a regeneration solution to treat the chip to facilitate subsequent determination of antibody affinity. Each measurement included three independent measurements, and the mean ± standard error was calculated.

The binding status of PPP, PDO, the new coronavirus prototype strain RBD, the Delta variant RBD, and the Omicron BA.1 variant RBD with the human receptor molecule hACE2 and various antibodies is shown in Figure 11.

Then, the measured affinities were summarized, and the results are shown in Figure 12.

It can be seen from Figure 11 and Figure 12 that PPP and PDO can bind to the human receptor molecule hACE2 and seven kinds of antibody molecules targeting different epitopes with high affinity, indicating that the trimer immunogen PDO of the present application can combine various types of effective The antigenic epitope is fully exposed, therefore, it has the potential to stimulate the body to produce neutralizing antibodies against multiple sites.

Example 5: Experimental animal immunization and sample collection

In order to detect the immunogenicity of the trimeric protein, we used the purified trimeric protein PPP or PDO obtained in Example 2 as an immunogen to immunize BALB/c mice respectively. The negative control (Sham group) was immunized with PBS solution. Group 6 mice. The BALB/c mice used were purchased from Viton Lever Company. They were all female and 6-8 weeks old. The grouping of mice and the immunization dosage are shown in Table 1.

Table 1 Grouping and immunization dose of mice immunized with novel coronavirus RBD trimer vaccine

The specific procedures are as follows:

Dilute the immunogen PPP or PDO with PBS to 40 μg/ml respectively, mix and emulsify the diluted immunogen and SWE adjuvant at a volume ratio of 1:1 to prepare a vaccine. The negative control group was PBS solution mixed with SWE adjuvant.

The immunization protocol is shown in Figure 13. Specifically, BALB/c mice were immunized with the vaccine obtained by the above method through intramuscular injection. All mice were immunized for the first and second times on day 0 and day 21, respectively, with an inoculation volume of 100 μL each time. (Contains 2μg of antigenic protein). On days 19 and 35, blood was collected from the mice and centrifuged Serum was collected and stored in a -80°C refrigerator for titration of antigen-specific antibody titers and pseudovirus neutralizing antibody titers. The experimental flow of immunizing mice and sample collection is shown in Figure 13.

Example 6: Detection of antigen-specific binding antibody titers induced by trimeric protein vaccine PPP or PDO through enzyme-linked immunosorbent assay (ELISA)

In this example, an enzyme-linked immunosorbent assay (ELISA) was used to detect the antigen-specific antibody titers of the serum of mice immunized with the trimeric protein vaccines PPP and PDO in Example 5. The specific procedures are as follows:

(1) Dilute PPP and PDO trimer proteins to 3 μg/mL with ELISA coating solution (Solebao, C1050) respectively, add 100 μL of the above dilution solution to each well of a 96-well ELISA plate (Coring, 3590), 4 Leave it overnight (more than 12 hours) at ℃ for coating;

(2) Pour out the coating solution, add PBS, and wash once; use 5% skim milk in PBS as the blocking solution, add 100 μL per well to a 96-well plate, leave it at room temperature for 1 hour, block, and then wash it once with PBS solution ;

(3) During the blocking period, the mouse serum sample was diluted with blocking solution; the serum sample was diluted sequentially from 20 times according to a 4-fold gradient; specifically, 152 μL of blocking solution and 8 μL of serum sample were added to the first well and mixed well. The two dilutions are 120 μL of blocking solution and 40 μL of the solution in the first well, mix well, and dilute sequentially; after dilution, add 100 μL to each well of the ELISA plate, add blocking solution to the negative control group, incubate at 37°C for 2 hours, and then use Wash 4 times with PBS-T;

(4) Add HRP-conjugated goat anti-mouse secondary antibody (Biaoyijie, BE0102-100) diluted 1:2000 in blocking solution to each well, incubate at 37°C for 1.5 hours, and then wash with PBS-T for 5- 6 times; then, add 60 μL TMB chromogenic solution to develop color, add 60 μL 2M hydrochloric acid to terminate the reaction after an appropriate reaction time, and detect the OD450 reading on a microplate reader.

The antibody titer value was defined as the highest dilution of serum with a reaction value greater than 2.5 times the negative control value. When the reaction value at the lowest dilution factor (detection limit) is still less than 2.5 times the background value, the titer of the sample is defined as half of the lowest dilution factor, that is, 1:10.

The immunogenicity test results of the serum collected on day 19 (i.e., primary immune serum) and the serum collected on day 35 (i.e., secondary immune serum) are shown in Figure 14; Figure 14 results show that PPP and PDO trimers The vaccines produced corresponding antibodies after immunization. The specific binding antibody titer of the serum after the first immunization of the PPP trimer vaccine exceeded 10 ³ , while the specific binding antibody titer of the serum after the primary immunization of the PDO trimer vaccine exceeded 10 ⁴ , that is, the specific binding antibody titer of the serum after the first immunization of the PDO trimer vaccine exceeded 10 4 . The RBD-specific binding antibody in serum was significantly higher than that of PPP(***); the specific binding antibody titer of the serum after the second immunization of the PPP trimer vaccine exceeded 10 ⁵ , while that of the PDO trimer vaccine was close to 10 ⁶ . That is, the RBD-specific binding antibodies in the serum after the second immunization of PDO vaccine were significantly higher than those of PPP(*).

It can be seen from Figure 14 that the level of RBD-specific binding antibodies stimulated by the PDO trimer antigen in mice is significantly higher than that of PPP. That is, compared with the PPP homotrimer, the heterotrimeric antigen PDO of the present application has more Good immunogenicity, and immunogenicity is directly related to the effectiveness of the vaccine. In other words, these experimental results show that the PDO trimer antigen design of the present application has obvious advantages over PPP.

Example 7: Using a pseudovirus neutralization experiment to detect the neutralizing antibody titer against the new coronavirus pseudovirus produced after the second immunization of the trimeric protein vaccine PPP or PDO

Using the new coronavirus pseudovirus, the mouse serum after the second immunization (that is, collected on the 35th day) was tested for the new coronavirus prototype strain, Delta and Omicron (BA.1, BA.2, BA.2.75, BA. Pseudovirus neutralization titers (pVNT ₅₀ ) of pseudoviruses of mutant strains (subtype 4/5).

The new coronavirus pseudovirus used in this example is a pseudovirus displaying the new coronavirus S protein prepared based on the vesicular stomatitis virus (VSV) skeleton. For the preparation method, please refer to the methods section of the published papers of this research group (Zhao, X. , et al., Effects of a Prolonged Booster Interval on Neutralization of Omicron Variant.N EnglJ Med, 2022.386(9):p.894-896).

The method for detecting the neutralizing antibody titer of the new coronavirus pseudovirus (hereinafter referred to as the pseudovirus) is as follows:

In a 96-well plate, the immunized mouse serum was diluted with a 2-fold gradient, with an initial concentration of 1:20, and a total of 11 concentration gradients were set; then, the diluted immunized mouse serum and pseudovirus were mixed separately (blank culture The base and pseudovirus were mixed as negative control (NC), and the blank medium not mixed with pseudovirus was used as blank control (MOCK). Incubate at 37°C for 1 hour; then, transfer the immune mouse serum-pseudovirus mixture to the plated In a 96-well plate filled with Vero cells, after incubation at 37°C for 15 hours, positive cells were detected and calculated using a CQ1 confocal cell imager (Yokogawa). Then, a fitting curve was drawn in GraphPad Prism software to calculate 50% neutralization. The reciprocal of the corresponding serum dilution is the neutralizing titer pVNT ₅₀ .

The test results of pseudovirus neutralizing antibody titers in the serum of mice in each immunization group after the second immunization are shown in Figure 15.

As can be seen from Figure 15:

1) For the pseudovirus of the new coronavirus prototype strain, after the second immunization, the pVNT ₅₀ of the PPP trimer vaccine is 2228.6, while the pVNT ₅₀ of the PDO trimer vaccine is 7760.5, which is more than 3 times higher than the PPP vaccine, indicating that: the second immunization Finally, the neutralizing effect of the PDO trimer vaccine on the prototype strain of pseudovirus was significantly better than that of PPP(***);

2) Against the pseudovirus of the new coronavirus Delta variant strain, after the second immunization, the pVNT ₅₀ of the PPP trimer vaccine is 735.2, while the pVNT ₅₀ of the PDO trimer vaccine is 4457.2, which is 6 times higher than the PPP vaccine, indicating that: the second immunization Finally, the neutralizing effect of the PDO trimer vaccine on the Delta variant pseudovirus was significantly better than that of PPP(***);

3) Against the pseudovirus of the new coronavirus Omicron BA.1 variant strain, after the second vaccination, the pVNT ₅₀ of the PPP trimer vaccine is 10.7, while the pVNT ₅₀ of the PDO trimer vaccine is 844.5, which is nearly higher than the PPP vaccine 80 times, indicating that: after the second vaccination, the neutralizing effect of PDO on the pseudovirus of the Omicron BA.1 mutant strain is significantly better than that of PPP(***);

4) Against the pseudovirus of the new coronavirus Omicron BA.2 variant strain, after the second vaccination, the pVNT ₅₀ of the PPP trimer vaccine is 9.4, while the pVNT ₅₀ of the PDO trimer vaccine is 557.2, which is nearly higher than the PPP vaccine 60 times, indicating that after the second vaccination, the neutralizing effect of PDO on the pseudovirus of the Omicron BA.2 mutant strain is significantly better than that of PPP(***).

5) Against the pseudovirus of the new coronavirus Omicron BA.2.75 variant strain, after the second immunization, the pVNT ₅₀ of the PPP trimer vaccine is 219.5, while the pVNT ₅₀ of the PDO trimer vaccine is 2319.7, which is 10 higher than the PPP vaccine. times, difference Significant (**), indicating that after the second vaccination, the neutralizing effect of PDO on the pseudovirus of the Omicron BA.2.75 variant strain is significantly better than that of PPP.

6) Against the pseudovirus of the new coronavirus Omicron BA.4/5 mutant strain, after the second vaccination, the pVNT ₅₀ of the PPP trimer vaccine is 18.4, while the pVNT ₅₀ of the PDO trimer vaccine is 312.8, which is a PPP vaccine 17 times, the difference is significant (**), indicating that after the second vaccination, the neutralizing effect of PDO on the pseudovirus of the Omicron BA.4/5 mutant strain is significantly better than that of PPP.

Example 8: Using ELISpot assay to detect the secretion of IL-2, IL-4 and IFNγ in mouse splenocytes stimulated by RBD polypeptide library after PDO secondary immunization

In this example, the mice immunized with PDO in Example 5 were used. Two weeks after the second immunization, the spleens of the mice were taken and ground into spleen cells; the spleen cells were combined with the RBD polypeptide library (Beijing Zhongke Yaguang Biotechnology Co., Ltd. company) at 37°C for 36 hours to stimulate cytokine secretion; then, ELISpot detection of three cytokines IL-2, IL-4, and IFNγ was performed to determine their expression levels. At the same time, the splenocytes of mice immunized with PBS were used as a negative control; and the splenocytes of mice immunized with PBS and PMA (phorbol ester, purchased from Shenzhen Dawei Biotechnology Co., Ltd., can stimulate the production of mouse splenocytes. immunoreaction) as a positive control.

The specific experimental methods are as follows:

1. First add 20mL of 1640 medium to the culture dish and set aside;

2. Take the mouse spleen and transfer it to a culture dish;

3. Grind the splenocytes slowly with a grinding rod and rinse with 1640 culture medium;

4. Transfer the grinding fluid to a 50mL centrifuge tube and centrifuge at 500g for 5 minutes;

5. Add 4mL of red blood cell lysis solution and lyse for 5 minutes, then add 20mL of 1640 culture medium to dilute, and centrifuge at 500g for 5 minutes;

6. After pouring out the culture medium, first add 1 mL of 1640 culture medium, and remove the clumps of tissue cells, leaving only evenly dispersed cells;

7. Add 20mL of medium again, 500g, centrifuge for 5 minutes and discard the supernatant;

8. Resuspend the cells in 10 mL of complete medium (1640 medium + 10% FBS);

9. Use a cell counter to count cells;

10. Add the RBD polypeptide library diluted with culture medium to the blocked ELISpot 96-well plate (MSIPS4510, Mabtech), and then add mouse spleen cells (5×10 ⁵ cells/well);

11. Carefully transfer the 96-well ELISpot plate to the incubator and culture it for 36 hours. Try not to move it during this period. Then take the plate out of the incubator and proceed with the subsequent steps;

12. Lyse cells: Pour the cells and culture medium in the well, add 200 μL/well of ice-cold deionized water, and keep in ice bath at 4°C for 10 minutes;

13. Washing: Add 200 μL of PBST to each well and wash 5 times; for the last time, pat dry on absorbent paper;

14. Add detection antibodies (antibodies against IL-2, IL-4, and IFNγ were purchased from Mabtech and SWEDEN respectively): Add 100 μL of diluted biotin-labeled detection antibodies to each well and incubate at room temperature for 2 hours;

15. Washing: Add 200 μL of PBST to each well and wash 5 times; for the last time, pat dry on absorbent paper;

16. Add enzyme-labeled avidin: Add 100 μL of diluted enzyme-labeled avidin to each well and incubate at room temperature for 1 hour;

17. Washing: Add 200 μL of PBST to each well and wash 5 times; for the last time, pat dry on absorbent paper;

18. Color development: Add 100 μL of chromogenic solution to each well and let it stand at room temperature for 5-15 minutes. During this period, be careful to avoid light;

19. Wash and dry: After the spots grow to a suitable size, wash them twice with deionized water to stop the color development process; turn the plate upside down on absorbent paper, pat dry the tiny water droplets, then remove the protective layer and put it away. Leave it at room temperature for 30 minutes in a ventilated place to let the film dry naturally; be careful not to put the board in the oven to prevent the film from becoming brittle or cracking;

20. Result analysis: spot counting (MabtechASTORELISpot Reader, SWEDEN).

The ELISpot detection results of the trimeric protein PDO after secondary immunization are shown in Figure 16.

Figure 16 shows that for the three detected cytokines IL-2, IL-4 and IFNγ, the secretion levels have significant differences between the PDO immunization group and the PBS control group, indicating: compared with the PBS negative control group, The PDO immune group induced a balanced and versatile cellular immune response.

The above results show that SWE adjuvant can assist the PDO trimer protein vaccine to produce a better cellular immune response, which supplements the shortcomings of poor T cell response of the recombinant subunit vaccine.

In other words, the PDO trimer immunogen assisted by SWE adjuvant can not only stimulate B cell responses, but also stimulate the body to produce cellular immune responses and enhance the protective effect of the vaccine.

Example 9: Live virus challenge experiment

experimental method:

In order to evaluate the protective efficacy of candidate vaccine PDO, SARS-CoV-2 challenge protection experiments were conducted with four VOCs, namely Delta, Omicron BA.1, Omicron BA.2 and Omicron BA.4. The experimental grouping is shown in Table 2 below; the specific implementation plan is as follows: PBS and PDO were used to immunize four groups of BALB/c mice (female, 6-8 weeks old, purchased from Vitong Lever), according to the time nodes in Example 5. Two doses of 2 μg PDO vaccine (using SWE adjuvant) were administered (21 days apart), and serum was collected 2 weeks after the second vaccination for assessment of binding and neutralizing antibody titers. The results showed that compared with the PBS control group, the serum of PDO-immunized mice could detect higher titers of antigen-binding IgG (Figure 17), as well as neutral antibodies against Delta, OmicronBA.1, BA.2 and BA.4 pseudoviruses. and antibodies (Figure 18).

Since the spike protein S of the Delta strain does not contain the N501Y mutation, it is not susceptible to ordinary BALB/c mice. Therefore, human recombinant adenovirus type 5 (Ad5-) expressing hACE2 needs to be used before challenge (5 days). hACE2) was used to transduce mice to express the receptor protein hACE2 through intranasal instillation at a dose of 8×10 ⁹ vp per mouse to make the mice susceptible to Delta virus. Then, the mice were challenged with the Delta strain through intranasal instillation. The spike protein S of strains Omicron BA1, Omicron BA.2 and Omicron BA.4 all contain the N501Y mutation and are susceptible to ordinary BALB/c mice. Therefore, the new coronavirus can be challenged directly through intranasal instillation. , all virus attack-related experiments were completed in the ABSL-3 laboratory become.

Challenge virus strain information and dosage: Delta (NPRC 2.192100004), the challenge dose is 1.6×10 ⁴ TCID ₅₀ ; Omicron BA.1 (NPRC 2.192100009), the challenge dose is 8×10 ³ TCID ₅₀ ; Omicron BA.2( NPRC 2.192100010), the challenge dose is 7×10 ³ TCID ₅₀ ; Omicron BA.4 (NPRC2.192100012), the challenge dose is 3×10 ³ TCID ₅₀ .

Table 2. Grouping of experimental mice and corresponding challenge types

On the third day after the challenge, the mice were euthanized, and then the turbinates and lung tissues of the infected mice were collected, and the samples were stored in a -80°C refrigerator for later RNA extraction and viral load determination.

Example 10: Determination of virus titers in tissues (lungs and turbinates) after challenge

In this example, by extracting RNA from the lungs and turbinate tissues of mice in the PDO immune group and PBS group after challenge with the new coronavirus live virus in Example 9, RT-qPCR kit (Tiangen Biotech, China, No.: FP314), SARS-CoV-2-specific quantitative PCR (qRT-PCR) assay was performed on the CFX96 Touch real-time PCR detection system (Bio-Rad, USA). Specifically, a specific region of the N gene of the viral genome was detected ( See Chandrashekar, A., et al., SARS-CoV-2 infection protects against recallenge in rhesus macaques.Science, 2020.369(6505):p.812-817).

(1) Extraction of RNA (ABSL-3 laboratory):

Grind the turbinates and part of the lung samples, add 140 μL of the ground supernatant to the AVL solution (560 μL) of the RNA extraction kit, mix well, leave it for 10 minutes, then add 560 μL of 100% ethanol solution, mix well, and the virus will be inactivated.

Then perform RNA extraction according to the instructions of the QIAGEN viral RNA extraction kit; store the extracted RNA in a -80°C refrigerator for later use.

(2)qPCR experiment:

The following primers and probes are used to detect the viral genome of Delta VOC, sequence reference Xu, K., et al., Protective prototype-Beta and Delta-Omicron chimeric RBD-dimer against vaccines SARS-CoV-2.Cell,2022.185(13):p.2265-2278e14, details are as follows:

RNA-F,GACCCCAAAATCAGCGAAAT(SEQ ID NO:27);

RNA-R,TCTGGTTACTGCCAGTTGAATCTG(SEQ ID NO:28);

RNA probe-Delta,ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO: 29).

In the qRT-PCR analysis of the viral genome of Omicron mutant strains (BA.1, BA.2 and BA.4), the primer sequences used were the same as those of the above-mentioned Delta VOC, but the probe sequences used were different. For Omicron mutant strains ( The probe sequences for BA.1, BA.2 and BA.4) are:

RNA probe-Omicron, ACTCCGCATTACGTTTGGTGGACC (SEQ ID NO: 30).

According to Table 3 and Table 4, configure the qPCR system and set the qPCR program.

Table 3. qPCR system configuration

Table 4 qPCR program

The qPCR detection results of mouse lung and turbinate samples are shown in Figure 19.

Figure 19 shows that for the four viruses tested, the levels of lung virus gRNA in the PDO immunized mouse group were significantly lower than those in the PBS group, with significant differences: Delta (**), OmicronBA.1 (**), OmicronBA. 2(**),OmicronBA.4(**). Compared with the PBS group, the turbinate samples of the PDO immunized mouse group showed a 1383-fold reduction in Delta virus (**), a 145-fold reduction in OmicronBA.1 virus (*), a 44-fold reduction in OmicronBA.2 virus (*), and a 44-fold reduction in OmicronBA.4 virus. reduced by 16 times. This shows that PDO vaccine immunization significantly reduces the viral load in the lungs and turbinates of mice after challenge with Delta, OmicronBA.1, Omicron BA.2 and Omicron BA.4 strains.

Based on the above experimental results, it can be concluded that mice immunized with PDO as an immunogen can effectively reduce the viral load in the upper respiratory tract-turbinates and lower respiratory tract-lungs of mice in live virus challenge experiments. For many popular All new coronavirus mutant strains have shown good protective effects.

Example 11: Immunization and sample collection of a new batch of experimental animals

Immunization program:

Except for the third immunization on day 42 (the immunization dose was the same as the first two), the remaining procedures were the same as in Example 5.

Sample collection procedure:

On the 56th day (i.e., the 14th day after the third immunization), blood was collected from the orbital venous plexus of the mice, and the serum was collected by centrifugation. The resulting serum was stored in a -80°C refrigerator for titration of antigen-binding antibody titers and pseudo-antibody titers. Virus neutralizing antibody titers.

The experimental flow of immunizing mice and sample collection is shown in Figure 20.

Example 12: Using a pseudovirus neutralization experiment to detect the neutralizing antibody titer produced by the trimeric protein vaccine PPP or PDO against the new coronavirus pseudovirus after the third immunization.

Using the detection method described in Example 7, the immune mouse serum collected in Example 11 after three immunizations was tested against the new coronavirus prototype strain, Delta and Omicron (BA.1, BA.2, BA.2.75, BA.4 /5 subtype) pseudovirus neutralizing antibody titer (pVNT ₅₀ ) of the mutant strain.

The results are shown in Figure 21. It can be seen from Figure 21:

1) For the pseudovirus of the new coronavirus prototype strain, after three immunizations, the pVNT ₅₀ of the PPP trimer vaccine is 14902.9, while the pVNT ₅₀ of the PDO trimer vaccine is 26913.4, which is higher than the PPP vaccine, indicating that: after three immunizations, the pVNT 50 of the PDO trimer vaccine is 26913.4. The trimer vaccine has a better neutralizing effect on the prototype strain of pseudovirus than PPP;

2) Against the pseudovirus of the new coronavirus Delta variant strain, after three immunizations, the pVNT ₅₀ of the PPP trimer vaccine is 14085.1, while the pVNT ₅₀ of the PDO trimer vaccine is 46142.1, which is higher than the PPP vaccine, indicating that: after three immunizations, The PDO trimer vaccine has a better neutralizing effect on Delta variant pseudoviruses than PPP;

3) Against the pseudovirus of the new coronavirus Omicron BA.1 variant strain, after three immunizations, the pVNT ₅₀ of the PPP trimer vaccine is 427.6, while the pVNT ₅₀ of the PDO trimer vaccine is 12896.0, which is significantly higher than the PPP vaccine , indicating that: after three immunizations, the neutralizing effect of the PDO trimer vaccine on the pseudovirus of the Omicron BA.1 mutant strain is significantly better than that of PPP(**);

4) Against the pseudovirus of the new coronavirus Omicron BA.2 variant strain, after three immunizations, the pVNT ₅₀ of the PPP trimer vaccine is 393.4, while the pVNT ₅₀ of the PDO trimer vaccine is 14712.7, which is 37 of the PPP vaccine times, the difference is significant (**), indicating that: after three immunizations, the neutralizing effect of PDO on the pseudovirus of the Omicron BA.2 mutant strain is significantly better than that of PPP;

5) Against the pseudovirus of the new coronavirus Omicron BA.2.75 variant strain, after three immunizations, the pVNT ₅₀ of the PPP trimer vaccine is 534.8, while the pVNT ₅₀ of the PDO trimer vaccine is 11756.8, which is 20 of the PPP vaccine times, indicating that: after three immunizations, the neutralizing effect of PDO on the pseudovirus of the Omicron BA.2.75 mutant strain is significantly better than that of PPP, and the difference is significant (**).

6) Against the pseudovirus of the new coronavirus Omicron BA.4/5 mutant strain, after three immunizations, the pVNT ₅₀ of the PPP trimer vaccine is 89.5, while the pVNT ₅₀ of the PDO trimer vaccine is 6043.2, which is a PPP vaccine 67 times. It shows that after three immunizations, the neutralizing effect of PDO on the pseudovirus of the Omicron BA.4/5 mutant strain is significantly better than that of PPP, and the difference is significant (**).

A radar chart was produced based on the pseudovirus neutralization titer after the above three immunizations, as shown in Figure 22.

Figure 22 clearly shows that compared with the PPP homotrimer, the PDO trimer immunogen of the present application has a significantly better neutralizing effect on pseudoviruses of various SARS-CoV-2 popular mutant strains, especially Yes, the neutralization titer against the Omicron BA.4/5 pseudovirus has been significantly improved, demonstrating that PDO, as a new immunogen, can produce relatively broad-spectrum and balanced pseudovirus neutralization against a variety of popular strains. effect, and has strong potential to become a candidate immunogen for a new generation of SARS-CoV-2 vaccines.

Example 13. ELISpot assay to detect the secretion of IL-2, IL-4 and IFNγ in mouse splenocytes stimulated by RBD polypeptide library after triple immunization with PPP and PDO

For the mice in Example 11, after collecting blood on the 14th day after the third immunization, the mouse spleen was taken and ground, and the spleen cells were incubated with the RBD polypeptide library (Beijing Zhongke Yaguang Biotechnology Co., Ltd.) at 37°C for 36 hours. Stimulate cytokine secretion; then, perform ELISpot detection on three cytokines, IL-2, IL-4, and IFNγ, to determine their expression levels. At the same time, splenocytes from mice immunized with PBS were incubated with PBS as a negative control; and splenocytes from mice immunized with PBS were incubated with PMA as a positive control. Refer to Example 8 for specific experimental methods.

The ELISpot detection results after three immunizations of the trimeric protein PDO are shown in Figure 23.

Figure 23 shows that the secretion levels of these three cytokines (IL-2, IL-4 and IFNγ) are significantly different between the PDO immunization group and the PBS control group, indicating that compared with the PBS negative control group, the PDO vaccine Activates a balanced and versatile cellular immune response.

The above results show that SWE adjuvant can assist PDO trimer protein vaccine to produce better cellular immune response. That is, the PDO trimer immunogen assisted by SWE adjuvant can not only stimulate B cell responses, but also effectively stimulate the body to produce cellular immune responses and enhance the protective effect of the vaccine.

Based on the above experimental results, it can be concluded that compared with the homotrimeric PPP, the heterotrimeric antigen PDO of the present application has the following advantages:

(1) Compared with PPP, the serum of PDO-immunized mice showed potency against the new coronavirus prototype strain, Delta, and Omicron BA.1, BA.2, BA.2.75, and BA.4/5 mutant strains. Higher and broader spectrum neutralizing and protective activity.

In particular, for the currently popular strains Omicron BA.1, BA.2, BA.2.75 and BA.4/5 subtypes, the serum of mice in the PPP group has basically lost its ability to target various Omicron subtypes. Pseudovirus neutralizing activity; while the serum of mice in the PDO group showed higher neutralizing activity against Omicron BA.1, BA.2, and BA.2.75 pseudoviruses; specifically, the serum of mice after PDO's second immunization was specific against BA. The pVNT ₅₀ of 4/5 is 312.8, and the mouse serum after triple immunization with PDO is against BA.4/5 The pVNT ₅₀ is 6043, and the neutralizing titer of the serum after three immunizations has been greatly improved. Therefore, the serum after three immunizations with PDO also has a good neutralizing effect on BA.4/5.

(2) PDO supplemented with SWE adjuvant can stimulate multifunctional cellular immune responses in mice.

According to the ELISpot experimental results after the second and third immunizations of SWE adjuvant and the trimeric vaccine PDO expressed in eukaryotic 293F cells, compared with the PBS control group, the PDO immunization group can significantly stimulate IL-2, IL-4 and IFNγ The production of three cytokines shows that SWE adjuvant can assist PDO trimer protein vaccine to produce better T cell response.

(3) The experimental results of live virus challenge and protection showed that compared with the PBS control group, the viral gRNA load in the lungs and turbinates of mice after PDO immunization decreased significantly.

Specifically, after mice in the PDO immune group were challenged with live viruses of the new coronavirus popular mutant strains Delta, Omicron BA.1, Omicron BA.2 and Omicron BA.4, their lungs and The viral gRNA load in the turbinates was significantly lower than that in the PBS control group. In particular, when challenged with the live virus of Omicron BA.4, the viral load in the turbinates of mice in the PDO immunized group was 15.6 times lower than that in the PBS control group, which indicates that it has the effect of preventing infection and transmission. .

The PDO trimer vaccine has significant neutralizing effects against pseudoviruses of the new coronavirus Delta, Omicron BA.1, Omicron BA.2 and Omicron BA.4/5 mutant strains. Sexually higher than PPP. Especially after three immunizations, from the radar chart shown in Figure 20, the mouse serum after PDO immunization is more effective against the prototype strain, Delta, Omicron BA.1, Omicron BA.2, Omi Cron BA, 2.75 and Omicron BA.4/5 demonstrated a relatively uniform and broad-spectrum neutralizing and protective effect against pseudoviruses. As we all know, in the past year, Delta mutant strains and Omicron mutant strains have become widespread around the world, posing a serious threat to the life and health of people around the world. The above experiments have confirmed that the PDO trimer vaccine of the present application targets Delta and Omicron mutants. Both strains can induce a strong immune response, indicating that it will have a good immune protection effect against these two mutant strains and has broad application prospects.

In summary, the PDO trimer vaccine of the present application can induce a stronger and broader-spectrum immune response; the current circulating new coronavirus strains change rapidly, and the types of future circulating strains and their immunological characteristics are extremely It is difficult to predict, so the above characteristics of PDO vaccine have great application value in preventing changes in circulating strains or the co-circulation of multiple strains.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that it can still be Modifications are made to the technical solutions described in the foregoing embodiments, or equivalent substitutions are made to some of the technical features; however, these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solution of the present application.

Industrial applicability

The recombinant chimeric antigens of the new coronavirus prototype strain, Delta and Omicron mutant strains provided in this application have high immunogenicity and can induce the production of high-level neutralizing antibodies against the original virus strain and a series of mutant strains, which is expected to Become a broad-spectrum vaccine to prevent the new coronavirus.

The sequences used in this article are as follows:

SEQ ID NO: 1-Amino acid sequence of R319-L533 region of prototype strain S protein RBD (215aa)

SEQ ID NO: Amino acid sequence of V320-L533 region of S protein RBD of 2-Delta variant strain (214aa)

SEQ ID NO: Amino acid sequence of V320-K537 region of S protein RBD of 3-Omicron mutant strain (218aa)

SEQ ID NO:4-Full-length amino acid sequence of PDO vaccine example (SEQ ID NO:1+SEQ ID NO:2+SEQ ID NO :3) (647aa)

SEQ ID NO:5 – DNA sequence encoding SEQ ID NO:4 (1941 bp)

SEQ ID NO:6 – mRNA sequence encoding SEQ ID NO:4 (1941 bp)

SEQ ID NO:7 – Signal peptide sequence

SEQ ID NO:8 – Construct of prototype strain RBD trimer PPP (680aa)

SEQ ID NO:9 – Signal peptide sequence

SEQ ID NO: 10 – Construct of prototype strain-Delta-Omicron chimeric RBD trimer PDO (672aa)

SEQ ID NO: 11 - DNA sequence of the construct encoding prototype strain RBD trimer PPP (i.e., SEQ ID NO: 8) (2040bp)

SEQ ID NO: 12 – DNA sequence (2016 bp) encoding the construct encoding the prototype strain-Delta-Omicron chimeric RBD trimer PDO (i.e., SEQ ID NO: 10)

SEQ ID NO:13-CB6 antibody heavy chain variable region amino acid sequence (115aa)

SEQ ID NO: 14-CB6 antibody light chain variable region amino acid sequence (109aa)

SEQ ID NO:15-REGN10933 antibody heavy chain variable region amino acid sequence (116aa)

SEQ ID NO:16-REGN10933 antibody light chain variable region amino acid sequence (107aa)

SEQ ID NO:17-ADI-56046 Antibody heavy chain variable region amino acid sequence (120aa)

SEQ ID NO:18-ADI-56046 Antibody light chain variable region amino acid sequence (112aa)

SEQ ID NO:19-CV07-270 Antibody heavy chain variable region amino acid sequence (125aa)

SEQ ID NO:20-CV07-270 Antibody light chain variable region amino acid sequence (112aa)

SEQ ID NO:21-S309 antibody heavy chain variable region amino acid sequence (123aa)

SEQ ID NO:22-S309 antibody light chain variable region amino acid sequence (107aa)

SEQ ID NO:23-C022 antibody heavy chain variable region amino acid sequence (125aa)

SEQ ID NO:24-C022 antibody light chain variable region amino acid sequence (107aa)

SEQ ID NO: 25-CR022 antibody heavy chain variable region amino acid sequence (115aa)

SEQ ID NO:26-CR022 antibody light chain variable region amino acid sequence (113aa)

SEQ ID NO:27-qPCR upstream primer (20bp)

SEQ ID NO:28-Downstream primer for qPCR (24bp)

SEQ ID NO:29-qPCRDelta probe (24bp)

SEQ ID NO:30-qPCROmicron probe (24bp)

Claims (19)

1. A recombinant chimeric antigen of the new coronavirus prototype strain, Delta and Omicron mutant strains, characterized in that: the amino acid sequence of the recombinant chimeric antigen includes: (A-B)-C1-(A-B')-C2- Amino acid sequences arranged in the (A-B”) pattern, where:

   A-B represents the amino acid sequence of the RBD domain of the S protein of the new coronavirus prototype strain or a part thereof, or has at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with it and is the same or Substantially identical immunogenic amino acid sequences,

   A-B' represents the amino acid sequence of the RBD domain of the S protein of the new coronavirus Delta variant strain or a part thereof, or has at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with it and having the same or substantially the same immunogenic amino acid sequence,

   A-B” represents the amino acid sequence of the RBD domain of the S protein of the new coronavirus Omicron variant strain or a part thereof, or has at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with it and has the same The same or substantially the same immunogenic amino acid sequence, and

   C1 and C2 are the same or different, and each independently represents the linker (GGS) _n , where n=0, 1, 2, 3, 4 or 5.
2. The recombinant chimeric antigen according to claim 1, characterized in that: a part of the RBD domain of the S protein of the new coronavirus prototype strain is at least 70%, 80%, 85%, 90%, and 92% of its entire amino acid sequence. %, 95%, 96%, 97%, 98% or 99%;

   And/or, a part of the RBD domain of the S protein of the new coronavirus Delta variant strain is at least 70%, 80%, 85%, 90%, 92%, 95%, 96%, 97% of its entire amino acid sequence. 98% or 99%;

   And/or, a part of the RBD domain of the S protein of the new coronavirus Omicron variant is at least 70%, 80%, 85%, 90%, 92%, 95%, 96%, 97% of its entire amino acid sequence. 98% or 99%;

   and/or, n=0,1,2 or 3.
3. The recombinant chimeric antigen according to claim 1 or 2, characterized in that: the amino acid sequence of the S protein RBD domain of the new coronavirus prototype strain or a part thereof is as shown in SEQ ID NO: 1, or as shown in SEQ ID NO : An amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence shown in 1 and having the same or substantially the same immunogenicity;

   And/or, the amino acid sequence of the S protein RBD domain of the new coronavirus Delta variant strain or a part thereof is as shown in SEQ ID NO:2, or the amino acid sequence as shown in SEQ ID NO:2 is substituted, deleted or added An amino acid sequence derived from one or several amino acids and having the same or substantially the same immunogenicity;

   And/or, the amino acid sequence of the S protein RBD domain of the new coronavirus Omicron variant strain or a part thereof is as shown in SEQ ID NO: 3, or the amino acid sequence as shown in SEQ ID NO: 3 is substituted, deleted or added An amino acid sequence derived from one or several amino acids and having the same or substantially the same immunogenicity;

   and/or, n=0, 1 or 2.
4. The recombinant chimeric antigen according to any one of claims 1-3, characterized in that: A-B represents the amino acid sequence shown in SEQ ID NO: 1, and A-B' represents the amino acid sequence shown in SEQ ID NO: 2 "Sequence, A-B" represents the amino acid sequence shown in SEQ ID NO:3;

   Preferably, the recombinant chimeric antigen includes the amino acid sequence shown in SEQ ID NO:4.
5. A method for preparing a recombinant chimeric antigen according to any one of claims 1-4, which includes the following steps: in 5 of the nucleotide sequence encoding a recombinant chimeric antigen according to any one of claims 1-4 Add Kozak sequence and signal peptide coding sequence to the 'end, add the coding sequence of histidine tag and stop codon to the 3' end, clone and express, screen the correct recombinant, and then transfect it into expression system cells for expression , collect the cell culture supernatant, and isolate the recombinant antigen therefrom.
6. The preparation method according to claim 5, characterized in that: the expression system cells are mammalian cells, insect cells, yeast cells or bacterial cells;

   Optionally, the mammalian cells are HEK293T cells, 293F series cells or CHO cells; further optionally, the 293F series cells are HEK293F cells, Freestyle293F cells or Expi293F cells;

   Alternatively, the insect cells are sf9 cells, Hi5 cells, sf21 cells or S2 cells;

   Optionally, the yeast cell is a Pichia pastoris cell or a yeast cell modified therefrom;

   Optionally, the bacterial cells are E. coli cells.
7. A polynucleotide encoding the recombinant chimeric antigen according to any one of claims 1-4.
8. The polynucleotide according to claim 7, characterized in that: the polynucleotide is DNA or mRNA;

   Preferably, the polynucleotide is the DNA sequence shown in SEQ ID NO:5;

   Preferably, the polynucleotide is the mRNA sequence shown in SEQ ID NO:6.
9. A nucleic acid construct comprising the polynucleotide of claim 7 or 8, and optionally, at least one expression control element operably linked to the polynucleotide.
10. An expression vector comprising the nucleic acid construct of claim 9.
11. A host cell transformed or transfected with the polynucleotide according to claim 7 or 8, the nucleic acid construct according to claim 9 or the expression vector according to claim 10.
12. The recombinant chimeric antigen according to any one of claims 1 to 4, the polynucleotide according to claim 7 or 8, the nucleic acid construct according to claim 9, and the expression vector according to claim 10 Or the application of the host cell as claimed in claim 11 in the preparation of drugs for preventing and/or treating novel coronavirus infection;

    Preferably, the drug is a vaccine;

    Preferably, the new coronavirus is one or more selected from the following: original strain of SARS-CoV-2, mutant strain of SARS-CoV-2 Alpha (B.1.1.7), Beta (B.1.351 ), Gamma(P.1), Kappa(B.1.617.1), Delta(B.1.617.2), Omicron subtype BA.1, BA.1.1, BA.2, BA.2.12.1, BA. 3. BA.4, BA.5.
13. A vaccine or immunogenic composition comprising the recombinant chimeric antigen according to any one of claims 1-4, the polynucleotide according to claim 7 or 8, and the nucleic acid according to claim 9 A construct, an expression vector as claimed in claim 10 or a host cell as claimed in claim 11, and a physiologically acceptable vehicle, adjuvant, excipient, carrier and/or diluent.
14. The vaccine or immunogenic composition according to claim 13, which is a new coronavirus recombinant protein vaccine, which includes the recombinant chimeric antigen and adjuvant as described in any one of claims 1-4;

    Optionally, the adjuvant is one or more selected from the following adjuvants: aluminum adjuvant, MF59 adjuvant and MF59-like adjuvant.
15. The vaccine or immunogenic composition according to claim 13, which is a new coronavirus DNA vaccine, and the DNA vaccine includes:

    (1) Eukaryotic expression vector; and

    (2) A DNA sequence encoding the recombinant chimeric antigen according to any one of claims 1-4 constructed into the eukaryotic expression vector;

    Optionally, the eukaryotic expression vector is selected from pGX0001, pVAX1, pCAGGS and pcDNA series vectors.
16. The vaccine or immunogenic composition according to claim 13, which is a new coronavirus mRNA vaccine, and the mRNA vaccine includes:

    (1) The mRNA sequence encoding the recombinant chimeric antigen according to any one of claims 1-4; and

    (II) Lipid nanoparticles.
17. The vaccine or immunogenic composition according to claim 13, which is a novel coronavirus-viral vector vaccine, comprising:

    (1) Viral backbone vector; and

    (2) A DNA sequence encoding the recombinant chimeric antigen according to any one of claims 1 to 4 constructed into the viral backbone vector;

    Optionally, the viral backbone vector is selected from one or more of the following viral vectors: adenovirus vector, poxvirus vector, influenza virus vector, and adeno-associated virus vector.
18. The vaccine or immunogenic composition according to any one of claims 13-17, characterized in that the vaccine or immunogenic composition is in the form of a nasal spray, oral preparation, suppository or parenteral preparation;

    Preferably, the nasal spray is selected from aerosols, sprays and powder sprays;

    Preferably, the oral preparation is selected from tablets, powders, pills, powders, granules, fine granules, soft/hard capsules, film-coated agents, pellets, sublingual tablets and ointments;

    Preferably, the parenteral preparation is a transdermal preparation, an ointment, a plaster, a topical liquid, an injectable or a pushable preparation.
19. A kit comprising the recombinant chimeric antigen according to any one of claims 1-4, The polynucleotide of claim 7 or 8, the nucleic acid construct of claim 9, the expression vector of claim 10, the host cell of claim 11 and/or any of claims 13-18 A vaccine or immunogenic composition as described above, and optionally other types of novel coronavirus vaccines.