WO2023210607A1 - Ｅｎｏ１遺伝子のプロモーター - Google Patents

Ｅｎｏ１遺伝子のプロモーター Download PDF

Info

Publication number
WO2023210607A1
WO2023210607A1 PCT/JP2023/016191 JP2023016191W WO2023210607A1 WO 2023210607 A1 WO2023210607 A1 WO 2023210607A1 JP 2023016191 W JP2023016191 W JP 2023016191W WO 2023210607 A1 WO2023210607 A1 WO 2023210607A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleotide sequence
sequence
polynucleotide
promoter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2023/016191
Other languages
English (en)
French (fr)
Japanese (ja)
Inventor
真初 西尾
祐人 中澤
翔太郎 上園
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Daiichi Sankyo Co Ltd
Original Assignee
Daiichi Sankyo Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Daiichi Sankyo Co Ltd filed Critical Daiichi Sankyo Co Ltd
Priority to KR1020247038353A priority Critical patent/KR20250007570A/ko
Priority to EP23796347.5A priority patent/EP4516902A1/en
Priority to CA3256438A priority patent/CA3256438A1/en
Priority to CN202380032676.6A priority patent/CN119013400A/zh
Priority to US18/860,580 priority patent/US20250283139A1/en
Priority to JP2024517326A priority patent/JPWO2023210607A1/ja
Priority to AU2023258798A priority patent/AU2023258798A1/en
Publication of WO2023210607A1 publication Critical patent/WO2023210607A1/ja
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
    • C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01011—Phosphopyruvate hydratase (4.2.1.11), i.e. enolase

Definitions

  • the present invention relates to a transformed mammalian cell in which transcriptional activity of a foreign protein is enhanced, obtained by using a foreign gene expression vector having a promoter of the Eno1 gene, and a method for producing the foreign protein using the same.
  • antibody drugs are said to have a low risk of causing harmful immune reactions even when administered to the human body, and are being actively developed due to their high specificity.
  • hosts for producing protein drugs include microorganisms, yeast, animal and plant cells, insects, transgenic animals and plants, and the like. Correct folding and post-translational modifications such as glycosylation are often essential for the physiological activity and antigenicity of protein drugs. Unsuitable as a host.
  • Cultured mammalian cells such as CHO (Chinese Hamster Ovary) cells, which have a sugar chain structure similar to that of humans, are capable of post-translational modification, and have no safety concerns due to a proven track record of use. is currently the mainstream.
  • Non-Patent Document 1 When cultured mammalian cells are used as hosts, compared to microorganisms, etc., there are problems such as low growth rate, low productivity, and high cost (Non-Patent Document 1). Furthermore, in order to use antibody drugs clinically, large amounts of administration are required, and a lack of production capacity is a problem worldwide. When producing protein-based drugs using a cultured mammalian cell expression system, the production cost is higher than that of synthetic low-molecule drugs. Improving production volume is also an effective method for reducing manufacturing costs (Non-Patent Documents 2 and 3). Therefore, in order to improve the productivity of foreign proteins in cultured mammalian cells, many approaches such as promoters, enhancers, drug selection markers, gene amplification, culture engineering techniques, etc. have been tested through trial and error.
  • CMV promoter virus-derived Human cytomegalovirus major or immediate promoter
  • EF1 ⁇ viral document 1, non-patent document 7
  • polynucleotides promoter regions upstream of the transcription start point of human ribosomal protein genes RPL32 and RPS11
  • it can be used for protein expression in combination with other heterologous promoters (Non-Patent Document 8, Patent Documents 2 and 3).
  • promoters of the heat shock protein A5 (Hspa5/GRP78) gene and heat shock protein A8 (Hspa8) that improve the productivity of foreign proteins are known (Patent Documents 4 and 5).
  • Patent No. 3051411 International Publication No. 2006/123097 International Publication No. 2013/080934 International Publication No. 2018/066492 International Publication No. 2020/032153
  • An object of the present invention is to provide a promoter that has a high activity of enhancing foreign gene expression in host cells such as cultured mammalian cells, and a means for using the promoter to enhance the production amount of a foreign protein that becomes a protein-based drug.
  • Our goal is to provide the following.
  • a promoter of a gene derived from Chinese hamster selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14, or comprising a nucleotide sequence having at least 85% sequence identity with those sequences, or a subsequence of the nucleotide sequence; polynucleotide.
  • [2] A nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, or having at least 85% or more sequence identity with those sequences. , or a subsequence of said nucleotide sequence, Polynucleotide of [1].
  • the polynucleotide of [1] consisting of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of [1] which consists of a nucleotide sequence having at least 99% or more sequence identity with the nucleotide sequence of SEQ ID NO: 3.
  • a polynucleotide that is a promoter of a gene derived from Chinese hamster and comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence having at least 85% sequence identity with the sequence.
  • a promoter of a mouse-derived gene selected from SEQ ID NO: 2, SEQ ID NO: 17, and SEQ ID NO: 16, or comprising a nucleotide sequence having at least 85% sequence identity with those sequences, or a subsequence of the nucleotide sequence; polynucleotide.
  • the polynucleotide of [11] comprising a nucleotide sequence having at least 85% or more sequence identity with the nucleotide sequence of SEQ ID NO: 18.
  • the polynucleotide of [11] consisting of a nucleotide sequence having at least 99% sequence identity with the nucleotide sequence of SEQ ID NO: 2.
  • SEQ ID NO: 1 SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17 of [1] or [11] , or a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence of SEQ ID NO: 16, or a partial sequence of the nucleotide sequence, having promoter activity; polynucleotide.
  • SEQ ID NO: 1 SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17 in [1] or [11] , or a nucleotide sequence having 95% or more sequence identity to the nucleotide sequence of SEQ ID NO: 16, or a partial sequence of the nucleotide sequence, having promoter activity; polynucleotide.
  • SEQ ID NO: 1 SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 2, SEQ ID NO: 17 of [1] or [11] , or a polynucleotide that hybridizes under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 16, and has promoter activity.
  • [17a] The length is 1 kbp or more and 10 kbp or less, 2 kbp or more and 6 kbp or less, 2.6 kbp or more and 5 kbp or less, 2.7 kbp or more and 4.5 kbp or less, or 2.8 kbp or more and 4 kbp or less, [1]-[17] Any polynucleotide. [18] A polynucleotide comprising the polynucleotide of any one of [1] to [17] and [17a] and a foreign gene.
  • a foreign gene expression unit comprising the polynucleotide of any one of [1] to [18] and [17a] and a foreign gene.
  • the foreign gene expression unit of [19] further comprising a transcription terminator region.
  • the foreign gene expression unit of [21], wherein the foreign gene is a gene encoding an antibody or an antigen-binding fragment thereof.
  • a foreign gene expression vector comprising the foreign gene expression unit of any one of [19]-[22] and [19a].
  • a polynucleotide having (e) comprises a nucleotide sequence having 85% or more sequence identity to the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7, or a partial sequence of the nucleotide sequence, and has foreign gene expression enhancing activity.
  • a polynucleotide having [24a] A foreign gene expression vector comprising the foreign gene expression unit of any one of [19]-[22] and [19a] and the polynucleotide of (b) or (d) below; (b) the nucleotide sequence of SEQ ID NO: 6, or a partial sequence thereof; (d) A polynucleotide comprising a nucleotide sequence having 80% or more sequence identity to the nucleotide sequence of SEQ ID NO: 6, or a partial sequence of the nucleotide sequence, and having foreign gene expression enhancing activity.
  • [25] A transformed cell into which the foreign gene expression vector described in [23], [24] or [24a] has been introduced.
  • the transformed cell of [24] which is a cultured cell derived from a mammal.
  • the transformed cell of [25] which is a COS-1 cell, 293 cell, or CHO cell.
  • [28] A method for producing a protein, which comprises culturing the transformed cell according to any one of [25] to [27] and obtaining a protein derived from a foreign gene from the culture.
  • the production method according to [30], wherein the heteromultimeric protein is an antibody protein.
  • [31a] The production method according to any one of [28] to [31], wherein the culture of the transformed cells is fed-batch culture.
  • [31b] The production method according to any one of [28]-[31] and [31a], wherein the transformed cells are cultured for 6 days or more.
  • [34] A method for producing transformed cells that express a foreign gene by introducing the foreign gene vector of [23], [24] or [24a].
  • the present invention provides a promoter that has a high foreign gene expression enhancing activity in host cells such as cultured mammalian cells, and a means for using the promoter to enhance the production of a foreign protein that becomes a protein-based drug.
  • Schematic diagram of 1-hEF1 ⁇ -Y. A diagram comparing the production amount of an antibody expressed by the Chinese hamster-derived Eno1 gene promoter with that of the human EF1 ⁇ gene promoter in fed-batch culture using a stable pool expressing humanized antibody Y.
  • FIG. 2-A shows the number of living cells on each sampling date on the vertical axis.
  • hEF1 ⁇ indicates the human EF1 ⁇ gene promoter
  • Eno1 indicates the Chinese hamster-derived Eno1 gene promoter (the same applies to FIG. 2-B).
  • FIG. 1 A diagram comparing the production amount of an antibody expressed by the Chinese hamster-derived Eno1 gene promoter with that of the human EF1 ⁇ gene promoter in fed-batch culture using a stable pool expressing humanized antibody Y.
  • Figure 2-B shows the production amount on each sampling date on the vertical axis.
  • the vertical axis indicates the value obtained by dividing the luminescence amount of Firefly-derived luciferase on pGL4.10 by the luminescence amount of Renilla-derived luciferase on pGL4.74.
  • approximately 4.5 kbp upstream SEQ ID NO: 11
  • Eno1 and mEno1 indicate the results of the Chinese hamster-derived Eno1 gene promoter and the mouse-derived Eno1 gene promoter, respectively.
  • FIG. 4-A shows the number of living cells on each sampling date on the vertical axis. In the figure, approximately 4.0 kbp upstream from the nucleotide immediately before the nucleotide sequence corresponding to the start codon sequence of the Chinese hamster Eno1 gene (SEQ ID NO: 4), approximately 3.5 kbp upstream (SEQ ID NO: 12), approximately 3 The regions up to .0 kbp (SEQ ID NO: 1) and up to about 2.8 kbp (SEQ ID NO: 3) were expressed as Eno1 4k, Eno1 3.5k, Eno1 3k, and Eno1 2.8k, respectively.
  • Eno1 and mEno1 indicate the results of the Chinese hamster-derived Eno1 gene promoter and the mouse-derived Eno1 gene promoter, respectively.
  • Figure 4-B shows the production amount on each sampling date on the vertical axis.
  • Eno1 and mEno1 indicate the results of the Chinese hamster-derived Eno1 gene promoter and the mouse-derived Eno1 gene promoter, respectively.
  • FIG. 5-A shows the number of living cells on each sampling date on the vertical axis.
  • each Eno1 gene promoter is labeled as in Figure 4-A, and when it is combined with DNA element A7, it is labeled as A7 (+), and when A7 is absent, it is labeled as A7 (-) (the same applies to Figure 5-B).
  • FIG. 5-B shows the production amount on each sampling date on the vertical axis.
  • the term “gene” refers to a portion that is transcribed into mRNA and translated into protein, and includes not only DNA but also mRNA, cDNA, and RNA thereof.
  • polynucleotide is used in the same meaning as nucleic acid, and also includes DNA, RNA, probes, oligonucleotides, and primers.
  • polypeptide and “protein” are used without distinction.
  • gene expression refers to the phenomenon in which a certain gene is transcribed into mRNA and/or the phenomenon in which a protein is translated from the mRNA.
  • the term “foreign gene” refers to a gene that is artificially introduced into a host cell.
  • “foreign protein” refers to a protein encoded by a foreign gene.
  • the term “gene expression unit” refers to a polynucleotide having at least a promoter region, a foreign gene, and a transcription terminator region (polyA addition signal) in the direction of the reading frame of transcription.
  • promoter refers to a region to which transcription factors involved in the initiation of transcription from DNA to RNA bind.
  • promoter region examples include polynucleotides from about 3 kbp upstream of the start codon to the nucleotide immediately before the nucleotide sequence corresponding to the start codon, and may include a 5'UTR and an intron.
  • promoter activity refers to the activity of a transcription factor binding to a promoter, initiating transcription, and producing a protein encoded by a gene, and a protein encoded by a reporter gene such as firefly luciferase. It is possible to assay using the activity as an index.
  • DNA element refers to a DNA element that, when placed in the vicinity of a gene expression unit or on a foreign gene expression vector containing a gene expression unit, exhibits the activity of enhancing foreign gene expression.
  • sequence identity refers to the relationship between two or more nucleotide or amino acid sequences, as determined by comparison of the sequences, as is known in the art.
  • sequence identity refers to the sequence identity between nucleic acid molecules or polypeptides, as the case may be, as determined by the correspondence between two or more nucleotide sequences or between two or more amino acid sequences in a row. Denotes the degree of relevance. “Sequence identity” refers to the identity between the lesser of two or more sequences and the gap alignment (if any) addressed by a particular mathematical model or computer program (i.e., an "algorithm”). It can be evaluated by calculating the percentage of matches.
  • hybridizing under stringent conditions refers to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed.
  • Conditions under which a complementary strand of a nucleic acid consisting of a nucleotide sequence with a low nucleotide sequence does not hybridize can be mentioned. More specifically, hybridization is carried out at 68° C. in a commercially available hybridization solution ExpressHyb Hybridization Solution (manufactured by Clontech), or in the presence of 0.7 to 1.0 M NaCl using a DNA-fixed filter. After hybridization at 68°C, wash at 68°C using a 0.1 to 2x SSC solution (1x SSC consists of 150 mM NaCl and 15 mM sodium citrate), or Means hybridization under equivalent conditions.
  • “about” refers to a value that fluctuates by plus or minus 10%, 8%, 6%, 5%, 4%, 3%, 2% or 1%, respectively, with respect to a reference value.
  • the term “about” indicates a range of plus or minus 10%, 5%, or 1%, respectively, relative to the reference value.
  • Promoter used to enhance expression of foreign gene is ⁇ -enolase (hereinafter referred to as “promoter of the present invention”). This is the promoter of the gene (called “Eno1”).
  • the origin of the promoter of the Eno1 gene is not particularly limited, but it may be derived from mammals, such as promoters of the Eno1 gene derived from Chinese hamsters, humans, mice, etc.
  • the promoter of the present invention is preferably a promoter of the Eno1 gene derived from a rodent, and more preferably a promoter of the Eno1 gene derived from a Chinese hamster or a mouse. Even more preferred is the Eno1 gene promoter derived from Chinese hamster.
  • the promoter of the Chinese hamster-derived Eno1 gene includes, for example, 2.0 kbp, 2.5 kbp, 2.6 kbp, 2.7 kbp, 2.8 kbp, 3.0 kbp, 3.5 kbp, 4.0 kbp, Examples include sequences comprising 4.5 kbp, 5.0 kbp, 5.5 kbp, and 6.0 kbp nucleotides to the nucleotide immediately preceding the nucleotide sequence corresponding to the start codon. More specifically, polynucleotides of SEQ ID NOs: 1, 3, 4, 10, 11, 12, 13, and 14 are exemplified as promoters of the Chinese hamster-derived Eno1 gene.
  • the nucleotide sequence of SEQ ID NO: 1 is a sequence consisting of nucleotides from about 3.0 kbp upstream of the start codon of the Chinese hamster Eno1 gene to the nucleotide immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 3 is a sequence consisting of nucleotides from about 2.8 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene to the nucleotide immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 4 is a sequence consisting of nucleotides approximately 4.0 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene and nucleotides immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 10 is a sequence consisting of nucleotides from about 5.0 kbp upstream of the start codon of the Chinese hamster Eno1 gene to the nucleotide immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 11 is a sequence consisting of nucleotides from about 4.5 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene to the nucleotide immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 12 is a sequence consisting of nucleotides approximately 3.5 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene and nucleotides immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 13 is a sequence consisting of nucleotides approximately 2.7 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene and nucleotides immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 14 is a sequence consisting of nucleotides from about 2.6 kbp upstream of the start codon of the Chinese hamster-derived Eno1 gene to the nucleotide immediately before the nucleotide sequence corresponding to the start codon.
  • the promoter of the Eno1 gene can be a region extending from the nucleotide immediately before the nucleotide sequence corresponding to the start codon sequence to about 2.8 kbp upstream of the start codon sequence or longer. Therefore, from the viewpoint of superior promoter activity, the Chinese hamster-derived Eno1 gene promoter is preferably a polynucleotide of SEQ ID NO: 1, 3, 4, 10, 11, or 12. As the Chinese hamster-derived Eno1 gene promoter, polynucleotides having SEQ ID NOs: 1, 3, 4, and 12 are more preferably selected, and even more preferably polynucleotides having SEQ ID NOs: 1 and 3 are selected.
  • mouse-derived Eno1 gene promoter for example, 2.0 kbp, 2.5 kbp, 3.0 kbp, 3.5 kbp, 4.0 kbp, 4.5 kbp, 5.0 kbp, 5.5 kbp, 6.0 kbp upstream of the start codon of the Eno1 gene.
  • An example is a sequence comprising the nucleotide immediately preceding the nucleotide sequence corresponding to the initiation codon. More specifically, the mouse-derived Eno1 gene promoter is exemplified by the polynucleotides of SEQ ID NOs: 2, 17, and 16.
  • the nucleotide sequence of SEQ ID NO: 2 is a sequence consisting of nucleotides from about 3.0 kbp upstream of the start codon of the mouse-derived Eno1 gene to the nucleotide immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 17 is a sequence consisting of nucleotides approximately 3.5 kbp upstream of the start codon of the mouse-derived Eno1 gene and nucleotides immediately before the nucleotide sequence corresponding to the start codon.
  • the nucleotide sequence of SEQ ID NO: 16 is a sequence consisting of nucleotides approximately 4.0 kbp upstream of the start codon of the mouse-derived Eno1 gene and nucleotides immediately before the nucleotide sequence corresponding to the start codon.
  • the promoter of the present invention has a nucleotide sequence of at least 80%, preferably at least 85%, of any one of SEQ ID NOs: 1, 2, 17, 3, 4, 10, 11, 12, 13, 14, and 16. , may be 86% or more, 87% or more, 88% or more, 89% or more, more preferably 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, More preferably, it comprises a nucleotide sequence having a sequence identity of 95% or more, 96% or more, 97% or more, 98% or more, most preferably 99% or more, 100%, or a partial sequence of the nucleotide sequence, and , or a polynucleotide having promoter activity.
  • the partial sequence is 80% or more, preferably 85% or more, 86% of the total length of any one of the nucleotide sequences of SEQ ID NOs: 1, 2, 17, 3, 4, 10, 11, 12, 13, 14, and 16. 87% or more, 88% or more, 89% or more, more preferably 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, still more preferably 95% or more, 96% or more.
  • the length of the fragment may be 97% or more, 98% or more, and most preferably 99% or more, 100% of the length.
  • the partial sequence may be a 5' (upstream) or 3' (downstream) fragment of the full length, or may be a fragment that connects multiple regions of the full length.
  • the promoter of the present invention is a polynucleotide consisting of a nucleotide sequence complementary to a polynucleotide consisting of a nucleotide sequence of any one of SEQ ID NOs: 1, 2, 17, 3, 4, 10, 11, 12, 13, 14, and 16. It may also be a polynucleotide that hybridizes with the promoter under stringent conditions and has promoter activity.
  • the promoter of the present invention preferably contains the nucleotide sequence of SEQ ID NO: 18, or a nucleotide sequence having at least 85% sequence identity with the sequence, such as 90% or more, 91% or more, 92% or more, It is more preferable that the sequence has an identity of 93% or more, 94% or more, and it is even more preferable that the sequence has an identity of 95% or more, 96% or more, 97% or more, 98% or more. Preferably, sequences having 99% or more identity are particularly preferred, and most preferably sequences having 100% identity.
  • the Chinese hamster-derived Eno1 promoter preferably contains the nucleotide sequence of SEQ ID NO: 18, or a nucleotide sequence having at least 85% sequence identity with the sequence, preferably 90% or more, 91% or more, 92% or more. % or more, 93% or more, 94% or more, and more preferably 95% or more, 96% or more, 97% or more, 98% or more. It is more preferable that the sequence has an identity of 99% or more, and it is particularly preferable that the sequence has an identity of 100%.
  • the length of the promoter of the present invention is not particularly limited as long as it is 1 kbp or more and 10 kbp or less, preferably 2 kbp or more and 6 kbp or less, more preferably 2.6 kbp or more and 5 kbp or less, and 2.7 kbp or more. It is more preferably 4.5 kbp or less, particularly preferably 2.8 kbp or more and 4 kbp or less, and typically about 3 kbp.
  • the shorter the length the more effective it is in terms of gene introduction efficiency.
  • the promoter of the present invention has one or more, preferably 1 to 300, nucleotide sequences of any one of SEQ ID NOs: 1, 2, 17, 3, 4, 10, 11, 12, 13, 14, and 16.
  • a modified polynucleotide consisting of a nucleotide sequence in which preferably 1 to 200 nucleotides, more preferably 1 to 100 nucleotides, and particularly preferably 1 to 30 nucleotides are deleted, substituted, and/or added, and which has promoter activity. It may be a polynucleotide having the following.
  • the modification (deletion, substitution, and/or addition) of the nucleotide sequence can be introduced by methods known in the art, such as the Kunkel method or the Gapped duplex method, or methods analogous thereto, such as site-specific Mutagenesis kits using manual mutagenesis methods (for example, Mutant-K (manufactured by Takara Bio) or Mutant-G (manufactured by Takara Bio), Takara Bio's LA PCR in vitro Mutagenesis series kits, etc. can be used.
  • Such modified polynucleotides can also be used as promoters of the present invention.
  • the foreign gene expression enhancing activity of the promoter of the present invention can be assayed using the activity of a protein encoded by a reporter gene such as firefly luciferase or the amount of antibody produced in fed-batch culture as an indicator.
  • the activity of the protein encoded by the reporter gene of the vector containing the promoter of the present invention is 1 compared to the activity of the protein encoded by the reporter gene of the control vector (for example, the amount of luminescence of Renilla luciferase).
  • the promoter exhibits an activity of at least 20 times, preferably at least 20 times, more preferably at least 30 times, even more preferably at least 40 times, even more preferably at least 45 times, particularly preferably at least 50 times, the expression of the foreign gene is enhanced. It can be determined that it has activity. Comparing the case where the human EF1 ⁇ promoter is used and the case where the promoter of the present invention is used, the antibody production amount in fed-batch culture is equal or more, preferably 1.2 times or more, more preferably 1.3 times or more, If the increase is more preferably 1.5 times or more, particularly preferably 1.8 times, 1.9 times, or 2.0 times or more, it can be determined that the promoter has foreign gene expression enhancing activity.
  • the foreign gene expression unit of the present invention (hereinafter also referred to as “gene expression unit of the present invention") is arranged in at least the above-mentioned 1. It has the promoter of the present invention, a foreign gene, and a transcription terminator region (poly A addition signal) described in . Furthermore, the polyA addition sequence may be any sequence having the activity of terminating transcription of transcription from the promoter, and may be of a gene that is the same as or different from the promoter gene.
  • DNA element used to enhance expression of foreign gene By using the gene expression unit of the present invention described in 1. in combination with a DNA element, expression of a foreign gene can be further enhanced.
  • DNA elements to be used in combination can be obtained using interaction with acetylated histone H3 as an indicator. It is generally said that acetylation of histones (H3, H4) is involved in transcriptional activation, and two main theories are considered. A theory that this is related to a change in the three-dimensional structure of nucleosomes in which the histone tails are neutralized by acetylation and the bond between DNA and histones becomes looser (Mellor J. (2006) Dynamic nucleosomes and gene transcription. Trends Genet.
  • DNA elements used in combination with the promoter of the present invention to enhance expression of foreign genes include A2, A7, and A18.
  • the DNA element is preferably A7.
  • A2 is located on human chromosome 15, 80966429 to 80974878, and is a polynucleotide of 8450 bp with an AT content of 62.2%.
  • the nucleotide sequence of A2 is listed as SEQ ID NO: 5 in the sequence listing.
  • A7 is located on human chromosome 11 from 88992123 to 89000542, and is a polynucleotide of 8420 bp with an AT content of 64.52%.
  • the nucleotide sequence of A7 is listed in SEQ ID NO: 6 in the sequence listing.
  • A18 is located on human chromosome 4, 111275976 to 111284450, and is a polynucleotide of 8475 bp with an AT content of 62.54%.
  • the nucleotide sequence of A18 is listed as SEQ ID NO: 7 in the sequence listing.
  • the foreign gene expression enhancing activity of the DNA element used in combination with the promoter of the present invention can be assayed using the activity of a protein encoded by a reporter gene such as secreted alkaline phosphatase (SEAP) as an indicator.
  • SEAP secreted alkaline phosphatase
  • any one of the above DNA elements may be used alone, or two or more copies of one DNA element may be used. Alternatively, two or more types of DNA elements may be used in combination.
  • the DNA element used in the present invention has at least 80%, preferably at least 85%, at least 86%, at least 87%, at least 88%, at least 89% of the nucleotide sequence of any one of SEQ ID NOS: 5 to 7. , more preferably 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, more preferably 95% or more, 96% or more, 97% or more, 98% or more, most preferably 99% or more,
  • the nucleotide sequence may be composed of a nucleotide sequence having 100% sequence identity and having foreign gene expression enhancing activity.
  • the DNA element used in the present invention is one or more, preferably 1 to 1000 or 1 to 500, more preferably 1 to 100 or 1 in the nucleotide sequence of any one of SEQ ID NOS: 5 to 7. Modifications consisting of a nucleotide sequence in which 50 to 50, more preferably 1 to 10, or 1 to 5, particularly preferably 4, 3, 2, or 1 nucleotides are deleted, substituted, and/or added.
  • the polynucleotide may also be a polynucleotide having foreign gene expression enhancing activity.
  • modifications to the polynucleotide can be carried out by methods known in the art, such as the Kunkel method or the Gapped duplex method, or methods analogous thereto, such as site-specific Mutagenesis kits using manual mutagenesis methods (for example, Mutant-K (manufactured by Takara Bio) or Mutant-G (manufactured by Takara Bio), Takara Bio's LA PCR in vitro Mutagenesis series kits, etc. can be used.
  • Such mutant polynucleotides can also be used as DNA elements of the present invention.
  • a partial sequence consisting of at least 3000 or at least 2000 consecutive nucleotides of the polynucleotide sequence set forth in any one of SEQ ID NOs: 5 to 7 can be used.
  • Such a partial sequence may be, for example, one described in International Publication No. 2012/005378, and examples of the partial sequence of A2 include A2-1 to A2-17, Examples of partial sequences of A7 include A7-1 to A7-18, and examples of partial sequences of A18 include A18-1 to A18-4.
  • any one of the partial sequences of the DNA element may be used alone, or two or more copies of one partial fragment may be used.
  • two or more types of partial fragments may be used in combination.
  • a combination of full-length sequences and partial sequences of each DNA element may be used.
  • the partial sequence may be derived from a full-length sequence DNA element constituting the combination, or may be derived from a different full-length sequence DNA element.
  • a polynucleotide containing a foreign gene encoding a foreign protein whose production is to be increased as described below can be obtained by the general method shown below.
  • a cDNA library derived from cells or tissues in which a foreign gene is expressed can be isolated by screening using a DNA probe synthesized based on the gene fragment.
  • Preparation of mRNA can be performed by methods commonly used in the technical field. For example, the cells or tissues are treated with a guanidinine reagent, a phenol reagent, etc.
  • poly(A)+RNA is obtained by a batch method.
  • poly(A)+RNA may be further fractionated by sucrose density gradient centrifugation or the like.
  • single-stranded cDNA is synthesized using an oligo dT primer and reverse transcriptase, and from the single-stranded cDNA, a double-stranded cDNA is synthesized using DNA synthase I, DNA ligase, RNase H, etc. Synthesize cDNA.
  • a cDNA library can also be constructed using a plasmid vector. Thereafter, a strain having the desired DNA (positive clone) may be selected from the cDNA library.
  • an adapter e.g., EcoRI adapter
  • phosphorylated e.g., phosphorylated
  • a cDNA library can also be constructed using a plasmid vector. Thereafter, a strain having the desired DNA (positive clone) may be selected from the cDNA library.
  • genomic DNA is extracted from the cell line of the source organism and polynucleotides are selected.
  • Genomic DNA can be extracted using, for example, the method of Cryer et al. (Methods in Cell Biology, 12, 39-44 (1975)) and P. It can be carried out according to the method of Philipsen et al. (Methods Enzymol., 194, 169-182 (1991)).
  • the polynucleotide containing the target promoter, DNA element, or foreign gene can also be obtained by, for example, the PCR method (PCR Technology. Henry A. Erlich, Attockton press (1989)).
  • PCR method PCR Technology. Henry A. Erlich, Attockton press (1989)
  • 20-30mer synthetic single-stranded DNA is used as a primer and genomic DNA is used as a template.
  • genomic DNA is used as a template.
  • the amplified gene is used after confirming the polynucleotide sequence.
  • a genomic DNA library such as a bacterial artificial chromosome (BAC) can be used as a genomic DNA library such as a bacterial artificial chromosome (BAC) can be used.
  • BAC bacterial artificial chromosome
  • a gene library is created by a conventional method, (b) a desired polynucleotide is selected from the created gene library, and the polynucleotide is This can be done by amplifying.
  • a gene library is prepared by partially digesting and fragmenting chromosomal DNA obtained from a cell line of a source organism using an appropriate restriction enzyme using an appropriate restriction enzyme, ligating the obtained fragments to an appropriate vector, and inserting the vector into an appropriate vector. It can be prepared by introducing it into a suitable host.
  • It can also be prepared by extracting mRNA from cells, synthesizing cDNA therefrom, ligating it to an appropriate vector, and introducing the vector into an appropriate host.
  • a vector used in this case a plasmid commonly known as a gene library preparation vector can be used, and phage vectors, cosmids, etc. can also be widely used.
  • a host for transformation or transduction may be selected depending on the type of the vector.
  • a polynucleotide containing a foreign gene is selected from the gene library by a colony hybridization method, a plaque hybridization method, or the like using a labeled probe containing a sequence specific to the foreign gene.
  • a polynucleotide containing a foreign gene it is also possible to chemically synthesize a polynucleotide containing a foreign gene. For example, two complementary pairs of oligonucleotides are prepared and annealed, several annealed DNAs are linked together using DNA ligase, or several partially complementary oligonucleotides are prepared and PCR is performed. Genes can be synthesized by methods such as gap filling.
  • the polynucleotide sequence can be determined by a conventional method, such as the dideoxy method (Sanger et al., Proc. Natl. Acad. Sci., USA, 74, 5463-5467 (1977)). Furthermore, the polynucleotide sequence can be easily determined using a commercially available sequencing kit or the like.
  • the foreign gene expression vector of the present invention includes the above-mentioned 1. Said 2. containing the promoter described in 2. A vector comprising the foreign gene expression unit described in .
  • the foreign gene expression vector of the present invention can be used in the above-mentioned 3. It may contain one type of DNA element described in , a copy number of two or more of one type of DNA element, or a combination of two or more types of DNA elements.
  • the DNA element may be placed immediately before or after the gene expression unit, or it may be placed at a position away from the gene expression unit. good.
  • a single foreign gene expression vector containing multiple DNA elements may be used. Note that the orientation of the DNA element may be either forward or reverse with respect to the gene expression unit.
  • foreign genes include, but are not particularly limited to, reporter genes such as secreted alkaline phosphatase (SEAP), green fluorescent protein (GFP), and luciferase, various enzyme genes such as ⁇ -amylase gene and ⁇ -galactosidase gene, and pharmaceutically useful genes.
  • reporter genes such as secreted alkaline phosphatase (SEAP), green fluorescent protein (GFP), and luciferase
  • SEAP secreted alkaline phosphatase
  • GFP green fluorescent protein
  • luciferase various enzyme genes such as ⁇ -amylase gene and ⁇ -galactosidase gene
  • various enzyme genes such as ⁇ -amylase gene and ⁇ -galactosidase gene, and pharmaceutically useful genes.
  • interferon genes such as interferon ⁇ and interferon ⁇ , which are physiologically active proteins; various interleukin genes such as IL1 and IL2; various cytokine genes such as the erythropoietin (EPO) gene and the granulocyte colony stimulating factor (G-CSF) gene; Examples include growth factor genes or genes encoding multimeric proteins, such as genes encoding heteromultimers that are antibodies or antigen-binding fragments thereof. These genes may be obtained by any method.
  • Antigen-binding fragment of an antibody means a partial fragment of an antibody that has antigen-binding activity, and includes Fab, F(ab')2, Fv, scFv, diabody, linear antibody, and antibody fragment. This includes multispecific antibodies formed by Antigen-binding fragments of antibodies also include Fab', which is a monovalent fragment of the variable region of an antibody obtained by treating F(ab')2 under reducing conditions. However, the molecules are not limited to these molecules as long as they have the ability to bind to the antigen. In addition, these antigen-binding fragments include not only full-length antibody protein molecules treated with appropriate enzymes, but also proteins produced in appropriate host cells using genetically engineered antibody genes. included.
  • the foreign gene expression vector of the present invention can contain a selection marker for selecting transformants.
  • a selection marker for selecting transformants for example, by using drug resistance markers that confer resistance to drugs such as cerulenin, aureobasidin, zeocin, canavanine, cycloheximide, hygromycin, puromycin, blasticidin, tetracycline, kanamycin, ampicillin, neomycin, etc. It is possible to select transformants. It is also possible to select transformants by using genes that confer solvent resistance to ethanol, etc., osmotic resistance to glycerol, salts, etc., metal ion resistance, such as copper, etc., as markers.
  • the foreign gene expression vector of the present invention may be a vector that does not integrate into chromosomal DNA.
  • foreign gene expression vectors are randomly integrated into chromosomes after gene introduction into host cells, but components derived from mammalian viruses such as simian virus 40 (SV40), papillomavirus (BPV, HPV), and EBV are used.
  • SV40 simian virus 40
  • BPV papillomavirus
  • HPV papillomavirus
  • EBV episomal vector capable of self-replication in the introduced host cell.
  • vectors having sequences encoding the SV40 large T antigen which is an origin of replication and trans-acting factor derived from SV40
  • vectors having sequences encoding EBV-derived oriP and EBNA-1 are widely used.
  • the effect of the DNA element is that it can exhibit the activity of enhancing foreign gene expression, regardless of the type of vector or whether or not it is integrated into the chromosome.
  • the transformed cell of the present invention can be obtained from the above-mentioned 5. These are transformed cells introduced using a foreign gene expression vector.
  • the host cell to be transformed is a eukaryotic cell, preferably a mammalian cell, and more preferably a cell derived from a human, mouse, rat, hamster, monkey, or cow.
  • mammalian cells include COS-1 cells, 293 cells, CHO cells (for example, CHO-K1, CHO-O1, CHO DG44, CHO dhfr-, CHO-S, etc.), but are not limited to these. Not done.
  • the expression vector may be introduced into the host cell by any method as long as the introduced gene stably exists in the host and can be appropriately expressed.
  • the calcium phosphate method (Ito et al., (1984) Agric. Biol. Chem., 48, 341)
  • the electroporation method (Becker, DM et al. (1990) Methods. Enzymol., 194, 182-187)
  • spheroplast method (Creggh et al., Mol. Cell. Biol., 5, 3376 (1985)
  • lithium acetate method Itoh, H. (1983) J. Bacteriol. 153, 163) -168
  • lipofection method etc.
  • the foreign gene may be expressed either transiently or stably, but it is preferably expressed in a stable expression system.
  • a stable expression system is a method in which an expression vector is incorporated into a chromosome and expressed using a calcium phosphate method, an electroporation method, a lipofection method, or the like.
  • the transgene is maintained on the chromosome, and it is possible to maintain transgene expression for long periods of time, such as several weeks or more.
  • introducing a selection marker into a plasmid drug selection becomes possible, and cells in which the introduced gene is maintained on the chromosome can be efficiently selected.
  • Method for producing foreign protein The production of the foreign protein of the present invention is carried out in the above-mentioned 6. This can be carried out by culturing the transformed cells described in the above section by a known method, harvesting the culture, and purifying the transformed cells.
  • culture refers to culture supernatants, cultured cells, or crushed cells.
  • As the foreign protein that can be produced using the transformed cells described in the above section it is possible to select not only monomeric proteins but also multimeric proteins. When producing a heteromultimeric protein composed of a plurality of different subunits, a plurality of genes encoding these subunits are each 6. It is necessary to introduce it into the host cells described in the section.
  • Transformed cells can be cultured according to conventional methods used for culturing host cells.
  • the transformed cells are mammalian cells, they are cultured at 37°C under 5% or 8% CO 2 conditions, and the culture time is about 24 to 1000 hours. This can be carried out by batch culture, fed-batch culture, perfusion culture, continuous culture, etc. as described below.
  • the culture is preferably fed-batch culture.
  • the period of fed-batch culture of the transformed cells may be 3 days or more and 20 days or less, more preferably 5 days or more and 18 days or less, and particularly preferably 6 days or more and 15 days or less.
  • Confirmation of the expression product of a foreign protein gene from the above-mentioned culture (culture solution) can be performed by SDS-PAGE, Western analysis, ELISA, etc.
  • An antibody protein is a tetrameric protein consisting of two molecules of heavy chain polypeptide and two molecules of light chain polypeptide. Therefore, in order to obtain an antibody protein in a form that maintains antigen-binding ability, the above-mentioned 6. Both heavy chain and light chain genes must be introduced into the transformed cells described in the above section. In this case, the heavy chain and light chain gene expression units may be present on the same expression vector or on different expression vectors.
  • the light chain gene expression unit may exist in the order of the heavy chain gene expression unit from the reading direction of the gene, and the DNA element, the light chain gene expression unit, and the heavy chain gene expression unit.
  • the gene expression units are present in this order.
  • a selection marker is included after the DNA element, the light chain gene expression unit, and the heavy chain gene expression unit.
  • Antibodies produced in the present invention include antibodies produced by immunizing experimental animals such as rabbits, mice, and rats with a desired antigen.
  • chimeric antibodies and humanized antibodies made from the above-mentioned antibodies can also be mentioned as antibodies produced in the present invention.
  • human antibodies obtained from genetically modified animals or by phage display methods are also antibodies produced in the present invention.
  • the antibody gene used for antibody production may be a specific polynucleotide, as long as the combination of heavy chain polypeptide and light chain polypeptide transcribed and translated from the antibody gene retains the activity of binding to any antigen protein. It is not limited to antibody genes with sequences. Further, the antibody gene does not necessarily have to encode a full-length antibody molecule, and a gene encoding an antigen-binding fragment of an antibody can be used. Genes encoding these antigen-binding fragments can be obtained by genetically modifying genes encoding full-length antibody protein molecules.
  • examples of the foreign proteins to be used in the production method of the present invention include various proteins derived from humans or non-human animals, antigen-binding fragments thereof, and modified forms thereof. I can do it.
  • Such proteins include atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), C-type natriuretic peptide (CNP), vasopressin, somatostatin, growth hormone (GH), insulin, oxytocin, ghrelin, Peptide hormones such as leptin, adiponectin, renin, calcitonin, osteoprotegerin, insulin-like growth factor (IGF), interleukins, chemokines, interferon, tumor necrosis factors (TNF ⁇ / ⁇ and other TNF superfamily, etc.), nerve growth factor (NGF), ), cell growth factors (EGF, FGF, PDGF, HGF, TGF, etc.), hematopoietic factors (CSF, G-CSF, erythropoietin, etc.), cytokines such as adipokines, receptors such as ⁇ NF receptors, lysozyme, protease,
  • the promoter region of the Eno1 gene was amplified by PCR using the genomic DNA of CHO cells as a template using the primer set shown below and PrimeSTAR Max DNA Polymerase (Takara Bio), and then amplified using the QIAquick PCR Purification kit (QI AGEN).
  • the nucleotide sequence of the promoter region of the cloned Chinese hamster Eno1 gene is shown in SEQ ID NO: 1 in the sequence listing.
  • Eno1 gene promoter primer set K24 (Fw): TTCGCGGCCGCGGCACGCAGCGCGCAGG (SEQ ID NO: 8)
  • K25 (Rev): TTCACTAGTTGTCTGTAGGGGAAAAAAAAC (SEQ ID NO: 9)
  • Example 2 Evaluation of Chinese hamster-derived Eno1 gene promoter by fed-batch culture using antibody expression level as an indicator (2-1) Construction of antibody expression vector
  • the antibody expression vector was the humanized antibody gene Y described in Patent Document 4.
  • pDSLH3.1 was obtained by replacing the nucleotide sequence corresponding to the Hspa5 gene promoter of the expression vector pDSLH3.1-Hspa5-Y with the nucleotide sequence of the Chinese hamster-derived Eno1 gene promoter using the DNA fragment amplified and purified in Example 1.
  • -Eno1-Y was constructed.
  • a schematic diagram of the vector is shown in Figure 1.
  • the pDSLH3.1-hEF1 ⁇ -Y used for comparison was that described in Patent Document 4.
  • the feed medium was added every day from the 3rd day of culture until the 13th day in an amount of 3% (v/v) of the initial culture solution. Sampling was performed on the 7th, 10th, and 14th days, and the viable cell density, antibody production, etc. were measured.
  • Example 3 Examination of Chinese hamster-derived Eno1 gene promoter length using the amount of luciferase luminescence during transient expression as an indicator (3-1) Construction of luciferase expression vector A Firefly-derived luciferase expression vector was constructed by inserting the Eno1 promoter. The chain lengths examined were approximately 5.0 kbp upstream from the nucleotide immediately before the nucleotide sequence corresponding to the start codon sequence of the Eno1 gene (SEQ ID NO: 10), approximately 4.5 kbp upstream (SEQ ID NO: 11), and approximately 4.5 kbp upstream of the nucleotide sequence corresponding to the start codon sequence of the Eno1 gene.
  • up to 0 kbp SEQ ID NO: 4
  • up to about 3.5 kbp SEQ ID NO: 12
  • up to about 3.0 kbp SEQ ID NO: 1
  • up to about 2.8 kbp SEQ ID NO: 3
  • up to about 2.7 kbp SEQ ID NO: 13
  • up to about 2.6 kbp SEQ ID NO: 14
  • up to about 2.5 kbp SEQ ID NO: 15
  • the promoter transcriptional activity was significantly superior to SEQ ID NO: 3 (Eno1 2.8k) between SEQ ID NO: 3 (Eno1 2.8k) and SEQ ID NO: 13 (Eno1 2.7k). From this, it was considered that when the promoter has SEQ ID NO: 18 (the differential sequence (100 bp) between SEQ ID NO: 3 (Eno1 2.8k) and SEQ ID NO: 13 (Eno1 2.7k)), transcriptional activity is particularly improved. .
  • Example 4 Evaluation of mouse-derived Eno1 gene promoter by fed-batch culture using antibody expression level as an indicator (4-1) Construction of antibody expression vector Humanized antibody gene Y expression vector pDSLH3.1-hEF1 ⁇ -Y, Construction of pDSLH3.1-mEno1-Y, pDSLH3.1-mEno1-3.5-Y, and pDSLH3.1-mEno1-4.0-Y in which the promoters of antibody H chain and L chain genes were replaced with the mouse Eno1 promoter. did.
  • the mouse-derived Eno1 gene promoter contains a region from the nucleotide immediately before the nucleotide sequence corresponding to the start codon sequence of Eno1 to about 3.0 kbp upstream of the start codon sequence (SEQ ID NO: 2), and a region up to about 3.5 kbp upstream of the start codon sequence (SEQ ID NO: 2). SEQ ID NO: 17) or the same region up to about 4.0 kbp (SEQ ID NO: 16) was used.
  • the region from the nucleotide immediately before the nucleotide sequence corresponding to the start codon sequence of Eno1 in the Chinese hamster Eno1 gene promoter to about 4.0 kbp upstream of the start codon sequence (SEQ ID NO: 4), and the region up to about 3.5 kbp upstream of the start codon sequence.
  • SEQ ID NO: 4 the region from the nucleotide immediately before the nucleotide sequence corresponding to the start codon sequence of Eno1 in the Chinese hamster Eno1 gene promoter to about 4.0 kbp upstream of the start codon sequence (SEQ ID NO: 4), and the region up to about 3.5 kbp upstream of the start codon sequence.
  • pDSLH3.1-Eno1-4.0-Y pDSLH3.1-Eno1-3.5-Y using the region (SEQ ID NO: 12) and the same region up to approximately 2.8 kbp (SEQ ID NO: 3) as the Eno1 gene promoter.
  • the number of viable cells and the amount of antibody produced over time are shown in Figures 4-A and 4-B, respectively.
  • the average value of the antibody production amount of the two pools prepared for each vector was calculated and the antibody productivity was compared.
  • the antibody production amount on the 14th day of culture was 3.0 kbp (mEno1 3k) from the mouse-derived Eno1 gene promoter. , 3.5 kbp (mEno1 3.5k) and 4.0 kbp (mEno1 4k), reaching values 1.3 times, 1.8 times, and 1.9 times, respectively, of the human EF1 ⁇ promoter (hEF1 ⁇ ), and are currently widely used.
  • the amount of antibody produced by the promoter was significantly higher than that produced by the currently used promoter.
  • the mouse-derived Eno1 gene promoter also has the same promoter ability as the Chinese hamster-derived Eno1 gene promoter.
  • Chinese hamster-derived Eno1 gene promoters 2.8 kbp (Eno1 2.8 k), 3.0 kbp (Eno1 3k), 3.5 kbp (Eno1 3.5 k) and 4.0 kbp (Eno1 4 k) each contain 2 of the human EF1 ⁇ promoter.
  • the antibody production amount reached values of .7 times, 2.0 times, 2.8 times, and 3.1 times (as of the 14th day of culture), which greatly exceeded the antibody production amount using promoters currently widely used.
  • the antibody productivity of the mouse-derived Eno1 gene promoter and the Chinese hamster-derived Eno1 gene promoter was compared, it was found that the Chinese hamster-derived Eno1 gene promoter was superior.
  • Qp [antibody production amount on day 10] ⁇ [cumulative viable cell density on day 10] (The integral value of the change in viable cell density over time calculated using the viable cell density on days 0, 7, and 10 was defined as the "cumulative viable cell density on day 10.")
  • Chinese hamster-derived Eno1 gene promoters 2.8 kbp (Eno1 2.8 k), 3.0 kbp (Eno1 3k), 3.5 kbp (Eno1 3.5 k) and 4.0 kbp (Eno1 4 k) each contain 2 of the human EF1 ⁇ promoter. It reached .7 times, 2.3 times, 3.0 times, and 3.1 times.
  • Mouse-derived Eno1 gene promoters of 3kbp (mEno1 3k), 3.5kbp (mEno1 3.5k), and 4k (mEno1 4k) reach 1.9 times, 2.2 times, and 2.4 times, respectively, that of the human EF1 ⁇ promoter. did.
  • Qp the amount of antibody produced per cell
  • Example 5 Examination of the combination effect of Eno1 gene promoter derived from each species and A7 using the antibody expression level in fed-batch culture as an indicator (5-1) Construction of antibody expression vector pDSLH3 constructed in (2-1) .1-Eno1-Y, pDSLH3.1-Eno1-3.5-Y, pDSLH3.1-Eno1-2.8-Y, pDSLH3.1-mEno1-Y, pDSLH3.1 constructed with (4-1) -mEno1-3.5-Y, pDSLH3.1-mEno1-4.0-Y, and pDSLH3.1-Eno1-4.0-Y are used as parent vectors, and DNA element A7 (sequence No. 6) was inserted into an antibody expression vector using the same method as in Patent Document 5.
  • SEQ ID NO: 1 Promoter of Eno1 gene derived from Chinese hamster Nucleotide sequence consisting of the nucleotide approximately 3.0 kbp upstream of the start codon of Eno1 gene to the nucleotide immediately before the nucleotide sequence corresponding to the start codon
  • SEQ ID NO: 2 Promoter of Eno1 gene derived from mouse Promoter Nucleotide sequence consisting of approximately 3.0 kbp upstream of the start codon of the Eno1 gene to the nucleotide immediately before the nucleotide sequence corresponding to the start codon
  • SEQ ID NO: 3 Promoter of the Chinese hamster Eno1 gene Approximately upstream of the start codon of the Eno1 gene Nucleotide sequence consisting of a nucleotide of 2.8 kbp to the nucleotide immediately before the nucleotide sequence corresponding to the start codon
  • SEQ ID NO: 4 Promoter of the Eno1 gene from Chinese hamster From

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
PCT/JP2023/016191 2022-04-26 2023-04-25 Ｅｎｏ１遺伝子のプロモーター Ceased WO2023210607A1 (ja)

Priority Applications (7)

Application Number Priority Date Filing Date Title
KR1020247038353A KR20250007570A (ko) 2022-04-26 2023-04-25 Eno1 유전자의 프로모터
EP23796347.5A EP4516902A1 (en) 2022-04-26 2023-04-25 Promoter of eno1 gene
CA3256438A CA3256438A1 (en) 2022-04-26 2023-04-25 Eno1 Gene Promoter
CN202380032676.6A CN119013400A (zh) 2022-04-26 2023-04-25 Eno1基因的启动子
US18/860,580 US20250283139A1 (en) 2022-04-26 2023-04-25 PROMOTER OF Eno1 GENE
JP2024517326A JPWO2023210607A1 (https=) 2022-04-26 2023-04-25
AU2023258798A AU2023258798A1 (en) 2022-04-26 2023-04-25 PROMOTER OF Eno1 GENE

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2022072103 2022-04-26
JP2022-072103 2022-04-26
JP2022161649 2022-10-06
JP2022-161649 2022-10-06

Publications (1)

Publication Number Publication Date
WO2023210607A1 true WO2023210607A1 (ja) 2023-11-02

Family

ID=88519007

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2023/016191 Ceased WO2023210607A1 (ja) 2022-04-26 2023-04-25 Ｅｎｏ１遺伝子のプロモーター

Country Status (9)

Country Link
US (1) US20250283139A1 (https=)
EP (1) EP4516902A1 (https=)
JP (1) JPWO2023210607A1 (https=)
KR (1) KR20250007570A (https=)
CN (1) CN119013400A (https=)
AU (1) AU2023258798A1 (https=)
CA (1) CA3256438A1 (https=)
TW (1) TW202400789A (https=)
WO (1) WO2023210607A1 (https=)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3051411B2 (ja) 1989-03-14 2000-06-12 持田製薬株式会社 新規ｄｎａならびにそれを含有する発現プラスミド
WO2006123097A2 (en) 2005-05-17 2006-11-23 Millipore Corporation Improved expression elements
WO2012005378A2 (en) 2010-07-07 2012-01-12 Daiichi Sankyo Company, Limited Dna element having the activity of enhancing foreign gene expression
WO2013080934A1 (ja) 2011-11-28 2013-06-06 第一三共株式会社 ヒト遺伝子由来プロモーター
WO2018066492A1 (ja) 2016-10-03 2018-04-12 第一三共株式会社 Ｈｓｐａ５遺伝子のプロモーター
WO2020032153A1 (ja) 2018-08-09 2020-02-13 第一三共株式会社 Ｈｓｐａ８遺伝子のプロモーター

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3051411U (ja) 1997-04-25 1998-08-25 信一 朝長 安全プラグ

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3051411B2 (ja) 1989-03-14 2000-06-12 持田製薬株式会社 新規ｄｎａならびにそれを含有する発現プラスミド
WO2006123097A2 (en) 2005-05-17 2006-11-23 Millipore Corporation Improved expression elements
WO2012005378A2 (en) 2010-07-07 2012-01-12 Daiichi Sankyo Company, Limited Dna element having the activity of enhancing foreign gene expression
WO2013080934A1 (ja) 2011-11-28 2013-06-06 第一三共株式会社 ヒト遺伝子由来プロモーター
WO2018066492A1 (ja) 2016-10-03 2018-04-12 第一三共株式会社 Ｈｓｐａ５遺伝子のプロモーター
WO2020032153A1 (ja) 2018-08-09 2020-02-13 第一三共株式会社 Ｈｓｐａ８遺伝子のプロモーター

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
BECKER, D.M. ET AL., METHODS. ENZYMOL., vol. 194, 1990, pages 182 - 187
BOSHART M ET AL., CELL, vol. 41, no. 2, 1985, pages 521 - 530
CREGGH ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 3376
CRYER ET AL., METHODS IN CELL BIOLOGY, vol. 12, 1975, pages 39 - 44
DEER JR.ALLISON DS., BIOTECHNOL. PROG., vol. 20, 2004, pages 880 - 889
DUROCHER Y ET AL., CURR OPIN BIOTECHNOL., vol. 20, no. 6, 2009, pages 700 - 707
FARID SS., J CHROMATOGR B ANALYT TECHNOL BIOMED LIFE SCI., vol. 848, no. 1, 2007, pages 8 - 18
FLORIAN M. WURM., NAT., vol. 22, no. 11, 2004, pages 1393 - 1398
FOECKING MK ET AL., GENE., vol. 45, no. 1, 1986, pages 101 - 105
HENRY A. ERLICH: "PCR Technology", 1989, ATOCKTON PRESS
HOEKSEMA F. ET AL., BIOTECHNOLOGY RESEARCH INTERNATIONAL, vol. 2011, pages 11
ITO ET AL., AGRIC. BIOL. CHEM., vol. 48, 1984, pages 341
ITOH, H., J. BACTERIOL., vol. 153, 1983, pages 163 - 168
MELLOR J.: "Dynamic nucleosomes and gene transcription", TRENDS GENET., vol. 22, no. 6, 2006, pages 320 - 329, XP028055000, DOI: 10.1016/j.tig.2006.03.008
METHODS IN ENZYMOLOGY, vol. 194, 1991
MOLECULAR CLONING, 1989
NAKATANI Y.: "Histone acetylases - versatile players", GENES CELLS., vol. 6, no. 2, 2001, pages 79 - 86, XP072053683, DOI: 10.1046/j.1365-2443.2001.00411.x
P. PHILIPPSEN, METHODS ENZYMOL., vol. 194, 1991, pages 169 - 182
SANGER ET AL., PROC. NATL. ACAD. SCI., USA, vol. 74, 1977, pages 5463 - 5467
WERNER RG: "Economic aspects of commercial manufacture of biopharmaceuticals", J BIOTECHNOL., vol. 113, no. 1-3, 2004, pages 171 - 182, XP004569607, DOI: 10.1016/j.jbiotec.2004.04.036

Also Published As

Publication number Publication date
JPWO2023210607A1 (https=) 2023-11-02
TW202400789A (zh) 2024-01-01
US20250283139A1 (en) 2025-09-11
AU2023258798A1 (en) 2024-11-14
CN119013400A (zh) 2024-11-22
KR20250007570A (ko) 2025-01-14
CA3256438A1 (en) 2025-07-03
EP4516902A1 (en) 2025-03-05

Similar Documents

Publication Publication Date Title
US20230257767A1 (en) Promoter of Hspa5 Gene
CN105950621B (zh) 具有提高外源基因表达活性的dna元件
US9862969B2 (en) Promoter derived from human gene
WO2020032153A1 (ja) Ｈｓｐａ８遺伝子のプロモーター
WO2023210607A1 (ja) Ｅｎｏ１遺伝子のプロモーター
HK40122500A (en) Promoter of eno1 gene
WO2021201268A1 (ja) 新規遺伝子発現ユニット
HK40043731A (en) Promotor for hspa8 gene
HK40004749A (en) Promoter of hspa5 gene

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23796347

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2024517326

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202380032676.6

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: AU2023258798

Country of ref document: AU

Ref document number: 18860580

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2023258798

Country of ref document: AU

Date of ref document: 20230425

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20247038353

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020247038353

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2023796347

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 11202407487V

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 2023796347

Country of ref document: EP

Effective date: 20241126

WWP Wipo information: published in national office

Ref document number: 18860580

Country of ref document: US