WO2023186170A1 - Chimeric antigen of sars-cov-2 delta and omicron variants, and preparation method therefor and use thereof - Google Patents

Abstract

The present application relates to a chimeric antigen of SARS-CoV-2 Delta and Omicron variants, and a preparation method therefor and the use thereof. The recombinant antigen of the present application is formed by: (1) a specific amino acid sequence from a SARS-CoV-2 Delta variant RBD protein; and (2) a specific amino acid sequence from a SARS-CoV-2 Omicron variant RBD protein by means of an appropriate linking sequence or direct linking in series. Compared to an RBD homodimer of an original SARS-CoV-2 strain or a variant thereof, the recombinant antigen of the present application can activate broad-spectrum protective antibodies more efficiently, and can also achieve a good prevention or treatment effect on the original strain and existing various variants.

Description

A novel coronavirus Delta and Omicron variant chimeric antigen, its preparation method and application

cross reference

This application claims the priority of the Chinese patent application submitted on April 1, 2022, with the application number 202210340144.6 and the invention title "A new coronavirus Delta and Omicron variant chimeric antigen, its preparation method and application", which The entire contents are incorporated herein by reference.

Technical field

This application relates to the field of biomedicine, specifically to a new coronavirus Delta and Omicron variant chimeric antigen, its preparation method and application.

Background technique

Novel coronavirus pneumonia (also known as COVID-19) is an acute respiratory infectious disease caused by infection with a new coronavirus (also known as new coronavirus, SARS-CoV-2). The new coronavirus belongs to the beta-coronavirus genus of the family Coronaviridae. It has an envelope and is a positive-strand RNA virus. The spike (S) protein on the surface of the new coronavirus is responsible for the receptor recognition and membrane fusion of the virus. The receptor binding domain (RBD) on the S protein is an important vaccine target. It stimulates the production of neutralizing antibodies and has immunity. Focused advantages. In the early days of the COVID-19 epidemic, we urgently developed the recombinant subunit protein vaccine ZF2001 based on the COVID-19 RBD dimer, which showed good immunogenicity and protective effects in subsequent clinical trials.

At present, the COVID-19 epidemic is still severe around the world. New coronavirus mutant strains continue to emerge and spread, some of which can escape the immune response of existing vaccines and cause breakthrough infections. In particular, the Delta and Omicron mutant strains have swept the world and become the dominant epidemic strains. The Omicron mutant strain has as many as 32 S protein mutation sites. It has severe immune evasion against the humoral immune response activated by new coronavirus neutralizing antibody drugs and vaccines, posing severe challenges to the current epidemic prevention and control. However, some studies have reported that although the immune response activated by vaccines developed with Omicron sequences is strong against Omicron variants, the cross-reactivity against prototype strains and other strains is very weak, and is not suitable for the current coexistence of prototype strains and multiple mutant strains. , and the prevailing mutant strains are still changing rapidly. Therefore, it is necessary to develop a vaccine that has a strong protective effect against the current global epidemic strains and can induce a broad-spectrum immune response, which can be useful for the prevention and control of the new coronavirus epidemic. play a vital role.

The information disclosed in this Background section is merely intended to increase understanding of the general context of the application and should not be considered an admission or in any way implied that the information constitutes prior art that is already known to a person of ordinary skill in the art.

Contents of the invention

Purpose of invention

The purpose of this application is to provide a recombinant chimeric antigen of the new coronavirus Delta and Omicron mutant strains, its related products, and its preparation methods and applications. The recombinant antigen according to the present application is (1) the specific amino acid sequence of the RBD protein from the new coronavirus Delta variant strain or is at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to it specific amino acid sequence and (2) a specific amino acid sequence of the RBD protein from the new coronavirus Omicron variant strain or an amino acid with at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto The single-chain dimer formed by directly connecting the sequences or connecting them through appropriate connecting sequences can effectively activate broad-spectrum protective antibodies and can effectively prevent or prevent the original strain and various current mutant strains. treatment effect.

solution

In order to achieve the purpose of this application, this application provides the following technical solutions:

In the first aspect, this application provides a recombinant chimeric antigen of the new coronavirus Delta and Omicron variants. The amino acid sequence of the recombinant antigen includes: (A-B)-(A-B') or (A-B)-C -Amino acid sequences arranged in the (A-B') pattern, wherein:

A-B represents an amino acid sequence as set forth in SEQ ID NO:1 or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto,

A-B’ represents an amino acid sequence as set forth in SEQ ID NO:2 or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto, and

C represents the connection sequence.

In a feasible implementation of the above recombinant antigen, C represents a connection sequence shown as (GGS) _n , where n represents the number of GGS, and n is an integer between 1 and 10, preferably 1-5 integers between.

In a preferred embodiment of the above recombinant antigen, the amino acid sequence of the recombinant antigen includes: an amino acid sequence arranged in the (A-B)-(A-B’) pattern, wherein:

A-B represents the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto, preferably as SEQ ID NO: The amino acid sequence shown in 1;

A-B' represents the amino acid sequence shown in SEQ ID NO:2 or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with it, preferably as SEQ The amino acid sequence shown in ID NO:2.

In a preferred embodiment, the amino acid sequence of the recombinant antigen is shown in SEQ ID NO: 3.

In a second aspect, this application provides a method for preparing a recombinant antigen as described in the first aspect, which includes the following steps:

Add a sequence encoding a signal peptide to the 5' end of the nucleotide sequence encoding the recombinant antigen as described in the first aspect, add histidine and a stop codon to the 3' end, perform cloning and expression, and screen the correct recombinant , then transfect it into cells of the expression system for expression, collect the cell culture supernatant, and isolate the recombinant antigen therefrom.

In a feasible implementation of the above preparation method, the cells of the expression system include mammalian cells, Insect cells, yeast cells, or bacterial cells;

Alternatively, the mammalian cells include HEK293T cells, HEK293F cells, Expi293F cells or CHO cells;

Optionally, the bacterial cells comprise E. coli cells.

In a third aspect, the present application provides a polynucleotide encoding the recombinant antigen as described in the first aspect.

The polynucleotide is a nucleotide sequence optimized by human codons, and can be DNA or mRNA;

Preferably, the polynucleotide is the nucleotide sequence shown in SEQ ID NO:4.

In a fourth aspect, the present application provides a nucleic acid construct comprising the polynucleotide as described in the third aspect above, and optionally, at least one expression control element operably linked to the polynucleotide.

In a fifth aspect, the present application provides an expression vector comprising the nucleic acid construct described in the fourth aspect.

In the sixth aspect, the present application provides a transformed cell, which includes the polynucleotide as described in the third aspect, the nucleic acid construct as described in the fourth aspect, or the expression vector as described in the fifth aspect. .

In the seventh aspect, the present application provides the recombinant antigen as described in the first aspect, the polynucleotide as described in the third aspect, the nucleic acid construct as described in the fourth aspect, the fifth aspect as described above The application of the expression vector or the transformed cells as described in the sixth aspect above in the preparation of a new coronavirus vaccine.

In the eighth aspect, the present application provides a vaccine or immunogenic composition, which includes the recombinant antigen as described in the first aspect, the polynucleotide as described in the third aspect, the fourth aspect as described above The nucleic acid construct, the expression vector as described in the fifth aspect above or the transformed cells as described in the sixth aspect above, and physiologically acceptable vehicles, adjuvants, excipients, carriers and/or diluents.

In a preferred embodiment, the vaccine or immunogenic composition is a novel coronavirus recombinant protein vaccine, which includes the recombinant antigen and adjuvant as described in the first aspect above;

Optionally, the adjuvant is one or more selected from the following adjuvants: aluminum adjuvant, MF59 adjuvant and MF59-like adjuvant.

In another preferred embodiment, the vaccine or immunogenic composition is a novel coronavirus DNA vaccine, which includes:

(1) Eukaryotic expression vector; and

(2) The DNA sequence encoding the recombinant antigen described in the first aspect is constructed into the eukaryotic expression vector;

Optionally, the eukaryotic expression vector is selected from pGX0001, pVAX1, pCAGGS and pCDNA series vectors.

In another preferred embodiment, the vaccine or immunogenic composition is a novel coronavirus mRNA vaccine, which includes an mRNA sequence encoding a recombinant antigen as described in the first aspect above and lipid nanoparticles.

In another preferred embodiment, the vaccine or immunogenic composition is a novel coronavirus-viral vector vaccine, which includes:

(1) Viral backbone vector; and

(2) The nucleic acid sequence encoding the recombinant antigen described in the first aspect is constructed into the viral backbone vector;

Optionally, the viral backbone vector is selected from one or more of the following viral vectors: adenovirus vector, poxvirus vector, influenza virus vector, and adeno-associated virus vector.

In a feasible implementation, the vaccine or immunogenic composition is in the form of a nasal spray, oral preparation, suppository or parenteral preparation;

Preferably, the nasal spray is selected from aerosols, sprays and powder sprays;

Preferably, the oral preparation is selected from tablets, powders, pills, powders, granules, fine granules, soft/hard capsules, film-coated agents, pellets, sublingual tablets and ointments;

Preferably, the parenteral preparation is a transdermal preparation, an ointment, a plaster, a topical liquid, an injectable or a pushable preparation.

beneficial effects

The inventor of the present application has designed a recombinant chimeric antigen of the new coronavirus Delta and Omicron mutant strains. The recombinant antigen consists of (1) the specific amino acid sequence of the RBD protein from the new coronavirus Delta mutant strain or has at least 90% similarity with it. , 92%, 95%, 96%, 97%, 98% or 99% identical amino acid sequence and (2) a specific amino acid sequence of the RBD protein from the new coronavirus Omicron variant strain or having at least 90%, 92% identity with it , 95%, 96%, 97%, 98% or 99% identical amino acid sequences are directly concatenated or concatenated through appropriate connecting sequences, which can induce the production of high levels of virus against the original virus strain as well as a series of major mutant strains. Neutralizing antibodies are expected to become a broad-spectrum vaccine to prevent the new coronavirus.

Description of drawings

One or more embodiments are exemplified by the pictures in the corresponding drawings, and these exemplary illustrations do not constitute limitations to the embodiments. The word "exemplary" as used herein means "serving as an example, example, or illustrative." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior or superior to other embodiments.

Figure 1 shows the new coronavirus prototype strain RBD dimer (referred to as prototype RBD-dimer), Delta variant strain RBD dimer (referred to as Delta RBD-dimer), and Omicron variant strain RBD dimer constructed and expressed in Example 1 of the present application. Structural schematic diagram of the polymer (referred to as Omicron RBD-dimer) and the chimeric RBD dimer formed by connecting Delta RBD and Omicron RBD (referred to as Delta-Omicron chimeric RBD-dimer, representing the recombinant antigen of the present application).

Figure 2 is the absorbance curve of the Delta-Omicron chimeric RBD-dimer protein purified using a nickel affinity column as described in Example 1 of the present application, as well as the SDS-PAGE identification results of the collected elution peaks. The position indicated by the arrow is the target The elution peak where the protein is located.

Figure 3 is the absorbance curve of the eluate containing the Delta-Omicron chimeric RBD-dimer protein purified by the nickel affinity column and subjected to molecular sieve chromatography (to further purify the protein) as described in Example 1 of the present application, and SDS-PAGE identification results of the collected elution peaks (under non-reducing or reducing conditions), the position indicated by the arrow is the elution peak where the target protein is located.

Figure 4 is the absorbance curve of the eluate containing the prototype RBD-dimer protein purified by the nickel affinity column and subjected to molecular sieve chromatography (to further purify the protein) as described in Example 1 of the present application, as well as the collected elution SDS-PAGE identification results of peaks. The position indicated by the arrow is the elution peak where the target protein is located.

Figure 5 is the absorbance curve of molecular sieve chromatography (to further purify the protein) of the eluate containing the Delta RBD-dimer protein purified by the nickel affinity column as described in Example 1 of the present application, and the collected elution SDS-PAGE identification results of peaks. The position indicated by the arrow is the elution peak where the target protein is located.

Figure 6 is the absorbance curve of the eluate containing the Omicron RBD-dimer protein purified by the nickel affinity column and subjected to molecular sieve chromatography (to further purify the protein) as described in Example 1 of the present application, as well as the collected elution SDS-PAGE identification results of peaks. The position indicated by the arrow is the elution peak where the target protein is located.

Figure 7 is a schematic diagram of the three-dimensional structure of the RBD protein of the new coronavirus prototype strain from different perspectives as described in Example 2 of the present application. In it, the mutated amino acid positions of the Delta and Omicron mutant strains in the RBD protein, the new coronavirus receptor are marked. Binding epitopes of human hACE2 and 5 representative antibodies (CB6, CV07-270, C110, S309 and CR3022).

Figure 8 shows the novel coronavirus receptor protein hACE2 and the representative antibodies CB6, CV07-270, C110, S309 and CR3022 of five different antibody epitopes and the antigens detected through surface plasmon resonance experiments as described in Example 2 of the present application. Protein binding affinity data for epitope identification of antigenic proteins.

Figure 9 is the absorbance curve of the complex of Delta-Omicron chimeric RBD-dimer protein and CB6 Fab purified by molecular sieve chromatography technology as described in Example 3 of the present application. Among them, one elution peak is Delta-Omicron chimeric RBD. -Dimer protein complex with CB6 Fab, another elution peak is excess CB6 Fab.

Figure 10 is a schematic diagram of the cryo-electron microscopy structure of the complex of Delta-Omicron chimeric RBD-dimer protein and CB6 Fab as described in Example 3 of the present application.

Figure 11 is a schematic diagram of the mutation sites of the S protein of the new coronavirus Alpha, Beta, Delta and Omicron mutant strains relative to the S protein of the new coronavirus prototype strain as described in Example 4 of the present application.

Figure 12 is the neutralization titer results of the serum collected from mice after the second immunization with the immunogen against the pseudovirus of the new coronavirus prototype strain and each new coronavirus mutant strain as described in Example 4 of the present application.

Figure 13 is the detection result of the viral load in the lung tissue of mice collected on the 3rd day after the Delta mutant strain was challenged with the mice in each immune group as described in Example 5 of the present application, where gRNA represents viral genomic RNA and sgRNA Represents viral subgenomic RNA.

Figure 14 is the neutralizing resistance of the serum of immunized mice to the Delta variant pseudovirus as described in Example 5 of the present application. Correlation analysis between the body titer and the viral gRNA load in the lung tissue of the immunized mice after challenge with the Delta mutant strain.

Figure 15 is the detection result of the viral load in the lung tissue of mice collected on the 3rd day after the mice in each immune group were challenged with Omicron mutant strains as described in Example 5 of the present application, where gRNA represents viral genomic RNA and sgRNA Represents viral subgenomic RNA.

Figure 16 is described in Example 5 of the present application. The neutralizing antibody titer of the serum of the immunized mice against the Omicron variant pseudovirus and the viral gRNA load in the lung tissue of the immunized mice after the Omicron variant challenged the virus. Correlation analysis.

Figure 17 is a representative HE staining pathological picture of the lung tissue of each group of mice after challenging each group of immunized mice with Delta or Omicron mutant strains as described in Example 5 of the present application.

Detailed ways

In order to make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present application, not all of them. Embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of this application.

In addition, in order to better explain the present application, numerous specific details are given in the following detailed description. It will be understood by those skilled in the art that the present application may be practiced without certain specific details. In some embodiments, raw materials, components, methods, means, etc. that are well known to those skilled in the art are not described in detail in order to highlight the gist of the present application.

Unless expressly stated otherwise, throughout the specification and claims, the term "comprises" or its variations such as "comprises" or "comprising" will be understood to include the stated elements or components, and to Other elements or other components are not excluded.

Example 1: Construction, expression and purification of SARS-CoV-2 prototype strain RBD dimer, Delta variant RBD dimer, Omicron variant RBD dimer and Delta-Omicron chimeric RBD dimer protein

According to the schematic diagram of the RBD dimer structure shown in Figure 1, the RBD dimer of the new coronavirus prototype strain (referred to as prototype RBD-dimer), the RBD dimer of the Delta variant strain (referred to as Delta RBD-dimer), and the Omicron variant strain were designed respectively. The constructs of RBD dimer (referred to as Omicron RBD-dimer) and chimeric RBD dimer formed by connecting Delta RBD and Omicron RBD (referred to as Delta-Omicron chimeric RBD-dimer), the specific scheme is as follows:

(1) Directly connect the RBD sequences of the two new coronavirus prototype strains (as shown in SEQ ID NO:5), connect the signal peptide (MIHSVFLLMFLLTPTES, SEQ ID NO.6) to their N-terminus, and add Add 6 histidines (HHHHHH) and a stop codon to obtain the prototype RBD-dimer construct (its amino acid sequence is shown in SEQ ID NO: 7);

(2) Directly connect the RBD sequences of the two new coronavirus Delta mutant strains (as shown in SEQ ID NO: 1), Connect the signal peptide (MIHSVFLLMFLLTPTES, SEQ ID NO. 6) to its N-terminus, add 6 histidines (HHHHHH) and a stop codon to its C-terminus to obtain the Delta RBD-dimer construct (its amino acid sequence is as shown in SEQ ID NO:9 shown);

(3) Directly connect the RBD sequences of the two new coronavirus Omicron mutant strains (as shown in SEQ ID NO:2), connect the signal peptide (MIHSVFLLMFLLTPTES, SEQ ID NO.6) to their N-terminus, and add Add 6 histidines (HHHHHH) and a stop codon to obtain the Omicron RBD-dimer construct (its amino acid sequence is shown in SEQ ID NO: 11);

(4) Directly connect the RBD sequence of the new coronavirus Delta variant strain (as shown in SEQ ID NO:1) with the RBD sequence of the Omicron variant strain (as shown in SEQ ID NO:2), and connect a signal peptide at the N-terminal (MIHSVFLLMFLLTPTES, SEQ ID NO.6), add 6 histidines (HHHHHH) and a stop codon to its C-terminus to obtain the Delta-Omicron chimeric RBD-dimer construct (its amino acid sequence is as SEQ ID NO:13 shown).

Plasmid construction:

The amino acid sequences of the above four constructs are optimized using human codons, and the corresponding DNA coding sequences are as shown in SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12 and SEQ ID NO:14; in these The Kozak sequence gccacc is added to the upstream of the DNA coding sequence. These four DNA sequences containing the Kozak sequence were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.; the four synthesized DNA sequences were cloned into pCAGGS through the EcoRI and XhoI restriction sites. Plasmids were obtained to express the prototype RBD-dimer, Delta RBD-dimer, Omicron RBD-dimer and Delta-Omicron chimeric RBD-dimer expression plasmids pCAGGS-prototype, pCAGGS-Delta, pCAGGS-Omicron and pCAGGS-D-O chimeric.

Protein expression and purification:

The plasmid expressing the Delta-Omicron chimeric RBD-dimer protein was transfected into Expi293F ^TM cells. After 5 days, the supernatant was collected, centrifuged to remove the precipitate, and then filtered through a 0.22 μm filter to further remove impurities. The obtained cell supernatant was adsorbed through a nickel affinity column (His Trap, GE Healthcare) at 4°C, washed with buffer A (20mM Tris, 150mM NaCl, pH 8.0) to remove non-specific binding proteins, and then washed with buffer B ( 20mM Tris, 150mM NaCl, pH 8.0, 300mM imidazole) to elute the target protein from His Trap, collect the eluate at the elution peak, and use it for SDS-PAGE identification of the target protein and subsequent molecular sieve chromatography. The nickel affinity column chromatography curve of the Delta-Omicron chimeric RBD-dimer protein and the SDS-PAGE identification results of its elution peak are shown in Figure 2. In the left picture of Figure 2, the position pointed by the arrow is the elution peak where the target protein is located. .

Then, use a 30kD concentrator tube to concentrate the eluent at the elution peak collected above and change the liquid into molecular sieve chromatography buffer PBS (8mM Na ₂ HPO ₄ , 136mM NaCl, 2mM KH ₂ PO ₄ , 2.6mM KCl, pH7.4), the final volume is less than 1 ml; then pass through Superdex ^TM 200 Increase 10/300GL column (GE Healthcare) for molecular sieve chromatography to further purify the target protein. During the chromatography process, collect the elution peaks liquid, for purpose eggs SDS-PAGE identification of white. The molecular sieve chromatography curve of the Delta-Omicron chimeric RBD-dimer protein and the SDS-PAGE identification results of the elution peaks are shown in Figure 3. In the left figure of Figure 3, the arrow indicates the elution peak corresponding to the target protein; in addition , the SDS-PAGE gel electrophoresis analysis of the elution peak showed that the size of the eluted protein was correct, proving that the Delta-Omicron chimeric RBD-dimer protein was purified, and it can be seen from the electrophoresis bands that the purified target protein was also With higher purity and yield.

The three proteins of prototype RBD-dimer, Delta RBD-dimer and Omicron RBD-dimer were expressed and purified using the same method. Briefly, their expression plasmids were transfected into Expi293F ^TM cells respectively. After 5 days, the supernatant was collected, centrifuged and Filter to remove impurities. First purified by nickel affinity column chromatography, then the prototype RBD-dimer protein was 16/600 200pg column (GE Healthcare) was used for molecular sieve chromatography, and the two proteins Delta RBD-dimer and Omicron RBD-dimer were used for molecular sieve chromatography on a Superdex ^TM 200 Increase 10/300GL column (GE Healthcare) to further purify the target protein; prototype RBD The molecular sieve chromatography curves of -dimer, Delta RBD-dimer and Omicron RBD-dimer and the SDS-PAGE identification results of their elution peaks are shown in Figure 4, Figure 5 and Figure 6 respectively. Above each molecular sieve chromatography curve, arrows Indicated is the elution peak corresponding to the target protein. The eluate at the elution peak was analyzed by SDS-PAGE gel electrophoresis. The results showed that the sizes of the eluted proteins were all about 60kD, which was consistent with the above three dimers. The molecular size of the protein proves that three dimeric proteins, namely prototype RBD-dimer, Delta RBD-dimer and Omicron RBD-dimer, were purified, and the electrophoresis band is single, indicating that the purified protein has high purity. In addition, The prototype RBD-dimer and Delta RBD-dimer also have higher yields.

Example 2: Antigen epitope identification and analysis

The inventor used surface plasmon resonance technology (Surface Plasmon Resonance, SPR) to identify the RBD binding motif (RBM) of the antigen protein and the exposure of the main neutralizing antibody epitope, and detected the antigen protein's response to the human receptor of the new coronavirus - human Affinity for angiotensin-converting enzyme (hACE2), as well as for the representative monoclonal antibody CB6 targeting 5 different epitopes in the SARS-CoV-2 RBD (see A human neutralizing antibody targets for specific information on this antibody the receptor-binding site of SARS-CoV-2.Nature, 2020, PMID: 32454512), CV07-270 (for specific information about this antibody, please see A Therapeutic Non-self-reactive SARS-CoV-2 Antibody Protects from Lung Pathology in a COVID-19 Hamster Model. Cell, 2020, PMID: 33058755), C110 (for specific information about this antibody, please see SARS-CoV-2 neutralizing antibody structures inform therapeutic strategies. Nature, 2020, PMID: 33045718), S309 (for detailed information about this antibody For specific information, please see Cross-neutralization of SARS-CoV-2 by a human monoclonal SARS-CoV antibody.Nature, 2020, PMID: 32422645) and CR3022 (for specific information about this antibody, please see A highly conserved cryptic epitope in the receptor binding domains of SARS-CoV-2 and SARS-CoV.Science, 2020, PMID: 32245784); the epitopes of hACE2 receptor and 5 monoclonal antibodies binding RBD in the RBD protein of the new coronavirus prototype strain are shown in Figure 7.

In the affinity test experiment, the monomeric RBD protein of the prototype strain, the monomeric RBD protein of the Delta variant strain, The affinity of the monomeric RBD protein of the Omicron variant strain and the Delta-Omicron chimeric RBD-dimer protein to the hACE2 receptor and the above five monoclonal antibodies were comparatively analyzed.

The affinity test method is as follows: This test is performed using BIAcore8000 (GE Healthcare) instrument. Before testing, the target antigen protein was changed into PBS-T buffer (10mM Na ₂ HPO ₄ , 2mM KH ₂ PO ₄ , pH 7.4, 137mM NaCl, 2.7mM KCl, 0.005% Tween 20). First, the antigen protein is immobilized on the CM5 chip using the amino coupling method, with a target response value of about 1000RU; then, the antibody Fab protein is diluted twice, and the diluent is used as the mobile phase, flowing through the fixed chip in sequence at a speed of 30 μL/min. Antigen protein, different real-time binding response signals are obtained. The collected data is calculated using BIAevaluation Version 4.1 (GE Healthcare) software according to the 1:1 binding model, and finally the binding affinity between the antigen protein and the antibody is obtained.

The affinity test results are shown in Figure 8. From Figure 8, it can be seen that all antigen proteins have similar affinity to hACE2 receptor, with K _D values in the range of 5.09–8.44nM; in terms of affinity to the above five monoclonal antibodies, Delta The RBD monomer protein has lost its binding activity to the C110 antibody, and the Omicron RBD monomer protein has lost its binding activity to the CB6 antibody, indicating that the Delta and Omicron mutant strains will escape some prototype strain infections or vaccines designed with the prototype strain sequence. Induces the resulting antibody response; for comparison, the Delta-Omicron chimeric RBD-dimer protein can bind to all representative monoclonal antibodies tested, and the affinity value of the Delta-Omicron chimeric RBD-dimer protein for binding to each monoclonal antibody is consistent with Delta or Omicron The two monomeric RBD proteins have similar affinity for binding to each monoclonal antibody, which shows that the Delta-Omicron chimeric RBD-dimer protein combines the epitope characteristics of Delta and Omicron and well exposes the receptor binding sites and shows the major neutralizing antibody epitope conformations.

Example 3: Electron microscope structure analysis of the complex of the Delta-Omicron chimeric RBD-dimer protein and CB6 Fab of the present application

Delta-Omicron chimeric RBD-dimer protein and CB6 Fab protein were mixed and incubated at 4°C for 12 hours. Molecular sieve chromatography (pH8.0) was then carried out through Superdex ^TM 200 Increase 10/300GL column (GE Healthcare) to purify the complex of Delta-Omicron chimeric RBD-dimer protein and CB6 Fab protein. The molecular sieve chromatography curve is as shown in the figure As shown in 9; in addition, the eluates at the two elution peaks were collected and subjected to SDS-PAGE identification. From the SDS-PAGE identification results (data not shown), it can be seen that one of the elution peaks in Figure 9 is The other peak of the complex between Delta-Omicron chimeric RBD-dimer protein and CB6 Fab is excess CB6 Fab, which shows that Delta-Omicron chimeric RBD-dimer protein can bind to CB6 Fab and form a complex.

In addition, the eluate of the complex of the Delta-Omicron chimeric RBD-dimer protein and CB6 Fab collected above was concentrated and used for cryo-electron microscopy analysis after concentration. The procedure is as follows:

Prepare the Quantifoil grid (specification 1.2/1.3) for sample preparation in advance and perform glow discharge hydrophilization treatment. Then, the prepared complex of Delta-Omicron chimeric RBD-dimer protein and CB6 Fab was dropped onto the prepared network, and the automatic sample preparation machine Vitrobot Mark IV was used to quickly insert the network into liquid ethane to complete sample preparation. .

Data were collected using a 300 kV Titan Krios transmission electron microscope (Thermo Fisher Co., Ltd.) with K2 direct electron The detector camera was used to collect a large number of photos using the Serial-EM automated collection program. Then, MotionCor2 software was used to perform drift correction on the collected raw data, CTFFIND4.1 software was used to perform contrast transfer function correction on the images, and Relion-3.1 software was used for further processing and final three-dimensional reconstruction of the images.

The cryo-electron microscope image of the complex of the Delta-Omicron chimeric RBD-dimer protein and CB6 Fab of this application is shown in Figure 10. It can be seen from Figure 10: In the complex of the Delta-Omicron chimeric RBD-dimer protein and CB6 Fab, Delta RBD and Omicron RBD are symmetrically distributed and present a "double lung shape"; moreover, Delta RBD can bind CB6 Fab, and the main epitope of the Delta-Omicron chimeric RBD-dimer protein is fully exposed, which is beneficial to activating the immune response.

Example 4: Detection of humoral immune response induced by Delta-Omicron chimeric RBD-dimer protein

In order to detect the immunogenicity of the Delta-Omicron chimeric RBD-dimer protein of the present application, we used the purified prototype RBD-dimer, Delta RBD-dimer, Omicron RBD-dimer and Delta-Omicron chimeric RBD-dimer obtained in Example 1 The protein was used as an immunogen to immunize BALB/c mice respectively, and the negative control (Sham group) was immunized with PBS solution, with 10 mice in each group. The BALB/c mice used were purchased from Viton Lever Company. They were all female and 7-9 weeks old. The grouping of mice and the immunization dosage are shown in Table 1.

Table 1 Grouping and dosage of mice immunized with novel coronavirus RBD dimer vaccine

The specific immunization program is as follows:

Dilute the immunogen with PBS to 40 μg/ml, mix and emulsify the diluted immunogen with AddaVax adjuvant (a vaccine adjuvant similar to MF59) at a volume ratio of 1:1 to prepare a vaccine. In the Sham group, PBS solution was mixed with AddaVax adjuvant to prepare a vaccine control. The obtained vaccine was immunized by intramuscular injection into BALB/c mice. All mice were immunized for the first and second times on day 0 and day 21, respectively, with an inoculation volume of 100 μL each time (containing 2 μg of antigen protein). . On the 35th day, blood was collected from the mice, and serum was collected by centrifugation. The obtained serum was stored in a -80°C refrigerator.

Use the new coronavirus pseudovirus to detect the 50% pseudovirus neutralization titer (pVNT ₅₀ ) of the collected immune mouse sera against the new coronavirus prototype strain and mutant strains. The mutant strains include Alpha, Beta, and Delta. , Omicron mutant strains. The mutation sites of the S protein of each mutant strain relative to the S protein of the prototype strain are shown in Figure 11.

The new coronavirus pseudovirus used in this example is a pseudovirus displaying the S protein of the new coronavirus prepared based on the vesicular stomatitis virus (VSV) skeleton. For the preparation method, please refer to the method section of the published paper of this research group (Effects of a Prolonged Booster Interval on Neutralization of Omicron Variant, N Engl J Med, 2022, PMID: 35081296).

The method for detecting the neutralizing antibody titer of the new coronavirus pseudovirus (hereinafter referred to as the pseudovirus) is as follows: in a 96-well plate, The immune mouse serum was diluted with a 2-fold gradient, and then mixed with the pseudovirus respectively. The blank culture medium was also mixed with the pseudovirus as a control, and incubated at 37°C for 1 hour. Transfer the immune serum-pseudovirus mixture to a 96-well plate covered with Vero cells. After 15 hours, the number of positive cells was calculated using a CQ1 confocal cell imager (Yokogawa), and then a fitting curve was drawn in GraphPad Prism software to calculate the reciprocal of the serum dilution corresponding to 50% neutralization, which is 50% pseudovirus. Neutralizing titer pVNT ₅₀ . The test results of pseudovirus neutralizing antibody titers are shown in Figure 12.

As can be seen from Figure 12:

1) For the prototype RBD-dimer, the geometric mean (GMT) of the neutralizing antibody titer of the immune mouse serum against the prototype strain pseudovirus is 3009, but the neutralizing effect against some mutant strains of the pseudovirus has decreased. , including Beta (GMT, 1112), Delta (GMT, 2059), Omicron (GMT, 374).

2) For Delta RBD-dimer, the neutralizing antibody titer GMT of the immunized mouse serum against Delta pseudovirus is 16722, but the neutralizing antibody titer GMT against Beta pseudovirus is 756, and the neutralizing antibody titer against Omicron pseudovirus is 756. The titer GMT is 633, which is not effective against Beta and Omicron mutant strains.

3) For Omicron RBD-dimer, the immune mouse serum has certain neutralizing antibody activity against Omicron pseudovirus, but the titer is low (GMT=43), and it has no effect on the prototype strain and Alpha, Beta, and Delta mutant strains. Neutralizing activity (below detection limit).

4) For the Delta-Omicron chimeric RBD-dimer protein vaccine, it induced a relatively balanced antibody response. The neutralizing antibody titers GMT of the immunized mouse serum against the pseudovirus were 4518 (prototype) and 5576 (Alpha), respectively. 2263 (Beta), 38387 (Delta) and 7194 (Omicron). For these five pseudoviruses, the neutralizing antibody GMT of the serum of mice immunized with the Delta-Omicron chimeric RBD-dimer protein vaccine was higher than that of the other three protein vaccines. , showing the advantages of strong immunogenicity and broad spectrum.

Example 5: New coronavirus live virus challenge experiment to verify vaccine effect

In order to further explore the protective effect of the Delta-Omicron chimeric RBD-dimer protein vaccine, the Sham group, the prototype RBD-dimer immunization group and the Delta-Omicron chimeric RBD-dimer immunization group of mice prepared as in Example 4 were tested respectively. Live virus challenge experiments of SARS-CoV-2 Delta and Omicron mutant strains.

Five mice in each experimental group were subjected to a live virus challenge experiment with the new coronavirus Delta variant strain, and the other five mice in each experimental group were subjected to a live virus challenge experiment with the new coronavirus Omicron variant strain. Since BALB/c mice are not susceptible to the Delta mutant strain, the following Delta mutant strain challenge experimental method was used: intranasally transduced 8×10 ⁹ vp recombinant adenovirus type 5 (Ad5- hACE2), a model of transient expression of hACE2 was established. Five days after transducing Ad5-hACE2, 6×10 ⁵ TCID ₅₀ Delta variant strain (CCPM-BV-049-2105-8) was intranasally infected. In addition, the challenge experiment method of Omicron mutant strain is as follows: mice are directly infected with 6×10 ⁵ TCID ₅₀ new coronavirus Omicron mutant strain (BA.1, CCPM-BV-049-2112-18) through intranasal drip.

On the third day after infection with the new coronavirus Delta or Omicron mutant strain, the mice were euthanized and dissected; the lungs of each mouse were removed and divided into two parts: one part was homogenized and ground, the viral nucleic acid was extracted, and qRT-PCR was used to sick Viral viral genome gRNA and subgenomic sgRNA were quantified. gRNA represents the entire viral nucleic acid, and sgRNA represents the viral nucleic acid in the process of replication, which is an indicator of the viral replication level; the other part was fixed with paraformaldehyde, and then subjected to hematoxylin and Eosin (H&E) staining was used to observe the tissue pathology.

The method for detecting viral gRNA and sgRNA is as follows: After homogenizing mouse lung tissue, take the tissue homogenate supernatant and use the Direct-zol RNA MiniPrep kit (Zymo Research Company, Cat. No. R2052) to extract viral RNA. SARS-CoV-2-specific quantitative reverse transcription PCR (qRT) was performed on the CFX384 Touch real-time PCR detection system (Bio-Rad) using the TaqMan Fast Virus 1-Step Master Mix Kit (Thermo Fisher Scientific, Cat. No. 4444436) -PCR) detection. Two sets of primers and probes were used to detect SARS-CoV-2 Delta and Omicron virus genomic gRNA respectively, and a set of primers and probes were used to detect Delta and Omicron virus sgRNA.

The primer and probe sequences for detecting SARS-CoV-2 Delta gRNA are as follows:

F,GACCCCAAAATCAGCGAAAT (SEQ ID NO: 15);

R,TCTGGTTACTGCCAGTTGAATCTG(SEQ ID NO: 16);

probe-Delta,FAM-ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO: 17)-BHQ1.

The primer sequence for detecting SARS-CoV-2 Omicron gRNA is the same as Delta, namely (SEQ ID NO: 15) and (SEQ ID NO: 16). The probe sequence for detecting SARS-CoV-2 Omicron gRNA is as follows:

probe-Omicron: FAM-ACTCCGCATTACGTTTGGTGGACC (SEQ ID NO: 18)-BHQ1;

The primer and probe sequences for detecting SARS-CoV-2 Delta and Omicron sgRNA are as follows:

sgRNA-F,CGATCTCTTGTAGATCTGTTCTC (SEQ ID NO: 19);

sgRNA-R,ATATTGCAGCAGTACGCACACA (SEQ ID NO: 20);

sgRNA-probe,FAM-ACACTAGCCATCCTTACTGCGCTTCG (SEQ ID NO: 21)-BHQ1.

After the live virus challenge experiment with the Delta variant strain, the viral load detection results in the lung tissue of mice are shown in Figure 13. It can be seen from Figure 13 that for mice challenged with the Delta variant strain of the new coronavirus, the control group mice tested to high levels of gRNA (mean: 1.09 × ¹⁰ copies/g lung tissue) and sgRNA (mean: 1.70 × ¹⁰ copies/g lung tissue), compared to those detected in mice after vaccination Viral loads (including gRNA and sgRNA) were significantly reduced, with the average values of lung tissue gRNA in the prototype RBD-dimer and Delta-Omicron chimeric RBD-dimer immunization groups being 1.43×10 ⁸ copies/g and 2.37×10 ⁷ copies respectively. /g lung tissue. In addition, no viral sgRNA in lung tissue was detected in any mice in the Delta-Omicron chimeric RBD-dimer vaccine group, indicating that they completely inhibited virus replication; while 3 out of 5 mice in the prototype RBD-dimer group showed sgRNA Positive, the mean titer of the prototype RBD-dimer group is 1.07×10 ⁶ copies/g lung tissue (Figure 13), which shows that compared with the prototype RBD-dimer, the Delta-Omicron chimeric RBD-dimer is more effective against the new coronavirus prototype strain The suppression effect is significantly better.

Correlation analysis was performed based on a linear model between the neutralizing antibody titer of the serum of each immunized mouse against the pseudovirus of the new coronavirus Delta variant strain and the corresponding viral gRNA in the lung tissue after challenge. The results are shown in Figure 14. , The correlation between the neutralizing antibody titer and the new coronavirus Delta variant gRNA in the lung tissue after challenge is high (r=-0.8889, P<0.0001), indicating that the higher the neutralizing antibody titer, the more obvious the inhibitory effect of the virus. .

After the live virus challenge experiment with the Omicron mutant strain, the viral load detection results of the mouse lung tissue are shown in Figure 15. From Figure 15, it can be seen that for the mice challenged with the Omicron mutant strain of the new coronavirus, the control group mice tested to high levels of gRNA (mean: 1.04×10 ⁹ copies/g lung tissue) and sgRNA (mean: 1.73×10 ⁷ copies/g lung tissue). In contrast, the prototype RBD-dimer immune panel and Delta-Omicron embedded The average values of lung tissue gRNA in the RBD-dimer immunized group were 3.68×10 ⁷ copies/g and 1.61×10 ⁷ copies/g lung tissue, respectively. Additionally, none of the mice in the Delta-Omicron chimeric RBD-dimer vaccine group had detectable lung tissue viral sgRNA, indicating that they completely inhibited viral replication, compared with 2 of 5 mice in the prototype RBD-dimer group. The sgRNA was positive, and the mean titer of the prototype RBD-dimer group was 2.41×10 ⁴ copies/g lung tissue, indicating that compared with the prototype RBD-dimer, the Delta-Omicron chimeric RBD-dimer has an inhibitory effect on the Omicron variant of the new coronavirus. Significantly better.

The neutralizing antibody titer of each mouse's serum against the pseudovirus of the new coronavirus Omicron variant strain and the corresponding lung tissue virus gRNA after challenge with the new coronavirus Omicron variant strain were correlated based on a linear model. The results are shown in Figure 16. As can be seen in Figure 16, the correlation between the neutralizing antibody titer and the new coronavirus gRNA of the prototype strain of lung tissue after challenge is high (r=-0.7362, P=0.0017), indicating that the higher the neutralizing antibody titer, the greater the risk of the virus. The inhibitory effect is more obvious.

The lung histopathological results of mice in each experimental group after being challenged with the new coronavirus Delta variant or Omicron variant are shown in Figure 17. By analyzing the lung histopathology of mice in each experimental group in Figure 17, it can be seen that the lung pathological changes of mice in the control group (Sham) showed moderate to severe lesions after being infected with the new coronavirus Delta or Omicron mutant strains. Including the disappearance of alveolar spaces, pulmonary hemorrhage, and diffuse inflammatory cell infiltration; in contrast, mice vaccinated with prototype RBD-dimer and Delta-Omicron chimeric RBD-dimer vaccines only showed mild lung damage and significantly alleviated pneumonia ( Figure 17). In addition, the lung histopathological results of mice showed that the Delta-Omicron chimeric RBD-dimer had a better protective effect compared with the prototype RBD-dimer (Figure 17). These lung histopathological results were consistent with the above lung tissue viral gRNA. The measured trends are consistent, proving that the Delta-Omicron chimeric RBD-dimer protein vaccine can indeed provide a relatively balanced and efficient protection against different strains of the new coronavirus, especially the recently popular Delta and Omicron variants.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that it can still be Modifications are made to the technical solutions described in the foregoing embodiments, or equivalent substitutions are made to some of the technical features; however, these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solution of the present application.

Industrial applicability

The RBD recombinant chimeric antigens of the new coronavirus Delta and Omicron variants provided by this application can be very Efficiently activating broad-spectrum protective antibodies can have a very good preventive or therapeutic effect on the original strain of the new coronavirus and various current mutant strains, which is of far-reaching significance for the prevention and control of the global new coronavirus epidemic.

Claims (18)

1. A recombinant chimeric antigen of the new coronavirus Delta and Omicron variants, characterized in that: the amino acid sequence of the recombinant antigen includes: (A-B)-(A-B') or (A-B)-C-(A- B') Amino acid sequence arranged in a pattern, wherein:

   A-B represents an amino acid sequence as set forth in SEQ ID NO:1 or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto,

   A-B’ represents an amino acid sequence as set forth in SEQ ID NO:2 or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto, and

   C represents the connection sequence.
2. The recombinant antigen according to claim 1, characterized in that: C represents a connection sequence represented by (GGS) _n , wherein n represents the number of GGS, and n is an integer between 1 and 10, preferably 1- An integer between 5.
3. The recombinant antigen according to claim 1, characterized in that: the amino acid sequence of the recombinant antigen includes: an amino acid sequence arranged in a (A-B)-(A-B’) pattern, wherein:

   A-B represents the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity thereto, preferably as SEQ ID NO: The amino acid sequence shown in 1;

   A-B' represents the amino acid sequence shown in SEQ ID NO:2 or an amino acid sequence having at least 90%, 92%, 95%, 96%, 97%, 98% or 99% identity with it, preferably as SEQ The amino acid sequence shown in ID NO:2.
4. The recombinant antigen according to claim 3, characterized in that: the amino acid sequence of the recombinant antigen is shown in SEQ ID NO: 3.
5. A method for preparing a recombinant antigen according to any one of claims 1-4, which includes the following steps: adding to the 5' end of the nucleotide sequence encoding the recombinant antigen according to any one of claims 1-4 The sequence encoding the signal peptide, with histidine and stop codon added to the 3' end, is cloned and expressed, the correct recombinant is screened, and then transfected into cells of the expression system for expression, and the cell culture supernatant is collected and isolated from it. The recombinant antigen.
6. The preparation method according to claim 5, characterized in that: the cells of the expression system include mammalian cells, insect cells, yeast cells or bacterial cells;

   Alternatively, the mammalian cells include HEK293T cells, HEK293F cells, Expi293F cells or CHO cells;

   Optionally, the bacterial cells comprise E. coli cells.
7. A polynucleotide encoding the recombinant antigen according to any one of claims 1-4.
8. The polynucleotide according to claim 7, characterized in that: the polynucleotide is DNA or mRNA;

   Preferably, the polynucleotide is the nucleotide sequence shown in SEQ ID NO:4.
9. A nucleic acid construct comprising the polynucleotide of claim 7 or 8, and optionally, with The polynucleotide is operably linked to at least one expression control element.
10. An expression vector comprising the nucleic acid construct of claim 9.
11. A transformed cell comprising the polynucleotide of claim 7 or 8, the nucleic acid construct of claim 9 or the expression vector of claim 10.
12. The recombinant antigen as claimed in any one of claims 1 to 4, the polynucleotide as claimed in claim 7 or 8, the nucleic acid construct as claimed in claim 9, the expression vector as claimed in claim 10 or as Use of the transformed cells described in claim 11 in preparing a novel coronavirus vaccine.
13. A vaccine or immunogenic composition comprising the recombinant antigen according to any one of claims 1-4, the polynucleotide according to claim 7 or 8, and the nucleic acid construct according to claim 9 , the expression vector according to claim 10 or the transformed cell according to claim 11, and a physiologically acceptable vehicle, adjuvant, excipient, carrier and/or diluent.
14. The vaccine or immunogenic composition according to claim 13, which is a new coronavirus recombinant protein vaccine, which includes the recombinant antigen and adjuvant as described in any one of claims 1-4;

    Optionally, the adjuvant is one or more selected from the following adjuvants: aluminum adjuvant, MF59 adjuvant and MF59-like adjuvant.
15. The vaccine or immunogenic composition according to claim 13, which is a new coronavirus DNA vaccine, comprising:

    (1) Eukaryotic expression vector; and

    (2) A DNA sequence encoding the recombinant antigen according to any one of claims 1-4 constructed into the eukaryotic expression vector;

    Optionally, the eukaryotic expression vector is selected from pGX0001, pVAX1, pCAGGS and pCDNA series vectors.
16. The vaccine or immunogenic composition according to claim 13, which is a new coronavirus mRNA vaccine, which includes an mRNA sequence encoding the recombinant antigen as described in any one of claims 1-4 and lipid nanoparticles.
17. The vaccine or immunogenic composition according to claim 13, which is a novel coronavirus-viral vector vaccine, comprising:

    (1) Viral backbone vector; and

    (2) A nucleic acid sequence encoding the recombinant antigen according to any one of claims 1 to 4 constructed into the viral backbone vector;

    Optionally, the viral backbone vector is selected from one or more of the following viral vectors: adenovirus vector, poxvirus vector, influenza virus vector, and adeno-associated virus vector.
18. The vaccine or immunogenic composition according to any one of claims 13-17, characterized in that the vaccine or immunogenic composition is in the form of a nasal spray, oral preparation, suppository or parenteral preparation;

    Preferably, the nasal spray is selected from aerosols, sprays and powder sprays;

    Preferably, the oral preparation is selected from tablets, powders, pills, powders, granules, fine granules, soft/hard capsules, film-coated agents, pellets, sublingual tablets and ointments;

    Preferably, the parenteral preparation is a transdermal preparation, an ointment, a plaster, a topical liquid, an injectable or a pushable preparation.