CN115612725A

CN115612725A - Composition and kit for detecting sickle cell anemia and application of composition and kit

Info

Publication number: CN115612725A
Application number: CN202110795542.2A
Authority: CN
Inventors: 宋立洁; 王晓丹; 范林林; 孙隽; 彭智宇
Original assignee: Huada Biotechnology Wuhan Co ltd; Tianjin Medical Laboratory Bgi; BGI Shenzhen Co Ltd
Current assignee: Huada Biotechnology Wuhan Co ltd; Tianjin Medical Laboratory Bgi; BGI Shenzhen Co Ltd
Priority date: 2021-07-14
Filing date: 2021-07-14
Publication date: 2023-01-17

Abstract

The invention provides a composition, a kit and application for detecting sickle cell anemia, wherein the composition comprises a probe set, the probe set comprises a 1 st group of probes, the 1 st group of probes comprises a first probe, a second probe and a third probe, and the first probe comprises: 5 'CAGACTTCTCCTCAGGAG-doped 3' (SEQ ID NO: 1), or a sequence similar to SEQ ID NO:1, a nucleic acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity; the second probe includes: 5 'CAGACTTCCACACAGAG-3' (SEQ ID NO: 2), or a sequence similar to SEQ ID NO:2, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to the nucleic acid sequence set forth in seq id no; the third probe includes: 5 'CAGACTTCCTTAGGAG-doped 3' (SEQ ID NO: 3), or a sequence similar to SEQ ID NO:3, is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical.

Description

Composition and kit for detecting sickle cell anemia and application of composition and kit

Technical Field

The invention relates to the technical field of biology, in particular to a composition, a kit and an application for detecting sickle cell anemia, and more particularly relates to a probe set, a composition, a kit, an application of a reagent containing the probe set or the composition in preparation of the kit, a method for detecting sickle cell anemia and a method for detecting sickle cell anemia related gene mutation type.

Background

Sickle cell anemia, also known as sickle cell anemia (SCD), is an autosomal recessive hereditary hemoglobinopathy, and clinically manifests as chronic hemolytic anemia, susceptibility to infection and recurrent pain crisis causing chronic ischemia and thus causing organ and tissue damage. The molecular definition of SCD, includes a group of diseases characterized by the presence of at least one hemoglobin S (HbS) allele, and a second pathogenic variant of the HBB gene, resulting in abnormal hemoglobin polymerization. The following mutations in the HBB gene are common in sickle cell anemia, as shown in table 1:

table 1:

according to literature reports, about 30 million sick infants are born each year around the world, and about 500 million carriers are born, mainly concentrated in african, indian, and african american populations. In many parts of africa, the prevalence of the sickle cell trait of HbS, hbC, hbD and HbO is as high as 25% -35%, and it is estimated that 1500 thousands of africans are affected by SCD, which accounts for 16% of deaths in children younger than five years of age in west africa. Sickle cell disease is the most common inherited hematological disorder in the united states, with SCD occurring in approximately every 300-500 african americans born in the united states; every 1000 to 1400 hispanic americans had SCD.

Screening and detecting the mutation type of the SCD are the best means for carrying out birth defect prevention and control and early and effective treatment on diseases. The main pathogenic mutations of SCD comprise HbS mutant type (A20T), hbC mutant type (G19A), hbD mutant type (G364C) and HbO mutant type (G364A), and the 4 mutation sites can be detected to achieve the purposes of effective screening and molecular detection.

At present, the detection and screening of SCD are mainly based on technologies such as isoelectric focusing electrophoresis (IEF), high Performance Liquid Chromatography (HPLC), immunochromatography determination and the like, and protein characteristics are detected and analyzed, and these detection methods have the disadvantages of poor specificity, expensive equipment, complex operation, incapability of realizing accurate molecular typing, easiness in being influenced by subjective judgment of detection personnel, and the like, so that the methods are not suitable for clinical application and popularization.

The technology for detecting nucleic acid molecules of single-gene genetic diseases mainly comprises Sanger sequencing, high-throughput sequencing, chip hybridization and other technologies, and the detection methods have the defects of low throughput, high cost, complicated operation steps, long period and the like, and are not suitable for clinical application and popularization in underdeveloped areas.

Therefore, there is still a need for further development and improvement of methods for screening and detecting the causative mutation of SCD.

Disclosure of Invention

The present application is based on the discovery and recognition by the inventors of the following problems:

RT-qPCR based on Taqman probe is a mature and simple-and-convenient fluorescent probe technology, and can realize the detection of nucleic acid gene mutation based on the technology, but at present, no mature product or service is applied to SCD detection. Therefore, if a method and a product for rapidly and accurately screening and detecting the SCD pathogenic mutation can be developed based on the RT-qPCR of the Taqman probe, the method and the product have important significance for the birth defect prevention and control and the early and effective treatment of diseases.

In a first aspect of the invention, the invention provides a probe set for detecting sickle cell anemia. According to an embodiment of the present invention, the probe set includes a 1 st group of probes and a2 nd group of probes, the 1 st group of probes further includes a first probe, a second probe and a third probe, and the 2 nd group of probes further includes a fourth probe, a fifth probe and a sixth probe.

According to an embodiment of the present invention, the probe set may further comprise at least one of the following additional technical features:

according to an embodiment of the invention, the first probe nucleic acid sequence comprises: 5 'CAGACTTCTCCTCAGGAG-doped 3' (SEQ ID NO: 1), or a sequence similar to SEQ ID NO:1, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical; the second probe nucleic acid sequence comprises: 5 'CAGACTTCCACACAGAG-3' (SEQ ID NO: 2), or a sequence similar to SEQ ID NO:2, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical; the third probe nucleic acid sequence comprises: 5 'CAGACTTCCTTAGGAG-doped 3' (SEQ ID NO: 3), or a sequence similar to SEQ ID NO:3, has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity. According to the embodiment of the invention, the first, second and third probe nucleic acid sequences in the probe group needle detect the 20 th site and the 19 th site of the HBB genome sequence (the sequence positions of the HBB genome in the text are all referred to as NG-059281.1 sequence). The probe set can be specifically used for detecting HbA wild type and HbS (A20T) and HbC (G19A) mutant sequences, wherein the first probe is used for detecting the HbA wild type; the second probe is directed to the HbS mutant, and the base of the mutant at the 20 site of the genome is changed from A to T (A20T); the third probe is directed at HbC mutant type, and the third probe sequence can specifically recognize a genome sequence (G19A) after the base at the 19 site is mutated from G to A.

According to an embodiment of the invention, the fourth probe nucleic acid sequence comprises: 5-: 4, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical; the fifth probe nucleic acid sequence comprises: 5 '(CTGGTGAATTGTTTTGC) -3' (SEQ ID NO: 5) or a sequence similar to SEQ ID NO:5, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical; the sixth probe nucleic acid sequence comprises: 5-: 6, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to the nucleic acid sequence shown in figure 6. According to the embodiment of the invention, the fourth, fifth and sixth probe nucleic acid sequences in the probe set are detected aiming at the 364 th site of HBB genome sequence. The pair of probe sets is specifically detected for HbA wild type and HbD (G364C) and HbO (G364A) mutant, wherein the fourth probe is for HbA wild type; the fifth probe is directed at the HbD mutant type, and can specifically recognize a genome sequence (G364C) after the base of the 364 th site is mutated from G to C; the sixth probe is directed at HbO mutant type, and the sixth probe sequence can specifically recognize a genome sequence (G364A) after the base of the 364 th site is mutated from G to A.

In a second aspect of the invention, a composition is provided. According to an embodiment of the invention, the composition comprises a set of probes according to the first aspect. The composition provided by the embodiment of the invention can be used for detecting HBB genome sequence 20 th site, HBB genome sequence 19 th site or HBB genome sequence 364 th site.

According to an embodiment of the present invention, the above composition may further comprise at least one of the following additional technical features:

according to an embodiment of the present invention, the above composition further comprises: the nucleic acid sequences of the first pair of primers and the second pair of primers are shown as follows: the first pair of primer upstream sequences: 5 '(SEQ ID NO: 7) GTTTCTATTGGTCTCCTTAAACCTGT-3'; the downstream sequences of the first pair of primers: 5 'GGCAGAGCCATCTATGCTTA-3' (SEQ ID NO: 8); the upstream sequence of the second primer pair: 5 'AAAGGAACCTTAATAGAAATTGGACA-3' (SEQ ID NO: 9); the downstream sequences of the second pair of primers: 5' and 5' of TGCTAATCATGTTCATCCTTATCTTATCTT-3 ' (SEQ ID NO: 10). According to the embodiment of the invention, the first pair of primers can be used for specifically amplifying the 19 th site, the 20 th site and the upstream and downstream nucleic acid sequences of the HBB genome, and the second pair of primers can be used for specifically amplifying the 364 th site and the upstream and downstream nucleic acid sequences of the HBB genome. The first pair of primers can be matched with the first group of probes to specifically detect whether a sample to be detected contains HbA wild type, hbS mutant type and HbC mutant type sequences, and the second pair of primers can be matched with the second group of probes to specifically detect whether the sample to be detected contains the HbA wild type, hbD mutant type and HbO mutant type gene sequences. By using the probe and the primer, the gene mutation site and the mutation type of the SCD can be simply, efficiently and accurately detected by using an RT-qPCR technology.

According to the embodiment of the present invention, the composition further comprises a third pair of primers and a seventh probe, the nucleic acid sequences of which are shown as follows: the upstream sequences of the third pair of primers: 5 'TTCCCTCCAGATCTACCTCCTTA-doped 3' (SEQ ID NO: 11); the downstream sequences of the third pair of primers are as follows: 5 '-GCCGACCAACCTAATG' (SEQ ID NO: 12); a seventh probe: 5 '-AAGAGATCCTCCAGAGTGTTCCTGG' (SEQ ID NO: 13). According to the embodiment of the invention, the third pair of primers is an internal reference gene primer for SCD detection, and the seventh probe is an internal reference gene probe.

In a third aspect of the invention, the invention provides the use of a reagent for preparing a kit for detecting a mutation site of an SCD-related HBB gene, the reagent comprising the probe set provided in the first aspect of the invention or the composition provided in the second aspect of the invention. According to the reagent provided by the embodiment of the invention, the kit for efficiently and accurately detecting the SCD related mutant gene can be prepared, and the prepared kit can efficiently and accurately detect whether the sample to be detected contains the SCD related mutant gene locus or not by using an RT-qPCR method.

In a fourth aspect, the present invention provides the use of a reagent comprising a set of probes as set forth in the first aspect or a composition as set forth in the second aspect of the present invention in the preparation of a kit useful for SCD detection. According to the reagent provided by the embodiment of the invention, the kit for efficiently and accurately detecting the SCD can be prepared, the prepared kit can efficiently and accurately utilize an RT-qPCR method to effectively distinguish HbA wild type, hbS mutant type, hbC mutant type, hbD mutant type and HbO mutant type in a sample to be detected, and accurately judge whether the SCD suffered by a patient is homozygous mutation or heterozygous mutation.

In a fifth aspect of the invention, the invention provides a method for detecting an SCD-related mutation. According to an embodiment of the present invention, the method comprises performing RT-qPCR detection on a sample to be tested using the probe set proposed in the first aspect of the present invention or the composition proposed in the second aspect of the present invention, wherein the probes in the probe set further carry a fluorophore; based on the RT-qPCR fluorescent signal, whether the SCD related mutation is contained in the sample to be tested can be determined. The method according to the embodiment of the present invention can be used for diagnosing SCD, or for non-diagnostic purposes, such as scientific research, to confirm whether the sample to be tested contains SCD-related mutations, and if the sample to be tested contains SCD-related mutations, the signal transduction mechanism of SCD-related mutations can be further researched by using the sample to be tested.

According to an embodiment of the invention, the detection of the fluorescent signal is indicative of the presence of an SCD-related mutation in the sample to be tested. The two ends of the probe are respectively provided with a fluorescent group and a quenching group, the fluorescent group and the quenching group are close to each other, so that the fluorescence emitted by the fluorescent group cannot be detected, when the 20 site of the genome nucleic acid to be detected is T, the second probe sequence can be complementarily paired with the genome nucleic acid to be detected, when the first pair of primers is synthesized and amplified by taking the genome nucleic acid to be detected as a template, the second probe sequence is amplified to the position of the second probe sequence, the second probe sequence is hydrolyzed, the fluorescent group and the quenching group are released, at the moment, the fluorescent group and the quenching group are far away from each other, the signal of the fluorescent group is captured, and a specific fluorescent signal is detected, so that the existence of the HbS mutation (A20T) in the SCD related mutation in the sample to be detected is indicated; when 19 sites of the genome nucleic acid to be detected are A, the third probe sequence can be subjected to complementary pairing with the genome nucleic acid to be detected, when the first pair of primers is subjected to synthesis amplification by using the genome nucleic acid to be detected as a template, the third probe sequence is amplified to the third probe sequence position, the third probe sequence is hydrolyzed, a fluorescent group and a quenching group are released, the fluorescent group is far away from the quenching group, a signal of the fluorescent group is captured, and a specific fluorescent signal is detected, so that the existence of the mutation of HbC (G19A) in SCD related mutation in the sample to be detected is indicated; when 364 th site of the genome nucleic acid to be detected is C, the sequence of the fifth probe can be subjected to complementary pairing with the genome nucleic acid to be detected, when the second pair of primers is subjected to synthesis amplification by using the genome nucleic acid to be detected as a template, the second pair of primers is amplified to the sequence position of the fifth probe, so that the sequence of the fifth probe is hydrolyzed, a fluorescent group and a quenching group are released, the distance between the fluorescent group and the quenching group is very long, a signal of the fluorescent group is captured, and a specific fluorescent signal is detected, so that the existence of HbSCD mutation (G364C) in HbSCD related mutation in the sample to be detected is indicated; and when the 364 site of the genome nucleic acid to be detected is A, the sixth probe can be subjected to complementary pairing with the genome nucleic acid to be detected, when the second pair of primers is subjected to synthesis amplification by using the genome nucleic acid to be detected as a template, the sequence of the sixth probe is amplified to the sequence position of the sixth probe, so that the sequence of the sixth probe is hydrolyzed, a fluorescent group and a quenching group are released, the distance between the fluorescent group and the quenching group is very long, the signal of the fluorescent group is captured, and a specific fluorescent signal is detected, so that the existence of the mutation (G364A) of SCD related mutations in the sample to be detected is indicated.

According to the embodiment of the present invention, the kind of the fluorophore is not particularly limited as long as the fluorophore can be used for RT-qPCR. For example, the fluorophore can include at least one selected from the group consisting of: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE.

In a sixth aspect of the present invention, the present invention provides a method for detecting an SCD-related gene mutation type. According to an embodiment of the invention, the method comprises: detecting a sample to be detected by using the probe set provided by the first aspect or the composition provided by the second aspect of the present invention, wherein the probe in the probe set or the composition further carries a fluorophore, the first probe sequence carries a first fluorophore, the second probe sequence carries a second fluorophore, the third probe sequence carries a third fluorophore, the fourth probe sequence carries a fourth fluorophore, the fifth probe sequence carries a fifth fluorophore, and the sixth probe sequence carries a sixth fluorophore; the Ct values of the first fluorophore, the second fluorophore, the third fluorophore, the fourth fluorophore, the fifth fluorophore and the sixth fluorophore channel are respectively and independently detected; and obtaining and determining the mutant of the SCD related gene according to the Ct value. The probe set specifically detects for HbA wild-type and HbS (A20T), hbC (G19A), hbD (G364C), and HbO (G364A) mutant, wherein a first probe is for HbA wild-type; the second probe is directed at HbS mutant, and the base of the mutant at the 20 site of the genome is mutated from A to T (A20T); the third probe is used for the HbC mutant type, and can specifically recognize a genome (G19A) after the mutation of the base at the 19 site from G to A; the fourth probe is directed against the HbA wild type; the fifth probe is directed at the HbD mutant type, and can specifically recognize the genome (G364C) after the base of the 364 th site is mutated from G to C; the sixth probe is directed to the HbO mutant, and the genome (G364A) in which the base at the 364 th site is mutated from G to A can be specifically recognized by using the sixth probe.

According to an embodiment of the present invention, the method may further include at least one of the following additional technical features:

according to an embodiment of the present invention, the first, second, third, fourth, fifth and sixth fluorophores are each independently selected from at least one of the following: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE; wherein the first, second and third fluorophores are different in the same reaction system; the fourth, fifth and sixth fluorescent groups in the same reaction system are different. According to an embodiment of the present invention, the type of the fluorophore is not particularly limited, and all fluorophores that can be used for RT-qPCR can be used. The quencher used was MGB, and any quencher that can be used in RT-qPCR can be used.

According to the embodiment of the invention, the first fluorescent group, the second fluorescent group and the third fluorescent group in the reaction system 1 have different fluorescent groups, so that detection of HbA wild type, hbS mutant type, hbC mutant type and reference gene ACTB can be completed in a single reaction hole; the fourth, fifth and sixth fluorophores in the reaction system 2 are different in fluorophore, so that the detection of the wild type HbA, the mutant HbD, the mutant HbO and the ACTB can be completed in a single hole at the same time.

According to the embodiment of the invention, the Ct value of the first fluorophore channel is not more than 37, the Ct value of the second fluorophore channel is more than 37 or NoCT, and the Ct value of the third fluorophore channel is more than 37 or NoCT, which is an indication that the sample to be detected contains the HbA wild type, no HbS mutant type and no HbC mutant type.

According to the embodiment of the invention, the Ct value of the fourth fluorophore channel is not more than 37, the Ct value of the fifth fluorophore channel is more than 37 or NoCT, and the sixth fluorophore channel is more than 37 or NoCT, which indicates that the sample to be detected contains HbA wild type, no HbO mutant type and no HbD mutant type.

According to the embodiment of the invention, the Ct value of the first fluorophore channel is not more than 37, the second fluorophore channel is not more than 37, and the third fluorophore channel is more than 37 or NoCT, which is an indication that the sample to be tested contains HbS hybrid mutant and does not contain HbC mutant.

According to an embodiment of the present invention, the Ct value of the first fluorophore channel is greater than 37 or NoCT, the second fluorophore channel is not greater than 37, and the third fluorophore channel is greater than 37 or NoCT, which is an indication that the sample to be tested contains HbS homozygous mutant and no HbC mutant.

According to the embodiment of the invention, the Ct value of the first fluorophore channel is not more than 37, the second fluorophore channel is more than 37 or NoCT, and the third fluorophore channel is not more than 37, which indicates that the sample to be tested does not contain HbS mutant and contains HbC hybrid mutant.

According to an embodiment of the present invention, the Ct value of the first fluorophore channel is greater than 37 or NoCT, the second fluorophore channel is greater than 37 or NoCT, and the third fluorophore channel is not greater than 37, which is an indication that the sample to be tested does not contain HbS mutant and contains HbC homozygous mutant.

According to an embodiment of the present invention, the Ct value of the first fluorophore channel is greater than 37 or NoCT, the second fluorophore channel is not greater than 37, and the third fluorophore channel is not greater than 37, which indicates that the sample to be tested contains HbS hybrid mutant and HbC hybrid mutant.

According to the embodiment of the invention, the Ct value of the fourth fluorophore channel is not more than 37, the fifth fluorophore channel is more than 37 or NoCT, and the sixth fluorophore channel is not more than 37, which is an indication that the sample to be tested contains HbO hybrid mutant and does not contain HbD mutant.

According to the embodiment of the invention, the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the fifth fluorophore channel is greater than 37 or NoCT, and the sixth fluorophore channel is not greater than 37, and the sample to be tested contains the HbO homozygous mutant and does not contain the HbD mutant.

According to an embodiment of the present invention, the Ct value of the fourth fluorophore channel is not greater than 37, the fifth fluorophore channel is not greater than 37, and the sixth fluorophore channel is greater than 37 or NoCT, which indicates that there is no HbO mutant and there is a HbD hybrid mutant in the sample to be tested.

According to an embodiment of the present invention, the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the fifth fluorophore channel is not greater than 37, and the sixth fluorophore channel is greater than 37 or NoCT, which is an indication that the sample to be tested does not contain HbO mutant and contains HbD homozygous mutant.

According to the embodiment of the invention, the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the fifth fluorophore channel is not greater than 37, and the sixth fluorophore channel is not greater than 37, which are an indication of the HbO-containing hybrid mutant and the HbD-containing hybrid mutant in the sample to be tested.

According to the embodiment of the invention, the method is used for detecting the sample to be detected, SCD mutation detection can be efficiently and accurately carried out based on Ct value information of RT-qPCR, and whether the SCD mutation is homozygous mutation or heterozygous mutation can be accurately judged.

In a seventh aspect of the invention, the invention provides a kit for SCD mutation detection. According to an embodiment of the invention, the kit comprises a set of probes as set forth in the first or second aspect of the invention or a composition as set forth in the third aspect. The kit prepared according to the embodiment of the invention can detect whether the sample to be detected contains SCD related mutation, efficiently and accurately detect gene mutation sites, and judge whether the SCD mutation is homozygous mutation or heterozygous mutation.

According to the specific embodiment of the invention, the kit can further comprise reagents such as enzyme, buffer solution, dNTPs and the like required by RT-qPCR.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a graph of RT-qPCR amplification of a sample positive for a known HbS (HBB: A20T; het) mutation using system 1-Group 1 according to an embodiment of the present invention, wherein Het represents a heterozygous mutation and Hom represents a homozygous mutation;

FIG. 2 is a graph of RT-qPCR amplification of a sample positive for a known HbC (HBB: G19A; het) mutation using system 1-Group 1 according to an embodiment of the present invention, wherein Het represents a heterozygous mutation and Hom represents a homozygous mutation;

FIG. 3 is a graph of RT-qPCR amplification of samples positive for known HbS (HBB: A20T; het) mutations for System 1-Group Final detection according to an embodiment of the present invention, wherein Het represents a heterozygous mutation and Hom represents a homozygous mutation;

FIG. 4 is a graph of RT-qPCR amplification of a sample positive for a known HbD (HBB: G364C; het) mutation by system 2-Group 1 according to an embodiment of the present invention, wherein Het represents a heterozygous mutation and Hom represents a homozygous mutation;

FIG. 5 is a graph of RT-qPCR amplification of a sample positive for a known HbO (HBB: G364A; het) mutation by system 2-Group 1 according to an embodiment of the present invention, wherein Het represents a heterozygous mutation and Hom represents a homozygous mutation;

FIG. 6 is a graph showing RT-qPCR amplification of a sample positive for a known HbD (HBB: G364C; het) mutation in system 2-Group Final according to an embodiment of the present invention, wherein Het represents a heterozygous mutation, and Hom represents a homozygous mutation;

FIG. 7 is a graph of RT-qPCR amplification of known SCD negative samples using the system 1-Group Final primer probe combination and the system 2-Group Final primer probe combination, other components in the kit, optimized reaction system and optimized reaction program according to the present invention;

FIG. 8 is a graph of RT-qPCR amplification of a sample with known HbS heterozygous mutation and HbC heterozygous mutation detected by the system 1-Group Final primer probe combination and the system 2-Group Final primer probe combination, other components in the kit, the optimized reaction system and the optimized reaction program according to the embodiment of the invention;

FIG. 9 is a graph of RT-qPCR amplification of known HbS homozygous mutant samples according to the system 1-Group Final primer probe combination and the system 2-Group Final primer probe combination, other components in the kit, the optimized reaction system and the optimized reaction program of the embodiment of the present invention;

FIG. 10 is a graph of RT-qPCR amplification curves for detecting known HbD heterozygous mutation samples according to the system 1-Group Final primer probe combination and the system 2-Group Final primer probe combination, other components in the kit, the optimized reaction system and the optimized reaction program in the embodiment of the invention; and

FIG. 11 is a graph of RT-qPCR amplification curves for detecting known HbO heterozygous mutation samples according to the system 1-Group Final primer probe combination and the system 2-Group Final primer probe combination, other components in the kit, the optimized reaction system and the optimized reaction program of the embodiment of the invention.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.

Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of the feature. In the description of the present invention, "a plurality" means at least two, e.g., two, three, etc., unless explicitly specified otherwise.

It is noted that, in the present context, the terms "sickle cell anemia", "sickle cell anemia" and "SCD" refer to an autosomal recessive genetic hemoglobinopathy which is clinically manifested by chronic hemolytic anemia, a risk of susceptibility to infection and recurrent pain causing chronic ischemia, resulting in organ tissue damage.

It is noted that, herein, the terms "HbS mutant (a 20T), hbC mutant (G19A), hbD mutant (G364C), hbO mutant (G364A)" refer to Genebank accession numbers: the 20 th base of the HBB genome sequence of NG-059281.1 is mutated from A to T, resulting in the mutation of hemoglobin S; genebank accession numbers are: the 19 th base of the HBB genome sequence of NG-059281.1 is mutated from G to A, resulting in the mutation of hemoglobin C; genebank accession numbers are: the 364 th base of the HBB genomic sequence of NG-059281.1 is mutated from G to C, resulting in a hemoglobin D mutation; genebank accession numbers are: the 364 th base of the HBB genome sequence of NG-059281.1 is mutated from G to A, resulting in a hemoglobin O mutation.

In a first aspect of the invention, the invention proposes a probe set for the detection of SCD-type. According to an embodiment of the invention, a first set of probes is comprised, the nucleic acid sequences of which are as follows: first probe sequence: 5 'CAGACTTCTCCTCAGGAG-doped 3' (SEQ ID NO: 1); a second probe sequence: 5 'CAGACTTCCACACAGAGGA-3' (SEQ ID NO: 2); the third probe sequence: 5 'CAGACTTCCTTAGGAG-doped 3' (SEQ ID NO: 3). The inventors designed and screened the probes, which specifically recognized and bound the mutation sites, based on the mutations A20T and G19A occurring in the HBB gene encoding hemoglobin.

In some embodiments, the 5 'terminus and the 3' terminus of the probe have a fluorescent group and a quencher group modification, respectively. HbA wild-type probe: 5 'CAGACTTCTCCTCAGGAG-3' (SEQ ID NO: 1) the 5 'end of the probe was modified with FAM and the 3' end with MGB; hbS mutant probe: 5 'CAGACTTCTCCACACAGAG-3' (SEQ ID NO: 2) the 5 'end of the probe was modified with ROX and the 3' end was modified with MGB; hbC mutant probe: 5 'CAGACTTCCTTAGGAG-3' (SEQ ID NO: 3) the 5 'end of the probe was modified with HEX and the 3' end with MGB.

In some embodiments, the set of probes is or further comprises a second set of probes having the nucleic acid sequences shown below: fourth probe sequence: 5 'CTGGTGAATTCTTTTGC-3' (SEQ ID NO: 4); a fifth probe sequence: 5 'CTGGTGAATTGTTTTGC-3' (SEQ ID NO: 5); sixth probe sequence: 5 '-CTGGTGAATTTTTTTGC-3' (SEQ ID NO: 6). The inventors designed and screened the probes that specifically recognize and bind to the mutation sites based on the mutations G364C and G364A in the HBB gene encoding hemoglobin.

In some embodiments, the 5 'end and the 3' end of the probe have a fluorescent group and a quencher group modification, respectively. HbA wild-type probe: 5 'CTGGTGAATTCTTTTGC-3' (SEQ ID NO: 4) the 5 'end of the probe was modified with FAM and the 3' end was modified with MGB; hbD mutant probe: 5 'CTGGTGAATTGTTTGTGC-3' (SEQ ID NO: 5) the 5 'end of the probe was modified with HEX and the 3' end was modified with MGB; hbO mutant probe: 5 '-CTGGTGAATTTTTTTGC-3' (SEQ ID NO: 6) the 5 'end of the probe was modified with ROX and the 3' end was modified with MGB.

In some embodiments, the probe set further comprises a first pair of primers and a second pair of primers having the nucleic acid sequences shown below: the first pair of primer upstream sequences: 5 'GTTTCTATTGGTCTCCTTAAACCTGT-3' (SEQ ID NO: 7); the downstream sequences of the first pair of primers: 5 'GGCAGAGCCATCTATTGCTTA-3' (SEQ ID NO: 8); the upstream sequence of the second primer pair: 5 'AAAGGAACCTTAATAGAAATTGGACA-3' (SEQ ID NO: 9); the downstream sequences of the second pair of primers: 5-. Wherein the first pair of primers is C.19/C.20 (i.e. genome g.5248232/g.52482323 site) primer, and the second pair of primers is C.364 (i.e. genome g.5246908 site) primer.

In some embodiments, the probe set further comprises a third pair of primers and a seventh probe having the nucleic acid sequences shown below: the upstream sequences of the third pair of primers: 5-; the downstream sequences of the third pair of primers are as follows: 5 'GCCGACCAACCTAATG-doped 3' (SEQ ID NO: 12); seventh Probe sequence: 5 'AAGAGATCCCTCAGAGTGTTCCTGG-3' (SEQ ID NO: 13). Wherein, the third pair of primers is an internal reference gene primer, the seventh probe is an internal reference gene probe, and both ends of the probe are respectively modified with a fluorescent group and a quenching group. In some embodiments, the seventh probe is modified at the 5 'end with CY5 and at the 3' end with MGB.

In some embodiments, the use of the probe sets described above allows discrimination between SCD (confirmation genome reference sequence number) whether position 20 is HbS mutant, position 19 is HbC mutant, and position 364 is HbD mutant and/or HbO mutant. By detecting the type of the site, the SCD mutation types can be distinguished, the severity of SCD suffered by a patient can be determined, effective treatment can be carried out in time, and birth defects of SCD diseases can be prevented and controlled.

By using the probe group finally screened by the invention, the Ct value of the MGB probe of the corresponding type for detecting the specific target site is small, the detection sensitivity is high, the difference value of the Ct value of the specific template and the Ct value of the non-specific template is large, and the specificity is good. In the comparative example (refer to the probe sets in Group1 in

reaction systems

1 and 2 in examples 1 and 2 of the present invention), the difference between the Ct value of the specific template and the Ct value of the non-specific template detected by the probe is smaller than that of the probe set of the present invention, and the specificity is relatively poor, which may result in erroneous detection result.

In some embodiments, the compositions of the invention are useful for RT-qPCR detection.

In some embodiments, in the probe set, probes of HbA wild type, hbS mutant type, hbC mutant type and internal reference gene ACTB are labeled by different fluorescent reporters, and detection channels of the fluorescent reporters are different, so that the HbA wild type, the HbS mutant type, the HbC mutant type and the internal reference gene ACTB can be simultaneously detected according to different fluorescent channels; the probes of the HbA wild type, the HbD mutant type, the HbO mutant type and the reference gene ACTB are marked by different fluorescent reporter groups, and detection channels of the fluorescent reporter groups are different, so that the HbA wild type, the HbD mutant type, the HbO mutant type and the reference gene ACTB can be simultaneously detected according to different fluorescent channels.

In some embodiments, the composition further comprises: the internal reference gene upstream primer, the internal reference gene downstream primer and the internal reference gene probe for detection are the third pair of primers according to the embodiment of the invention.

In some embodiments, the fluorescent reporter group may be selected from FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3, and JOE, but is not limited thereto.

In a specific embodiment, the fluorescent reporter groups at the 5' end of the probes shown as SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 are FAM, ROX and HEX, respectively; the quenching group marked at the 3' end of the probe is MGB; the fluorescent reporter groups at the 5' end of the probes shown as SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6 are FAM, HEX and ROX respectively; the quenching group marked at the 3' end of the probe is MGB.

In some embodiments, embodiments further include an internal reference gene probe as set forth in SEQ ID NO 13, wherein the fluorescent reporter at the 5' end is CY5; the quenching group marked at the 3' end of the probe is MGB.

In some embodiments, the amount of primer in the composition is 1.6 μ M; the amount of probe in the composition was 1. Mu.M.

In a specific embodiment, the two sets of probe compositions of the combination of the invention are present in separate reaction tubes.

In some embodiments, the ingredients of the compositions of the present invention are present in admixture.

In a further aspect, the present invention provides the use of a reagent for the preparation of a kit for the differentiation of SCD mutation types, said reagent comprising a set of probes as set forth herein.

In a further aspect, the invention provides the use of a reagent in the preparation of a kit for the detection of SCD. The reagent comprises the probe set provided by the invention.

In another aspect, the present invention provides a method for detecting SCD. According to the embodiment of the invention, the probe set provided by the first aspect of the invention is used for carrying out RT-qPCR detection on a sample to be detected, and the probe in the probe set provided by the first aspect of the invention further carries a fluorescent group; the detection of the fluorophore signal carried by either of the sequences of the first set of probes and the second set of probes is indicative of the presence of SCD nucleic acid in the test sample.

In some embodiments, the fluorophore is selected from at least one of the following: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE.

In another aspect, the present invention provides a method for detecting SCD. According to the embodiment of the invention, a sample to be detected is subjected to RT-qPCR detection by using the probe set provided in the first aspect of the invention, and the probe in the probe set provided in the first aspect of the invention further carries a fluorophore, wherein the first probe sequence carries the first fluorophore, the second probe sequence carries the second fluorophore, the third probe sequence carries the third fluorophore, the fourth probe sequence carries the fourth fluorophore, the fifth probe sequence carries the fifth fluorophore, and the sixth probe sequence carries the sixth fluorophore; the Ct values of the first fluorophore, the second fluorophore, the third fluorophore, the fourth fluorophore, the fifth fluorophore and the sixth fluorophore channel are respectively and independently detected; and determining the mutant type of the SCD related gene according to the Ct value.

Further, when the Ct value of the first fluorophore channel is not greater than 37, the Ct value of the second fluorophore channel is greater than 37 or NoCT, and the Ct value of the third fluorophore channel is greater than 37 or NoCT, which is an indication that the sample to be tested contains a wild type HbA, no mutant HbS, and no mutant HbC; the Ct value of the fourth fluorophore channel is not more than 37, the Ct value of the fifth fluorophore channel is more than 37 or NoCT, and when the sixth fluorophore channel is more than 37 or NoCT, the sixth fluorophore channel is an indication that the sample to be detected contains a HbA wild type, does not contain a HbO mutant type, and does not contain a HbD mutant type.

In some embodiments, the first fluorophore and the second fluorophore are each independently selected from at least one of: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE.

In some embodiments, the method comprises the steps of:

1) Extracting nucleic acid of a sample to be detected;

2) Performing RT-qPCR amplification on the nucleic acid obtained in the step 1) by using the probe group of the invention as described above;

3) And analyzing the result of the amplification curve.

In the present invention, the type of the sample for detection may be blood, tissue, cell, etc., but is not limited thereto.

Further, the reaction conditions of the RT-qPCR are as follows:

pre-denaturation of gDNA: the temperature is 95 ℃ and the time is 2-5 min; the first step of amplification: denaturation at 95 ℃ for 15-30 s; annealing at 65 deg.c for 20-50s for 5-10 times; a second amplification step: denaturation at 95 ℃ for 15-30 s; annealing at 60 deg.c for 20-40s and repeating for 40-50 times to collect fluorescent signal. In a specific embodiment, a method for rapid identification of SCD is provided, the specific steps of which are the same as the above described mutation type detection method.

In yet another aspect, the invention provides a method for detecting SCD-related HBB genomic site mutations to A20T and/or G19A and/or G364C and/or G364A. According to the embodiment of the invention, the probe set provided by the first aspect of the invention is used for carrying out RT-qPCR detection on a sample to be detected, and the probe in the probe set provided by the first aspect of the invention further carries a fluorescent group, wherein the first probe sequence carries a first fluorescent group, the second probe sequence carries a second fluorescent group, the third probe sequence carries a third fluorescent group, the fourth probe sequence carries a fourth fluorescent group, the fifth probe sequence carries a fifth fluorescent group, and the sixth probe sequence carries a sixth fluorescent group; the Ct values of a first fluorescent group channel, a second fluorescent group channel, a third fluorescent group channel, a fourth fluorescent group channel, a fifth fluorescent group channel and a sixth fluorescent group channel are respectively and independently detected; and judging whether the site is mutated or not according to the Ct value.

Specifically, when the Ct value of the first fluorophore channel is not greater than 37, the Ct value of the second fluorophore channel is greater than 37 or NoCT, and the Ct value of the third fluorophore channel is greater than 37 or NoCT, it is an indication that the sample to be detected does not contain the HbS mutant and does not contain the HbC mutant; when the Ct value of the first fluorophore channel is not more than 37, the second fluorophore channel is not more than 37, and the third fluorophore channel is more than 37 or NoCT, the sample to be detected contains the HbS hybrid mutant and does not contain the HbC mutant indication; when the Ct value of the first fluorophore channel is greater than 37 or NoCT, the second fluorophore channel is not greater than 37, and the third fluorophore channel is greater than 37 or NoCT, the sample to be detected contains the homozygous mutant type of HbS and does not contain the indication of HbC mutant type; when the Ct value of the first fluorophore channel is not more than 37, the second fluorophore channel is more than 37 or NoCT, and the third fluorophore channel is not more than 37, the result is that the sample to be detected does not contain the HbS mutant type, and the indication of the HbC hybrid mutant type is contained; when the Ct value of the first fluorophore channel is greater than 37 or NoCT, the second fluorophore channel is greater than 37 or NoCT, and the third fluorophore channel is not greater than 37, the indication that the sample to be detected does not contain HbS mutant type and contains HbC homozygous mutant type is provided; when the Ct value of the first fluorophore channel is greater than 37 or NoCT, the Ct value of the second fluorophore channel is not greater than 37, and the Ct value of the third fluorophore channel is not greater than 37, the indication is that the sample to be detected contains the HbS hybrid mutant and the HbC hybrid mutant; when the Ct value of the fourth fluorophore channel is not more than 37, the Ct value of the fifth fluorophore channel is more than 37 or NoCT, and the Ct value of the sixth fluorophore channel is more than 37 or NoCT, the indication that the sample to be detected does not contain the HbO mutant type and does not contain the HbD mutant type is provided; when the Ct value of the fourth fluorophore channel is not more than 37, the Ct value of the fifth fluorophore channel is more than 37 or NoCT, and the Ct value of the sixth fluorophore channel is not more than 37, the sample is a sample to be detected containing the HbO hybrid mutant type and not containing the HbD mutant type indication; when the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the Ct value of the fifth fluorophore channel is greater than 37 or NoCT, and the Ct value of the sixth fluorophore channel is not greater than 37, the sample is an HbO homozygous mutant type containing sample to be detected, and the sample does not contain an HbD mutant type indication; when the Ct value of the fourth fluorophore channel is not more than 37, the Ct value of the fifth fluorophore channel is not more than 37, and the Ct value of the sixth fluorophore channel is more than 37 or NoCT, the indication is that the sample to be detected does not contain the HbO mutant and contains the HbD heterozygous mutant; when the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the Ct value of the fifth fluorophore channel is not greater than 37, and the Ct value of the sixth fluorophore channel is greater than 37 or NoCT, the indication is that the sample to be detected does not contain the HbO mutant and contains the HbD homozygous mutant; and when the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the Ct value of the fifth fluorophore channel is not greater than 37, and the Ct value of the sixth fluorophore channel is not greater than 37, the indication is that the sample to be detected contains the HbO hybrid mutant type and the indication of the HbD hybrid mutant type.

In some embodiments, the method comprises the steps of:

1) Extracting nucleic acid of a sample to be detected;

3) And analyzing the result of the amplification curve.

Further, the reaction conditions of the RT-qPCR are as follows:

pre-denaturation of gDNA: the temperature is 95 ℃ and the time is 2-5 min; the first step of amplification: denaturation at 95 ℃ for 15-30 s; annealing at 65 deg.c for 20-50s for 5-10 times; a second amplification step: denaturation at 95 ℃ for 15-30 s; annealing at 60 deg.c for 20-40s and repeating for 40-50 times to collect fluorescent signal. In a specific embodiment, a method for rapid identification of SCD is provided, said method comprising the specific steps of:

1) Extracting nucleic acid of a sample to be detected;

2) Performing RT-qPCR amplification on the nucleic acid extracted in the step 1) by using the probe group disclosed by the invention;

3) And (5) analyzing an amplification curve.

Further, the reaction program after RT-qPCR optimization is as follows:

pre-denaturation of gDNA: the temperature is 95 ℃ and the time is 2-5 min; the first step of amplification: denaturation at 95 ℃ for 15-30 s; annealing at 65 deg.c for 20-50s for 5-10 times; and (2) second-step amplification: denaturation at 95 ℃ for 15-30 s; annealing at 60 deg.c for 20-40s and repeating for 40-50 times to collect fluorescent signal.

Finally, the invention provides a kit for SCD detection. According to an embodiment of the invention, a set of probes as set forth in the first aspect of the invention is comprised.

Furthermore, the kit also comprises a PCR reaction solution and an RT-PCR detection enzyme solution.

The common PCR reaction solution is prepared from Tris-HCl and MgCl ₂ And buffer systems and dNTPs. The total volume of a single PCR reaction tube is generally 10 to 50. Mu.L. A common RT-PCR enzyme solution consists of a hot start DNA polymerase.

In a specific embodiment, the specific components of the reaction system composed of the first set of probes of the present invention are shown in Table 2.

Table 2:

in a specific embodiment, the specific components of the reaction system composed of the second set of probes of the present invention are shown in Table 3.

Table 3:

furthermore, the final reaction concentration of the detection probe in the probe set is 0.04-1 μ M.

Further, the final reaction concentration of the detection enzyme solution is 0.02-1U.

The invention will now be described with reference to specific examples, which are intended to be illustrative only and not to be limiting in any way.

Example 1 design and optimization of primer Probe sequences

1. Primer probe sequence design and optimization of reaction system 1

In this example, the reaction system 1 was used as a reaction system for simultaneously detecting 2 kinds of mutations HbS (A20T) and HbC (G19A) of the HBB gene encoding hemoglobin.

In the process of the invention, the target region can be amplified by the same pair of primers considering that the two detection sites are closer in position on the genome sequence. Meanwhile, aiming at the sequence characteristics of the site to be detected, the invention respectively marks a wild type sequence (HbA), a c.20A > T mutant sequence (HbS) and a c.19G > A mutant sequence (HbC) through 3 probes which are modified and marked by different fluorescent groups, identifies and judges whether c.20A > T or c.19G > A mutation exists in a sample to be detected through signals of three different fluorescent marking probes, and judges the heterozygosity of the mutation (homozygous mutation/heterozygous mutation/compound heterozygous mutation).

(1) First time optimization

And designing primer probes aiming at the target sites for testing and optimization, wherein the first-designed SCD primers and probe compositions of Group1 are shown in Table 4.

Table 4:

the reaction solution was prepared according to the reaction system shown in Table 5:

table 5:

name of material	Amount used (μ L)
		A/S/C primer upstream sequence	2.5
A/S/C primer downstream sequence	1
		A/S/C-HbA probe	0.75
A/S/C-HbS probe	0.75
		A/S/C-HbC probe	0.75
ACTB primer upstream sequences	0.3
		ACTB primer downstream sequences	0.3
ACTB probes	0.3
		DNA polymerase	0.15
10 Xbuffer Buffer	3
		dNTP(each 2.5mM)	2.4
MgSO ₄ (100mM)	0.3
		DNA template	2
H ₂ O	15.5
		Total volume	30

The fluorescent quantitative PCR reaction was carried out according to the procedure shown in Table 6.

Table 6:

as shown in FIG. 1, a positive sample of a known mutation in HbS (HBB: A20T; het) was detected based on the primer probe compositions, reaction systems, and reaction procedures described in tables 4 to 6, and as a result, the first designed probe for detecting wild type HbA, mutant HbS, and mutant HbC had a poor A/S/C-HbA-1 probe signal, which may lead to erroneous detection results.

As shown in FIG. 2, when an experiment was performed using the primer probe compositions, reaction systems, and reaction programs shown in tables 4 to 6 to detect a positive sample of a known HbC (HBB: G19A; het) mutation, the first designed HbA wild-type, hbS mutant, and HbC mutant probes had poor A/S/C-HbA-1 probe signals, and thus, erroneous detection results were likely to occur.

According to the known variation information of the test sample, the expected result and the actual test result of the test sample in each fluorescence channel are shown in table 7, and the test results show that the good detection purpose cannot be achieved under the conditions of the primer probe composition, the reaction system and the reaction program described in tables 4-6.

Table 7:

(2) Second optimization

According to the result of the first optimization test, the three probes in the system 1 are optimized and tested and screened for the second time, and finally a good primer probe sequence of Group2 is obtained, as shown in table 8:

table 8:

primer Probe name	Sequence of	5' end modifying group	3' end modifying group
				A/S/C primer upstream sequence	GTTTCTATTGGTCTCCTTAAACCTGT	-	-
A/S/C primer upstream sequence	GGCAGAGCCATCTATTGCTTA	-	-
				A/S/C-HbA probe	CAGACTTCTCCTCAGGAG	FAM	MGB
A/S/C-HbS probe	CAGACTTCTCCACAGGA	ROX	MGB
				A/S/C-HbC probe	CAGACTTCTCCTTAGGAG	HEX	MGB
ACTB primer upstream sequences	TTCCCTCCAGACTACCTCCTTA	-	-
				ACTB primer downstream sequences	GCCGACCAACACCTAATAATG	-	-
ACTB probes	AAGAGATCCCTCAGAGTGTTCCTGG	CY5	MGB

A positive sample with a known mutation of HbS (HBB: A20T; het) was detected using the primer probe composition described in Table 8, the reaction systems and the reaction programs shown in tables 5 and 6, and the results are shown in FIG. 3, in which the A/S/C-HbA probe, the A/S/C-HbS probe and the reference gene ACTB probe all gave good amplification signals, the A/S/C-HbC probe did not amplify non-specifically, and the specific detection data are shown in Table 9. Therefore, the primer/probe sequences can better realize the detection purpose.

Table 9:

2. primer probe sequence design and optimization for reaction system 2

In this example, the reaction system 2 was used as a reaction system for simultaneously detecting 2 kinds of mutations HbD (G364C) and HbO (G364A) of the HBB gene encoding hemoglobin.

In the process of the invention, because the two detection sites are closer in position distance on the genome sequence, the amplification of the target region can be carried out by the same pair of primers. Meanwhile, aiming at the sequence characteristics of the sites to be detected, the invention respectively marks a wild type sequence (HbA), a c.364G > C mutant sequence (HbD) and a c.364G > A mutant sequence (HbO) through 3 probes which are modified and marked by different fluorescent groups, identifies and judges whether c.364G > C or c.364G > A mutation exists in a sample to be detected and judges the heterozygosity of the mutation (pure mutation/heterozygosity mutation/composite heterozygosity mutation) through signals of three different fluorescent mark probes. Meanwhile, a pair of primers and a probe are used for amplifying and signal marking the reference gene ACTB in the system, and the system is used for quality control of a detection system.

(1) First time optimization

And designing a primer probe aiming at the target site for testing and optimizing. Wherein, the compositions of the SCD primer and probe in the first designed system 2 are shown in table 10.

Table 10:

primer Probe name	Sequence of	5' end modifying group	3' end modifying group
				A/D/O primer upstream sequence	AAAGGAACCTTTAATAGAAATTGGACA	-	-
A/D/O primer downstream sequence	TGCTAATCATGTTCATACCTCTTATCTT	-	-
				A/D/O-HbA-1 probe	CCATCACTTTGGCAAAGAATT	FAM	MGB
A/D/O-HbD-1 probe	CCATCACTTTGGCAAACAATT	HEX	MGB
				A/D/O-HbO-1 probe	CCATCACTTTGGCAAAAAATT	ROX	MGB
ACTB primer upstream sequences	TTCCCTCCAGACTACCTCCTTA	-	-
				ACTB primer downstream sequences	GCCGACCAACACCTAATAATG	-	-
ACTB probes	AAGAGATCCCTCAGAGTGTTCCTGG	CY5	MGB

Table 11:

as shown in FIG. 4, a positive sample with a known HbD (HBB: G364C; het) mutation was detected using the primer probe composition shown in Table 10, the reaction system shown in tables 11 and 6, and the result shows that the A/D/O-HbO-1 probe of the sample has a strong non-specific amplification signal, which may lead to an erroneous detection result.

As shown in FIG. 5, the primer probe composition shown in Table 10 was used to detect a positive sample with known HbO (HBB: G364A; het) mutation, and the result is shown in FIG. 5.

According to the known variation information of the test sample, the expected results and the actual test results of the test sample in each fluorescence channel are shown in table 12, and the test results show that the primer probe composition shown in table 8, the reaction systems and the reaction procedures shown in tables 11 and 6 can not achieve good detection.

Table 12:

(2) Second optimization

And (3) according to the first optimization test result, carrying out second sequence optimization and test screening on the three probes aiming at the SCD type detection in the system 2, and obtaining a probe sequence table 13 shown in the figure.

Watch 13

Primer Probe name	Sequence of	5' end modifying group	3' end modifying group
				A/D/O primer upstream sequence	AAAGGAACCTTTAATAGAAATTGGACA	-	-
A/D/O primer downstream sequence	TGCTAATCATGTTCATACCTCTTATCTT	-	-
				A/D/O-HbA probe	CTGGTGAATTCTTTGC	FAM	MGB
A/D/O-HbD probe	CTGGTGAATTGTTTGC	HEX	MGB
				A/D/O-HbO probe	CTGGTGAATTtTTTGC	ROX	MGB
ACTB primer upstream sequences	TTCCCTCCAGACTACCTCCTTA	-	-
				ACTB primer downstream sequences	GCCGACCAACACCTAATAATG	-	-
ACTB probes	AAGAGATCCCTCAGAGTGTTCCTGG	CY5	MGB

A positive sample with known HbD (HBB: G364C; het) mutation is detected by using the primer probe composition shown in Table 13, the reaction systems and the reaction programs shown in tables 11 and 6, and the result is shown in FIG. 6, wherein the A/D/O-HbA probe, the A/D/O-HbD probe and the ACTB probe can obtain good amplification signals, the A/D/O-HbO probe does not perform non-specific amplification, and the specific detection result is shown in Table 14, so that the detection purpose of the primer/probe sequence can be better realized.

Table 14:

in conclusion, the primer probe sequences meeting the expected detection requirements are screened and determined in the embodiment, the specific sequences are shown in table 15, and the fluorescent groups and the quenching groups can be adjusted and optimized according to actual conditions.

Table 15:

example 2 reaction System and reaction procedure optimization

In the embodiment, the detection purpose and the sequence characteristics of the primers/probes are combined, an asymmetric amplification mode is adopted in a reaction system, and the target chain combined with the probes is amplified more favorably on the premise of effective amplification by adjusting the concentration and the ratio of the upstream primers and the downstream primers, so that the purposes of a signal method and inhibition of nonspecific signal interference are realized.

Through optimized screening, the final concentration of the primer is determined to be preferably: the final concentration of the upstream primer is 0.5-4 mu M; the final concentration of the downstream primer is 0.1-1 mu M, the final concentration of the fluorescent probe is 0.04-1 mu M, mgSO ₄ The final concentration of the enzyme is 1-3 mM, and the enzyme selection reagent TaKaRa Ex from Biotechnology (Beijing) Ltd

And Hot Start Version (RR 006B), which can optimize the system according to the actual situation.

The reaction procedure was optimized as follows: pre-denaturation of gDNA: the temperature is 95 ℃, and the time is 2-5 min; the first step of amplification: denaturation at 95 ℃ for 15-30 s; annealing at 65 deg.c for 20-50s for 5-10 times; and (2) second-step amplification: denaturation at 95 ℃ for 15-30 s; annealing at 60 deg.c for 20-40s and repeating for 40-50 times to collect fluorescent signal.

EXAMPLE 3 Rapid identification method of SCD kit

In this example, the primer probe composition, the reaction system and the reaction program selected in example 1 and example 2 were used to perform RT-qPCR amplification in negative or positive samples to obtain CT values thereof, so as to verify the effects of the primers and the probes.

Step 1, sample collection: the detection sample of the invention is blood, tissue, cell, etc., and the adaptive DNA extraction/purification kit can be selected to extract the gDNA of the human genome according to the type of the sample in practical application.

Step 2, preparing qPCR reaction solution:

1) And (3) uniformly mixing the primer probe composition and the detection enzyme solution according to the final concentration of each substance in the table 16 and the table 17, and subpackaging the mixture into each reaction tube according to the total volume of the reaction system. Adding the extracted sample nucleic acid to be detected into each reaction tube, covering a PCR tube cover, performing instant centrifugation, and placing in a real-time fluorescent PCR instrument (A/S/C).

Table 16:

table 17:

and 3, step 3: reactions and assays were performed according to the cycling conditions described in Table 18 (fluorescence collection selected from FAM, ROX, HEX and CY5 channels)

Table 18:

step four: interpretation of results

1) Target detection signals of interest are FAM, ROX and HEX;

2) Setting a baseline: the baseline is generally set to be 3-15 cycles, and can be adjusted according to actual conditions. The adjustment principle is as follows: selecting a region with stable fluorescence signals before exponential amplification, wherein the starting point (Start) avoids the signal fluctuation in the initial stage of fluorescence acquisition, and the End point (End) is reduced by 2 cycles compared with the Ct of the sample with the earliest exponential amplification. Setting of threshold line: the rule is set based on the fact that the threshold line just exceeds the highest point of the amplification curve (irregular noise line) of the normal blank control.

3) And if the Ct value of the CY5 channel in the reaction system 1 and the reaction system 2 is more than 33, the detection needs to be carried out again.

After the amplification of the reaction system 1 is completed, the detection results of the HbS and HbC sites of the sample to be detected are judged according to the S type or S-like type of the amplification curve and the Ct value, which are detailed in Table 19.

Table 19:

after the amplification of the reaction system 2 is completed, the detection results of the HbD and HbO sites of the sample to be detected are judged according to the S-type or S-like amplification curve and the Ct value, which are detailed in Table 20.

Table 20:

the invention is suitable for 2 domestic common RT-qPCR instruments (Hongshi SLAN-96S or elegant MA-6000).

Example 4 specific detection of compositions of the invention

Using the composition 1 and the composition 2 described in the embodiment 1 of the present invention, samples with known HbS, hbC, hbD, and HbO mutation site information were detected according to the method described in the embodiment 2, the specific mutation information of the samples is shown in table 21, the specific results are shown in fig. 7 to 11, and the Ct value of each detection result is shown in the following table 25.

Table 21:

step 1, sample collection: the detection sample type is a peripheral blood sample, and the magnetic bead method nucleic acid extraction kit is selected to take the gDNA of the human genome.

Step 2, preparing qPCR reaction liquid:

the primer probe compositions obtained after the optimized screening are shown in Table 15.

The primer probe compositions and the detection enzyme solutions were mixed uniformly at the final concentrations of the substances in tables 22 and 23, and dispensed into the respective reaction tubes in a volume of 30. Mu.L in total volume. Adding 2 mu L of the extracted sample nucleic acid to be detected into each reaction tube, covering a PCR tube cover, performing instant centrifugation, and placing in a real-time fluorescent PCR instrument (A/S/C).

Table 22:

table 23:

and 3, step 3: reactions and assays were performed under cycling conditions as shown in Table 24 (fluorescence collection selected from FAM, ROX, HEX and CY5 channels)

Table 24:

and 4, step 4: interpretation of results

The detection data of the samples of 5 embodiments are derived, and the detection result is judged according to the CT value, and the specific result is shown in a table 25. The detection results of 5 samples prove that the kit can accurately detect the wild type HbA, the wild type HbS and the,

HbC, hbD and HbO mutant types, and the mutation site of the HBB gene can be accurately and efficiently judged.

Table 25:

in the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Claims

1. A probe set comprising a group1 probe, wherein the group1 probe further comprises a first probe, a second probe and a third probe,

the first probe nucleic acid sequence comprises: 5 'CAGACTTCTCCTCAGGAG-doped 3' (SEQ ID NO: 1), or a sequence similar to SEQ ID NO:1, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical;

the second probe nucleic acid sequence comprises: 5 'CAGACTTCCACACAGAG-3' (SEQ ID NO: 2), or a sequence similar to SEQ ID NO:2, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical;

the third probe nucleic acid sequence comprises: 5 'CAGACTTCCTTAGGAG-containing 3' (SEQ ID NO: 3) or a nucleotide sequence similar to SEQ ID NO:3, has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity.

2. A set of probes, comprising set 2, wherein the set 2 of probes further comprises a fourth probe, a fifth probe, and a sixth probe,

the fourth probe nucleic acid sequence comprises: 5-: 4, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical;

the fifth probe nucleic acid sequence comprises: 5-: 5, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical;

the sixth probe nucleic acid sequence comprises: 5-: 6, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identical to the nucleic acid sequence shown in figure 6.

3. A composition comprising a set of probes according to claim 1 and/or 2.

4. The composition of claim 3, further comprising a primer set.

5. The composition of claim 4, wherein the primer set comprises a first primer pair and/or a second primer pair, and the nucleic acid sequences of the first primer pair and/or the second primer pair are as follows:

the first pair of primer upstream sequences: 5 'GTTTCTATTGGTCTCCTTAAACCTGT-3' (SEQ ID NO: 7);

the downstream sequences of the first pair of primers: 5 'GGCAGAGCCATCTATGCTTA-3' (SEQ ID NO: 8);

the upstream sequence of the second pair of primers: 5 'AAAGGAACCTTAATAGAAATTGGACA-3' (SEQ ID NO: 9);

the downstream sequences of the second pair of primers: 5-.

6. The composition according to any one of claims 3 to 5, further comprising a third pair of primers and a seventh probe, wherein the nucleic acid sequences are as follows:

the third pair of primer upstream sequences: 5 'TTCCCTCCAGATCTACCTCCTTA-doped 3' (SEQ ID NO: 11);

the downstream sequences of the third pair of primers are as follows: 5 'GCCGACCAACCTAATG-doped 3' (SEQ ID NO: 12);

a seventh probe sequence: 5 'AAGAGATCCCTCAGAGTGTTCCTGG-3' (SEQ ID NO: 13).

7. Use of a reagent comprising a set of probes according to claim 1 or 2 or a composition according to any one of claims 3 to 6 in the preparation of a kit for the detection of sites of mutations in sickle cell anemia genes.

8. Use of a reagent comprising a set of probes according to claim 1 or 2 or a composition according to any one of claims 3 to 6 in the manufacture of a kit for the detection of sickle cell anemia.

9. A method for detecting sickle cell anemia related mutation is characterized in that,

performing RT-qPCR detection on a sample to be detected by using a probe set of claim 1 or 2 or a composition of any one of claims 3 to 6, wherein the probe in the probe set further carries a fluorescent group;

determining whether the sample to be detected contains sickle cell anemia related mutation or not based on the RT-qPCR fluorescent signal;

optionally, detection of a fluorescent signal is indicative of the presence of a sickle cell anemia-associated mutation in the test sample.

10. The method of claim 9, wherein the fluorophore is selected from at least one of the following: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE.

11. A detection method of sickle cell anemia related gene mutant is characterized by comprising the following steps:

performing RT-qPCR detection on a sample to be detected by using the probe set of claim 1 or 2 or the composition of any one of claims 3 to 6, wherein the probes in the probe set or composition further carry a fluorophore, and the first probe sequence carries a first fluorophore, the second probe sequence carries a second fluorophore, the third probe sequence carries a third fluorophore, the fourth probe sequence carries a fourth fluorophore, the fifth probe sequence carries a fifth fluorophore, and the sixth probe sequence carries a sixth fluorophore;

the Ct values of a first fluorescent group channel, a second fluorescent group channel, a third fluorescent group channel, a fourth fluorescent group channel, a fifth fluorescent group channel and a sixth fluorescent group channel are respectively and independently detected;

and determining the mutant type of the sickle cell anemia related gene according to the Ct value.

12. The method of claim 11, wherein the first, second, third, fourth, fifth, and sixth fluorophores are each independently selected from at least one of the following: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE;

wherein the first fluorescent group, the second fluorescent group and the third fluorescent group in the same reaction system have different fluorescent groups;

the fourth, fifth and sixth fluorophores are different fluorophores in the same reaction system.

13. The method of claim 11,

the Ct value of the first fluorophore channel is not more than 37, the Ct value of the second fluorophore channel is more than 37 or NoCT, and when the Ct value of the third fluorophore channel is more than 37 or NoCT, the indication that the sample to be detected contains the wild type HbA, does not contain the mutant type HbS and does not contain the mutant type HbC;

optionally, the Ct value of the fourth fluorophore channel is not greater than 37, the Ct value of the fifth fluorophore channel is greater than 37 or NoCT, and the sixth fluorophore channel is greater than 37 or NoCT, which is an indication that the sample to be tested contains a wild type HbA, no mutant HbO, and no mutant HbD.

14. The method of claim 13,

the Ct value of the first fluorophore channel is not more than 37, the second fluorophore channel is not more than 37, and the third fluorophore channel is more than 37 or NoCT, and the first fluorophore channel is an indication that the sample to be detected contains the HbS heterozygous mutant and does not contain the HbC mutant;

optionally, the Ct value of the first fluorophore channel is greater than 37 or NoCT, the second fluorophore channel is not greater than 37, and the third fluorophore channel is greater than 37 or NoCT, is an indication that the sample to be tested contains HbS homozygous mutant, and does not contain HbC mutant;

optionally, the Ct value of the first fluorophore channel is not greater than 37, the second fluorophore channel is greater than 37 or NoCT, and the third fluorophore channel is not greater than 37, indicating that no HbS mutant and no HbC hybrid mutant are contained in the sample to be tested;

optionally, the Ct value of the first fluorophore channel is greater than 37 or NoCT, the second fluorophore channel is greater than 37 or NoCT, and the third fluorophore channel is not greater than 37, which is an indication that HbS mutant is not contained and HbC homozygous mutant is contained in the sample to be tested;

optionally, the Ct value of the first fluorophore channel is greater than 37 or NoCT, the second fluorophore channel is not greater than 37, and the third fluorophore channel is not greater than 37, which is an indication of HbS-containing hybrid mutant and HbC-containing hybrid mutant in the sample to be tested;

optionally, the Ct value of the fourth fluorophore channel is not greater than 37, the fifth fluorophore channel is greater than 37 or NoCT, and the sixth fluorophore channel is not greater than 37, which is an indication that the sample to be tested contains HbO hybrid mutant and does not contain HbD mutant;

optionally, the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the fifth fluorophore channel is greater than 37 or NoCT, and the sixth fluorophore channel is not greater than 37, which is an indication that the sample to be tested contains an HbO homozygous mutant and does not contain an HbD mutant;

optionally, the Ct value of the fourth fluorophore channel is not greater than 37, the fifth fluorophore channel is not greater than 37, and the sixth fluorophore channel is greater than 37 or NoCT, is an indication that no HbO mutant and no HbD hybrid mutant are contained in the sample to be tested;

optionally, the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the fifth fluorophore channel is not greater than 37, and the sixth fluorophore channel is greater than 37 or NoCT, which is an indication that the sample to be tested does not contain HbO mutant and contains HbD homozygous mutant;

optionally, the Ct value of the fourth fluorophore channel is greater than 37 or NoCT, the fifth fluorophore channel is not greater than 37, and the sixth fluorophore channel is not greater than 37, which is an indication of the HbO-containing hybrid mutant and the HbD-containing hybrid mutant in the sample to be tested.

15. A kit comprising a set of probes according to claim 1 or 2 or a set of probes according to a composition according to any one of claims 3 to 6.