WO2022184027A1 - Novel coronavirus multivalent antigen, and preparation method therefor and application thereof - Google Patents

Abstract

The present application relates to a novel coronavirus multivalent antigen, and a preparation method therefor and an application thereof. An amino acid sequence of the novel coronavirus antigen comprises: an amino acid sequence arranged in an (A-B)-(A-B') pattern or an amino acid sequence arranged in an (A-B)-C-(A-B') pattern, wherein A-B represents a partial amino acid sequence or a full-length amino acid sequence of a receptor binding domain (RBD) of a surface spike protein of the novel coronavirus, C represents a linking amino acid sequence, and A-B' represents an amino acid sequence obtained by substituting the amino acid sequence of A-B with one or more amino acids in K417N, E484K or N501Y. Compared with a tandem repeat dimer of two original strain RBD proteins, the novel coronavirus multivalent antigen of the present application can activate a broad-spectrum protective antibody, and has a good preventive effect on both the original strain and the current epidemic strain.

Description

A kind of novel coronavirus multivalent antigen, its preparation method and application

cross reference

This application claims the priority rights of the invention patent application filed on March 1, 2021 with the application number of 202110225584.2 and the invention titled "a novel coronavirus multivalent antigen, its preparation method and application", the entire contents of which are by reference Incorporated herein.

technical field

The present application relates to the field of biomedicine, in particular to a novel coronavirus multivalent antigen, its preparation method and application.

Background technique

Novel coronavirus pneumonia (new coronary pneumonia, COVID-19) is caused by the infection of the new coronavirus (new coronavirus, SARS-CoV-2). The new coronavirus belongs to the genus β-coronavirus of the family Coronaviridae, has an envelope, and is a positive-strand RNA virus. The spike (S) protein on the surface of the virus is responsible for the recognition, binding and membrane fusion with the receptor ACE2 (Angiotensin-converting enzyme 2) protein of the host cell, and mediates virus invasion. Among them, the receptor binding domain (RBD) of the S protein is mainly Responsible for binding to ACE2, a large number of studies have shown that most of the neutralizing antibodies induced during 2019-nCoV infection target RBD, so RBD is an important target in vaccine design.

We have previously designed a novel coronavirus pneumonia subunit protein vaccine, which uses two tandemly repeated novel coronavirus RBDs to form single-chain dimers, which show good immunogenicity in animal experiments (Cell, 2020, PMID: 32645327 ), and started a Phase 1 clinical trial (NCT04445194) in June 2020. The results of Phase 1 and Phase 2 clinical trials showed that the vaccine can induce higher neutralizing antibodies in humans (2020, medRxiv, doi.org/10.1101/2020.12 .20.20248602), a Phase 3 clinical trial in Uzbekistan was launched in December 2020 (NCT04646590).

At present, the global epidemic of new coronary pneumonia is still severe, and widespread vaccination is an effective preventive measure. However, there have been some mutations in the currently circulating virus strains, especially some existing vaccines have proved that the mutant 501Y.V2 can escape the effect of some neutralizing antibodies produced by its immunity, reducing the protective effect of the vaccine. Therefore, it is urgent to develop a vaccine with broad-spectrum protective effect, which can play an important role in the prevention and control of the new crown epidemic.

The information disclosed in this Background section is only for enhancement of understanding of the general background of the application and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art.

SUMMARY OF THE INVENTION

Purpose of invention

The purpose of this application is to provide a novel coronavirus multivalent antigen, its preparation method and application. In this application, the partial or full-length amino acid sequences of two monomeric RBD proteins are concatenated, wherein the partial or full-length amino acid sequence of one monomeric RBD protein is the original strain sequence, and the amino acid sequence of the other monomeric RBD protein is introduced One, two or three point mutations, the point mutations are K417N, E484K and N501Y respectively. Compared with the partial or full-length amino acid sequence tandem repeat dimer of the RBD protein of the two original strains, the multivalent antigen of the novel coronavirus of the present application can activate a broad-spectrum protective antibody, which plays a good role in both the original strain and the current epidemic strain. preventive effect.

solution

To achieve the purpose of the application, the application provides the following technical solutions:

A novel coronavirus antigen, its amino acid sequence comprises: the amino acid sequence arranged according to (A-B)-(A-B') pattern or the amino acid sequence arranged according to (A-B)-C-(A-B') pattern, wherein: A-B represent the partial amino acid sequence or the full-length amino acid sequence of the receptor binding region of the surface spike protein of the novel coronavirus, and the partial amino acid sequence of the receptor binding region of the surface spike protein of the novel coronavirus includes at least K417, E484 or One or more amino acids in N501, C represents the connecting amino acid sequence, A-B' represents the amino acid sequence obtained by substituting the amino acid sequence of A-B with one or more amino acids in K417N, E484K or N501Y.

In a possible implementation, the partial amino acid sequence of the receptor binding region of the novel coronavirus surface spike protein is at least 50% or more of the full-length amino acid sequence of the receptor binding region of the novel coronavirus surface spike protein , 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more.

In a possible implementation, the partial amino acid sequence or full-length amino acid sequence of the receptor binding region of the surface spike protein of the novel coronavirus is SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

Among them: SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 sequences are all derived from part of the S protein sequence of the WH01 strain of the new coronavirus (GenBank on NCBI: QHR63250), which are respectively the new coronavirus The R319-S530 region, the R319-K537 region, and the R319-F541 region of the RBD of the S protein.

In a possible implementation, A-B' represents the amino acid sequence obtained by simultaneously substituting the amino acid sequence of A-B with K417N, E484K and N501Y.

In a possible implementation, the amino acid sequence of the novel coronavirus antigen is SEQ ID NO:4.

In a possible implementation, the linking amino acid sequence includes: (GGS) _n linking sequence, where n represents the number of GGS, and n is an integer ≥ 1; optionally, n is selected from 1-10 Integer; further optionally, n is an integer selected from 1-5. The three letters GGS represent the amino acids G, G, and S, respectively.

The application also provides a method for preparing the above-mentioned novel coronavirus antigen, comprising the following steps: adding a sequence encoding a signal peptide to the 5' end of the nucleotide sequence encoding the above-mentioned novel coronavirus antigen, adding histidine to the 3' end acid and stop codon, clone and express, screen the correct recombinant, and then transfect cells of the expression system for expression, collect the cell supernatant after expression, and purify to obtain the novel coronavirus antigen.

In a possible implementation manner, the cells of the expression system include mammalian cells, insect cells, yeast cells or bacterial cells, optionally; the mammalian cells include HEK293T cells, HEK293F cells or CHO cells, wherein The bacterial cells include E. coli cells.

The present application also provides a nucleotide sequence encoding the above novel coronavirus antigen.

In a possible implementation, the nucleotide sequence is SEQ ID NO:5.

The present application also provides a recombinant vector comprising the above-mentioned nucleotide sequence.

The present application also provides an expression system cell comprising the above-mentioned recombinant vector.

The application also provides an application of the above-mentioned novel coronavirus antigen, the above-mentioned nucleotide sequence, the above-mentioned recombinant vector, and the above-mentioned expression system cell in the preparation of a novel coronavirus vaccine.

The present application also provides a novel coronavirus vaccine, comprising the above novel coronavirus antigen and adjuvant.

In one possible implementation, the adjuvant is selected from aluminum adjuvant, MF59 adjuvant or MF59-like adjuvant.

The present application also provides a novel coronavirus DNA vaccine, comprising: a recombinant vector comprising the DNA sequence encoding the novel coronavirus antigen.

The application also provides a novel coronavirus mRNA vaccine, comprising: a recombinant vector comprising the mRNA sequence encoding the novel coronavirus antigen.

The application also provides a novel coronavirus virus vector vaccine, including: a recombinant virus vector comprising a nucleotide sequence encoding the above-mentioned novel coronavirus antigen; optionally, the virus vector is selected from one or more of the following: Adenovirus vector, poxvirus vector, influenza virus vector, adeno-associated virus vector.

beneficial effect

(1) A novel coronavirus RBD partial or full-length amino acid sequence tandem dimer antigen is designed in this application, and it can not introduce any exogenous linking sequence, wherein the partial or full-length amino acid sequence of a monomeric RBD protein is The original strain sequence (GenBank on NCBI: QHR63250), and the amino acid sequence of another monomeric RBD protein introduced three point mutations based on the original strain sequence, namely K417N, E484K and N501Y. The novel coronavirus antigen can efficiently induce an immune response against the original virus strain, and can also efficiently induce an immune response against the mutant virus strain.

(2) Based on the cross-linking reaction between two different RBDs of the vaccine protein and B cells, the novel coronavirus antigen can enhance the immune response that activates the conserved epitopes of the two RBD proteins, thus providing broad-spectrum protection.

Description of drawings

One or more embodiments are exemplified by the pictures in the accompanying drawings, and these exemplified descriptions do not constitute limitations of the embodiments. The word "exemplary" is used exclusively herein to mean "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.

Figure 1 shows that in Example 2 of the present application, the plasmids expressing RBD-tr2-WTV2 and RBD-tr2 were transfected in HEK293T cells, and the supernatant and cells were collected 72 hours later, and the expression of the target protein was detected by Western blot experiment.

Figure 2 shows in Example 3 of the present application, the supernatant of RBD-tr2-WTV2 protein expressed by HEK293F cells was used to purify the target protein through a nickel affinity column, and the RBD-tr2-WTV2 protein was detected by Coomassie brilliant blue staining.

Figure 3 shows that in Example 3 of the present application, the RBD-tr2-WTV2 protein was purified by a nickel affinity column, and the target protein was purified by molecular sieve chromatography, and the RBD-tr2-WTV2 protein was detected by Coomassie brilliant blue staining.

Fig. 4 shows that in Example 4 of the present application, after the purified RBD-tr2-WTV2 protein is combined with the new coronavirus receptor human ACE2 protein, molecular sieve chromatography is performed to purify the complex of RBD-tr2-WTV2 and human ACE2 protein, and Protein detection was performed by Coomassie brilliant blue staining.

Figure 5 shows the complex of RBD-tr2-WTV2 and CB6 antibody protein purified by molecular sieve chromatography in Example 5 of the present application, and protein detection by Coomassie brilliant blue staining.

Figure 6 shows that in Example 5 of the present application, the complex of RBD-tr2-WTV2 and CB6 antibody was continuously mixed with human ACE2 protein to form a complex of RBD-tr2-WTV2, CB06 antibody and human ACE2 protein, purified by molecular sieve chromatography , and protein detection by Coomassie brilliant blue staining.

7 is a schematic diagram of the design of the dimer antigen protein in Example 6 of the present application; wherein, RBD-tr2 is the RBD of two prototype virus strains in series to form a dimer, and RBD-tr2-V2 is the RBD of two Beta variant strains Concatenated into a dimer, RBD-tr2-WTV2 is a chimeric dimer of the RBD of a prototype virus strain and the RBD of a Beta variant strain.

Figure 8 is the supernatant of RBD-tr2, RBD-tr2-V2 and RBD-tr2-WTV2 proteins expressed by 293F cells in Example 6 of the present application, purified by molecular sieve chromatography, and purified by Coomassie brilliant blue stain to detect the protein of interest.

Figure 9 shows the use of the novel coronavirus receptor protein hACE2 and representative antibodies of 5 different antibody epitopes to identify antigenic protein epitopes in Example 7 of the present application; wherein, prototype RBD-monomer represents the prototype virus strain monomer RBD protein, Beta RBD-monomer represents the monomeric RBD protein of the Beta variant, RBD-tr2 represents the dimer RBD protein of the prototype virus strain, RBD-tr2-V2 represents the dimer RBD protein of the Beta variant strain, and RBD-tr2-WTV2 represents the prototype virus strain RBD is a tandem chimeric dimer protein with Beta variant RBD protein, and N/B means no binding.

10 is a schematic diagram of the S protein mutation site of each new coronavirus variant strain in Example 8 of the present application.

Figure 11 shows the neutralization results of sera collected from mice 14 days after the second immunization of the new coronavirus prototype strain and pseudoviruses of each new coronavirus variant strain in Example 8 of the present application, wherein Sham is the negative control immunization group , RBD-tr2 is the prototype strain dimer RBD protein immune group, RBD-tr2-V2 is the Beta mutant dimer RBD protein immune group, RBD-tr2-WTV2 is the prototype strain RBD and the Beta mutant RBD protein in series Chimeric Dimeric Protein Immunogroup.

Figure 12 shows the neutralizing antibody titers of the sera of mice immunized with RBD-tr2, RBD-tr2-V2 and RBD-tr2-WTV2 to the prototype strain of the new coronavirus and the pseudoviruses of each new coronavirus variant in Example 8 of the application Radar chart plotted with geometric mean (GMT) of degrees to analyze the effect of broad-spectrum neutralization.

Figure 13 shows the results of the live virus challenge experiment of the prototype strain of the new coronavirus or the Beta variant of each immunized mouse group in Example 9 of the present application; wherein, Sham is the negative control immunization group, and RBD-tr2 is the prototype virus Strain dimer RBD protein immunization group, RBD-tr2-V2 is the Beta variant strain dimer RBD protein immunization group, RBD-tr2-WTV2 is the prototype strain-Beta variant chimeric RBD dimer protein immunization group; and , where A-C is the challenge result of the prototype strain of SARS-CoV-2, D-F is the challenge result of the SARS-CoV-2 Beta variant strain, A and D are the genomic RNA detected in mouse lung tissue on the 5th day after challenge (gRNA) load, B and E are the subgenomic RNA (sgRNA) load of mouse lung tissue detected on the 5th day after challenge, C and F are the neutralizing antibody titer after immunization and the Correlation analysis of viral gRNA load, G panel is a representative HE staining pathology image of each group of mice after challenge.

Detailed ways

In order to make the purpose, technical solutions and advantages of the present application clearer, the technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present application, rather than all implementations. example. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

In addition, in order to better illustrate the present application, numerous specific details are given in the following detailed description. It should be understood by those skilled in the art that the present application may be practiced without certain specific details. In some embodiments, materials, components, methods, means, etc. that are well known to those skilled in the art are not described in detail, so as to highlight the gist of the present application.

Unless expressly stated otherwise, throughout the specification and claims, the term "comprising" or its conjugations such as "comprising" or "comprising" and the like will be understood to include the stated elements or components, and Other elements or other components are not excluded.

Example 1: Design of novel coronavirus broad-spectrum protective vaccine RBD-tr2-WTV2

Analysis of new coronavirus mutant strains: The new coronavirus S protein D614G mutation appeared in January and February 2020. In June 2020, the D614G mutant virus strain became the main epidemic strain in the world. Cell and animal experiments showed that the D614G mutation enhanced Compared with the original strain, the infection of D614G new coronavirus does not increase the pathogenicity. In December 2020, a new variant strain 501Y.V1 (also called VOC-202012/01, belonging to the B.1.1.7 lineage) appeared in the UK, with 23 mutations compared to the original strain, which may affect the S protein. The three larger mutations are N501Y, 69-70del (deletion) and P681H, among which N501Y mutation enhances the binding ability of S protein to receptor ACE2 protein, 501Y.V1 has stronger transmission ability, but does not enhance pathogenicity . Also in December 2020, a new mutant strain 501Y.V2 (B.1.351 lineage) was reported in South Africa. In South Africa, the 501Y.V2 mutant strain quickly replaced other strains and was called the main epidemic strain. The study found that 501Y.V2 infection will cause resulting in higher viral loads, suggesting a possible increase in transmissibility. The mutations of 501Y.V2 on the S protein include: D80A, L242del, A243del, L244del, R246I, K417N, E484K, N501Y, D614G, A701V. 501Y.V2 was also named after Beta variant.

We designed subunit protein vaccines based on the new coronavirus RBD in the early stage. The mutation sites outside the RBD in the new coronavirus variant strains will not affect the effect of the previous vaccines. Therefore, we mainly optimize the RBD mutation sites of each variant strain. After analysis, it was found that the RBD mutations of the current mutants were mainly concentrated in K417N, E484K, N501Y.

RBD-tr2 is two identical new coronavirus RBD tandem repeat dimers (R319-K537-R319-K537). Based on this, we mutated one of the RBD sequences K417N, E484K, N501Y, and the other RBD The sequence remained unchanged, and the resulting dimer was named RBD-tr2-WTV2. RBD-tr2-WTV2 can efficiently induce both an immune response against the original virus strain and an immune response against the mutant virus strain. In addition, the RBD-tr2-WTV2 protein can also enhance the activation of two of the conserved RBD proteins. specific antibody response, thus providing a broader spectrum of protection.

Example 2: Western blot detection of protein expression

The amino acid sequence of the designed RBD-tr2-WTV2 antigen is SEQ ID NO: 4 (signal peptide and histidine sequence are not given in the sequence), and the nucleotide sequence for expressing the antigen is SEQ ID NO: 5, and the nucleotide sequence is SEQ ID NO: 5. The elements of the sequence from N-terminal to C-terminal are (1) Kozak sequence gccacc; (2) the sequence encoding the signal peptide of MERS-S protein: MIHSVFLLMFLLTPTES (SEQ ID NO: 6); (3) New coronavirus (GenBank on NCBI: QHR63250) S protein RBD (R319-K537); (4) New coronavirus (GenBank on NCBI: QHR63250) S protein RBD (R319-K537), which contains three point mutations K417N, E484K, N501Y; (5) 6 histidines; (6) stop codon. The gene sequence was synthesized in Suzhou Jinweizhi Company, and cloned into pCAGGS plasmid through EcoRI and XhoI restriction sites to obtain pCAGGS-RBD-tr2-WTV2 plasmid.

The pCAGGS plasmid expressing RBD-tr2-WTV2 was transfected into HEK293T cells, and at the same time, the pCAGGS plasmid expressing RBD-tr2 was transfected as a positive control, and only the transfection reagent was added as a negative control. After 72 hours, the cells and the culture supernatant were harvested, and the expression of the target protein was detected by Western blot. In the early stage, the research group immunized rabbits with the new coronavirus RBD protein to prepare a rabbit anti-new crown RBD polyclonal antibody. In the Western blot experiment, the rabbit anti-new crown RBD protein polyclonal antibody was added as the primary antibody, and the HRP-conjugated goat anti-rabbit antibody was used as the secondary antibody ( Proteintech, SA00001-2). The results of Western blot detection are shown in Figure 1, indicating that the protein has been expressed normally and can be secreted outside the cell.

Example 3: Expression and purification of RBD-tr2-WTV2

Use HEK293F cells suitable for large-scale protein expression to express RBD-tr2-WTV2 antigen: Transfect the plasmid pCAGGS-RBD-tr2-WTV2 into HEK293F cells, collect the supernatant after 5 days, remove the precipitate by centrifugation, and filter it through a 0.22 μm filter. Remove impurities. The cell supernatant was adsorbed through a nickel affinity column (Histrap, GE Healthcare) at 4°C and washed with buffer A (20 mM Tris, 150 mM NaCl, pH 8.0) to remove non-specifically bound proteins. Then use buffer B (20mM Tris, 150mM NaCl, pH 8.0, 1000mM imidazole) to gradient elute the target protein from the Histrap, and set the ratio of buffer B to 2%, 5%, 10%, 20% in turn , 30%, 50%, 100%, the results are shown in Figure 2. Concentrate the eluted protein solution corresponding to 10% imidazole with a 10kD concentrating tube, and change the solution more than 30 times until the final volume of buffer A is less than 1 ml. The target protein was further purified by molecular sieve chromatography on Hiload ^™ 16/600 Superdex ^™ 200pg column (GE Healthcare). The molecular sieve chromatography buffer was PBS buffer (8 mM Na2HPO4, 136 mM NaCl, 2 mM KH2PO4, 2.6 mM KCl, pH 7.2). After molecular sieve chromatography, RBD-tr2-WTV2 has an elution peak at about 80ml (Figure 3). SDS-PAGE analysis shows that the protein is 62KD under both non-reducing (without DTT) and reducing (with DTT) conditions Left and right, it is a single-chain dimer (the size of the monomer is 31KD). This shows that RBD-tr2-WTV2 can be folded and secreted correctly, and high-purity antigen protein can be obtained by purification.

Example 4: Detection of binding ability of RBD-tr2-WTV2 to receptor human ACE2 protein

RBD-tr2-WTV2 protein was mixed with human ACE2 protein and incubated at 4°C for 8 hours. The complex of RBD-tr2-WTV2 with human ACE2 protein was then purified by molecular sieve chromatography on a Superdex ^™ 200Increase 10/300GL column (GE Healthcare). It can be seen from Figure 4 that the corresponding elution peak at about 11ml is the RBD-tr2-WTV2 binding human ACE2 protein complex, and the corresponding elution peak at about 15ml is RBD-tr2-WTV2 protein, indicating that RBD-tr2-WTV2 can interact with human ACE2 protein. ACE2 protein binding, proving that the conformation of RBD-tr2-WTV2 is correct.

Example 5: RBD-tr2-WTV2 epitope analysis

We analyzed the epitope of RBD-tr2-WTV2 through the binding experiment of CB6 antibody and human ACE2 receptor. CB6 antibody can bind to the original Wuhan isolated new coronavirus RBD (PMID: 32454512), so we used CB6 antibody and RBD- tr2-WTV2 binding experiments were performed. 0.5 mg of RBD-tr2-WTV2 protein at a concentration of 5.9 mg/ml was mixed with 1 mg of CB6 antibody protein at a concentration of 15.4 mg/ml, and incubated at 4°C for 4 hours. Then, the complex of RBD-tr2-WTV2 and CB6 antibody protein was purified by molecular sieve chromatography (pH8.0) by Superdex ^TM 200Increase10/300GL column (GE Healthcare). CB6 antibodies can bind.

To further determine whether the mutant RBD (K417N, E484K, N501Y) in RBD-tr2-WTV2 had bound to CB6 antibody in RBD-tr2-WTV2 complexed with CB6 antibody, we put 0.4 mg at a concentration of 0.7 mg/ml The RBD-tr2-WTV2 and CB6 antibody complexes were mixed with 0.5 mg of human ACE2 protein at a concentration of 15.3 mg/ml and incubated at 4°C for 4 hours. Then, molecular sieve chromatography (pH 8.0) was performed on a Superdex ^TM 200Increase 10/300GL column (GE Healthcare). The results are shown in Figure 6, indicating that the complex of RBD-tr2-WTV2 and CB6 antibody can still bind to human ACE2 protein. This indicates that wild-type RBD in RBD-tr2-WTV2 protein binds to CB6 antibody, mutant RBD does not bind to CB6, and after the addition of human ACE2 protein, mutant RBD binds to human ACE2 protein to form RBD-tr2 - WTV2 and CB6 antibody complexed with human ACE2 receptor, this result can show that the conformation of RBD-WTV2 is as expected, the wild-type RBD can still bind to CB6, the mutant RBD has been correctly mutated, in this binding In the experiment, it was shown that it could not bind to CB6 antibody, but the mutant RBD could bind to the receptor human ACE2 protein, indicating that the protein conformation is correct.

These results suggest that RBD-WTV2 can be used as a vaccine to activate the generation of a broad-spectrum immune response.

Example 6: Design and preparation of homotypic RBD dimer proteins and chimeric RBD dimer proteins

In order to further verify in animals whether the chimeric RBD dimer protein RBD-tr2-WTV2 has a better immune effect than the homodimeric RBD protein, the inventors designed three dimer proteins, which are: (1) RBD-tr2, which is a dimer formed by concatenating the RBDs of two prototype virus strains; (2) RBD-tr2-V2, which is a dimer formed by concatenating the RBDs of two Beta variant strains; ( 3) RBD-tr2-WTV2, which is a chimeric dimer composed of the RBD of a prototype virus strain and the RBD of a Beta variant strain in series; the schematic diagram of the structural design of each dimer protein is shown in FIG. 7 .

The RBD-tr2 protein, RBD-tr2-V2 protein and RBD-tr2-WTV2 protein were all expressed using 293F cells. The specific procedure is as follows: 293F cells were transfected with plasmid pCAGGS-RBD-tr2, plasmid pCAGGS-RBD-tr2-V2 and plasmid pCAGGS-RBD-tr2-WTV2 respectively. After 5 days, the supernatant was collected, centrifuged to remove the precipitate, and then passed through 0.22 μm filter membrane to further remove impurities. Cell supernatants were adsorbed through a nickel affinity column (Histrap, GE Healthcare) at 4°C and washed with buffer A (20 mM Tris, 150 mM NaCl, pH 8.0) to remove non-specifically bound proteins; then buffer B ( 20mM Tris, 150mM NaCl, pH 8.0, 1000mM imidazole) to wash the column to elute the target protein from the Histrap gradient, the corresponding eluted protein solution was concentrated with a 10kDa concentrator tube, and the solution was changed more than 30 times to buffer A. The volume is less than 1 ml; then molecular sieve chromatography is performed through a Hiload ^{™ 16/600 Superdex™ 200pg} column (GE Healthcare) to further purify the target protein. The molecular sieve chromatography buffer was PBS buffer (8 mM Na ₂ HPO ₄ , 136 mM NaCl, 2 mM KH ₂ PO ₄ , 2.6 mM KCl, pH 7.2). After molecular sieve chromatography, the protein solution corresponding to the elution peak was collected and analyzed by SDS-PAGE. The results are shown in Figure 8; The size is about 31kDa). Thus, purified RBD-tr2 protein, RBD-tr2-V2 protein and RBD-tr2-WTV2 protein were obtained.

Example 7: Epitope identification

The inventors identified the RBD binding motif (RBM) of the antigenic protein and the exposure of the main neutralizing antibody epitopes by Surface Plasmon Resonance (SPR), and detected the human receptor of the antigenic protein for the new coronavirus - human Affinity of angiotensin-converting enzyme (hACE2), and a representative monoclonal antibody CB6 targeting 5 different epitopes in the SARS-CoV-2 RBD (for specific information on this antibody, see A human neutralizing antibody targets the receptor-binding site of SARS-CoV-2.Nature, 2020, PMID: 32454512), CV07-270 (for specific information of this antibody, please refer to A Therapeutic Non-self-reactive SARS-CoV-2 Antibody Protects from Lung Pathology in a COVID-19 Hamster Model. Cell, 2020, PMID: 33058755), C110 (for the specific information of this antibody, please refer to SARS-CoV-2 neutralizing antibody structures inform therapeutic strategies. Nature, 2020, PMID: 33045718), S309 (this antibody For specific information, please refer to Cross-neutralization of SARS-CoV-2 by a human monoclonal SARS-CoV antibody. Nature, 2020, PMID: 32422645) and CR3022 (for specific information of this antibody, please refer to A highly conserved cryptic epitope in the receptor binding The affinity of the Fab protein of domains of SARS-CoV-2 and SARS-CoV.Science, 2020, PMID:32245784), the epitopes of hACE2 receptor and five monoclonal antibodies bound to RBD are shown in Figure 9.

In the affinity test experiment, in addition to testing the affinity of the dimer proteins RBD-tr2, RBD-tr2-V2 and RBD-tr2-WTV2, the affinity of the monomeric RBD protein of the prototype strain and the monomeric RBD protein of the Beta variant strain was also tested. as a comparison.

Affinity test method: This test was performed using a BIAcore 8000 (GE Healthcare) instrument. Before the test, the target antigen protein was exchanged into PBS-T buffer (10 mM Na ₂ HPO ₄ , 2 mM KH ₂ PO ₄ , pH 7.4, 137 mM NaCl, 2.7 mM KCl, 0.005% Tween 20). First, the antigen protein was immobilized on the CM5 chip by amino-coupling method, and the target response value was about 1000RU; then, the antibody Fab protein was diluted in multiples, and the diluent was used as the mobile phase to flow through the immobilized Fab protein at a speed of 30mL/min. Different real-time binding response signals are obtained for antigen protein, and the collected data is calculated using BIAevaluation Version 4.1 (GE Healthcare) software according to the 1:1 binding model, and finally the binding affinity of antigen protein and antibody is obtained.

The results showed that all antigenic proteins had similar affinity to hACE2, and the K _D value was in the range of 1.13-2.66 nM (see the lower panel of Figure 9). In terms of affinity to mAb, Beta RBD in monomeric and dimeric forms lost the binding activity to CB6 antibody; compared to the affinity of the monomeric RBD protein of the prototype strain for CV07-270 and C110, monomeric and dimeric forms Form Beta RBD showed a more than 100-fold reduction in affinity for CV07-270 and C110, confirming that the Beta variant escapes infection with some prototype strains or elicits antibody responses from vaccines designed with the prototype strain sequence. In contrast, the chimeric RBD dimer antigen RBD-tr2-WTV2 maintained affinity for all tested mAbs (see bottom panel in Figure 9), indicating that the chimeric antigen was designed to expose the receptor binding site well and Major neutralizing antibody epitope conformations are shown.

Example 8: Detection of humoral immune responses induced by RBD-tr2-WTV2 vaccine

In order to detect the antibody response induced by the RBD-tr2-WTV2 vaccine, the inventors used the above-mentioned dimeric RBD antigen vaccines to immunize BALB/c mice, and the experimental groups were as follows: (1) The prototype strain RBD dimer RBD-tr2 immunized group (2) Beta RBD dimer RBD-tr2-V2 immune group; (3) Prototype strain+Beta strain chimeric RBD dimer RBD-tr2-WTV2 immune group; (4) Sham group, PBS solution.

For each experimental group, each dimeric antigen protein was mixed with Addavax adjuvant to prepare a vaccine; for the Sham group, PBS solution was mixed with Addavax adjuvant to prepare a vaccine control. The experimental mice were immunized twice, with an interval of 21 days between the two immunizations. Each dose contained 0.5 μg of antigenic protein and was injected intramuscularly in the hind legs. On the 14th day after the second immunization, the blood of mice was collected, and the pseudovirus of the new coronavirus was used to detect the 50% pseudovirus neutralization titers (pVNT ₅₀ ) of the mouse serum to the pseudovirus of the prototype strain and the mutant strain of the new coronavirus, respectively. The variant strains include Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2), Delta plus (S protein mutation site is the same as B.1.617.2) , plus K417N), Kappa (B.1.617.1), Lambda (C.37) and Omicron (B.1.1.529) variant strains, the mutation sites of each variant strain relative to the prototype strain are shown in Figure 10.

The new coronavirus pseudovirus used in this example is a pseudovirus that displays the new coronavirus S protein prepared based on the vesicular stomatitis virus (VSV) skeleton. Booster Interval on Neutralization of Omicron Variant, N Engl J Med, 2022, PMID:35081296).

The method for detecting the neutralizing antibody titer of the new coronavirus pseudovirus (hereinafter referred to as pseudovirus) is as follows: in a 96-well plate, the immunized mouse serum is diluted by a 2-fold gradient, and then mixed with the pseudovirus, and the blank medium is also Mixed with pseudovirus as a control, incubated at 37°C for 1 hour. The immune serum-pseudovirus mixture was transferred to a 96-well plate plated with Vero cells. After 15 hours, the number of positive cells was calculated by the CQ1 confocal cell imager (Yokogawa), and then the fitting curve was drawn in the GraphPad Prism software, and the inverse of the serum dilution corresponding to 50% neutralization was calculated, which is 50% pseudovirus. Neutralizing titer _pVNT50 . The detection results of pseudovirus neutralizing antibody titers are shown in Figure 11.

It can be seen from Figure 11 that:

1) For the prototype strain RBD dimer vaccine RBD-tr2, the geometric mean (GMT) of the neutralizing antibody titers to the pseudovirus displaying the prototype strain S protein is 1779, but the neutralization effect on some variant strains is slightly higher. The declines, including Beta (GMT, 487), Gamma (GMT, 699), etc., are 1100 and 122 for the currently popular Delta and Omicron mutant strains, and the fold reduction for Omicron mutant strains is higher.

2) For the Beta RBD dimer vaccine RBD-tr2-V2, its neutralizing antibody titers to the S protein pseudovirus of the Beta and Gamma variant strains were higher, 809 and 1650, respectively, but the titers to the prototype strain and other variant strains were higher. The neutralizing activity of the rhizome is not high, and the GMT range is 104-385, among which the GMTs for the currently popular Delta and Omicron variants are 104 and 136.

3) For the prototype strain + Beta strain chimeric RBD dimer vaccine RBD-tr2-WTV2, it induces a relatively balanced antibody response, among which the GMTs for the currently popular Delta and Omicron variant strains are 1140 and 434, both better than RBD -tr2 and RBD-tr2-V2 also maintained high neutralizing titers against the prototype strain and other variants.

Using the neutralizing antibody titer GMT value in Figure 11 to make a radar chart, the results are shown in Figure 12; Virus, Beta, Gamma, Delta, Delta+, Kappa, Lambda, and Omicron variants had the highest neutralizing abilities, especially among the currently prevalent Delta and Omicron variants, RBD-tr2-WTV2 showed better results.

To sum up, it can be concluded that the antibody response induced by the chimeric RBD dimer vaccine RBD-tr2-WTV2 was significantly higher than that of the RBD dimer protein vaccines of the same type (RBD-tr2 and RBD-tr2-V2). The neutralizing activity of pseudoviruses was more balanced, maintained a high titer, and had a good broad-spectrum.

Example 9: New coronavirus live virus challenge experiment to verify the effect of RBD-tr2-WTV2 vaccine

To further explore the protective effect of the chimeric RBD dimer vaccine, RBD-tr2-WTV2, SARS-CoV-2 challenge experiments were performed on 8 mice in each of the above experimental groups.

Due to the low affinity of BALB/c mouse ACE2 to the S protein of the prototype strain, BALB/c mice are not susceptible to the prototype new coronavirus, but the N501Y mutation of the S protein can improve the affinity of the S protein to the mouse ACE2. The Beta variant contains the N501Y mutation, so BALB/c mice are susceptible to the Beta variant.

Four mice in each experimental group were challenged with the prototype strain of the new coronavirus, while the other four mice in each experimental group were challenged with the Beta variant of the new coronavirus. The challenge experiment method of the prototype strain of 2019-nCoV is as follows: 8×10 ⁹ vp adenovirus Ad5-hACE2 was transduced by intranasal, and the hACE2 model was transiently expressed. Five days after transduction of Ad5-hACE2, 5×10 were infected by intranasal injection. ⁵ TCID ₅₀ prototype strain of novel coronavirus (hCoV-19/China/CAS-B001/2020 strain). The challenge experiment method of Beta variant strain (GDPCC-nCoV84 strain) was as follows: Mice were directly infected with 1×10 ⁶ TCID ₅₀ new coronavirus Beta variant strain (GDPCC-nCoV84 strain) by intranasal instillation.

On the 5th day after infection with the new coronavirus prototype strain or Beta variant strain, the mice were euthanized and dissected; the lungs of each mouse were taken out and divided into 2 parts: one part was added to DMEM medium and then homogenized and ground to extract the virus Nucleic acid, using the qRT-PCR method to quantify the viral genomic gRNA and subgenomic sgRNA of the virus, gRNA represents the entire viral nucleic acid, and sgRNA represents the viral nucleic acid in the replication process, which is an indicator of the level of virus replication; After formaldehyde fixation, hematoxylin and eosin (H&E) staining was performed to observe histopathology.

The method for detecting viral gRNA and sgRNA is as follows: after the mouse lung tissue is homogenized, take 140 μL of the tissue homogenate supernatant and use the viral RNA extraction kit QIAamp Viral RNA Mini Kit (GIAGEN company, cat.no.52906) to extract viral RNA . Using FastKing One-Step Probe RT-qPCR Kit (Tiangen Bio, China) on CFX96Touch real-time PCR detection system (Bio-Rad, USA), following the kit instructions for SARS-CoV-2-specific quantitative reversal PCR (qRT-PCR) detection. Two sets of primers and probes were used to detect SARS-CoV-2 genome gRNA and sgRNA, respectively.

The primer probe sequences for detecting SARS-CoV-2 virus gRNA are as follows:

F, GACCCCAAAATCAGCGAAT (SEQ ID NO: 7);

R, TCTGGTTACTGCCAGTTGAATCTG (SEQ ID NO: 8);

probe, FAM-ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO: 9)-TAMRA.

The primer probe sequences for detecting SARS-CoV-2 virus sgRNA are as follows:

sgRNA-F, CGATCCTTGTAGATCTGTTCTC (SEQ ID NO: 10);

sgRNA-R, ATATTGCAGCAGTACGCACACA (SEQ ID NO: 11);

sgRNA-probe, FAM-ACACTAGCCATCCTTACTGCGCTTCG (SEQ ID NO: 12)-TAMRA.

The detection results of the challenge experiment are shown in Figure 13; it can be seen from Figure 13 that for the mice challenged with the new coronavirus prototype strain, the control group mice detected a high level of gRNA (mean: 1.72×10 ⁹ copies/g ) and ^sgRNA (mean: 1.9 x 108 copies/g) (Figures 13A and 13B), by contrast, the viral loads (both gRNA and sgRNA) detected in vaccine-immunized mice were significantly reduced, Among them, the mean values of gRNA in lung tissue of RBD-tr2, RBD-tr2-V2 and RBD-tr2-WTV2 immunized groups were 4.61×10 ⁵ copies/g, 2.58×10 ⁶ copies/g and 2.66×10 ⁵ copies/g, respectively. It was shown that among the three vaccines, RBD-tr2-WTV2 was the most effective at inhibiting the prototype strain of the new coronavirus, which was significantly different from the RBD-tr2-V2 group. In addition, no lung tissue viral sgRNAs were detected in all vaccine groups, indicating that they completely inhibited viral replication (Figure 13B). Correlation analysis was performed based on the linear model based on the correlation analysis between the neutralizing antibody titer of each mouse against the pseudovirus of the prototype strain of the new coronavirus and the corresponding lung tissue virus gRNA after challenge. The correlation between the gRNA of the new coronavirus prototype strain in the posterior lung tissue was higher (r=-0.8967, P<0.0001), indicating that the higher the neutralizing antibody titer, the more obvious the virus-inhibiting effect (Figure 13C).

For mice challenged with the 2019-nCoV Beta variant, high levels of gRNA (mean: 4.01×10 ⁸ copies/g) and sgRNA (mean: 3.03×10 ⁷ copies/g) were detected in control mice (Fig. 13D). and 13E), in contrast, significantly lower viral loads, including both gRNA and sgRNA, were detected in mice immunized with vaccines with RBD-tr2, RBD-tr2-V2, and RBD-tr2-WTV2 immunized The average value of lung tissue gRNA in the group was 6.34×10 ⁶ copies/g, 5.46×10 ⁵ copies/g copies/g and 9.81×10 ⁴ copies/g, respectively, indicating that the three vaccines have the effect of inhibiting the new coronavirus Beta variant strain. The best was RBD-tr2-WTV2, which was significantly different from the RBD-tr2 group; neither RBD-tr2-V2 nor RBD-tr2-WTV2 vaccine groups detected viral sgRNAs in lung tissue, indicating that they completely inhibited viral replication ; sgRNA was still detected in mice in the RBD-tr2 group, and the mean value of viral sgRNA in the lung tissue of the RBD-tr2 group was 4.51×10 ⁵ copies/g ( FIG. 13E ). Correlation analysis was performed based on the linear model based on the correlation analysis between the neutralizing antibody titer of each mouse against the pseudovirus of the new coronavirus beta variant strain and the corresponding lung tissue virus gRNA after challenge with the new coronavirus beta variant strain, and the neutralizing antibody can be seen. The correlation between the titer and the new coronavirus gRNA of the lung tissue prototype strain after challenge was higher (r=-0.8039, P=0.0002), indicating that the higher the neutralizing antibody titer, the more obvious the virus-inhibiting effect (Figure 13F).

The histopathological results of the lungs of mice in each experimental group after being challenged with the new coronavirus prototype strain or Beta variant strain are shown in Figure 13G. By analyzing the lung histopathology of the mice in each experimental group, it can be seen that the lung pathological changes of the control group mice (Sham) showed moderate to severe lesions after being infected with the prototype strain of the new coronavirus or the Beta variant of the new coronavirus , including disappearance of alveolar spaces, pulmonary vascular congestion, and diffuse inflammatory cell infiltration; in contrast, mice vaccinated with RBD-tr2, RBD-tr2-V2, or RBD-tr2-WTV2 exhibited only mild lung damage (Fig. 13G). In addition, lung histopathology in mice challenged with the Beta variant showed that RBD-tr2-V2 and RBD-tr2-WTV2 were more protective than RBD-tr2 (Figure 13G). These lung histopathological results are consistent with the above-mentioned trend of viral gRNA determination in lung tissue, proving that RBD-tr2-WTV2 can indeed provide a more balanced and efficient protective effect for different strains of 2019-nCoV.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: it can still be The technical solutions described in the foregoing embodiments are modified, or some technical features thereof are equivalently replaced; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions in the embodiments of the present application.

Industrial Applicability

The present application provides a novel coronavirus multivalent antigen, its preparation method and application. The novel coronavirus antigen can not only efficiently induce an immune response against the original virus strain, but also efficiently induce an immune response against a series of mutant virus strains; that is, the novel coronavirus multivalent antigen of the present application can activate broad-spectrum protective Antibodies can have a good preventive effect on the original strain of the new coronavirus and the current epidemic strain.

Claims (18)

1. A novel coronavirus antigen is characterized in that: the amino acid sequence comprises: the amino acid sequence arranged according to (A-B)-(A-B') pattern or the amino acid sequence arranged according to (A-B)-C-(A-B') pattern , wherein: A-B represents the partial amino acid sequence or full-length amino acid sequence of the receptor binding region of the surface spike protein of the novel coronavirus, and the partial amino acid sequence of the receptor binding region of the novel coronavirus surface spike protein includes at least K417 , one or more amino acids in E484 or N501, C represents the connecting amino acid sequence, and A-B' represents the amino acid sequence obtained by replacing the amino acid sequence of A-B with one or more amino acids in K417N, E484K or N501Y.
2. The novel coronavirus antigen according to claim 1, characterized in that: the partial amino acid sequence of the receptor binding region of the surface spike protein of the novel coronavirus is at least the whole of the receptor binding region of the surface spike protein of the novel coronavirus. More than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 95%, or more than 99% of the long amino acid sequence.
3. The novel coronavirus antigen according to claim 1, wherein the partial amino acid sequence or full-length amino acid sequence of the receptor binding region of the surface spike protein of the novel coronavirus is SEQ ID NO: 1, SEQ ID NO :2 or SEQ ID NO:3.
4. The novel coronavirus antigen according to claim 3, characterized in that: A-B' represents the amino acid sequence obtained by simultaneously replacing the amino acid sequence of A-B with K417N, E484K and N501Y.
5. The novel coronavirus antigen according to claim 4, wherein the amino acid sequence of the novel coronavirus antigen is SEQ ID NO:4.
6. The novel coronavirus antigen according to claim 1, wherein the connecting amino acid sequence comprises: (GGS) _n connecting sequence, wherein n represents the number of GGS, and n is an integer ≥ 1; optionally, n is an integer selected from 1-10; further optionally, n is an integer selected from 1-5.
7. A method for preparing the novel coronavirus antigen described in one of claims 1-6, characterized in that: comprising the steps of: 5' of the nucleotide sequence encoding the novel coronavirus antigen described in one of claims 1-6 The sequence encoding the signal peptide was added to the end, histidine and stop codon were added to the 3' end, cloned and expressed, the correct recombinant was screened, and then transfected into the cells of the expression system for expression. After expression, the cell supernatant was collected and purified. Novel coronavirus antigens.
8. The preparation method according to claim 7, wherein: the cells of the expression system include mammalian cells, insect cells, yeast cells or bacterial cells, optionally; the mammalian cells include HEK293T cells, HEK293F cells or CHO cells, the bacterial cells include E. coli cells.
9. A nucleotide sequence encoding the novel coronavirus antigen described in one of claims 1-6.
10. The novel coronavirus antigen according to claim 9, wherein the nucleotide sequence is SEQ ID NO:5.
11. A recombinant vector comprising the nucleotide sequence of any one of claims 9-10.
12. An expression system cell comprising the recombinant vector of claim 11.
13. A novel coronavirus antigen described in one of claims 1-6, nucleotide sequence described in one of claims 9-10, recombinant vector described in claim 11, expression system cell described in claim 12 Application in the preparation of novel coronavirus vaccine.
14. A novel coronavirus vaccine, comprising the novel coronavirus antigen and adjuvant described in one of claims 1-6.
15. The novel coronavirus antigen according to claim 1, wherein the adjuvant is selected from aluminum adjuvant, MF59 adjuvant or MF59-like adjuvant.
16. A novel coronavirus DNA vaccine, comprising: a recombinant vector comprising a DNA sequence encoding the novel coronavirus antigen described in one of claims 1-6.
17. A novel coronavirus mRNA vaccine, comprising: a recombinant vector comprising an mRNA sequence encoding the novel coronavirus antigen described in one of claims 1-6.
18. A novel coronavirus viral vector vaccine, comprising: a recombinant viral vector comprising a nucleotide sequence encoding the novel coronavirus antigen described in one of claims 1-6; optionally, the viral vector is selected from the following one Or several: adenovirus vector, poxvirus vector, influenza virus vector, adeno-associated virus vector.

Images