WO2023193174A1

WO2023193174A1 - Methods for detecting insertion mutations

Info

Publication number: WO2023193174A1
Application number: PCT/CN2022/085507
Authority: WO
Inventors: Shu Kam Tony Mok; Hin-Nung Jason CHEN
Original assignee: The Chinese University Of Hong Kong
Priority date: 2022-04-07
Filing date: 2022-04-07
Publication date: 2023-10-12

Abstract

The disclosure provides methods for detecting insertion mutations in a mutant polynucleotide.

Description

METHODS FOR DETECTING INSERTION MUTATIONS

BACKGROUND

EGFR exon 20 insertions exist as over 85 unique variants that may occur in any position within amino acids 762 to 774 (39 base pairs) of the EGFR gene. Existing methods of traditional probe-based PCR utilizes one probe per mutant variant and this approach would be highly laborious and costly for the detection of multiple variants. Thus, there is a need for an alternative method to effectively detect EGFR exon 20 insertion mutations.

BRIEF SUMMARY

In one aspect, the disclosure provides a method for detecting in a sample a mutant polynucleotide comprising an insertion mutation, the method comprising: contacting the sample with a first probe and a second probe, wherein the first probe anneals to a sequence comprising a first wild-type portion of the mutant polynucleotide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a second wild-type portion of the mutant polypeptide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophore are different; incubating the sample for a time sufficient for the first probe and the second probe to anneal to the mutant polynucleotide; performing polymerase chain reaction (PCR) to allow the cleavage of the first fluorophore, the first quencher, the second fluorophore, and the second quencher; and detecting fluorescence emission signal from the first fluorophore and/or the second fluorophore, wherein the presence of only one fluorescence emission signal from the first or second fluorophore indicates the presence of the insertion mutation.

In some embodiments, the first probe and the second probe anneal to first and second wild-type portions of the mutant polynucleotide that have at least one basepair overlap. In some embodiments, the mutant polynucleotide encodes an epidermal growth factor receptor (EGFR) or a portion thereof. In particular embodiments, the insertion mutation is in EGFR exon 20. In particular embodiments, the wild-type portion of the mutant polynucleotide binds downstream of the EGFR exon 20 insertion mutation. In particular embodiments, the insertion mutation is S768_V769delinsIL, D770>GY, or D770_N771insG. In some embodiments, the first probe and second probe anneal to first and second wild-type portions of the mutant polynucleotide on complementary DNA strands that have at least one base pair overlap.

In some embodiments of this aspect, the first probe comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of GGCCATCACGTAGGCTTC (SEQ ID NO: 1) , and the second probe comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of CAGCGTGGACAACCCCCACGTG (SEQ ID NO: 2) .

In particular embodiments of this aspect, the first probe comprises the sequence of GGCCATCACGTAGGCTTC (SEQ ID NO: 1) , and the second probe comprises the sequence of CAGCGTGGACAACCCCCACGTG (SEQ ID NO: 2) .

In another aspect, the disclosure features a method for detecting in a sample a mutant polynucleotide comprising an insertion mutation, the method comprising: contacting the sample with a first probe and a second probe, wherein the first probe anneals to a sequence comprising a portion of the insertion mutation and a wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophores are different; incubating the sample for a time sufficient for the first probe and the second probe to anneal to the mutant polynucleotide; performing polymerase chain reaction (PCR) to allow the cleavage of the first fluorophore, the first quencher, the second fluorophore, and the second quencher; and detecting at least one fluorescence emission signal from the first fluorophore and/or the second fluorophore, wherein the presence of fluorescence emission signals from both the first fluorophore and the second fluorophore indicates the presence of the insertion mutation.

In some embodiments of this aspect, the mutant polynucleotide encodes an epidermal growth factor receptor (EGFR) or a portion thereof. In particular embodiments, the insertion mutation is in EGFR exon 20. In certain embodiments, the insertion mutation is V769_D770insASV, D770_N771insSVD, or A763_Y764FQEA.

In some embodiments of this aspect, the first probe comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of GCCTGCTGGGCATCTGCCTCACC (SEQ ID NO: 3) and the second probe comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of CGTGGCCAGCGTGGACAACCC (SEQ ID NO: 4) , CCAGCGTGGACAGCGTGGACAAC (SEQ ID NO: 5) , or TCCAGGAAGCCTTCCAGGAAGCCTACGT (SEQ ID NO: 6) . In particular embodiments, the first probe comprises the sequence of GCCTGCTGGGCATCTGCCTCACC (SEQ ID NO: 3) and the second probe comprises the sequence of CGTGGCCAGCGTGGACAACCC (SEQ ID NO: 4) , CCAGCGTGGACAGCGTGGACAAC (SEQ ID NO: 5) , or TCCAGGAAGCCTTCCAGGAAGCCTACGT (SEQ ID NO: 6) .

In some embodiments of the methods described herein, prior to the first step of contacting the sample with the first probe and the second probe, the method comprises contacting the sample with a forward primer and a reverse primer. In certain embodiments, the forward primer comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of GCCACCATGCGAAGCCACACTGA (SEQ ID NO: 7) and the reverse primer comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of TGCGTGATGAGCTGCACGGTG (SEQ ID NO: 8) .

In some embodiments of the methods described herein, the cleavage is performed by a DNA polymerase.

In some embodiments of the methods described herein, the first fluorophore is fluorescein or Alexa Fluor 488. In some embodiments, the second fluorophore is VIC, Alexa Fluor 546, Alexa Fluor 647, Cy5, or DY-647. In particular embodiments, the first fluorophore is fluorescein and the second fluorophore is VIC.

In some embodiments, the sample is a biological sample. In certain embodiments, the biological sample is selected from the group consisting of pleural fluid, whole blood, urine, a fecal specimen, plasma, and serum. In certain embodiments, the biological sample is pleural fluid.

In another aspect, the disclosure provides a kit for detecting an insertion mutation in a mutant polynucleotide in a sample, comprising a first probe and a second probe, wherein the first probe anneals to a sequence comprising a first wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a second wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophores are different.

In another aspect, the disclosure provides a kit for detecting an insertion mutation in a mutant polynucleotide in a sample, comprising a first probe and a second probe, wherein the first probe anneals to a sequence comprising a portion of the insertion mutation and a wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophores are different. In some embodiments, the mutant polynucleotide encodes an epidermal growth factor receptor (EGFR) or a portion thereof. In particular embodiments, the insertion mutation is in EGFR exon 20. In particular embodiments, the wild-type portion of the mutant polynucleotide binds downstream of the EGFR exon 20 insertion mutation.

In some embodiments of the kits described herein, the kits further contain a polymerase, deoxynucleotide triphosphates (dNTPs) , and buffers.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1A: EGFR exon 20 insertion multiple variants assay design.

FIG. 1B: EGFR exon 20 insertion multiple variants probe design.

FIG. 1C: EGFR exon 20 insertion multiple variants assay theoretical 2-D plot results.

FIGS. 1D-1H: Results of EGFR exon 20 insertion multiple variants assay synthetic variant detections.

FIG. 2A: EGFR exon 20 insertion high prevalence variants assay design.

FIG. 2B: the theoretical results of the EGFR exon 20 insertion high prevalence variants assay.

FIG. 2C: A763_Y764insFQEA (TCCAGGAAGCCT (SEQ ID NO: 9) Duplication)

FIG. 2D: Traditional probe-based PCR approach is ineffective in detecting certain duplication insertions.

FIGS. 2E-2G: Results of EGFR exon 20 insertion multiple variants assay elusive variants detections.

FIG. 2H: EGFR exon 20 high prevalence assay mutant-wild type hybrid probe design.

FIG. 2I: the sequences of the EGFR exon 20 high prevalence assay FAM-labelled mutant-wild type hybrid probes.

FIGS. 2J-2N: Results showed that the unique probe sequences were able to bind specifically to the mutant samples and not to the wild-type sample.

FIG. 3A: EGFR exon 19 deletion assay design.

FIG. 3B: EGFR exon 19 deletion theoretical 2-D plot results.

FIG. 4A: EGFR exon 21 L858R point mutation assay design.

FIG. 4B: EGFR exon 21 L858R point mutation 2-D poly results.

DETAILED DESCRIPTION

I. EGFR MUTATIONS

Lung cancer is the leading cause of cancer-related deaths with 1.6 million new cases globally every year. The number of cancer diagnoses and deaths are expected to continue onwards a rising trend due to global tobacco consumption and an aging population. Lung cancer is a heterogeneous disease that comprises of multiple histological and molecular subtypes. Proper clinical and pathological diagnosis of lung cancer types is critical for effective treatment (e.g., chemotherapy, radiotherapy, immunotherapy, target therapy) . Approximately 85%of lung cancer cases are diagnosed as non-small lung cancer (NSCLC) and is further sub-classified into large cell carcinoma, squamous cell carcinoma, and adenocarcinoma.

EGFR (epidermal growth factor receptor) is a transmembrane protein and member of the ErrB family of receptor tyrosine kinases, found in chromosome 7 of humans and spanning 110 kilobases of DNA over 28 exons. EGFR mutations arise as a result of alternation to the DNA sequence responsible for coding EGFR proteins, giving rise to tumourigenesis. There are over 200 known mutations and they are classified based on location (e.g., exon) and type (e.g., insertion, deletion, duplication, point mutation) . The most common EGFR mutations in NSCLC are known as classical mutations (EGFR exon 19 deletions and exon 21 L858R point mutation) and account for approximately 85%of all EGFR mutations in EGFR NSCLC. Non-classical (or uncommon) EGFR mutations account for the remaining 15%of EGFR mutations in EGFR NSCLC. Following the discovery that classical EGFR mutations are responsive to tyrosine kinase inhibitors (TKI) and that they are superior to traditional platinum-based chemotherapy, the development of liquid biopsy assays for their detection became a common focus for many researchers.

EGFR exon 20 insertions range in size from 3 to 12 base pairs and exist as over 85 unique variants that may occur in any position within amino acids 762 to 774 (39 base pairs) of the EGFR gene. They may vary in size and range from 3 to 21 base pairs, with the majority of them occurring near the α-C helix. The addition of amino acid residues result in a conformational change of the α-C helix, generating steric hindrance and causing the EGFR to be constitutively active. Multiple clinical trials have demonstrated that EGFR exon 20 insertions are resistant to tyrosine kinase inhibitors.

Droplet digital PCR is a gene detection platform used for the detection of DNA sequences. It utilizes fluorescent probes that generate a fluorescent signal after it has i) annealed to a DNA sequence of interest ii) been cleaved through DNA polymerase activity. Commercially available assay kits provide primers and probes for the detection of classical EGFR mutations through the use of two different designs. However, these designs are specific for the detection of EGFR exon 19 deletions and EGFR exon 21 L858R point mutations. Currently available designs are not applicable for the detection of EGFR exon 20 insertion mutations, which is the third most common EGFR mutation (e.g., 4%of all EGFR mutations) .

Existing methods of traditional probe-based PCR utilizes one probe per variant (e.g., EGFR exon 21 L858R point mutation) . This approach is laborious and costly as a separate portion of DNA is needed per variant. Therefore, it is not clinically feasible for the detection of EGFR exon 20 insertions. Although higher prevalence variants may be prioritized, selective screening may result in false negatives. Another method of probe-based PCR utilizes one probe to cover up a DNA sequence where mutations frequently occur (e.g. EGFR exon 19 deletions) . Hydrolysis probes are unable to exceed a maximum size of 18-22 base pairs before inefficient fluorophore quenching is observed. Thus, this approach is not applicable for the detection of EGFR exon 20 insertions which occur in a DNA sequence of 39 base pairs. There is a need for an alternative method to effectively detect EGFR exon 20 insertions.

II. DEFINITIONS

As used herein, the singular forms “a, ” “an” and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “an antibody” optionally includes a combination of two or more such molecules, and the like.

As used herein, the terms “about” and “approximately, ” when used to modify an amount specified in a numeric value or range, indicate that the numeric value as well as reasonable deviations from the value known to the skilled person in the art, for example ±20%, ± 10%, or ± 5%, are within the intended meaning of the recited value.

The terms “polynucleotide” and “nucleic acid” interchangeably refer to chains of nucleotides of any length, and include DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. Examples of polynucleotides contemplated herein include single-and double-stranded DNA, single-and double-stranded RNA, and hybrid molecules having mixtures of single-and double-stranded DNA and RNA.

The terms “identical” or percent “identity, ” in the context of two or more polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues, e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%or greater, that are identical over a specified region when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithm or by manual alignment and visual inspection.

For sequence comparison of polypeptides, typically one amino acid sequence acts as a reference sequence, to which a candidate sequence is compared. Alignment can be performed using various methods available to one of skill in the art, e.g., visual alignment or using publicly available software using known algorithms to achieve maximal alignment. Such programs include the BLAST programs, ALIGN, ALIGN-2 (Genentech, South San Francisco, Calif. ) or Megalign (DNASTAR) . The parameters employed for an alignment to achieve maximal alignment can be determined by one of skill in the art. For sequence comparison of polypeptide sequences for purposes of this application, the BLASTP algorithm standard protein BLAST for aligning two proteins sequence with the default parameters is used.

The terms “subject, ” “individual, ” and “patient, ” as used interchangeably herein, refer to a mammal, including but not limited to humans, non-human primates, rodents (e.g., rats, mice, and guinea pigs) , rabbits, cows, pigs, horses, and other mammalian species. In one embodiment, the subject, individual, or patient is a human.

III. EGFR EXON 20 INSERTION

Traditional probe-based DNA detection utilizes probe sequences that are complementary to the mutation sequence of interest (e.g., EGFR exon 21 L858R) . The EGFR exon 19 deletion assay took this one step further, utilizing a wild-type probe that annealed to the wild-type sequence where EGFR exon 19 deletions most frequently occur. As a result, any deletion that arose would displace the wild-type probe allowing for the coverage of not just one variant, but multiple different variants. As described herein, the EGFR exon 20 insertion assay is divided into two parts, the EGFR Exon 20 Insertion Multiple Variants Assay and the EGFR Exon 20 Insertion High Prevalence Variants Assay. EGFR exon 20 insertions are challenging to detect due to having i) numerous variants and ii) their existence as duplication insertions. The present assays utilize primers and probes in a unique way to detect EGFR exon 20 insertions.

EGFR Exon 20 Multiple Variants Assay

In this assay, two wild-type probes designed adjacent to each other cover the entirety of the wild-type DNA sequence where EGFR exon 20 insertions occur. Probes have a maximum length of 18-22 base pairs, and the adjacent probe design is unique for the detection of mutations in DNA sequences that exceed a single probe’s maximum length.

EGFR exon 20 insertions exist as over 85 variants, and the traditional method of one probe per variant is not physiologically feasible (e.g., patient cannot provide that much blood specimen) , astronomically costly, and highly laborious. Currently available EGFR exon 20 insertion assays (e.g., AmoyDx Super-ARMS EGFR Mutation Kit, Cobas EGFR Mutation Test V2) have limited coverage for only a select few variants. When variants are omitted from diagnostic testing, there is a chance of false negative results.

The present EGFR exon 20 insertion multiple variants assay utilizes two wild-type probes for the detection of numerous EGFR exon 20 insertions. The assay solves the aforementioned problems by requiring less specimen, having a fast turn-around time, and is economical. It is an improvement to currently available methods.

Further, in some embodiments, the two wild-type probes bind to complementary DNA strands with a one base pair overlap. In some embodiments, it is not sufficient to design the wild-type probes adjacent to each other. EGFR exon 20 insertions may arise anywhere within amino acids 762-774 of the EGFR gene. If an insertion were to arise between the probes, neither probes will be displaced, and a false-negative result will be observed. In the present design, one probe is designed on the sense strand where the other is designed on the anti-sense strand with a one base pair overlap. Thus, the entirety of the EGFR exon 20 mutational DNA sequence is covered.

The disclosure provides a method for detecting in a sample a mutant polynucleotide (e.g., a mutant polynucleotide encodes an epidermal growth factor receptor (EGFR) or a portion thereof) comprising an insertion mutation (e.g., an insertion mutation in EGFR exon 20) , the method comprising: a) contacting the sample with a first probe and a second probe, wherein the first probe anneals to a sequence comprising a first wild-type portion of the mutant polynucleotide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a second wild-type portion of the mutant polypeptide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophore are different; b) incubating the sample for a time sufficient for the first probe and the second probe to anneal to the mutant polynucleotide; c) performing polymerase chain reaction (PCR) to allow the cleavage of the first fluorophore, the first quencher, the second fluorophore, and the second quencher; and d) detecting fluorescence emission signal from the first fluorophore and/or the second fluorophore, in which the presence of only one fluorescence emission signal from the first or second fluorophore indicates the presence of the insertion mutation.

As described herein, in some embodiments, the first probe and the second probe anneal to first and second wild-type portions of the mutant polynucleotide that have at least one base pair overlap (e.g., one, two, three, four, five, six, seven, eight, nine, or ten base pair overlap) . The insertion mutation in a mutant polynucleotide encoding a mutant EGFR exon 20 can be S768_V769delinsIL, D770>GY, or D770_N771insG. Examples of insertion mutations can be found in the table below:

Table 1 -EGFR Exon 20 Insertion: Multiple Variants Assay (15 Total)

(bold and underlined nucleotides indicate the insertion)

In certain embodiments, the first probe comprises a sequence having at least 90%(e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of GGCCATCACGTAGGCTTC (SEQ ID NO: 1) , and the second probe comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of CAGCGTGGACAACCCCCACGTG (SEQ ID NO: 2) . In particular embodiments, the first probe comprises the sequence of GGCCATCACGTAGGCTTC (SEQ ID NO: 1) , and the second probe comprises the sequence of CAGCGTGGACAACCCCCACGTG (SEQ ID NO: 2) .

The disclosure also provides kits for detecting an insertion mutation in a mutant polynucleotide (e.g., an insertion mutation in a mutant polynucleotide encoding EGFR exon 20) in a sample, comprising a first probe and a second probe, wherein the first probe anneals to a sequence comprising a first wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a second wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophores are different. The kits can further include a polymerase (e.g., a DNA polymerase) , deoxynucleotide triphosphates (dNTPs) , and buffers.

EGFR Exon 20 High Prevalence Assay

In some embodiments, the assay uses a mutant-wild type hybrid probe. The traditional method of one probe per variant is not applicable for the detection of duplication insertions. If a probe specific for a duplication insertion was used, it would correctly bind to the duplication but also incorrectly bind to true wild-type sequences. If a wild type probe was used and to be displaced by an insertion, it would correctly bind to a true wild-type sequence but incorrectly bind to the duplication sequence. This results in a situation where neither a mutant or wild-type probe can be used to effectively identify an insertion mutation. To overcome this, the present assay utilizes a unique mutant wild-type hybrid probe that is specific for the detection of duplication insertions.

The disclosure provides a method for detecting in a sample a mutant polynucleotide (e.g., a mutant polynucleotide encoding an EGFR or a portion thereof) comprising an insertion mutation (e.g., an insertion mutation in EGFR exon 20) , the method comprising: a) contacting the sample with a first probe and a second probe, wherein the first probe anneals to a sequence comprising a portion of the insertion mutation and a wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophores are different; b) incubating the sample for a time sufficient for the first probe and the second probe to anneal to the mutant polynucleotide; c) performing polymerase chain reaction (PCR) to allow the cleavage of the first fluorophore, the first quencher, the second fluorophore, and the second quencher; and d) detecting at least one fluorescence emission signal from the first fluorophore and/or the second fluorophore, wherein the presence of fluorescence emission signals from both the first fluorophore and the second fluorophore indicates the presence of the insertion mutation. In certain embodiments, the wild-type portion of the mutant polynucleotide binds downstream of the EGFR exon 20 insertion mutant polynucleotide.

In certain embodiments, the insertion mutation is V769_D770insASV, D770_N771insSVD, or A763_Y764FQEA. Examples of insertion mutations can be found in the table below:

Table 2 -EGFR Exon 20 Insertion: High Prevalence Variants Assay (3 Total)

(bold and underlined nucleotides indicate the insertion)

In certain embodiments, the first probe comprises a sequence having at least 90%(e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of GCCTGCTGGGCATCTGCCTCACC (SEQ ID NO: 3) and the second probe comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of CGTGGCCAGCGTGGACAACCC (SEQ ID NO: 4) , CCAGCGTGGACAGCGTGGACAAC (SEQ ID NO: 5) , or TCCAGGAAGCCTTCCAGGAAGCCTACGT (SEQ ID NO: 6) . In certain embodiments, the first probe comprises the sequence of GCCTGCTGGGCATCTGCCTCACC (SEQ ID NO: 3) and the second probe comprises the sequence of CGTGGCCAGCGTGGACAACCC (SEQ ID NO: 4) , CCAGCGTGGACAGCGTGGACAAC (SEQ ID NO: 5) , or TCCAGGAAGCCTTCCAGGAAGCCTACGT (SEQ ID NO: 6) .

The disclosure also provides kits for detecting an insertion mutation in a mutant polynucleotide (e.g., an insertion mutation in a mutant polynucleotide encoding EGFR exon 20) in a sample, comprising a first probe and a second probe, wherein the first probe anneals to a sequence comprising a portion of the insertion mutation and a wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophores are different. The kits can further include a polymerase (e.g., a DNA polymerase) , deoxynucleotide triphosphates (dNTPs) , and buffers. In certain embodiments, the wild-type portion of the mutant polynucleotide binds downstream of the EGFR exon 20 insertion mutant polynucleotide.

In some embodiments of the methods described herein, prior to the first step of contacting the sample with the first probe and the second probe, the method comprises contacting the sample with a forward primer and a reverse primer. The forward primer can comprise a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of GCCACCATGCGAAGCCACACTGA (SEQ ID NO: 7) and the reverse primer comprises a sequence having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the sequence of TGCGTGATGAGCTGCACGGTG (SEQ ID NO: 8) .

In certain embodiments, the cleavage of the fluorophore and/or quench can be performed by a DNA polymerase.

In particular embodiments, the first fluorophore is fluorescein or Alexa Fluor 488. In particular embodiments, the second fluorophore is VIC, Alexa Fluor 546, Alexa Fluor 647, Cy5, or DY-647. In some embodiments, the first fluorophore is fluorescein and the second fluorophore is VIC.

In the assays described herein, the sample can be a biological sample (e.g., pleural fluid, whole blood, urine, a fecal specimen, plasma, or serum) . In particular embodiments, the biological sample is pleural fluid.

IV. PROBES WITH FLUOROPHORES AND QUENCHERS

In some embodiments, a probe described herein is attached to a fluorophore and a quencher by way of a linker. A linker can be used to describe any type of connection between two or more entities, e.g., organic compounds, amino acids, peptides, and proteins. A linker can be used to describe a linkage or connection between a fluorophore or a quencher and a probe. In some embodiments, a linker can be a simple covalent bond, e.g., a peptide bond, a synthetic polymer, e.g., a polyethylene glycol (PEG) polymer, or any kind of bond created from a chemical reaction, e.g. chemical conjugation. In the case that a linker is a synthetic polymer, e.g., a PEG polymer, the polymer can be functionalized with reactive chemical functional groups at each end to react with the terminal amino acids at the connecting ends of two proteins. In the case that a linker is made from a chemical reaction, chemical functional groups, e.g., amine, carboxylic acid, ester, azide, or other functional groups commonly used in the art, can be attached synthetically to the probe and the fluorophore or quencher. The two functional groups can then react to through synthetic chemistry means to form a chemical bond, thus connecting the two entities together. Such chemical conjugation procedures are routine for those skilled in the art.

In some embodiments, a linker can be cleaved to release the fluorophore or the quencher from the probe. Once the fluorophore and quencher are released, the fluorescence emission from the fluorophore can be detected. As described herein, once the probe binds to the polynucleotide and is used during PCR extension reaction, the fluorophore and the quencher can be released from the probe during the PCR extension via cleavage by DNA polymerase.

While the fluorophore and the quencher are attached to the probe, the fluorophore and the quencher are in proximity to each other such that the fluorescence emission of the fluorophore can be quenched by the quencher as long as the fluorophore and the quencher are spectrally matched. This phenomenon is often referred to as fluorescence resonance energy transfer (FRET) . Pairs of fluorophore and quencher that can participate in FRET are known in the art, for example, as described in, Marras, Methods in Mol. Biol. 335: 3-16, 2006. Examples of fluorophores include, but are not limited to, BODIPY, FAM, Oregon Green, Rhodamine Green, Oregon Green 514, TET, Cal Gold, BODIPY R6G, Yakima Yellow, Cal Orange, BODIPY TMR-X, Cy3, TAMRA, Rhodamine Red, BODIPY 581/591, Cy3.5, Cal Red/Texas Red, BODIPY TR-X, BODIPY 630/665-X, Pulsar-650, Cy5, and Cy5.5. Examples of quenchers include, but are not limited to, Dabcyl, QSY 35, BHQ-0, Eclipse, BHQ-1, QSY 7, QSY 9, BHQ-2, ElleQuencher, Iowa Black, QSY 21, and BHQ-3.

V. DROPLET DIGITAL PCR

As described herein, to detect mutations in a mutant polynucleotide, probes with attached fluorophores and quenchers can be annealed to polynucleotides in a sample and amplification reactions can be performed via droplet digital PCR. Droplet Digital PCR technology is a digital PCR method utilizing a water-oil emulsion droplet system. Droplets are formed in a water-oil emulsion to form the partitions that separate the template DNA molecules. Droplet digital PCR uses a combination of microfluidics and proprietary surfactant chemistries to divide PCR samples into water-in-oil droplets (Hindson et al., Anal Chem 83 (22) : 8604–8610, 2011) . The droplets support PCR amplification of the template molecules they contain and use reagents and workflows similar to those used for most standard TaqMan probe-based assays. The droplets serve essentially the same function as individual test tubes or wells in a plate in which the PCR reaction takes place, but in a much smaller format. In one example, the Droplet Digital PCR System partitions nucleic acid samples into thousands of nanoliter-sized droplets, and PCR amplification is carried out within each droplet. Following PCR, each droplet is analyzed or read to determine the fraction of PCR-positive droplets in the original sample. These data are then analyzed using Poisson statistics to determine the target DNA template concentration in the original sample.

Droplet digital PCR offers the advantage of a smaller sample requirement than other PCR systems, reducing cost and preserving precious samples. Further, droplet digital PCR surpasses the performance of earlier digital PCR techniques by resolving the previous lack of scalable and practical technologies for digital PCR implementation. Droplet digital PCR can create tens of thousands of droplets, which means that a single sample can generate tens of thousands of data points rather than a single result.

EXAMPLES

The present disclosure will be described in greater detail by way of specific examples. The following examples are offered for illustrative purposes only, and are not intended to limit the disclosure in any manner.

The examples refer to the primers, probes, and method for the detection of EGFR exon 20 insertion mutations from blood plasma. The inventors have developed a droplet digital PCR-based assay that was able to detect EGFR exon 20 insertion mutations in synthetic DNA and in EGFR exon 20 insertion positive (previously clinically confirmed) blood plasma from patients.

The detection of EGFR exon 20 insertion mutation consists of two droplet digital PCR assays that target different variants using different designs: Example 1: EGFR Exon 20 Insertion Multiple Variants Assay; and Example 2: EGFR Exon 20 Insertions High Prevalence Variants Assay.

Table 3 shows the PCR conditions of EGFR exon 20 insertion multiple variants and high prevalence assays.

Table 3

Temperature (℃)	Time (minutes)
37	30
95	10
94	15 seconds
65℃	1
98	10
12	Infinite

The EGFR Exon 20 Insertion Multiple Variants and High Frequency Variants Assay is performed using an annealing temperature of 65℃, for 50 cycles, 900 nM primer, and 250 nM probe per reaction. DNA primers specific for the EGFR exon 20 amplicon containing the mutation hotspot DNA sequence were designed with the following specifications as shown in Table 4.

Table 4

EXAMPLE 1 -EGFR EXON 20 INSERTION MULTIPLE VARIANTS ASSAY

The EGFR Exon 20 Insertion Multiple Variants Assay was designed to cover all potential insertion sites in the EGFR exon 20 mutational hotspot DNA sequence. The assay consisted of the aforementioned primer pair which generated one amplicon (amino acid 762-774) and was covered using two hydrolysis probes that annealed to its wild-type sequence (FIG. 1A) . Specifically, a FAM-labelled wild-type hydrolysis probe annealed to amino acid 762-768 and a VIC-labelled wild-type hydrolysis probe annealed to amino acid 768-774. The probes were designed adjacent to each other to allow for full coverage of the area where EGFR exon 20 insertion mutations arise. Furthermore, they were designed to anneal to complementary DNA strands (e.g., FAM anneals to sense strand and VIC anneals to anti-sense strand) with a one base pair overlap. This allowed for the detection of any insertions that may occur between

amino acids

767 and 768. FIG. 1B shows the EGFR exon 20 insertion multiple variants assay probe design. Table 5 shows the EGFR exon 20 insertion multiple variants assay FAM-labeled and VIC-labeled wild-type hydrolysis probe specifications.

Table 5

Further FIG. 1C shows the theoretical results of EGFR exon 20 insertion multiple variants assay. The interpretation of the EGFR Exon 20 Insertion Multiple Variants Assay consists of four droplet clusters, where single signals (e.g., FAM+ or VIC+) indicate the presence of mutant DNA and dual signals (e.g., FAM+ and VIC+) indicate the presence of wild-type DNA. Unlike the previous EGFR classical mutations design, the interpretation of an EGFR exon 20 insertion status using the Multiple Variants Assay Design requires the use of all four droplet clusters. Therefore, if the DNA molecule is wild-type, the absence of an EGFR exon 20 insertion mutation allows for the annealing of both the FAM-labelled probe and the VIC-labelled probe. Both probes are cleaved off during the extension stage of PCR, releasing the donor fluorophores (e.g., FAM, VIC) from the proximity of the quenchers and resulting in the generation of a dual FAM + VIC signal. If the DNA molecule is a mutant, the presence of an EGFR exon 20 insertion mutation within AA 762-768 disrupts the annealing of the FAM-labelled probe (left region) , resulting in only the annealing of the VIC-labelled probe. The VIC-labelled probe is cleaved off during the extension stage of the PCR, releasing the VIC fluorophore from the proximity of its quencher and resulting in the generation of a single VIC signal. Conversely, the presence of an EGFR exon 20 insertion mutation within AA 768-774 disrupts the annealing of the VIC-labelled probe (right region) , resulting in only the annealing of the FAM-labelled probe. The FAM-labelled probe is cleaved off during the extension stage of the PCR, releasing the FAM fluorophore from the proximity of its quencher and resulting in the generation of a single FAM signal.

FIGS. 1D-1H show the results of this assay. FIG. 1D is 2-D Plot result analysis of the EGFR Exon 20 Insertion Multiple Variants Assay for droplet digital PCR (BioRad) . The EGFR Exon 20 insertion variant “S768_V769delinsIL (TCT) ” was pooled together with wild-type DNA extracted from healthy maternal buffy coat. The pooled DNA was used to assess the performance (e.g., sensitivity, specificity) of the EGFR Exon 20 Multiple Variants Assay. A “mutant” population of droplets can be seen at the upper left quadrant (1200, 9000) . The DNA within these droplets exhibit a single FAM signal from the FAM wild-type probe annealing. The presence of the insertion “TCT” between amino acids S768 and V769 had prevented the VIC wild-type probe from successfully annealing and conferring a fluorescent signal. A “wild-type” population of droplets can be seen at the upper right quadrant (5000, 9000) . The DNA within these droplets exhibit a dual signal from the FAM wild-type probe and the VIC wild-type probe annealing. When there is no mutation present, both wild-type probes are able to successfully anneal and together produce a dual fluorescent signal. A “No DNA template” population of droplets can be seen at the bottom left corner (1200, 1000) . These droplets do not contain any DNA. The EGFR Exon 20 Insertion Multiple Variants Assay is well optimized and suitable for the detection of the “S768_V769delinsIL (TCT) ” variant as the mutant and wild-type population of droplets were identified and clearly separated into robust clusters.

FIG. 1E is a 2-D Plot result analysis of the EGFR Exon 20 Insertion Multiple Variants Assay for droplet digital PCR (BioRad) . The EGFR Exon 20 insertion variant “D770>GY” was pooled together with wild-type DNA extracted from healthy maternal buffy coat. The pooled DNA was used to assess the performance (e.g., sensitivity, specificity) of the EGFR Exon 20 Multiple Variants Assay. A “mutant” population of droplets can be seen at the upper left quadrant (1200, 9000) . The DNA within these droplets exhibit a single FAM signal from the FAM wild-type probe annealing. The presence of the deletion insertion at amino acid D770 had prevented the VIC wild-type probe from successfully annealing and conferring a fluorescent signal. A “wild-type” population of droplets can be seen at the upper right quadrant (5000, 9000) . The DNA within these droplets exhibit a dual signal from the FAM wild-type probe and the VIC wild-type probe annealing. When there is no mutation present, both wild-type probes are able to successfully anneal and together produce a dual fluorescent signal. A “No DNA template” population of droplets can be seen at the bottom left corner (1200, 1000) . These droplets do not contain any DNA. The EGFR Exon 20 Insertion Multiple Variants Assay is well optimized and suitable for the detection of the “D770>GY” variant as the mutant and wild-type population of droplets were identified and clearly separated into robust clusters.

FIG. 1F shows a 2-D Plot result analysis of the EGFR Exon 20 Insertion Multiple Variants Assay for droplet digital PCR (BioRad) . The EGFR Exon 20 insertion variant “D770_N771insG” was pooled together with wild-type DNA extracted from healthy maternal buffy coat. The pooled DNA was used to assess the performance (e.g., sensitivity, specificity) of the EGFR Exon 20 Multiple Variants Assay. A “mutant” population of droplets can be seen at the upper left quadrant (1200, 8000) . The DNA within these droplets exhibit a single FAM signal from the FAM wild-type probe annealing. The presence of the insertion between amino acids D770 and N771 had prevented the VIC wild-type probe from successfully annealing and conferring a fluorescent signal. A “wild-type” population of droplets can be seen at the upper right quadrant (5000, 8000) . The DNA within these droplets exhibit a dual signal from the FAM wild-type probe and the VIC wild-type probe annealing. When there is no mutation present, both wild-type probes are able to successfully anneal and together produce a dual fluorescent signal. A “No DNA template” population of droplets can be seen at the bottom left corner (1200, 1000) . These droplets do not contain any DNA. The EGFR Exon 20 Insertion Multiple Variants Assay is well optimized and suitable for the detection of the “D770_N771insG” variant as the mutant and wild-type population of droplets were identified and clearly separated into robust clusters.

FIG. 1G shows a 2-D Plot result analysis of the EGFR Exon 20 Insertion Multiple Variants Assay for droplet digital PCR (BioRad) . DNA extracted from healthy maternal buffy coat was used to assess the performance of the EGFR Exon 20 Multiple Variants Assay. Specifically, to ensure that a “wild-type population” and only a “wild-type population” of droplets would be detected when only wild-type DNA is added into the assay. A “wild-type” population of droplets can be seen at the upper right quadrant (4500, 8000) . The DNA within these droplets exhibit a dual signal from the FAM wild-type probe and the VIC wild-type probe annealing. When there is no mutation present, both wild-type probes are able to successfully anneal and together produce a dual fluorescent signal. A “No DNA template” population of droplets can be seen at the bottom left corner (1200, 1000) . These droplets do not contain any DNA.

FIG. 1H is a 2-D Plot result analysis of the EGFR Exon 20 Insertion Multiple Variants Assay for droplet digital PCR (BioRad) . PCR-grade water containing no DNA was used to assess the performance of the EGFR Exon 20 Multiple Variants Assay. Specifically, to ensure that no wild-type and mutant droplet populations would appear when no DNA is added into the assay. It serves as a control for potential DNA contamination throughout the experiment. A “No DNA template” population of droplets can be seen at the bottom left corner (1200, 1000) .

EXAMPLE 2 –EGFR EXON 20 INSERTION HIGH PREVALENCE VARIANTS ASSAY

The EGFR Exon 20 Insertion High Prevalence Variants Assay was designed to target the higher prevalence EGFR exon 20 insertions such as V769_D770insASV, D770_N771insSVD, and A763_Y764FQEA. The assay consisted of the aforementioned primer pair which generates one amplicon (includes AA 762-774) and four hydrolysis probes. Specifically, three FAM-labelled hydrolysis probes annealed to the wild-type and mutant DNA sequence (s) of the variants V769_D770insASV, D770_N771insSVD, and A763_Y764FQEA, and one VIC-labelled hydrolysis probe annealed to a downstream wild-type DNA reference region regardless of mutational status. FIG. 2A shows EGFR exon 20 insertion high prevalence variants assay probe design. Table 6 below shows EGFR exon 20 insertion high prevalence variants assay FAM-labeled mutant and VIC-labeled wild-type hydrolysis probes.

Table 6

FIG. 2B shows the theoretical results of the EGFR exon 20 insertion high prevalence variants assay. Therefore, if the DNA molecule is wild-type, the absence of an EGFR exon 20 insertion mutation allows for the annealing of only the VIC-labelled wild-type probe. The VIC-labelled probe is cleaved off during the extension stage of PCR, releasing the VIC fluorophore from the proximity of the quencher and resulting in the generation of a single VIC signal. If the DNA molecule is a mutant, the presence of an EGFR exon 20 insertion mutation (e.g., V769_D770insASV, D770_N771insSVD, or A763_Y764FQEA) results in the annealing of both the FAM-labelled probe of the variant and the VIC-labelled wild-type probe. Both probes are cleaved off during the extension stage of PCR, releasing the donor fluorophores (e.g., FAM, VIC) from the proximity of the quenchers and resulting in the generation of a dual FAM + VIC signal.

The EGFR Exon 20 High Prevalence Variants Assay was designed following the identification of high prevalence variants (e.g., V769_D770insASV, D770_N771insSVD, and A763_Y764FQEA) that were elusive to the EGFR Exon 20 Multiple Variants Assay design. These variants contained duplication insertions that were identical to the wild-type EGFR exon 20, making them very challenging to detect. FIG. 2C shows an example of duplication insertion (A763_Y764insFQEA (TCCAGGAAGCCT (SEQ ID NO: 9) Duplication) ) .

Traditional probe-based PCR utilizes probe sequences that are complementary to the mutation sequence. However, they are ineffective for the detection of these elusive high prevalence variants. The mutant probe would correctly bind to the mutant sequence, but it would also incorrectly bind to a true wild-type sequence (FIG. 2D) . This is because the mutation is a duplication insertion that mimics the wild-type sequence. The EGFR Exon 20 Insertion Multiple Variants design uses two wild-type probes that will correctly bind to a wild-type sequence, but one of the wild-type probes will also incorrectly bind to the duplication insertion sequence. This is because the mutation is a duplication insertion that mimics the wild-type sequence. Furthermore, the successful detection of insertions using this design is completely dependent on the displacement of a wild-type probe to confer a single signal. As expected, the results showed that since the probe was non-specific in this situation, the insertion duplications were masked within the wild-type cluster of a 2-D plot analysis, as seen in FIGS. 2E-2G.

The challenge stems from the inability to use a wild-type specific probe as seen in the EGFR Exon 19 Deletions Assay and the inability to use a mutant specific probe as seen in the EGFR Exon 21 L858R Point Mutations Assay. In order to successfully detect and differentiate the elusive variants from true wild-type DNA, a unique probe must be designed; a probe that contains half the wild-type sequence and half the mutant DNA sequence. This probe must bind only when the mutant is present, and will allow for the detection of a unique DNA sequence that is present only when there is an elusive variant insertion. The VIC- labelled wild-type reference probe will bind downstream regardless of mutational status (FIG. 2H) . FIG. 2I shows the sequences of the EGFR exon 20 high prevalence assay FAM-labelled probes. Results showed that these unique probe sequences were able to bind specifically to the mutant samples and not to the wild-type sample (FIGS. 2J-2N) .

EXAMPLE 3 –EGFR EXON 19 DELETION

The droplet digital PCR assay for the detection of EGFR exon 19 deletions uses a pair of primers and two hydrolysis probes (e.g., 1 FAM and 1 VIC) . The FAM probe is specific to the wild-type sequence of the EGFR exon 19 deletion and anneals to the anti-sense strand. If a deletion were to occur, the FAM probe would be unable to anneal and thus no fluorescent signal would be observed. The other VIC probe anneals to a downstream region on the sense strand, acting as a reference signal regardless of mutational status (FIG. 3A) . If the DNA molecule is: a) wild-type: both FAM probe and VIC probe will anneal; or b) mutant: only VIC probe will anneal (FIG. 3B) .

EXAMPLE 4 –EGFR EXON 21 L858R POINT MUTATION (S)

The droplet digital PCR assay for the detection of EGFR exon 21 L858R point mutation (s) uses a pair of primers and three hydrolysis probes (e.g., 2 FAM and 1 VIC) . One VIC probe is specific to the wild-type sequence of EGFR exon 21 L858R. The two FAM probes are specific to the variants of the EGFR exon 21 L858R mutation (FIG. 4A) . If the DNA molecule is: a) wild-type: only VIC probe will anneal; or b) mutant: only FAM probe (s) will anneal.

REFERENCES

1. Yan H, Zhu GY, Wong M, Lee V 2019. Computational platform for modelling, analysis and prediction of anti-EGFR drug resistance for lung cancer. Hong Kong Med J. 25 (6) : 40-42.

2. Torre L, Siegel R, Ward E, Jemal A 2016. Global Cancer Incidence and Mortality Rates and Trends –An Update. Cancer Epidemiol Biomarkers. 25 (1) : 16-22.

3. Rodriguez-Canales J, Parra-Cuentas E, Wistuba I 2016. Diagnosis and Molecular Classification of Lung Cancer. 170: 25-46.

4. Kim K, Dunn C, Park K 2019. Recent progress in mapping the emerging landscape of the small-cell lung cancer genome. Experimental &Molecular Medicine. 51: 157

5. Yasuda H, Kobayashi S, Costa D 2012. EGFR exon 20 insertion mutations in non-small-cell lung cancer: preclinical data and clinical applications. Lancel Oncol. 13: 23-31.

6. Wee P, Wang Z 2017. Epidermal Growth Factor Receptor Cell Proliferation Signaling Pathways. Cancers. 9 (52) .

7. Vincent, Kuruvilla, Leighl N. B., Kamel-Reid S 2012. Biomarkers that currently affect clinical practice: EGFR, ALK, MET, KRAS. Current Oncology. 19 (1) .

8. Castellanos E, Feld E, Horn L 2016. Driven by Mutations: The Predictive Value of Mutation Subtype in EGFR-Mutated Non-Small Cell Lung Cancer. Journal of Thoracic Oncology. 12 (4) : 612-623.

9. Robichaux JP, Elamin YY, Tan Z, Carter BW, Zhang S et al. 2018. Mechanisms and clinical activity of an EGFR and HER2 exon 20-selective kinase inhibitor in non-small cell lung cancer. Nat Med. 24 (5) : 638-646.

10. Duma N, Santana-Davila R, Molina JR 2019. Non-Small Cell Lung Cancer: Epidemiology, Screening, Diagnosis and Treatment. Mayo Clin Proc. 94 (8) : 1623-1640.

11. Qin Y, Jian H, Tong X, Wu X, Wang F et al. 2020. Variability of EGFR exon 20 insertions in 24468 Chinese lung cancer patients and their divergent responses to EGFR inhibitors. Molecular Oncology. 14: 1695-1704.

12. Yung T, Chan A, Mok T, Tong J, To K et al. 2009. Single-Molecular Detection of Epidermal Growth Factor Receptor Mutations in Plasma by Microfluidics Digital PCR in Non-Small Cell Lung Cancer Patients. Clin Cancer Res. 15 (6) : 2076-2084.

13. Vyse S, Huang P 2019. Targeting EGFR exon 20 insertion mutations in non-small cell lung cancer. Signal Transduction and Targeted Therapy. 4: 5.

Claims

A method for detecting in a sample a mutant polynucleotide comprising an insertion mutation, the method comprising:

contacting the sample with a first probe and a second probe, wherein the first probe anneals to a sequence comprising a first wild-type portion of the mutant polynucleotide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a second wild-type portion of the mutant polypeptide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophore are different;

incubating the sample for a time sufficient for the first probe and the second probe to anneal to the mutant polynucleotide;

performing polymerase chain reaction (PCR) to allow the cleavage of the first fluorophore, the first quencher, the second fluorophore, and the second quencher; and

detecting fluorescence emission signal from the first fluorophore and/or the second fluorophore,

wherein the presence of only one fluorescence emission signal from the first or second fluorophore indicates the presence of the insertion mutation.
The method of claim 1, wherein the first probe and the second probe anneal to first and second wild-type portions of the mutant polynucleotide that have at least one basepair overlap.
The method of claim 1 or 2, wherein the mutant polynucleotide encodes an epidermal growth factor receptor (EGFR) or a portion thereof.
The method of claim 3, wherein the insertion mutation is in EGFR exon 20.
The method of claim 4, wherein the insertion mutation is S768_V769delinsIL, D770>GY, or D770_N771insG.
The method of any one of claims 1 to 5, wherein the first probe comprises a sequence having at least 90%identity to the sequence of GGCCATCACGTAGGCTTC (SEQ ID NO: 1) , and the second probe comprises a sequence having at least 90%identity to the sequence of CAGCGTGGACAACCCCCACGTG (SEQ ID NO: 2) .
The method of claim 6, wherein the first probe comprises the sequence of GGCCATCACGTAGGCTTC (SEQ ID NO: 1) , and the second probe comprises the sequence of CAGCGTGGACAACCCCCACGTG (SEQ ID NO: 2) .
A method for detecting in a sample a mutant polynucleotide comprising an insertion mutation, the method comprising:

contacting the sample with a first probe and a second probe, wherein the first probe anneals to a sequence comprising a portion of the insertion mutation and a wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher, wherein the second probe anneals to a sequence comprising a wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and wherein the first fluorophore and second fluorophores are different;

incubating the sample for a time sufficient for the first probe and the second probe to anneal to the mutant polynucleotide;

performing polymerase chain reaction (PCR) to allow the cleavage of the first fluorophore, the first quencher, the second fluorophore, and the second quencher; and

detecting at least one fluorescence emission signal from the first fluorophore and/or the second fluorophore,

wherein the presence of fluorescence emission signals from both the first fluorophore and the second fluorophore indicates the presence of the insertion mutation.
The method of claim 8, wherein the mutant polynucleotide encodes an epidermal growth factor receptor (EGFR) or a portion thereof.
The method of claim 9, wherein the insertion mutation is in EGFR exon 20.
The method of claim 10, wherein the wild-type portion of the mutant polypeptide binds downstream of the EGFR exon 20 insertion mutation.
The method of claim 10 or 11, wherein the insertion mutation is V769_D770insASV, D770_N771insSVD, or A763_Y764FQEA.
The method of any one of claims 8 to 12, wherein the first probe comprises a sequence having at least 90%identity to the sequence of GCCTGCTGGGCATCTGCCTCACC (SEQ ID NO: 3) and the second probe comprises a sequence having at least 90%identity to the sequence of CGTGGCCAGCGTGGACAACCC (SEQ ID NO: 4) , CCAGCGTGGACAGCGTGGACAAC (SEQ ID NO: 5) , or TCCAGGAAGCCTTCCAGGAAGCCTACGT (SEQ ID NO: 6) .
The method of claim 13, wherein the first probe comprises the sequence of GCCTGCTGGGCATCTGCCTCACC (SEQ ID NO: 3) and the second probe comprises the sequence of CGTGGCCAGCGTGGACAACCC (SEQ ID NO: 4) , CCAGCGTGGACAGCGTGGACAAC (SEQ ID NO: 5) , or TCCAGGAAGCCTTCCAGGAAGCCTACGT (SEQ ID NO: 6) .
The method of any one of claims 1 to 14, prior to the first step of contacting the sample with the first probe and the second probe, the method comprises contacting the sample with a forward primer and a reverse primer.
The method of claim 15, wherein the forward primer comprises a sequence having at least 90%identity to the sequence of GCCACCATGCGAAGCCACACTGA (SEQ ID NO: 7) and the reverse primer comprises a sequence having at least 90%identity to the sequence of TGCGTGATGAGCTGCACGGTG (SEQ ID NO: 8) .
The method of any one of claims 1 to 16, wherein the cleavage is performed by a DNA polymerase.
The method of any one of claims 1 to 17, wherein the first fluorophore is fluorescein or Alexa Fluor 488.
The method of any one of claims 1 to 18, wherein the second fluorophore is VIC, Alexa Fluor 546, Alexa Fluor 647, Cy5, or DY-647.
The method of any one of claims 1 to 19, wherein the first fluorophore is fluorescein and the second fluorophore is VIC.
The method of any one of claims 1 to 20, wherein the sample is a biological sample.
The method of claim 21, wherein the biological sample is selected from the group consisting of pleural fluid, whole blood, urine, a fecal specimen, plasma, and serum.
The method of claim 22, wherein the biological sample is pleural fluid.
A kit for detecting an insertion mutation in a mutant polynucleotide in a sample, comprising a first probe and a second probe,

wherein the first probe anneals to a sequence comprising a first wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher,

wherein the second probe anneals to a sequence comprising a second wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and

wherein the first fluorophore and second fluorophores are different.
A kit for detecting an insertion mutation in a mutant polynucleotide in a sample, comprising a first probe and a second probe,

wherein the first probe anneals to a sequence comprising a sequence comprising a portion of the insertion mutation and a wild-type portion of the mutant polypeptide and is labeled with a first fluorophore and a first quencher,

wherein the second probe anneals to a sequence comprising a wild-type portion of the mutant polynucleotide and is labeled with a second fluorophore and a second quencher, and

wherein the first fluorophore and second fluorophores are different.
The kit of claim 25, wherein the mutant polynucleotide encodes an epidermal growth factor receptor (EGFR) or a portion thereof.
The kit of claim 26, wherein the insertion mutation is in EGFR exon 20.
The kit of claim 27, wherein the wild-type portion binds downstream of the EGFR exon 20 insertion mutation.
The kit of any one of claims 24 to 28, further comprising a polymerase, deoxynucleotide triphosphates (dNTPs) , and buffers.