WO2023213817A1 - Thérapie génique pour l'atrophie gyrate de la choroïde et de la rétine - Google Patents

Thérapie génique pour l'atrophie gyrate de la choroïde et de la rétine Download PDF

Info

Publication number
WO2023213817A1
WO2023213817A1 PCT/EP2023/061560 EP2023061560W WO2023213817A1 WO 2023213817 A1 WO2023213817 A1 WO 2023213817A1 EP 2023061560 W EP2023061560 W EP 2023061560W WO 2023213817 A1 WO2023213817 A1 WO 2023213817A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
promoter
oat
sequence
aav
Prior art date
Application number
PCT/EP2023/061560
Other languages
English (en)
Inventor
Alberto Auricchio
Iolanda BOFFA
Nicola BRUNETTI-PIERRI
Fabio DELL'AQUILA
Original Assignee
Fondazione Telethon Ets
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fondazione Telethon Ets filed Critical Fondazione Telethon Ets
Publication of WO2023213817A1 publication Critical patent/WO2023213817A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y206/00—Transferases transferring nitrogenous groups (2.6)
    • C12Y206/01—Transaminases (2.6.1)
    • C12Y206/01013—Ornithine aminotransferase (2.6.1.13)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/42—Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/48—Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • the present invention relates to constructs, vectors, in particular viral vectors, relative host cells and pharmaceutical compositions for gene therapy.
  • Gyrate atrophy of the choroid and retina is a rare inherited chorioretinal disease and a blinding disorder, first described as an atypical retinitis pigmentosa (RP) 1 .
  • Patients affected by GACR first experience loss of night vision and visual acuity, like in RP 2 .
  • GACR subjects lose vision completely 2 .
  • the causative gene of GACR encodes a reversible mitochondrial enzyme involved in ornithine conversion or synthesis.
  • Ornithine aminotransferase (OAT) monomers form an active homodimer that requires piridoxal 5’- phosphate (PLP), a derivative of vitamin B6, as a cofactor; active homodimers are able to reassemble into a mature homoexameric state 6 .
  • PBP piridoxal 5’- phosphate
  • active homodimers are able to reassemble into a mature homoexameric state 6 .
  • This enzyme is widely expressed in many tissues across species and in the eye is expressed both in the RPE and in photoreceptors 7 9 .
  • GACR dietary mediated correction of the excess of ornithine in blood can delay the development of retinal degeneration; it means that correction of the hyperornithinemia in blood is thought to be sufficient to prevent the disease phenotype. So GACR might be a target for a liver-directed genebased approach aimed at restoring the OAT enzymatic activity.
  • the inventors have engineered a nucleic acid construct and derived AAV vectors for gene therapy of GACR and found that gene therapy with a single intraocular administration of adeno-associated viral (AAV) vectors has the potential to restore local expression of OAT and its metabolic pathway in the eye and to treat the disease.
  • AAV8 vector expressing hOAT under the control of the ubiquitous CMV promoter was delivered by subretinal injection in one eye of vaOAT ⁇ mice with the contralateral receiving excipient. Eyes administered with AAV8-h(9d 7' were found to have a significant thicker outer nuclear layer (ONL) up to 12 months of age compared to eyes administered with the excipient. The improvement in ONL thickness was observed also in distant areas from the injection site. This is mirrored by a normalized RPE morphology across the entire retinal section.
  • the inventors also found that systemic reduction of the blood ornithine concentrations by intravenous injection of AAV vectors delivering the OAT gene to hepatocytes, can restore enzyme activity and prevent retinal degeneration in GACR patients. Indeed following injections with AAV-OAT, Oat rhg mice showed sustained reductions of blood ornithine concentrations compared to control mice injected with a vector expressing the green fluorescent protein (AAV-GFP). The reduction in blood ornithine concentrations was associated with improved electroretinogram (ERG) response, suggesting preservation of retinal function.
  • EMG electroretinogram
  • mice injected with the AAV-OAT vector showed partial restoration of the retinal structure on pathology with improvements of RPE structure at 1-year post injection.
  • hepatic OAT expression by AAV8 was effective at reducing blood ornithine concentrations and improving both the function and the structure of the retina proving the efficacy of liver-directed AAV-mediated gene therapy for GACR.
  • GACR is not associated to hepatic inflammation or regeneration, which reduce vector persistence, and, in addition, OAT is expressed at relatively low levels in the liver, suggesting that low percentage of cell transduction are needed to prevent the hyperornithinemia for phenotypic correction. Therefore, OAT gene therapy using a liver-directed vector, an AAV vector, is particularly effective and advantageous.
  • the inventors also found that subretinal injection of AAV8-hOAT further improves the retinal function in vaOAT ⁇ mouse model of GACR previously administered with AAV8-hOAT systemically. Therefore, the combination of intraocular and systemic gene therapy may be a supplementary approach in those patients where one approach or the other is not effective at treating the disease.
  • the present invention provides a nucleic acid construct for gene therapy of gyrate atrophy of the choroid and retina coding for an ornithine aminotransferase (OAT) enzyme comprising: a promoter sequence, a coding sequence of the ornithine aminotransferase (OAT) gene under control of said promoter.
  • OAT ornithine aminotransferase
  • said nucleic acid construct is inserted in a vector.
  • a vector for gene therapy of gyrate atrophy of the choroid and retina comprising a nucleic acid construct coding for a ornithine aminotransferase (OAT) enzyme, said construct comprising: a promoter sequence, a coding sequence of the ornithine aminotransferase (OAT) gene under control of said promoter.
  • OAT ornithine aminotransferase
  • said vector is a viral vector.
  • viral vectors are adenoviral vectors, adeno- associated viral (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, and baculoviral vectors vaccinia viruses, foamy viruses, cytomegaloviruses, Semliki Forest virus, poxviruses, RNA virus vector and DNA virus vector.
  • the viral vector derives from non- pathogenic parvovirus such as adeno-associated virus (AAV), retrovirus such as gammaretrovirus, spumavirus and lentivirus, adenovirus, poxvirus and an herpes virus.
  • the viral vector is selected from the group consisting of: adenoviral vectors, lentiviral vectors, retroviral vectors and adeno associated viral vectors (AAV).
  • the vector is a non-viral vector such as polymer-based, particle-based, lipid- based, peptide-based delivery vehicles or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles and nanoparticles including lipid nanoparticles (LNP).
  • a non-viral vector such as polymer-based, particle-based, lipid- based, peptide-based delivery vehicles or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles and nanoparticles including lipid nanoparticles (LNP).
  • a viral vector comprising a nucleic acid construct coding for the ornithine aminotransferase (OAT) enzyme, said construct comprising: a promoter sequence, a coding sequence of the ornithine aminotransferase (OAT) gene under control of said promoter, wherein said vector is a lentiviral vector or an adeno-associated virus (AAV) vector.
  • OAT ornithine aminotransferase
  • said promoter sequence is operably linked to the 5 ’end portion of said coding sequence.
  • the promoter can be for example a ubiquitous promoter or a tissue-specific promoter.
  • said promoter is a cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • said promoter is a promoter specific for liver expression, preferably a hepatocyte specific promoter, more preferably the OAT promoter or the thyroxine binding globulin (TBG) promoter.
  • said promoter is a retinal-specific promoter, in particular RPE or photoreceptor specific promoter.
  • said promoter is the OAT Promoter regulatory region, a sequence of 213 base pairs within the human OAT promoter, that was described to be to be sufficient for protein expression.
  • a further object of the invention is a viral particle containing the viral vector as defined above or herein.
  • composition comprising the vector or the viral particle according to the invention or herein described or the host cell according to the invention or herein described and at least one pharmaceutically acceptable vehicle.
  • the vector or the viral particle or the host cell or the pharmaceutical composition of the invention for use as a medicament. It is an object of the invention the vector or the viral particle or the host cell or the pharmaceutical composition of the invention for use in gene therapy.
  • said vector or viral particle or host cell or pharmaceutical composition is for use in the treatment of gyrate atrophy of the choroid and retina (GACR).
  • GACR gyrate atrophy of the choroid and retina
  • the vector or the viral particle or the host cell or the pharmaceutical composition of the invention for use in ameliorating and/or contrasting and/or reducing retinal pigment epithelium (RPE) degeneration.
  • RPE retinal pigment epithelium
  • the vector is systemically delivered or is delivered to the retina.
  • the vector is delivered systemically and to the retina, preferably said vector is delivered systemically before the delivery to the retina or said vector is delivered systemically and at the same time to the retina.
  • the vector is administered through intravenous injection or sub-retinal injection.
  • said vector is administered through intravenous injection and sub-retinal injection, preferably said administration is performed at the same time or the intravenous injection is performed before the sub-retinal injection.
  • the vector comprises a promoter specific for liver expression and is systemically administered, for example by intravenous injection.
  • the transgene is specifically expressed in the liver thereby treating GACR by liver production of the OAT enzyme.
  • the increase of the OAT enzyme in the liver leads to a lowering of the circulating levels of ornithine and to a correction of the eye defects.
  • the vector comprises a ubiquitous promoter and is delivered to the retina, for example by sub-retinal injection or intraocular administration.
  • the transgene is delivered to the target tissue, i.e. the retina, thereby treating GACR by production of the OAT enzyme in the retina.
  • the vector comprising a promoter specific for liver expression which is administered systemically, for example by intravenous injection is administered together with the vector comprising a ubiquitous promoter which delivered to the retina, for example by sub-retinal injection.
  • a vector of the invention is delivered to the retina, for example by sub-retinal injection, after or at the same time of systemically administration, for example by intravenous injection, of a vector of the invention.
  • GCR gyrate atrophy of the choroid and retina
  • said vector is delivered systemically.
  • said vector is delivered to the retina.
  • the method comprises administering systemically a first vector as defined above wherein said first vector comprises a promoter specific for liver expression and delivering to the retina a second vector as described above wherein said second vector comprises a ubiquitous promoter.
  • said vector is administered by intravenous injection or sub-retinal injection.
  • the vectors are delivered at the same time systemically, preferably by intravenous injection, and to the retina, by sub-retinal injection.
  • firstly said vectors is delivered systemically, preferably by intravenous injection, and secondly said vector is delivered to the retina, by sub-retinal injection.
  • the invention also provides a method for increasing expression of ornithine aminotransferase comprising administering to a subject in need thereof the vector according to the invention, the viral particle, the host cell according to the invention or the pharmaceutical composition according to the invention.
  • the invention also provides a method for lowering the circulating level of ornithine comprising administering to a subject in need thereof the vector, the viral particle, the host cell or the pharmaceutical composition according to the invention.
  • expression of the protein is increased in the liver or in the eye, especially in the retina, of the subject.
  • coding sequence of the ornithine aminotransferase (OAT) gene is a sequence coding for human ornithine aminotransferase (OAT).
  • the coding sequence can codify for a variant of ornithine aminotransferase (OAT), for example it can comprise additions, deletions or substitutions with respect to the coding sequence of the wild type ornithine aminotransferase (OAT) gene as long as these protein variants retain substantially the same relevant functional activity as the original OAT.
  • the coding sequence can also codify for a fragment of ornithine aminotransferase (OAT), as long as this fragment retains substantially the same relevant functional activity as the original OAT.
  • the coding sequence may be codon optimized for expression in human.
  • the viral vector or vector comprises a 5 ’-terminal repeat (5’-TR) nucleotide sequence and a 3 ’ -terminal repeat (3 ’ -TR) nucleotide sequence, preferably the 5 ’ -TR is a 5 ’ -inverted terminal repeat (5’-ITR) nucleotide sequence and the 3’-TR is a 3 ’-inverted terminal repeat (3’-ITR) nucleotide sequence, preferably the ITRs derive from the same virus serotype or from different virus serotypes, preferably the virus is an AAV, preferably of serotype 2.
  • said viral vector or vector further comprises one or more of: a 5’ inverted terminal repeat (ITR) sequence of AAV, preferably localized at the 5’ end of the promoter; a Kozak sequence, preferably localized at the 5’ end of the OAT-coding sequence and operably linked to said sequence; a post-transcriptional regulatory element, preferably localized at the 3’ end of the coding sequence of the ornithine aminotransferase (OAT) gene; a transcription termination sequence preferably localized at the 3’ end of the post- transcriptional regulatory element or at the 3 ’end of the coding sequence; a 3 ’ inverted terminal repeat (ITR) sequence of AAV, preferably localized at the 3 ’ end of the transcription termination sequence.
  • ITR inverted terminal repeat
  • the viral vector or vector preferably further comprises a 3XFLAG tag, more preferably at the 3’ end of the coding sequence of the ornithine aminotransferase (OAT) gene.
  • OAT ornithine aminotransferase
  • the transcription termination sequence is preferably localized at the 3’ end of the post-transcriptional regulatory element.
  • the vector or viral vector comprises in a 5 ’-3’ direction:
  • the viral vector or vector preferably further comprises a 3XFLAG tag, more preferably at the 3’ end of the of the coding sequence of the ornithine aminotransferase (OAT) gene.
  • OAT ornithine aminotransferase
  • the transcription termination sequence is preferably localized at the 3’ end of the post-transcriptional regulatory element.
  • said post-transcriptional regulatory element is the Woodchuck hepatitis virus post- transcriptional regulatory element (WPRE).
  • WPRE Woodchuck hepatitis virus post- transcriptional regulatory element
  • said transcription termination sequence is a poly-adenylation signal sequence, preferably the bovine growth hormon polyA (BGH poly A).
  • the vector further comprises a promoter intron, preferably selected from small T antigen intron, large T antigen intron, SV40 intron and hybrid introns made of fragments of introns, preferably said promoter intron being a chimeric promoter intron comprising or consisting of the 5’ donor site from the first intron of the human P-globin gene and the branch and 3 ’-acceptor site from the intron of an immunoglobulin gene heavy chain variable region.
  • a promoter intron preferably selected from small T antigen intron, large T antigen intron, SV40 intron and hybrid introns made of fragments of introns, preferably said promoter intron being a chimeric promoter intron comprising or consisting of the 5’ donor site from the first intron of the human P-globin gene and the branch and 3 ’-acceptor site from the intron of an immunoglobulin gene heavy chain variable region.
  • Said promoter intron is preferably operably linked to the 3’ of the promoter sequence and to the 5’ of the OAT coding sequence.
  • said promoter intron is between the promoter and the coding sequence of the ornithine aminotransferase (OAT) gene.
  • OAT ornithine aminotransferase
  • the promoter is preferably selected from a ubiquitous promoter and a tissue-specific promoter, preferably a liver-specific promoter or is preferably selected from a cytomegalovirus (CMV) promoter and a thyroxine binding globulin (TBG) promoter.
  • CMV cytomegalovirus
  • TBG thyroxine binding globulin
  • the vector is a viral vector.
  • the viral vector is selected from the group consisting of: adenoviral vectors, lentiviral vectors, retroviral vectors and adeno associated viral vectors (AAV).
  • the viral vector is an adeno associated viral vector (AAV) and the adeno-associated virus is from a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, and AAV11, AAV-PhP.B and AAV-PhP.eB, preferably it is of serotype 8.
  • the vector is a non-viral vector, preferably selected from polymer-based, particle-based, lipid-based, peptide-based delivery vehicles or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles and nanoparticles including lipid nanoparticles (LNP).
  • LNP lipid nanoparticles
  • the vector comprises in a 5 ’-3’ direction:
  • the vector comprises in a 5 ’-3’ direction:
  • promoter sequence wherein said promoter is liver-specific, preferably the thyroxine binding globulin (TBG) promoter;
  • the vector comprises in a 5 ’-3’ direction:
  • an AAV 5 ’-inverted terminal repeat (5’-ITR) sequence - a promoter sequence wherein said promoter is liver-specific, preferably the thyroxine binding globulin (TBG) promoter;
  • a further object of the invention is a viral particle containing the viral vector as defined above or herein.
  • a further object of the invention is a plasmid comprising: a promoter sequence, a coding sequence of the ornithine aminotransferase (OAT) gene under control of said promoter, wherein said plasmid is for the generation of a vector.
  • said vector is an AAV vector or a lentivirus vector.
  • it is a vector as described above.
  • Said plasmid may further comprise one or more of a 5’ inverted terminal repeat (ITR) sequence of AAV, preferably localized at the 5’ end of the promoter; a Kozak sequence, preferably localized at the 5’ end of the OAT-coding sequence and operably linked to said sequence; a post-transcriptional regulatory element, preferably localized at the 3’ end of the coding sequence of the ornithine aminotransferase (OAT) gene; a transcription termination sequence preferably localized at the 3’ end of the post- transcriptional regulatory element or at the 3 ’end of the coding sequence; a 3 ’ inverted terminal repeat (ITR) sequence of AAV, preferably localized at the 3 ’ end of the transcription termination sequence.
  • ITR inverted terminal repeat
  • the plasmid comprises in a 5’-3’ direction:
  • the promoter can be for example a ubiquitous promoter or a tissue-specific promoter, preferably a liver-specific promoter. In an embodiment it is a cytomegalovirus (CMV) promoter. In another embodiment said promoter is a promoter specific for liver expression, preferably the thyroxine binding globulin (TBG) promoter.
  • CMV cytomegalovirus
  • TSG thyroxine binding globulin
  • the plasmid preferably further comprises a 3XFLAGtag, more preferably at the 3’ end of the coding sequence of the ornithine aminotransferase (OAT) gene.
  • OAT ornithine aminotransferase
  • a nucleotide sequence of a post-transcriptional regulatory element is present, a nucleotide sequence of a transcription termination sequence is preferably localized at the 3’ end of the post-transcriptional regulatory element.
  • said post-transcriptional regulatory element is the Woodchuck hepatitis virus post- transcriptional regulatory element (WPRE).
  • WPRE Woodchuck hepatitis virus post- transcriptional regulatory element
  • said transcription termination sequence is a poly-adenylation signal sequence, preferably the bovine growth hormone polyA (BGH poly A).
  • BGH poly A bovine growth hormone polyA
  • the plasmid further comprises a promoter intron, preferably selected from small T antigen intron, large T antigen intron, SV40 intron and hybrid introns made of fragments of introns.
  • a promoter intron preferably selected from small T antigen intron, large T antigen intron, SV40 intron and hybrid introns made of fragments of introns.
  • the plasmid further comprises a chimeric promoter intron comprising or consisting of the 5’ donor site from the first intron of the human P-globin gene and the branch and 3 ’-acceptor site from the intron of an immunoglobulin gene heavy chain variable region.
  • Said promoter intron is preferably operably linked to the 3’ of the promoter sequence and to the 5’ of the OAT coding sequence.
  • the plasmid usually further comprises backbone elements which are typically required for the large scale plasmid production in bacteria, such as bacterial origin of replication, bacterial promoter, antibiotic resistance gene.
  • a further object of the invention is the use of said plasmid for the generation of a vector or an AAV vector according to the invention.
  • the coding sequence of the ornithine aminotransferase (OAT) gene comprises or consists of a sequence having at least 95% of identity to SEQ ID N.2, SEQ ID N.7 or SEQ ID N.20.
  • the promoter is a cytomegalovirus (CMV) promoter and its sequence comprises or consists of a sequence having at least 95% of identity to SEQ ID N.5.
  • CMV cytomegalovirus
  • the promoter is a TBG promoter comprising or consisting of a sequence having at least 95% of identity to the SEQ ID N.19.
  • the promoter is a OAT promoter comprising or consisting of a sequence having at least 95% of identity to the SEQ ID N.13.
  • the OAT promoter regulatory region comprises or consists of a sequence having at least 80% of identity to SEQ ID N.13.
  • the 5’ inverted terminal repeats (ITRs) of AAV comprises or consists of a sequence having at least 95% of identity to SEQ ID N.4, SEQ ID N.I 7 or SEQ ID N.23.
  • the bovine growth hormon polyA comprises or consists of a sequence having at least 95% of identity to SEQ ID N.10, SEQ ID N. I 6 or SEQ ID N.22.
  • the Woodchuck hepatitis virus post-transcriptional regulatory element comprises or consists of a sequence having at least 95% of identity to SEQ ID N.9 or SEQ ID N.15 or SEQ ID N.21.
  • the 3xflag tag comprises or consists of a sequence having at least 80% of identity to SEQ ID NO: 8.
  • the 3’ inverted terminal repeats (ITRs) of AAV comprises or consists of a sequence having at least 95% of identity to SEQ ID N.11 , SEQ ID N.18 or SEQ ID N.24
  • the chimeric promoter intron comprises or consists of a sequence having at least 95% of identity to SEQ ID N.6.
  • the Kozak sequence comprises or consists of a sequence having at least 95% of identity to the sequence GCGGCCGCC.
  • the plasmid comprises or consists of a sequence having at least 95% of identity to SEQ ID N.12.
  • the adeno-associated virus is from the serotype 8.
  • the identity may be at least 80%, or 85 % or 90% or 95% or 100% sequence identity to referred sequences. This applies to all the mentioned % of identity.
  • at least 95 % identity means that the identity may be at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to referred sequences. This applies to all the mentioned % of identity.
  • at least 98 % identity means that the identity may be at least 98%, 99% or 100% sequence identity to referred sequences. This applies to all the mentioned % of identity.
  • the % of identity relates to the full length of the referred sequence.
  • nucleic acid sequences derived from the nucleotide sequences herein mentioned, e.g. functional fragments, mutants, variants, derivatives, analogues, and sequences having a % of identity of at least 80% with the sequences herein mentioned, as far as such fragments, mutants, variants, derivatives and analogues maintain the function of the sequence from which they derive.
  • inverted terminal repeat means sequences which are repeated at both ends of a nucleotide sequence in the opposite orientation (reverse complementary).
  • gyrate atrophy of the choroid and retina is intended a disease caused by homozygous or compound heterozygous mutation in the OAT gene (613349) on chromosome 10q26.
  • Hyperomithinemia with gyrate atrophy of choroid and retina, ornithine aminotransferase deficiency and oat deficiency can be used as synonyms.
  • FIG. 1 Schematic representation of AAV-hOAT constructs used in Example 1.
  • FIG. 2 Plasmids encoding hOAT or hOAT-3XFlag significantly increase OAT activity in vitro. Quantification of OAT activity with the ninhydrin method. hARPE-19 cells were transfected with plasmids encoding for hOAT, hOAT-3XFlag or enhanced green fluorescent protein (EGFP) as a control with relatively low expression of OAT. One hundred pg of protein lysate were used per sample in the assay. Results are represented as value of each biological replicate (filled square) and as mean value for each group (column). Mean value of each group is indicated inside the corresponding bar. Statistical analysis was conducted using one-way ANOVA with Tuckey post-hoc analysis.
  • EGFP enhanced green fluorescent protein
  • Figure 3 Efficient expression of hOAT upon sub-retinal administration of AAV-hOAT-3XFlag in vivo.
  • a-OAT western blot with anti-Ornithine aminotransferase antibody
  • u- Calnexin western blot with anti-Calnexin antibody, used as loading control.
  • hOAT human ornithine aminotransferase
  • mOAT murine ornithine aminotransferase
  • FIG. 4 AAV-hOAT-3XFlag improved outer nuclear layer thickness upon sub-retinal injection in Oat-/- mice.
  • -I- homozygous affected Oat mice.
  • FIG. 5 Sub-retinal administration of AAV-hOAT-3XFlag results in improvements to retinal pigment epithelium degeneration (RPE) in Oat" ' mice.
  • RPE retinal pigment epithelium degeneration
  • A) Representative pictures from montages of the entire retinal section imaged at 40X magnification and used for RPE analysis. Each picture is composed of —2 fields. Scale bar (white bar) 20 pm.
  • RPE, outer segments (OS) and outer nuclear layer (ONL) are indicated in white, black and white, respectively. Red arrows point at degenerared RPE. +/- : heterozygous unaffected Oat mice; -I- : homozygous affected Oat mice.
  • RPE retinal pigment epithelium; OS: outer segments; ONL: outer nuclear layer.
  • FIG. 6 AAV-hOAT-3XFlag does not improve retinal function in subretinally injected Oat-/- mice.
  • A Representative ERG waves at 20 cd/m*2 of unaffected heterozygous (Oat+/-) mice injected with formulation buffer and affected homozygous (Oat-/-) mice injected with AAV-hOAT-3XFlag or formulation buffer. Blue point indicates A-Wave, orange point indicates B-Wave.
  • FIG. 8 OAT gene transfer in Oaf hg pigmented mice injected at 6 weeks of age improves retinal phenotype:
  • a WT mouse was included as control, and Vinculin was used as loading control, (g) Morphological analysis of CW ⁇ mice retinas 11 months post-injection of AAV-GFP or AAV-OAT. An age-matched WT mouse is shown as control (left panel). Semi-thin sections (40X). Abbreviations: ns, not statistically significant difference; OS, outer segment; IS, inner segment; RPE, retinal pigment epithelium; ONL, outer nuclear layer; INL, inner nuclear layer, WT, wild-type.
  • Fig. 9 Improvement of retinal disease of Oaf hg mice by liver-directed gene transfer.
  • FIG. 10 AAV mediated OAT delivery to hepatocyte of Oaf hg albino mice injected.
  • AAV-GFP eyes (middle panel) displaying irregular and highly altered thickened ultrastructure of basal infoldings compared to wild-type (WT-left panel) or AAV-OAT injected mice (right panel). Basal infoldings of Bruch’s membrane is outlined by dashed line. Scale bar: 750 nm.
  • Fig. 13 Improvement phenotype in Oat A mice following AAV-mediated liver-directed OAT gene transfer.
  • FIG. Schematic representation of the OAT expression cassette of Example 2.
  • FIG. 16 The OAT and -OAT-3XFlag plasmids express biologically-active OAT in vitro
  • hARPE- 19 cells transfected with a plasmid encoding EGFP were used as controls. Black bars correspond to 43 and 55 KDa, arrows indicate OAT or OAT-3XFlag, 10 pg of proteins were loaded in each lane.
  • a-OAT western blot with anti-Ornithine aminotransferase antibody
  • a-Tubulin western blot with anti-Tubulin antibody, used as loading control
  • pEGFP plasmid encoding for EGFP
  • jpOAT plasmid encoding for OAT
  • pCMT-3XFlag plasmid encoding for 0AT-3XFlag.
  • P5C pyrroline 5-carboxilate
  • pEGFP plasmid encoding for EGFP
  • pOAT plasmid encoding for OAT
  • pCMTkSXFlag plasmid encoding for OAT-3XFlag.
  • Figure 17 Efficient expression of OAT upon subretinal administration of AAV8-OAT in vivo
  • FIG. 18 Subretinal administration of AAV8-OAT improves outer nuclear layer thickness in Oat A mice
  • Figure 20 Subretinal administration of AAV8-OAT does not improve retinal function in subretinal injected Oat' ' mice.
  • Heterozygous (Oat O mice injected with excipient (circles, n of eyes 10, 10, 10 and 9 per each time-point) were used as unaffected controls.
  • Mouse eyes were stimulated with a luminance of 20 candelas/m 2 . Data are represented as mean ⁇ standard error of mean (SEM).
  • Cd candela; +/-: heterozygous unaffected Oat mice; -/-: homozygous affected Oat mice.
  • FIG. 21 Intraocular administration of AAV8-OAT does not alter hyperornithinaemia
  • Ornithinaemia measured in OaO ⁇ mice receiving AAV8-6M 7'in one eye Samples from Oat +/ ⁇ mice administered the excipient and OaO ⁇ mice uninjected were used as controls of normal- and hyperornithinaemia, respectively. Age at blood collection is reported below the graph. Results are represented as mean value for each animal (filled square) and as mean value for each treatment group (reported inside each column). +/-: Oat +/ ' heterozygous unaffected mice; -/-: Oat' 7 ' affected mice; Exc: group of animals administered with excipient; NT: uninjected animal group.
  • Figure 22 Combination of systemic and intraocular administration of AAV8-0AT further improves retinal function in Oat' ' mice.
  • A-B Electroretinogram analysis at age 4 months to assess A-wave (A) and B-wave (B) in Oaf' mice injected systemically and subretina with either AAV8-CMZ or excipient in the contralateral eye.
  • Heterozygous (Oat ) mice injected systemically and subretina with excipient were used as unaffected controls.
  • Mouse eyes were stimulated with luminances from 0.0001 to 20 candela. second/m 2 .
  • Data are represented as mean ⁇ standard error of mean (SEM), n of eyes is reported next to the 20-candela measurement of the A-WAVE.
  • Cd candela; s: second; +/-: heterozygous unaffected Oat mice; -/-: homozygous affected Oat mice.
  • C-D Electroretinogram analysis at age 6 months to assess A-wave (C) and B-wave (D) in Oaf mice injected systemically and subretina with either AAV8-CMZ or excipient in the contralateral eye.
  • Heterozygous (Oaf) mice injected systemically and subretina with excipient were used as unaffected controls.
  • Mouse eyes were stimulated with luminances from 0.0001 to 20 candela. second/m 2 .
  • Data are represented as mean ⁇ standard error of mean (SEM), n of eyes is reported next to the 20-candela measurement of the A-WAVE.
  • Cd candela; s: second; +/-: heterozygous unaffected Oat mice; -/-: homozygous affected Oat mice.
  • Figure 23 Ornithinaemia is lower in Oat' ' treated with the combination of systemic and Intraocular AAV8-OAT
  • Ornithinaemia measured in Oaf mice receiving AAV8-6M /' systemically and in one eye. Samples from Oaf ⁇ and Oaf mice administered the excipient were used as controls of normal- and hyperornithinaemia, respectively. Age at blood collection is reported below the graph. Results are represented as mean value for each animal (filled square) and as mean ⁇ standard error of mean value for each treatment group (mean value reported inside each column). +/-: Oat +/ ' heterozygous mice; - /-: Oat' 7 ' affected mice; Exc: group of animals administered with excipient.
  • the vectors may be administered to a patient. A skilled worker would be able to determine an appropriate dosage range.
  • Gene therapy may be directed to a specific tissue in order to correct a genetic defect.
  • one strategy is to direct the gene delivery directly to the target tissue, e.g. to the retina, for example via subretinal injection.
  • a systemic injection of a vector targets the liver via liver-specific expression of the transgene due to the presence of a liver-specific promoter.
  • the retina defect is corrected by the retina-specific expression of the transgene.
  • the retina defect is corrected by the reduction in ornithine levels achieved through liver-specific expression of the ornithine aminotransferase enzyme.
  • the retina defect is corrected by the combined reduction in ornithine levels achieved through liver-specific expression of the ornithine aminotransferase enzyme and by the retina-specific expression of the transgene.
  • the present invention provides a nucleic acid construct for gene therapy of GACR.
  • the nucleic acid construct of the invention comprises a nucleic acid sequence coding for a ornithine aminotransferase (OAT) enzyme comprising: a promoter sequence, a coding sequence of the ornithine aminotransferase (OAT) gene under control of said promoter.
  • OAT ornithine aminotransferase
  • OAT indicates the enzyme ornithine aminotransferase encoded by the ornithine aminotransferase (OAT) gene.
  • the nucleic acid construct further comprises a 3XFLAG tag at the 3 ’end of the coding sequence of the ornithine aminotransferase (OAT) gene.
  • OAT ornithine aminotransferase
  • the human OAT gene (ENSG00000065154, ensembl database, 12 April 2022 version) is located on the reverse strand of chromosome 10 (124,397,303-124,418,976) and has at least 8 annotated transcript isoforms.
  • the canonical transcript (GenBank accession NM 000274.4) is comprised of 10 exons, the first of which is non coding, and translation initiates from an AUG signal on exon 2.
  • the 5’UTR is 90 nucleotides long, while the 3’ UTR comprises 641 nucleotides, and contains a canonical AAUAA consensus 23 nucleotides upstream of the poly A.
  • the open reading frame encodes for a 439 amino acid protein (NCBI Reference Sequence: NP 000265.1) which is virtually ubiquitously expressed.
  • the other transcripts codify for shorter proteins which lack crucial functional domains and are likely to be enzymatically inactive.
  • the relative abundance, the tissue distribution, and the potential physiological role of each of these transcripts are still unknown 17 .
  • Exemplary sequence of the OAT gene can be found at NM_000274.4 (NCBI, last version).
  • the human OAT protein is a mitochondrial matrix enzyme which catalyzes the reversible interconversion of L-ornithine and 2-oxoglutarate to L-glutamate semialdehyde and L-glutamate (UniProt P04181-1).
  • the mature enzyme is a homopolymer comprised of four or possibly six monomers.
  • the monomers are synthesized on cytoplasmic free ribosomes as 49-kDa precursors which are cleaved to 45-kDa peptides at mitochondrial entry 18 .
  • the OAT protein can have a sequence identified as P04181-1 or as P04181-2 in Uniprot database (last version).
  • the OAT enzyme codified by the construct of the invention comprises or consists of an amino acid sequence that has at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 1 or a fragment thereof.
  • the OAT gene from which the OAT coding sequence is derived has sequence SEQ ID N. 3
  • the coding sequence can codify for a variant of ornithine aminotransferase (OAT), for example it can comprise additions, deletions or substitutions with respect to the coding sequence of the wild type ornithine aminotransferase (OAT) gene as long as these protein variants retain substantially the same relevant functional activity as the original OAT.
  • the coding sequence can also codify for a fragment of ornithine aminotransferase (OAT), as long as this fragment retains substantially the same relevant functional activity as the original OAT.
  • the coding sequence may be codon optimized for expression in human.
  • a nucleic acid construct coding for a OAT enzyme may comprise a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, or 99% identity with any of sequence SEQ ID NOs: 2, 7 and 20; preferably a sequence having at least 85%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, or 99% identity with any one of said sequences; more preferably a sequence having at least 95 %, 96%, 97%, 98%, or 99% identity with any one of said sequences.
  • the nucleic acid construct comprises or consists of DNA.
  • nucleic acid and “polynucleotide sequence” and “construct” refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and unless otherwise limited, would encompass known analogs of natural nucleotides that can function in a similar manner as naturally-occurring nucleotides.
  • the polynucleotide sequences include both full- length sequences as well as shorter sequences derived from the full-length sequences. It is understood that a particular polynucleotide sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell.
  • polynucleotide sequences falling within the scope of the subject invention further include sequences which specifically hybridize with the sequences coding for a peptide of the invention.
  • the polynucleotide includes both the sense and antisense strands as either individual strands or in the duplex.
  • the subject invention also contemplates those polynucleotide molecules having sequences which are sufficiently homologous with the polynucleotide sequences of the invention so as to permit hybridization with that sequence under standard stringent conditions and standard methods 19 .
  • the subject invention also concerns a construct that can include regulatory elements that are functional in the intended host cell in which the vector comprising the construct is to be expressed.
  • regulatory elements include, for example, promoters, transcription termination sequences, translation termination sequences, enhancers, signal peptides, degradation signals and polyadenylation elements.
  • a construct of the invention may optionally contain a transcription termination sequence, a translation termination sequence, signal peptide sequence, internal ribosome entry sites (IRES), enhancer elements, and/or post-trascriptional regulatory elements such as the Woodchuck hepatitis virus (WHV) posttranscriptional regulatory element (WPRE).
  • Transcription termination regions can typically be obtained from the 3' untranslated region of a eukaryotic or viral gene sequence. Transcription termination sequences can be positioned downstream of a coding sequence to provide for efficient termination. In the system of the invention a transcription termination site is typically included.
  • the nucleic acid construct of the invention of the invention can comprise a promoter sequence operably linked to a nucleotide sequence encoding the desired polypeptide.
  • operably linked means that the parts (e.g. transgene and promoter) are linked together in a manner which enables both to carry out their function substantially unhindered.
  • a promoter within the meaning of the present invention may be a ubiquitous promoter, meaning that it drives expression of the gene in a wide range of cells and tissues.
  • a further promoter within the present invention is a tissue- specific promoter that shows selective activity in one or a group of tissues but is less active or not active in other tissues. The promoter may show inducible expression in response to presence of another factor, for example a factor present in a host cell.
  • the promoter is functional in the target cell (e.g. retinal cell or liver cell).
  • the promoter is a ubiquitous promoter, retina-specific promoter, preferably an RPE or photoreceptor cell specific promoter or a liver specific promoter, preferably a hepatocyte specific promoter.
  • Promoters contemplated for use in the subject invention include, but are not limited to, native gene promoters or fragments thereof such as cytomegalovirus (CMV) promoter (see e.g.
  • thyroxine binding globulin (TBG) promoter 20 thyroxine binding globulin (TBG) promoter 20 , OAT promoter 21 , chimeric CMV/chicken beta-actin promoter (CBA) and the truncated form of CBA (smCBA) promoter (US8298818 and Light-Driven Cone Arrestin Translocation in Cones of Postnatal Guanylate Cyclase-1 Knockout Mouse Retina Treated with AAVGC1), Rhodopsin promoter (see e.g. NG 009115), Interphotoreceptor retinoid binding protein promoter (see e.g. NG 029718.1), vitelliform macular dystrophy 2 promoter (see e.g.
  • hGRKl PR-specific human G protein- coupled receptor kinase 1
  • hGRKl PR-specific human G protein- coupled receptor kinase 1
  • the promoter is a CMV or TBG promoter.
  • the promoter is a CMV promoter for example a promoter of SEQ ID N: 5 or a TBG promoter, for example a promoter of SEQ ID N.19 ; or a fragment thereof.
  • the promoter nucleic acid sequence that has at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide identity to SEQ ID Ns.5, 13 or 19 or a fragment thereof, preferably wherein the promoter substantially retains the natural function of the promoter of SEQ ID Ns 5, 13 or 19.
  • Promoters can be incorporated into a construct using standard techniques known in the art. Multiple copies of promoters or multiple promoters can be used in a construct of the invention. In one embodiment, the promoter can be positioned about the same distance from the transcription start site as it is from the transcription start site in its natural genetic environment. Some variation in this distance is permitted without a substantial decrease in promoter activity.
  • Introns may be included in a nucleic acid construct.
  • an intron placed between the promoter and the coding sequence increases mRNA stability and protein production, thereby increasing transgene expression.
  • a preferred intron of the invention is a chimeric promoter intron composed of the 5’ donor site from the first intron of the human P-globin gene and the branch and 3 ’-acceptor site from the intron of an immunoglobulin gene heavy chain variable region, for example the intron of SEQ ID N.6.
  • the invention comprises at least one detectable marker.
  • the term “detectable marker” refers to a moiety that, when attached to the polypeptide, confers detectability upon that polypeptide or another molecule to which the polypeptide binds.
  • the detectable marker comprises an affinity tag.
  • affinity tags include Strep-tags, chitin binding proteins (CBP) , maltose binding proteins (MBP) , glutathione-S-transferase (GST) , FLAG- tags, HA-tags, Myc-tags, poly (His) -tags as well as derivatives thereof.
  • the detectable marker is 3xFLAG (i.e., the FLAG motif repeated three times).
  • the detectable marker comprises or is encoded by SEQ ID NO: 8, or comprises or is encoded by a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence of SEQ ID NO: 8, that maintains the same functions as SEQ ID NO: 8 or by the sequence encoded by SEQ ID NO: 8 (e.g., detection of the polypeptide) .
  • Fluorescent moieties can be used as detectable markers, but detectable markers also include, for example, isotopes, fluorescent proteins and peptides, enzymes, components of a specific binding pair, chromophores, affinity tags as described herein or known in the art, antibodies, colloidal metals (i.e.g old) and quantum dots.
  • Detectable markers can be either directly or indirectly detectable. Directly detectable markers do not require additional reagents or substrates in order to generate detectable signal. Examples include isotopes and fluorophores. Indirectly detectable markers require the presence or action of one or more co-factors or substrates.
  • Examples include enzymes such as P- galactosidase which is detectable by generation of colored reaction products upon cleavage of substrates such as the chromogen X-gal (5-bromo-4-chloro-3-indoyl-P-D-galactopyranoside) , horseradish peroxidase which is detectable by generation of a colored reaction product in the presence of the substrate diaminobenzidine and alkaline phosphatase which is detectable by generation of colored reaction product in the presence of nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate.
  • substrates such as the chromogen X-gal (5-bromo-4-chloro-3-indoyl-P-D-galactopyranoside)
  • horseradish peroxidase which is detectable by generation of a colored reaction product in the presence of the substrate diaminobenzidine
  • alkaline phosphatase which is detect
  • the nucleic acid construct of the present invention may comprise a polyadenylation sequence.
  • the transgene is operably linked to a polyadenylation sequence.
  • a polyadenylation sequence may be inserted downstream of the transgene to improve transgene expression.
  • a polyadenylation sequence typically comprises a polyadenylation signal, a polyadenylation site and a downstream element: the polyadenylation signal comprises the sequence motif recognised by the RNA cleavage complex; the polyadenylation site is the site of cleavage at which a poly-A tails is added to the mRNA; the downstream element is a GT-rich region which usually lies just downstream of the polyadenylation site, which is important for efficient processing.
  • the polyadenylation sequence is a bovine growth hormone (bGH) polyadenylation sequence or an SV40 polyadenylation sequence; or a fragment thereof that retains the natural function of the polyadenylation sequence.
  • bGH bovine growth hormone
  • the polyadenylation sequence is a bovine growth hormone (bGH) polyadenylation sequence.
  • bGH bovine growth hormone
  • a preferred polyadenylation sequence of the invention is SEQ ID N. 10 or SEQ ID N.16 or SEQ ID N.22.
  • the polyadenylation sequence comprises or consists of a nucleic acid sequence that has at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide identity to SEQ ID N.10, 16 or 22, preferably wherein the polyadenylation sequence substantially retains the natural function of the polyadenylation sequence of SEQ ID N.10, 16 or 22.
  • the nucleic acid constructs of the present invention may comprise post-transcriptional regulatory elements.
  • the protein-coding sequence is operably linked to one or more further post- transcriptional regulatory elements that may improve gene expression.
  • the construct of the present invention may comprise a Woodchuck Hepatitis Virus Post- transcriptional Regulatory Element (WPRE).
  • WPRE Woodchuck Hepatitis Virus Post- transcriptional Regulatory Element
  • the OAT coding sequence is operably linked to a WPRE.
  • Suitable WPRE sequences will be well known to those of skill in the art (see, for example, Zufferey et al. 23 ; Zanta-Boussif et al. 24 ).
  • the WPRE is a wild-type WPRE or is a mutant WPRE.
  • the WPRE may be mutated to abrogate translation of the woodchuck hepatitis virus X protein (WHX), for example by mutating the WHX ORF translation start codon.
  • WHX woodchuck hepatitis virus X protein
  • the WPRE comprises or consists of the nucleotide sequence SEQ ID NOV, 15 or 21 or a fragment thereof.
  • the nucleic acid construct of the present invention may comprise a Kozak sequence.
  • the OAT-coding sequence is operably linked to a Kozak sequence.
  • a Kozak sequence may be inserted before the start codon to improve the initiation of translation.
  • Kozak sequences will be well known to the skilled person (see, for example, Kozak 25 ).
  • the Kozak sequence comprises or consists of the nucleotide sequence GCGGCCGCC or a fragment thereof.
  • the present invention also relates to a vector comprising the nucleic acid construct as described herein.
  • a vector comprising the nucleic acid construct as described herein.
  • Such vector may therefore contain any of the elements above described in relation to the construct.
  • it can comprise, besides the OAT coding sequence, one or more regulatory elements including, for example, promoters, transcription termination sequences, translation termination sequences, enhancers, signal peptides, degradation signals and polyadenylation elements, in particular as above defined.
  • Vectors suitable for the delivery and expression of nucleic acids into cells for gene therapy are encompassed by the present invention.
  • Vectors of the invention include viral and non-viral vectors.
  • Non-viral vectors include non-viral agents commonly used to introduce or maintain nucleic acid into cells.
  • Said agents include in particular polymer-based, particle-based, lipid-based, peptide-based delivery vehicles or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles and nanoparticles including lipid nanoparticles (LNP).
  • LNP lipid nanoparticles
  • viruses including adeno-associated viruses
  • the concept of virus-based gene delivery is to engineer the virus so that it can express the gene(s) of interest or regulatory sequences such as promoters and introns.
  • most viral vectors contain mutations that hamper their ability to replicate freely as wild-type viruses in the host.
  • Viruses from several different families have been modified to generate viral vectors for gene delivery. These viruses include retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, baculoviruses, picomaviruses, and alphaviruses.
  • Viral vectors of the invention may be derived from non-pathogenic parvovirus such as adeno- associated virus (AAV), retrovirus such as gammaretrovirus, spumavirus and lentivirus, adenovirus, poxvirus and an herpes virus.
  • AAV adeno- associated virus
  • retrovirus such as gammaretrovirus, spumavirus and lentivirus
  • adenovirus poxvirus
  • an herpes virus such as adeno- associated virus (AAV)
  • viruses according to the present invention are lentivirus and adeno-associated virus.
  • Viral vectors are by nature capable of penetrating into cells and delivering nucleic acids of interest into cells, according to a process known as viral transduction.
  • viral vector refers to a non-replicating, non-pathogenic virus engineered for the delivery of genetic material into cells. Viral genes essential for replication and virulence are replaced with an expression cassette for the transgene of interest. Thus, the viral vector genome comprises the transgene expression cassette flanked by the viral sequences required for viral vector production.
  • virus particle or “viral particle” is intended to mean the extracellular form of a non- pathogenic virus, in particular a viral vector, composed of genetic material made from either DNA or RNA surrounded by a protein coat, called capsid, and in some cases an envelope derived from portions of host cell membranes and including viral glycoproteins.
  • a viral vector refers also to a viral vector particle.
  • Viral vectors encompassed by the present invention are suitable for gene therapy.
  • Viral particles can be for example obtained using vectors that are capable of accommodating genes of interest and helper cells that can provide the viral structural proteins and enzymes to allow for the generation of vector-containing infectious viral particles.
  • AAV Adeno-associated virus
  • Adeno-associated virus is a family of viruses that differs in nucleotide and amino acid sequence, genome structure, pathogenicity, and host range. This diversity provides opportunities to use viruses with different biological characteristics to develop different therapeutic applications.
  • An ideal adeno-associated virus-based vector for gene delivery must be efficient, cell-specific, regulated, and safe. The efficiency of delivery may determine the efficacy of the therapy. Current efforts are aimed at achieving cell-type-specific infection and gene expression with adeno-associated viral vectors. In addition, adeno-associated viral vectors are being developed to regulate the expression of the gene of interest, since the therapy may require long-lasting or regulated expression.
  • Adeno-associated virus is a small virus which infects humans and some other primate species. AAV is not currently known to cause disease and consequently the virus causes a very mild immune response. Gene therapy vectors using AAV can infect both dividing and quiescent cells and persist in an extrachromosomal state without integrating into the genome of the host cell. These features make AAV a very attractive candidate for creating viral vectors for gene therapy, and for the creation of isogenic human disease models.
  • Wild-type AAV has attracted considerable interest from gene therapy researchers due to a number of features. Chief amongst these is the virus's apparent lack of pathogenicity. It can also infect nondividing cells and has the ability to stably integrate into the host cell genome at a specific site (designated AAVS1) in the human chromosome 19. Development of AAVs as gene therapy vectors, however, has eliminated this integrative capacity by removal of the rep and cap from the DNA of the vector.
  • the desired gene together with a promoter to drive transcription of the gene is inserted between the ITRs that aid in concatemer formation in the nucleus after the single-stranded vector DNA is converted by host cell DNA polymerase complexes into double-stranded DNA.
  • AAV-based gene therapy vectors form episomal concatemers in the host cell nucleus. In non-dividing cells, these concatemers remain intact for the life of the host cell. In dividing cells, AAV DNA is lost through cell division, since the episomal DNA is not replicated along with the host cell DNA. Random integration of AAV DNA into the host genome is detectable but occurs at very low frequency. AAVs also present very low immunogenicity, seemingly restricted to generation of neutralizing antibodies, while they induce no clearly defined cytotoxic response. This feature, along with the ability to infect quiescent cells make AAV particularly suitable for human gene therapy.
  • the AAV genome is built of single-stranded deoxyribonucleic acid (ssDNA), either positive- or negative-sensed, which is about 4.7 kilobase long.
  • the genome comprises inverted terminal repeats (ITRs) at both ends of the DNA strand, and two open reading frames (ORFs): rep and cap.
  • ITRs inverted terminal repeats
  • ORFs open reading frames
  • the former is composed of four overlapping genes encoding Rep proteins required for the AAV life cycle, and the latter contains overlapping nucleotide sequences of capsid proteins: VP1, VP2 and VP3, which interact together to form a capsid of an icosahedral symmetry.
  • the Inverted Terminal Repeat (ITR) sequences received their name because of their symmetry, which was shown to be required for efficient multiplication of the AAV genome. Another property of these sequences is their ability to form a hairpin, which contributes to so-called self-priming that allows primase-independent synthesis of the second DNA strand.
  • the ITRs were also shown to be required for efficient encapsidation of the AAV DNA combined with generation of a fully assembled, deoxyribonuclease-resistant AAV particles.
  • ITRs seem to be the only sequences required in cis next to the therapeutic gene: structural (cap) and packaging (rep) genes can be delivered in trans. With this assumption many methods were established for efficient production of recombinant AAV (rAAV) vectors containing a reporter or therapeutic gene.
  • rAAV recombinant AAV
  • the AAV vector comprises an AAV capsid able to transduce the target cells of interest.
  • the AAV capsid may be from one or more AAV natural or artificial serotypes.
  • AAV may be referred to in terms of their serotype.
  • a serotype corresponds to a variant subspecies of AAV which, owing to its profile of expression of capsid surface antigens, has a distinctive reactivity which can be used to distinguish it from other variant subspecies.
  • an AAV vector particle having a particular AAV serotype does not efficiently cross-react with neutralising antibodies specific for any other AAV serotype. All of the known serotypes can infect cells from multiple diverse tissue types. Tissue specificity is determined by the capsid serotype and pseudotyping of AAV vectors to alter their tropism range affects their use in therapy.
  • the inverted terminal repeat (ITR) sequences used in an AAV vector system of the present invention can be any AAV ITR.
  • the ITRs used in an AAV vector can be the same or different.
  • a vector may comprise an ITR of AAV serotype 2 and an ITR of AAV serotype 5.
  • an ITR is from AAV serotype 2, 4, 5, or 8.
  • ITRs of AVV serotype 2 are preferred.
  • AAV ITR sequences are well known in the art (for example, see for ITR2, GenBank Accession Nos. AF043303.1 ; NC_001401.2; J01901.1 ; JN898962.1; see for ITR5, GenBank Accession No. NC_006152.1).
  • AAV2 Serotype 2
  • HSPG heparan sulfate proteoglycan
  • FGFR-1 fibroblast growth factor receptor 1
  • the first functions as a primary receptor, while the latter two have a co-receptor activity and enable AAV to enter the cell by receptor-mediated endocytosis.
  • HSPG functions as the primary receptor, though its abundance in the extracellular matrix can scavenge AAV particles and impair the infection efficiency.
  • AAV2 is the most popular serotype in various AAV-based research, it has been shown that other serotypes can be effective as gene delivery vectors.
  • AAV6 appears much better in infecting airway epithelial cells
  • AAV7 presents very high transduction rate of murine skeletal muscle cells (similarly to AAV1 and AAV5)
  • AAV8 is superb in transducing hepatocytes and photoreceptors
  • AAV1 and 5 were shown to be very efficient in gene delivery to vascular endothelial cells.
  • most AAV serotypes show neuronal tropism, while AAV5 also transduces astrocytes.
  • Serotypes can differ with respect to the receptors they are bound to.
  • AAV4 and AAV5 transduction can be inhibited by soluble sialic acids (of different form for each of these serotypes), and AAV5 was shown to enter cells via the platelet-derived growth factor receptor.
  • cells can be coinfected or transfected with adenovirus or polynucleotide constructs comprising adenovirus genes suitable for AAV helper function. Examples of materials and methods are described, for example, in U.S. Patent Nos. 8,137,962 and 6,967,018.
  • An AAV virus or AAV vector of the invention can be of any AAV serotype, including, but not limited to, serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV1 1, AAV-PhP.B and AAV-PhP.eB.
  • an AAV2 or an AAV5 or an AAV7 or an AAV8 or an AAV9 serotype is utilized.
  • the AAV8 is used.
  • the AAV genome is derivatized for the purpose of administration to patients. Such derivatization is standard in the art and the invention encompasses the use of any known derivative of an AAV genome, and derivatives which could be generated by applying techniques known in the art.
  • the AAV genome may be a derivative of any naturally occurring AAV.
  • the AAV genome is a derivative of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or AAV11.
  • Derivatives of an AAV genome include any truncated or modified forms of an AAV genome which allow for expression of a transgene from an AAV vector of the invention in vivo.
  • the AAV serotype provides for one or more tyrosine to phenylalanine (Y-F) mutations on the capsid surface.
  • the plasmid described above can be used to generate the AAV vector of the invention.
  • the AAV vector can be for example produced by triple transfection of producer cells, such as HEK293 cells, a method known in the field wherein the plasmid comprising the gene of interest, OAT in the present case, is transfected along with two additional plasmids into a producer cell wherein the viral particles will then be produced.
  • the subject invention also concerns a host cell comprising the viral vector of the invention.
  • the host cell can be a cultured cell or a primary cell, i.e., isolated directly from an organism, e.g., a human.
  • the host cell can be an adherent cell or a suspended cell, i.e., a cell that grows in suspension.
  • Suitable host cells are known in the art and include, for instance, DH5a, E. coli cells, Chinese hamster ovarian cells, monkey VERO cells, COS cells, HEK293 cells, and the like.
  • the cell can be a human cell or from another animal.
  • the cell is a retina cell, particularly a photoreceptor cell, an RPE cell or a cone cell.
  • the cell may also be liver cell, particularly a hepatocyte.
  • said host cell is an animal cell, and most preferably a human cell.
  • the cell can express a nucleotide sequence provided in the viral vector of the invention.
  • the man skilled in the art is well aware of the standard methods for incorporation of a polynucleotide or vector into a host cell, for example transfection, lipofection, electroporation, microinjection, viral infection, thermal shock, transformation after chemical permeabilization of the membrane or cell fusion.
  • host cell or host cell genetically engineered relates to host cells which have been transduced, transformed or transfected with the viral vector of the invention.
  • the present invention also provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of the vector of the present invention comprising the therapeutic transgenes or a viral particle produced by or obtained from the same.
  • compositions within the meaning of the present invention comprise the vector or the host cell of the invention optionally in combination with a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
  • a pharmaceutically acceptable carrier diluent, excipient or adjuvant.
  • the choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice.
  • the pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilizing agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system).
  • the vector can be administered in vivo or ex vivo.
  • compositions adapted for parenteral or ocular (e.g. retinal) administration comprising an amount of a compound, constitute a preferred embodiment of the invention.
  • the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
  • the vector or the pharmaceutical composition of the present invention may be delivered to the retina preferentially via the subretinal injection or it can also be prepared in the form of injectable suspension, eye lotion or ophthalmic ointment that can be delivered to the retina with a non-invasive procedure.
  • the vector or the pharmaceutical composition is systemically delivered, for example by intravenous injection.
  • the vector or the pharmaceutical composition of the present invention may be delivered to the retina, preferentially via the subretinal injection or in the form of injectable suspension, eye lotion or ophthalmic ointment, and it may be systemically delivered, for example by intravenous injection, at the same time of the delivery to retina or before the delivery to the retina.
  • the methods of the present invention can be used with humans and other animals.
  • the terms "patient” and “subject” are used interchangeably and are intended to include such human and non-human species.
  • in vitro methods of the present invention can be earned out on cells of such human and non- human species.
  • kits comprising the viral vector or the host cells of the invention in one or more containers.
  • Kits of the invention can optionally include pharmaceutically acceptable carriers and/or diluents.
  • a kit of the invention includes one or more other components, adjuncts, or adjuvants as described herein.
  • a kit of the invention includes instructions or packaging materials that describe how to administer a vector system of the kit.
  • Containers of the kit can be of any suitable material, e.g., glass, plastic, metal, etc., and of any suitable size, shape, or configuration.
  • the viral vector or the host cell of the invention is provided in the kit as a solid.
  • the viral vector or the host cell of the invention is provided in the kit as a liquid or solution.
  • the kit comprises an ampoule or syringe containing the viral vector or the host cell of the invention in liquid or solution form.
  • the invention provides the vector, cell, kit or composition of the invention for use in therapy.
  • the invention provides the vector, cell, kit or composition of the invention for use in treatment of GACR.
  • an ordinary skilled clinician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular individual and administration route.
  • a dose range between IxlOe 9 and IxlOe 15 genome copies of each vector/kg, preferentially between IxlOe 11 and IxlOe 13 genome copies of each vector/kg are expected to be effective in humans.
  • a dose range between IxlOe 9 and IxlOe 15 genome copies of each vector/eye, preferentially between IxlOe 10 and IxlOe 13 are expected to be effective for ocular administration.
  • Dosage regimes and effective amounts to be administered can be determined by ordinarily skilled clinicians. Administration may be in the form of a single dose or multiple doses, preferably as a single dose.
  • General methods for performing gene therapy using polynucleotides, expression constructs, and vectors are known in the art (see, for example, Gene Therapy: Principles and Applications, Springer Verlag 1999 26 ; and U.S. Patent Nos. 6,461 ,606; 6,204,251 and 6,106,826).
  • the vector for the use according to the present invention may be used alone or in combination with other treatments or components of the treatment.
  • it can be used together with other treatments which might be helpful for GACR, for example together with an arginine-restricted diet.
  • the vector for the use of the invention is delivered to the retina, for example by sub-retinal injection, and it is used in combination with an arginine-restricted diet.
  • the vector for the use of the invention is delivered to the liver, for example by intra-venous injection, and it is used in combination with an arginine-restricted diet.
  • a first vector according to the invention comprising a promoter specific for liver expression is used in combination with a second vector according to the invention delivered to the retina.
  • said first vector is systemically administered and said second vector is delivered to the retina.
  • the combined use of said first and second vectors according to the invention might advantageously allow to reduce the dose of the systemically administered vector with subsequent toxicity reduction.
  • the subject invention also concerns methods for expressing the OAT polypeptide in a cell.
  • the method comprises incorporating in the cell the vector system of the invention, that comprises polynucleotide sequences encoding the OAT polypeptide, and expressing the polynucleotide sequences in the cell.
  • the cell is a mammalian cell.
  • the cell is a human cell.
  • the cell is a photoreceptor or a RPE cell or a liver cell or hepatocyte.
  • polynucleotides and polypeptides of the subject invention encompasses those specifically exemplified herein, as well as any natural variants thereof, as well as any variants which can be created artificially, so long as those variants retain the desired functional activity.
  • polypeptides which have the same amino acid sequences of a polypeptide exemplified herein, such as the OAT polypeptide, except for amino acid substitutions, additions, or deletions within the sequence of the polypeptide, as long as these variant polypeptides retain substantially the same relevant functional activity as the polypeptides specifically exemplified herein.
  • conservative amino acid substitutions within a polypeptide which do not affect the function of the polypeptide would be within the scope of the subject invention.
  • the polypeptides disclosed herein should be understood to include variants and fragments, as discussed above, of the specifically exemplified sequences.
  • the subject invention further includes nucleotide sequences which encode the polypeptides disclosed herein.
  • nucleotide sequences can be readily constructed by those skilled in the art having the knowledge of the protein and amino acid sequences which are presented herein. As would be appreciated by one skilled in the art, the degeneracy of the genetic code enables the artisan to construct a variety of nucleotide sequences that encode a particular polypeptide or protein. The choice of a particular nucleotide sequence could depend, for example, upon the codon usage of a particular expression system or host cell. Polypeptides having substitution of amino acids other than those specifically exemplified in the subject polypeptides are also contemplated within the scope of the present invention.
  • non-natural amino acids can be substituted for the amino acids of a polypeptide of the invention, so long as the polypeptide having substituted amino acids retains substantially the same activity as the polypeptide in which amino acids have not been substituted.
  • non-natural amino acids include, but are not limited to, ornithine, citrulline, hydroxyproline, homoserine, phenylglycine, taurine, iodotyrosine, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, 2- amino butyric acid, y-amino butyric acid, s-amino hexanoic acid, 6-amino hexanoic acid, 2-amino isobutyiic acid, 3 -amino propionic acid, norleucine, norvaline, sarcosine, homocitrulline, cysteic acid, r-butylglycine,
  • Non- natural amino acids also include amino acids having derivatized side groups.
  • any of the amino acids in the protein can be of the D (dextrorotary) form or L (levorotary) form.
  • Amino acids can be generally categorized in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby a polypeptide having an amino acid of one class is replaced with another amino acid of the same class fall within the scope of the subject invention so long as the polypeptide having the substitution still retains substantially the same biological activity as a polypeptide that does not have the substitution.
  • Table 1 provides a listing of examples of amino acids belonging to each class.
  • polynucleotides which have the same nucleotide sequences of a polynucleotide exemplified herein except for nucleotide substitutions, additions, or deletions within the sequence of the polynucleotide, as long as these variant polynucleotides retain substantially the same relevant functional activity as the polynucleotides specifically exemplified herein (e.g., they encode a protein having the same amino acid sequence or the same functional activity as encoded by the exemplified polynucleotide).
  • the polynucleotides disclosed herein should be understood to include variants and fragments, as discussed above, of the specifically exemplified sequences.
  • the subject invention also contemplates those polynucleotide molecules having sequences which are sufficiently homologous with the polynucleotide sequences of the invention so as to permit hybridization with that sequence under standard stringent conditions and standard methods (Maniatis, T. et al, 1982).
  • Polynucleotides described herein can also be defined in terms of more particular identity and/or similarity ranges with those exemplified herein.
  • the sequence identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%.
  • the identity and/or similarity of a sequence can be 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% or greater as compared to a sequence exemplified herein.
  • Intraocular Gene Delivery Ameliorates Retinal Structure in a Mouse Model of Gyrate Atrophy of the Choroid and Retina
  • the plasmids used for adeno-associated viral (AAV) vector production contain the inverted terminal repeats (ITRs) of AAV serotype 2.
  • the AAV vector plasmid required to generate AAV-human ornithine aminotransferase contains a cytomegalovirus (CMV) promoter and a chimeric promoter intron composed of the 5 donor site from the first intron of the human P-globin gene and the branch and 3 ’-acceptor site from the intron of an immunoglobulin gene heavy chain variable region followed by the Kozak sequence and the human OAT coding sequence (CDS, NM_000274.4) with or without a 3XFlag tag at the C- terminal of the protein; the expression cassette is completed with the Woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) and the bovine growth hormon polyA (BGH poly A).
  • WPRE Woodchuck hepatitis virus post- transcriptional regulatory element
  • BGH poly A bovine growth hormon polyA
  • the enhanced green fluorescent protein (EGFP) plasmid used in some experiments is as follows.
  • the CMV promoter described above was coupled with the chimeric intron followed by the EGFP CDS.
  • the expression cassette is completed with the WPRE sequence and the BGH polyA.
  • the AAV-hCMZ-3XFlag vector was produced by InnovaVector. Vectors were produced by triple transfection of HEK293 cells followed by two rounds of CsC12 purification. AAV-hCM 7'-3XFlag excipient is composed of phosphate buffer saline (PBS, Thermo Fisher Scientific, Waltham, Massachusetts) + 5% glycerol. Physical titers [genome copies (GC)/ml] were determined by TaqMan quantitative PCR (Applied Biosystems, Carlsbad, CA, USA). Primers and probes were designed to anneal on BGH pA. The titer of AAV-hCMZwas achieved by averaging the Taqman PCR on BGHpA with a dot-blot analysis on CMV promoter.
  • F12 medium supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific).
  • FBS fetal bovine serum
  • Cells were plated in 10 cm dishes at 4,8E+6 cells/dish.
  • To transfect cells medium was replaced 24 hours later with 3 mL of fresh pre-heated medium + 10 pg of plasmids diluted in lipofectamine LTX (Thermo Fisher Scientific). After an over-night incubation, cells received 7 mL of fresh pre- heated medium and were harvested 72 hours after transfection.
  • Oat tmlDVa/tmlDVa mice (referred to as Oat' ') were bom by breeding heterozygous females with heterozygous males. Oat mice used in this study were either affected (Oat' ') or unaffected (Oat +/ ‘). Oat tmlDVa/tmlDVa mice were generated by inserting the neomycin cassette in exon 3 of the murine Oat which leads to a frameshift and an early stop codon thus murine Oat is not expressed.
  • the genotype for Oat tmlDVa allele was performed by PCR analysis of genomic DNA extracted from mouse fingertip.
  • the primers used for the PCR amplification are as follows: Fw (5’- AACTAGCAAGTCTGCAGACC-3’, SEQ ID N.25) and Rev (5’-TCCACAAGGCATTCAGTGCG-3’, SEQ ID N.26), which generate a product of 290 bp for the wild type allele and a product of 1658 bp for the tmlDVa allele.
  • mice Oat' ' pups die because of hypoargininemia-hyperammonemia; for this reason, pups were intraperitoneally injected twice a day from post-natal day (p) 1 to pl5 with a solution 2: 1 of IM hydrochloride arginine and IM arginine base (arginine final concentration IM pH —9); mice were injected with 10-15 pmol/gr of body weight and volume of injection was maintained constant so that final dose tapered to —2-5 pmol/gr of body weight during mice growth.
  • Eyecups (cups + retinas) for Western blot (WB) analysis were lysed in a custom buffer (50 mM Tris- HC1 pH 7.4, 100 mM NaCl, 0,2 mM EDTA, 0,5% Triton) for OAT protein. Lysis buffer was supplemented with 0,5% phenylmethyl sulfonyl fluoride (PSMF) (Sigma-Aldrich) and 1% complete EDTA-free protease inhibitor cocktail (Roche, Milan, Italy). Protein concentration was determined using Pierce BCA protein assay kit (Thermo-Scientific).
  • PSMF phenylmethyl sulfonyl fluoride
  • samples were denatured at 99°C for 5 min in 4X Laemmli sample buffer (Bio-rad, Milan, Italy) supplemented with 13- mercaptoethanol (Sigma-Aldrich) diluted 1 : 10.
  • Samples for OAT analysis were separated on 12% SDS-polyacrilamide electrophoresis home-made gel. The following antibodies were used for immuno-blotting: anti-0 AT (1 : 1000, polyclonal, abl37679; Abeam, Cambridge, UK) that recognizes a peptide corresponding to aminoacids 30-395 of the hOAT protein
  • SD-OCT Spectral domain optical coherence tomography
  • Mice were positioned into the animal imaging mount and rodent alignment stage (AIM- RAS; Bioptigen, Morrisville, NC, USA); the laser source was placed in front of the mouse, and images were acquired by the InVivoVue Clinic software (Bioptigen, Morrisville, NC, USA). Three images, one central, one superior, and one inferior to the optic nerve, were taken from the temporal side and the nasal side of each eye. ONL thickness was manually measured three times from each OCT scan image and averaged.
  • Eyes from Oat mice (+/- or -/-) were enucleated at 12 months of age and marked on the temporal side of the cornea with a surgical needle. Fixation was performed using Davidson fixative overnight, then kept in 70% ethanol prior to processing and embedding in paraffin performed by Tigem Histology Core. Sections were cut at 6 pm thickness on a Leica Microtome RM2245 (Leica Microsystems, Bannockburn, IL, USA), mounted on slides and stained with toluidine blue and borace staining.
  • RPE denegerated retinal pigment epithelium
  • ANOVA One-way analysis of variance
  • Tuckey post-hoc analysis was used to perform multi pairwise comparisons between groups in Figure 2.
  • the Student’s t-test was used to compare data depicted in Figure 4..
  • pCMZ-3XFlag The hCMZ-3XFlag plasmid (hereafter referred to as pCMZ-3XFlag) was tested for enzymatic activity upon transfection into a cell line with relatively low expression of hOAT, hARPEl 9-cell s. Additionally, we performed a comparison between the hOAT plasmid (pOAT) and pCMZ-3XFlag tagged to ensure that tag addition to the protein does not alter enzymatic activity. Cell lysates were tested in an OAT activity assay based on the use of ninhydrin, which forms complexes with the OAT reaction product, pyrroline 5-carboxilate (P5C) 31 (Fig. 2).
  • Intraocular gene delivery ameliorates retinal structure but not function in a mouse model of gyrate atrophy of the choroid and retina
  • AAV-hCM 7'-3XFlag dose 5.4E+9 GC/eye
  • contralateral eye received formulation buffer as negative control.
  • Oat +,L mice were injected with formulation buffer as unaffected controls.
  • SD-OCT Spectral domain- Optical coherence tomography
  • AAV-hO ⁇ Z-SXFlag significantly increased outer nuclear layer (ONL) thickness at the temporal side of the eye (close to the injection site) up to 12 months of age in Oaf ⁇ eyes compared to contralateral control eyes, which received the formulation buffer ( Figure 4A-B).
  • the human OAT coding sequence was obtained by OriGene Technologies Inc. (Rockville) and amplified by PCR with the following primers:
  • PCR was performed using Phusion High-Fidelity DNA Polymerase (NEB, M0530), PCR product was subsequently digested with Notl and Hindlll, and subcloned into a pAAV2/8.TBG.GFP vector 19 by removing the GFP coding sequence (Notl-HindllY). The same pAAV2/8.TBG.GFP was used for control vector production.
  • AAV vectors were produced by the TIGEM AAV vector core, by triple transfection in HEK 293 cells, purified by CsCh ultracentrifugation, and titered (in genome copies/milliliter) using a real-time PCR-based assay and a dot blot analysis.
  • mice were purchased from the Jackson Laboratory (J AX stock #003544) and housed at TIGEM animal facility (Naples). Animals were inbred and maintained under normal animal house conditions: mice were stored in ventilated cages in a 12-hour light-dark cycle environment, receiving a standard chow diet and water ad libitum.
  • Injections of AAV.TBG.OAT and AAV.TBG.GFP were performed in a final volume of 200 pl into retro-orbital plexus of 6 or 10 weeks-old male and female B6Ei; AKR-rhg mice.
  • blood samples were collected by submandibular bleedings at baseline, and at 1, 2, 3, 4,5 6-, 9- and 12-months post-injection. Body weight was evaluated at the same time points.
  • Treated animals were sacrificed by sub-lethal injection of ketamine/medetomidine (300 mg/kg and lOmg/kg, respectively) and perfused with ice-cold phosphate-buff ered saline (PBS) at 12 months of age; liver and eyes samples were harvested for further analyses. Wild type littermates were used as controls, and for all experiments, WT and affected mice were housed in the same condition.
  • PBS ice-cold phosphate-buff ered saline
  • B6Ei; AKR-rhg mice were dark adapted for 180 minutes and anesthetized with an intraperitoneal injection of ketamine / medetomidine (100 mg/kg and 0.25 mg/kg, respectively); eyes were stimulated at regular time intervals (0, 5, 15, 30, 45 and 60 minutes) using a flash light and the amplitudes of a- and b-waves were recorded and plotted as a function of increasing light intensities, ranging from 1 x 10 4 to 20.0 cd s/m 2 . Body temperature was monitored over time with a rectal thermometer and kept constantly at 37.5 ° C. To allow dilation of the pupils, 1% tropicamide was used.
  • the electrophysiological signals were recorded by gold-plate electrodes positioned on the cornea of each eye, referred to a needle electrode inserted subcutaneously in the frontal region.
  • the different electrodes were connected to a two-channel amplifier.
  • the cone pathway was evaluated by a single flash of 20.0 cd s/m 2 in the presence of a continuous background illumination set at 50 cd/m 2 .
  • Ex/Em 535/587nm.
  • At sacrifice plasma amino acid concentrations were measured by HPLC using an Agilent Technologies 1200 Series LC System with an Agilent Zorbax Eclipse XDB-C18 analytical column (5pm, 4.6 x 150mm) and Agilent Eclipse XDB-C18 analytical guard column (5pm, 4.6 x 12.5mm).
  • Amino acids were identified by their retention time and quantified by absorption ratio by comparison with the ratio of authentic compounds in the calibration solution, composed by a mixture of amino acids in final concentration of 200pM.
  • Murine eye cups for ornithine determination were harvested upon mice sacrifice and perfusion, dissected under a light microscope to isolate the eyecups from lens and immediately frozen in liquid nitrogen. Collected samples were processed as previously described (Audano et al, 2021) and ornithine concentrations were obtained by liquid chromatography coupled to tandem mass spectrometry.
  • ketamine/medetomidine 300 mg/kg and lOmg/kg, respectively
  • perfusion with a mixture of 2% paraformaldehyde and 1% glutaraldehyde prepared in 0.2M HEPES buffer (pH 7.4).
  • the eye was gently secured in place and lens and iris were removed though the opening made by cornea excision.
  • the optic cup was centered at the base of the eye and bisected parallel to the median plane; then this half-sphere was bisected again with each of the two cuts.
  • Samples were placed on a slow rotator to circulate the fixative for 30 minutes and stored in PBS at 2°C to 8°C.
  • Mouse liver samples were fixed in 4% paraformaldehyde overnight, stored in 70% ethanol after washing in PBS IX, and finally embedded into paraffin blocks. 5-pm thick sections were rehydrated and permeabilized in PBS with 0.5% Triton (Sigma-Aldrich) for 20 minutes. Antigen unmasking was performed in 0.01 M citrate buffer pH 6.0 in a microwave oven.
  • Sections were stained with primary antibody rabbit anti-OAT (Abeam; Cat# abl37679, dilution 1 : 100) overnight at 4°C and with universal biotinylated horse antimouse IgG secondary antibody (dilution 1/200) (Vector Laboratories, PK-620) for 1 h RT. Biotin/avidin-HRP signal amplification was achieved using ABC Elite Kit (Vector Laboratories, PK- 6200) according to the manufacturer’ s instructions. 3,3 '-diaminobenzidine (Vector Laboratories) was used as peroxidase substrate. Mayer’s hematoxylin (Bio-Optica) was used as counter-staining. Sections were de-hydrated and mounted in VECTASHIELD® (Vector Laboratories). Image capture was performed using an Axioscan microscope (Zeiss).
  • liver protein Thirty micrograms of liver protein were loaded for each specimen into a 4-15% SDS-PAGE; after transfer to PVDF membrane, blots were blocked with TBS-Tween-20 containing 5% non-fat milk for 1 h at room temperature followed by incubation with primary antibody overnight at 4°C.
  • the primary antibodies used for immuno-blotting were: rabbit anti-OAT (Abeam; Cat# abl37679; dilution: 1/1,000), mouse anti-Calnexin (Santa Cruz Biotechnology; Cat# sc23954; dilution: 1/1000), mouse anti-Vinculin (Santa Cruz Biotechnology; Cat# sc73614; dilution: 1/1000) and rabbit anti-GFP (Novus Biologicals; Cat# nb 600-308; dilution: 1/1,000). Proteins of interest were detected with horseradish peroxidase (HRP)-conjugated goat anti-mouse or anti-rabbit IgG antibody (GE Healthcare).
  • HRP horseradish peroxidase
  • Peroxidase substrate was provided by ECL Western Blotting Substrate kit (Pierce). To measure OAT activity, liver specimens were lysed in PBS with protease inhibitor cocktail (Roche) by sonication (4 x5 seconds, 10 second pause) on ice. Enzyme activity was determined by a spectrophotometric assay measuring the dihydroquinazolium derivative of P5C after incubation with 2-aminobenzaldehyde as previously described (Montioli et al, 2017).
  • TSG thyroxine binding globulin
  • OATpromoter.GFP a 230 base pairs regulatory sequence identified within the human OAT endogenous promoter
  • Mice were sacrificed 4 weeks after the injection and GFP expression was evaluated. At 4 weeks post- injection higher levels of the GFP protein were detected in livers of mice injected with TBG.GFP vector if compared to OATpromoter.GFP injected animals, by immunofluorescence (Fig.7 c) and western blot analysis ( Figure 7 d), respectively.
  • mice injected with AAV-OAT showed significantly lower plasma ornithine concentrations compared to mice injected with the control vector expressing GFP (Fig.
  • AAV mediated OAT expression improves the phenotype in adult B6Ei; AKR rhg mice
  • mice were injected at 10 weeks of age when the mouse weight reached the adult size, and they showed a greater approximately 60% reduction of baseline plasma ornithine concentrations after the injection of IxlO 13 gc/kg of AAV- OAT vector (Fig. 9a). Further reduction in plasma ornithine concentrations was observed in mice injected with the higher dose of 3xl0 13 gc/kg (Fig. 9a).
  • mice treated with both doses of AAV-OAT showed a significant improvement of both a- and b-wave amplitudes at high luminance intensities in flash dark- adapted scotopic and photopic condition at 11 months post-injection (Fig. 9b).
  • Oaf hg mice injected with the AAV-OAT vector were confirmed to have reduced plasma ornithine concentrations and increased plasma concentrations of lysine (Fig. 9c), but no other significant changes in plasma amino acid concentrations compared to Oaf hg mice injected with AAV-GFP or wild-type control mice (Table 3).
  • the rhg mutation arose spontaneously in the AKR/J genetic background, that were later outcrossed to C57BL/6JEi for line maintenance.
  • AKR/J mice are an albino strain
  • Oaf hg mice mice with white fur are also obtained.
  • these Oat rhg white mice showed signs of ERG abnormalities at earlier age compared to the black mice and showed an improved ERG response following the i.v. injections performed at 10-weeks of age with AAV-OAT compared to control mice injected with AAV-GFP (Fig. 10).
  • Oat null mice (Oat A ) have increased perinatal mortality and die 24-48 hours after birth if not supplemented by intraperitoneal injections of arginine to prevent hyperammonemia (Wang et al, 1995; Wang et al, 1996). Compared to Oaf hg mice, Oat A mice have earlier onset of retinal degeneration and show signs of loss of retinal function by 4 months of age (Wang et al., 2000). Consistent with the results in the Oat rhg mice, 6-weeks-old Oat A mice injected with 3xl0 13 gc/kg of AAV-OAT showed sustained reduction of plasma ornithine concentrations (Fig. 13a) and improvement in ERG response and retinal pathology (Fig. 13b-c).
  • the plasmids used for AAV vector production contain the ITRs of AAV serotype 2.
  • the AAV vector plasmid required to generate AAV8-CMZ administered subretina contains a cytomegalovirus (CMV) promoter and a chimeric promoter intron composed of the 5’ donor site from the first intron of the human P-globin gene and the branch and 3 ’-acceptor site from the intron of an immunoglobulin gene heavy chain variable region followed by the human OAT coding sequence [CDS (NM_000274.4)] with the addition of the 3XFlag at the 3’ end; the expression cassette is completed with the Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and the bovine growth hormone polyA (BGH poly A).
  • WPRE Woodchuck hepatitis virus post-transcriptional regulatory element
  • BGH poly A bovine growth hormone polyA
  • the EGFP plasmid used in vitro contains the same genetic elements as the OAT plasmid.
  • the AAV vector plasmid required to generate AAV8-CMZ administered systemically is similar to the one described above for the exception of the promoter and promoter’s intron, substituted by the thyroxine binding globulin (TBG) promoter.
  • the AAV8-CMZ vector was produced by InnovaVector S.R.L. Vector was produced by triple transfection of HEK293 cells followed by two rounds of CsC12 purification.
  • AAV8-6M 7' formulation buffer is composed of phosphate buffer saline (PBS, Thermo Fisher Scientific, Waltham, Massachusetts) + 5% glycerol.
  • Physical titers [genome copies (GC)/mL] were determined by TaqMan quantitative PCR (Applied Biosystems, Carlsbad, CA, USA); primers and probes were designed to anneal the BGH pA. The titer of AAV8-CMZ was achieved by averaging the Taqman PCR on BGHpA with a dot-blot analysis on CMV promoter.
  • Oat tmlDVa/tmlDVa mice were born by breeding heterozygous females with heterozygous males. Oat mice used in this study were either affected (CkzU) or unaffected (Oat +/ ⁇ ). Oaf mice were generated by inserting the neomycine cassette in exon 3 of the Oat gene which leads to a frameshift and an early stop codon 24 thus Oat is not expressed. Genotype analysis for the Oat tmIDVa allele was performed by PCR analysis of genomic DNA extracted from mouse fingertip.
  • mice Oaf' pups die because of hypoargininemia- hyperammonemia; for this reason, pups were intraperitoneally injected twice a day from post-natal day (p) 1 to pl5 with a solution 2: 1 of IM hydrochloride arginine and IM arginine base (arginine final concentration IM pH —9); mice were injected with 10-15 pmol/gr of body weight and volume of injection was maintained constant so that final dose tapered to —2-5 pmol/gr of body weight during growth. Subr etinal and systemic injection of AAV vectors in mice
  • mice authorization n° 860/2020- PR Surgery was performed under anesthesia and all efforts were made to minimize suffering.
  • Adult mice (6 weeks of age) were anesthetized with an intraperitoneal injection of 2 mL/100 g body weight of ketamine/medetomidine.
  • An equal volume (150 pL) of either vector solution or excipient were delivered systemically via the retro-orbital plexus.
  • An equal volume (1 pL) of either vector solution or excipient were delivered subretinally via a posterior trans-scleral trans-choroidal approach.
  • mice were dark-adapted for 3 hours, anesthetized and positioned in a stereotaxic apparatus under dim red light. Their pupils were dilated with a drop of 0.5% tropicamide (Visufarma, Rome, Italy), and body temperature was maintained at 37°C. Light flashes were generated by a Ganzfeld stimulator (CSO, Costrumony Strumenti Oftalmici, Florence, Italy). The electrophysiological signals were recorded through gold-plate electrodes inserted under the lower eyelids in contact with the cornea. Subcutaneous needles used as negative references were inserted at the level of the corresponding frontal region. The different electrodes were connected to a two- channel amplifier.
  • Abeam Abeam fluorimetric Ornithine Assay Kit
  • mice administered at 6 weeks of age with AAV8-CMZ systemically (dose 3E+13 GC/Kg) have improved retinal electrical activity in eyes treated with intraocular AAV8- OAT (dose 5.4E+9 GC/eye) compared to contralateral untreated eyes at 4 and 6 months of age (Fig.22);
  • improvements of retinal electrical activity in animals treated systemically with AAV8-CMZ compared to animals that received the excipient at 4 months of age Fig.22.
  • ornithinaemia levels were lower in animals treated systemically with AAV8-CMZ compared to untreated animals at 4 and 6 months of age (Fig. 23).
  • CMV Cytomegalovirus
  • WPRE AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTCTGCGCTCGCTCGCTCACTGAG
  • CMV Cytomegalovirus
  • AAV.TBG.OAT plasmid sequence (OAT CDS in uppercase)
  • Ratzlaff, K. & Baich, A Comparison of ornithine aminotransferase activities in the pigment epithelium and retina of vertebrates. Comparative Biochemistry and Physiology — Part B: Biochemistry and 88, 35-37 (1987).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des constructions, des vecteurs, en particulier des vecteurs viraux, des cellules hôtes relatives et des compositions pharmaceutiques pour la thérapie génique de l'atrophie gyrate de la choroïde et de la rétine. En particulier, elle concerne un vecteur comprenant une construction d'acide nucléique codant pour une enzyme ornithine aminotransférase (OAT), ladite construction comprenant une séquence promoteur et une séquence codante du gène ornithine aminotransférase (OAT) sous le contrôle dudit promoteur. La présente invention concerne en outre des vecteurs viraux, des cellules hôtes, des compositions pharmaceutiques et leurs utilisations.
PCT/EP2023/061560 2022-05-02 2023-05-02 Thérapie génique pour l'atrophie gyrate de la choroïde et de la rétine WO2023213817A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22171167 2022-05-02
EP22171167.4 2022-05-02

Publications (1)

Publication Number Publication Date
WO2023213817A1 true WO2023213817A1 (fr) 2023-11-09

Family

ID=81579598

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/061560 WO2023213817A1 (fr) 2022-05-02 2023-05-02 Thérapie génique pour l'atrophie gyrate de la choroïde et de la rétine

Country Status (1)

Country Link
WO (1) WO2023213817A1 (fr)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6106826A (en) 1997-12-17 2000-08-22 Wisconsin Alumni Research Foundation Replication competent, avirulent Herpes simplex virus as a vector for neural and ocular gene therapy
US6204251B1 (en) 1994-10-31 2001-03-20 Genentech, Inc. Ocular gene therapy
US6461606B1 (en) 1998-04-24 2002-10-08 University Of Florida Research Foundation Materials and methods for gene therapy
US6967018B2 (en) 2002-01-11 2005-11-22 Applied Genetic Technologies Corporation Adiponectin gene therapy
US8137962B2 (en) 2004-09-03 2012-03-20 University Of Florida Research Foundation Compositions for treating cystic fibrosis
US8298818B2 (en) 2006-04-28 2012-10-30 University Of Florida Research Foundation, Inc. Self-complementary adeno-associated virus having a truncated CMV-chicken β-actin promoter
WO2015082690A1 (fr) * 2013-12-06 2015-06-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Méthodes et compositions pharmaceutiques pour exprimer un polynucléotide d'intérêt dans l'épithélium pigmentaire rétinien d'un sujet

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6204251B1 (en) 1994-10-31 2001-03-20 Genentech, Inc. Ocular gene therapy
US6106826A (en) 1997-12-17 2000-08-22 Wisconsin Alumni Research Foundation Replication competent, avirulent Herpes simplex virus as a vector for neural and ocular gene therapy
US6461606B1 (en) 1998-04-24 2002-10-08 University Of Florida Research Foundation Materials and methods for gene therapy
US6967018B2 (en) 2002-01-11 2005-11-22 Applied Genetic Technologies Corporation Adiponectin gene therapy
US8137962B2 (en) 2004-09-03 2012-03-20 University Of Florida Research Foundation Compositions for treating cystic fibrosis
US8298818B2 (en) 2006-04-28 2012-10-30 University Of Florida Research Foundation, Inc. Self-complementary adeno-associated virus having a truncated CMV-chicken β-actin promoter
WO2015082690A1 (fr) * 2013-12-06 2015-06-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Méthodes et compositions pharmaceutiques pour exprimer un polynucléotide d'intérêt dans l'épithélium pigmentaire rétinien d'un sujet

Non-Patent Citations (43)

* Cited by examiner, † Cited by third party
Title
"NCBI", Database accession no. NP_000265.1
"Uniprot", Database accession no. P04181-2
ALTSCHUL, S. F. ET AL.: "Gapped BLAST and PSI-BLAST: A new generation of protein database search programs", NUCLEIC ACIDS RESEARCH, vol. 25, 1997, XP002905950, DOI: 10.1093/nar/25.17.3389
ALTSCHUL, S. F.GISH, W.MILLER, W.MYERS, E. W.LIPMAN, D. J.: "Basic local alignment search tool", JOURNAL OF MOLECULAR BIOLOGY, vol. 215, 1990, XP002949123, DOI: 10.1006/jmbi.1990.9999
BAHOU, W. F.: "Gene Therapy: Principles and Application . Thomas Blankenstein", THE QUARTERLY REVIEW OF BIOLOGY, vol. 74, 1999
BALFOORT BERITH M. ET AL: "A review of treatment modalities in gyrate atrophy of the choroid and retina (GACR)", MOLECULAR GENETICS AND METABOLISM, vol. 134, no. 1-2, September 2021 (2021-09-01), AMSTERDAM, NL, pages 96 - 116, XP093069873, ISSN: 1096-7192, DOI: 10.1016/j.ymgme.2021.07.010 *
BERNSTEIN, S. L.WONG, P.: "Regional expression of disease-related genes in human and monkey retina", MOL VIS, vol. 4, 1998, pages 24
BISAILLON, J. J. ET AL.: "The retarded hair growth (rhg) mutation in mice is an allele of ornithine aminotransferase (Oat", MOLECULAR GENETICS AND METABOLISM REPORTS, vol. 1, 2014
BOFFA IOLANDA ET AL: "Liver-directed gene therapy for ornithine aminotransferase deficiency", EMBO MOLECULAR MEDICINE, vol. 15, no. 4, 17 January 2023 (2023-01-17), US, XP093069753, ISSN: 1757-4676, Retrieved from the Internet <URL:https://onlinelibrary.wiley.com/doi/full-xml/10.15252/emmm.202217033> DOI: 10.15252/emmm.202217033 *
CHANDLER RANDY J: "Messenger RNA therapy as an option for treating metabolic disorders", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, vol. 116, no. 42, 15 October 2019 (2019-10-15), pages 20804 - 20806, XP002796626, ISSN: 0027-8424, DOI: 10.1073/PNAS.1914673116 *
CLEARY, M. A. ET AL.: "Ornithine aminotransferase deficiency: Diagnostic difficulties in neonatal presentation", JOURNAL OF INHERITED METABOLIC DISEASE, vol. 28, 2005, pages 673 - 679, XP019232651, DOI: 10.1007/s10545-005-0074-1
CUNNINGHAM, S. C.DANE, A. P.SPINOULAS, A.ALEXANDER, I. E.: "Gene delivery to the juvenile mouse liver using AAV2/8 vectors", MOLECULAR THERAPY, vol. 16, 2008, XP055610915, DOI: 10.1038/mt.2008.72
DE SABBATA GIULIA ET AL: "Long-term correction of ornithine transcarbamylase deficiency in Spf-Ash mice with a translationally optimized AAV vector", MOLECULAR THERAPY- METHODS & CLINICAL DEVELOPMENT, vol. 20, March 2021 (2021-03-01), GB, pages 169 - 180, XP093069875, ISSN: 2329-0501, DOI: 10.1016/j.omtm.2020.11.005 *
E., J. EIN: "Fall von Retinitis Pigmentosa atypica", KLIN MONATSBL AUGENHEILKD, vol. 26, pages 202 - 6
ENGELHARDT, J. F.STEEL, G.VALLE, D.: "Transcriptional analysis of the human ornithine aminotransferase promoter", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 266, 1991
GINGUAY ANTONIN ET AL: "Ornithine Aminotransferase, an Important Glutamate-Metabolizing Enzyme at the Crossroads of Multiple Metabolic Pathways", BIOLOGY, vol. 6, no. 4, 7 March 2017 (2017-03-07), pages 18, XP093069953, DOI: 10.3390/biology6010018 *
HAIRE, S. E. ET AL.: "Light-driven cone arrestin translocation in cones of postnatal guanylate cyclase-1 knockout mouse retina treated with AAV-GC1", INVESTIGATIVE OPHTHALMOLOGY AND VISUAL SCIENCE, vol. 47, 2006, XP002661104, DOI: 10.1167/iovs.06-0086
HEINANEN, K. ET AL.: "Muscle creatine phosphate in gyrate atrophy of the choroid and retina with hyperornithinaemia - Clues to pathogenesis", EUROPEAN JOURNAL OF CLINICAL INVESTIGATION, vol. 29, 1999, pages 426 - 431, XP071215298, DOI: 10.1046/j.1365-2362.1999.00467.x
K.VANNAS-SULONENO.SIMELLI. S. GYRATE: "Atrophy of Choroid and Retina: The Ocular Disease Progresses in juvenile Patients despite Normal or Near Normal Plasma Ornithine Concentration", J INDIAN MED ASSOC, vol. 100, 2002, pages 196 - 197
KAISER-KUPFER, M. I. ET AL.: "Systemic Manifestations of Gyrate Atrophy of the Choroid and Retina", OPHTHALMOLOGY, vol. 88, 1981, pages 302 - 306
KARLIN, S.ALTSCHUL, S. F.: "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes", PROC NATL ACAD SCI U S A, vol. 87, 1990, XP001030853, DOI: 10.1073/pnas.87.6.2264
KARLIN, S.ALTSCHUL, S. F: "Applications and statistics for multiple high-scoring segments in molecular sequences", PROC NATL ACAD SCI U S A, vol. 90, 1993, XP001030852, DOI: 10.1073/pnas.90.12.5873
KIM, H. R. ET AL.: "Assay of Ornithine Aminotransferase with Ninhydrin", ANALYTICAL BIOCHEMISTRY, vol. 223, 1994, pages 205 - 207, XP024762834, DOI: 10.1006/abio.1994.1574
KOZAK, M.: "An analysis of 5'-noncoding sequences from 699 vertebrate messenger rNAS", NUCLEIC ACIDS RESEARCH, vol. 15, 1987, XP055318604
LA VAIL, M. M.GORRIN, G. M.REPACI, M. A.: "Strain differences in sensitivity to light-induced photoreceptor degeneration in albino mice", CURRENT EYE RESEARCH, vol. 6, 1987
M.KAISER-KUPFERR.CARUSO, D. V.: "Gyrate atrophy of the choroid and retina: Further Experience With Long-term Reduction of Ornithine Levels in Children", POSTGRADUATE MEDICAL JOURNAL, vol. 120, 2002
MANIATIS, T.FRIRSCH, E.SAMBROOK, J.: "Molecular: a laboratory manual", 1982, COLD SPRING HARBOR LABORATORY PRESS
MITCHELL, G. A. ET AL.: "Human ornithine-δ-aminotransferase. cDNA cloning and analysis of the structural gene", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 263, 1988
MONTIOLI, R. ET AL.: "Deficit of human ornithine aminotransferase in gyrate atrophy: Molecular, cellular, and clinical aspects", BIOCHIMICA ET BIOPHYSICA ACTA - PROTEINS AND PROTEOMICS, vol. 1869, 2021, pages 140555
PELTOLA, K. E. ET AL.: "Ophthalmologic heterogeneity in subjects with gyrate atrophy of choroid and retina harboring the L402P mutation of ornithine aminotransferase", OPHTHALMOLOGY, vol. 108, 2001, pages 721 - 729
RATZLAFF, K.BAICH, A.: "Comparison of ornithine aminotransferase activities in the pigment epithelium and retina of vertebrates", COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY -- PART B, vol. 88, 1987, pages 35 - 37, XP025794631, DOI: 10.1016/0305-0491(87)90075-7
RIVERO J LUIS ET AL: "Retrovims-Mediated Gene Transfer and Expression of Human Omithine ^-Aminotransferase into Embryonic Fibroblasts", HUMAN GENE THERAPY, vol. 5, 1994, pages 701 - 707, XP093069863 *
SANTINELLI, R. ET AL.: "Low-protein diet and progression of retinal degeneration in gyrate atrophy of the choroid and retina: A twenty-six-year follow-up", JOURNAL OF INHERITED METABOLIC DISEASE, vol. 27, 2004, pages 187 - 196
SHEN, B. W.HENNIG, M.HOHENESTER, E.JANSONIUS, J. N.SCHIRMER, T.: "Crystal structure of human recombinant ornithine aminotransferase", JOURNAL OF MOLECULAR BIOLOGY, vol. 277, 1998, pages 81 - 102, XP004462488, DOI: 10.1006/jmbi.1997.1583
SULLIVAN DM ET AL: "Adenovirus-mediated gene transfer of ornithine aminotransferase in cultured human retinal pigment epithelium", INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE, vol. 37, no. 5, April 1996 (1996-04-01), US, pages 766 - 774, XP093069791, ISSN: 0146-0404 *
SULLIVAN DM ET AL: "Ornithine-[delta]-aminotransferase expression and ornithine metabolism in cultured epidermal keratinocytes: toward metabolic sink therapy for gyrate atrophy", GENE THERAPY, NATURE PUBLISHING GROUP, LONDON, GB, vol. 4, no. 10, October 1997 (1997-10-01), pages 1036 - 1044, XP037773477, ISSN: 0969-7128, DOI: 10.1038/SJ.GT.3300505 *
T.WANGA.M. LAWLERG.STEELI.SIPILAA.H. MILAMD. V. MICE: "lacking ornithine-delta-aminotransferase have paradoxical neonatal hypoornithinaemia and retinal degeneration", NATURE, vol. 2, 1995, pages 983 - 989
TAKKI, K. K.MILTON, R. C.: "The Natural History of Gyrate Atrophy of the Choroid and Retina", OPHTHALMOLOGY, vol. 88, 1981, pages 292 - 301
VALTONEN, M. ET AL.: "Central nervous system involvement in gyrate atrophy of the choroid and retina with hyperornithinaemia", JOURNAL OF INHERITED METABOLIC DISEASE, vol. 22, 1999, pages 855 - 866
WANG, T.MILAM, A. H.STEEL, G.VALLE, D.: "A mouse model of gyrate atrophy of the choroid and retina: Early retinal pigment epithelium damage and progressive retinal degeneration", JOURNAL OF CLINICAL INVESTIGATION, vol. 97, 1996, pages 2753 - 2762
YAN, Z.YAN, H.OU, H.: "Human thyroxine binding globulin (TBG) promoter directs efficient and sustaining transgene expression in liver-specific pattern", GENE, vol. 506, 2012, XP055350459, DOI: 10.1016/j.gene.2012.07.009
ZANTA-BOUSSIF, M. A. ET AL.: "Validation of a mutated PRE sequence allowing high and sustained transgene expression while abrogating WHV-X protein synthesis: Application to the gene therapy of WAS", GENE THERAPY, vol. 16, 2009, XP037773510, DOI: 10.1038/gt.2009.3
ZUFFEREY, R.DONELLO, J. E.TRONO, D.HOPE, T. J.: "Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element Enhances Expression of Transgenes Delivered by Retroviral Vectors", JOURNAL OF VIROLOGY, vol. 73, 1999

Similar Documents

Publication Publication Date Title
US10040835B2 (en) Vectors encoding rod-derived cone viability factor
CN105821079B (zh) 用于治疗莱伯氏先天性黑蒙-1(lca1)的raav-鸟苷酸环化酶组合物及方法
ES2826384T3 (es) Terapia génica para trastornos oculares
Stieger et al. Adeno-associated virus mediated gene therapy for retinal degenerative diseases
US11827898B2 (en) Gene therapy for ocular disorders
US11879133B2 (en) Gene therapy for ocular disorders
US11793887B2 (en) Gene therapy for treating peroxisomal disorders
WO2023116745A1 (fr) Gène cyp4v2 optimisé et son application
WO2023213817A1 (fr) Thérapie génique pour l&#39;atrophie gyrate de la choroïde et de la rétine
CN111886340A (zh) 包括rdh12编码区的病毒载体和治疗视网膜营养不良的方法
US20240191257A1 (en) Gene Therapy for Retinal Disease
US11793890B2 (en) ELOVL2 constructs for human gene therapy
US20230070477A1 (en) Reprogramming the metabolome to delay onset or treat neurodegeneration
JP2023517929A (ja) Ｎｍｎａｔ１関連網膜変性に対する遺伝子療法
Matsuki Development of gene therapy for achromatopsia due to CNGA3 mutations
Dell’Aquila Gene therapy for gyrate atrophy of choroid and retina and for USH1B retinitis pigmentosa
WO2024013224A2 (fr) Thérapie génique pour rétinopathies associées à fam161a et autres ciliopathies
EA044520B1 (ru) Вирусные векторы, содержащие области, кодирующие rdh12, и способы лечения дистрофий сетчатки
Pellissier et al. HMG Advance Access published February 20, 2015
Auricchio et al. Expanding AAV cargo capacity for gene therapy of Stargardt disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23725116

Country of ref document: EP

Kind code of ref document: A1