WO2023192911A2 - Cxcl-modulating compositions and methods - Google Patents
Cxcl-modulating compositions and methods Download PDFInfo
- Publication number
- WO2023192911A2 WO2023192911A2 PCT/US2023/065108 US2023065108W WO2023192911A2 WO 2023192911 A2 WO2023192911 A2 WO 2023192911A2 US 2023065108 W US2023065108 W US 2023065108W WO 2023192911 A2 WO2023192911 A2 WO 2023192911A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- expression
- repressor
- sequence
- chr4
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
- C12N9/222—Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
Definitions
- Mis-regulation of gene expression is the underlying cause of many diseases (e.g., in mammals, e.g., humans).
- a number of diseases and conditions are associated with pluralities of related genes.
- the disclosure provides, among other things, expression repressors or systems comprising expression repressors that may be used to modulate, e.g., decrease, expression of a one or more target genes, e.g., one or more CXCL genes, that are within a CXCL locus comprising a cis-acting regulatory element.
- the disclosure provides an expression repressor comprising: a first targeting moiety that binds a target site comprising a cis-acting regulatory element, e.g., an enhancer (e.g., an enhancer for a CXCL gene); and a first effector moiety.
- a cis-acting regulatory element e.g., an enhancer (e.g., an enhancer for a CXCL gene)
- a first effector moiety e.g., an enhancer (e.g., an enhancer for a CXCL gene).
- the disclosure provides an expression repressor comprising: a first targeting moiety that binds to a target site, wherein the target site is within a cis-acting regulatory element of a CXCL locus, and optionally, a first effector moiety, wherein the expression repressor is capable of decreasing expression of a CXCL gene.
- the disclosure provides an expression repressor comprising: a first targeting moiety that binds a target site comprising an IL-8 promoter; and a first effector moiety.
- the disclosure provides an expression repressor comprising: a first targeting moiety that binds to a target site, wherein the target site is within an El cis-acting regulatory element of a CXCL locus or an E2 cis-acting regulatory element of a CXCL locus, and optionally, a first effector moiety, wherein the expression repressor is capable of decreasing expression of a CXCL gene.
- the target site is within genomic coordinates chr4: 74591400-74593000 or chr4:74982639-74983600 (based on hgl9 human genome reference assembly).
- the disclosure provides an expression repressor comprising: a first targeting moiety that binds to a target site within genomic coordinates chr4: 74591400- 74593000 or chr4:74982639-74983600 (based on hgl9 human genome reference assembly), and optionally, a first effector moiety, wherein the expression repressor is capable of decreasing expression of a CXCL gene.
- the target site is chosen from: t) GRCh37: chr4:74983181-74983203.
- the first targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site chosen from: a) GRCh37: chr4:74591777-74591797; b) GRCh37: chr4:74591834-74591854; c) GRCh37: chr4:74591896-74591916; d) GRCh37: chr4:74592082-74592102; e) GRCh37: chr4:74592107-74592127; f) GRCh37: chr4:74592156-74592176; g) GRCh37: chr4:74592210-74592230; h) GRCh37: chr4:74592057-74592077; i) GRCh37: chr4:74591977-74591997; j) GRCh37: chr4: chr4
- the disclosure provides an expression repressor comprising: a first targeting moiety that binds a target site comprising at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, T1 , 28, or 29, nucleotides of the sequence of any one of SEQ ID NOs: 163 or 164, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto, or a sequence with no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto , and optionally, a first effector moiety, wherein the expression repressor is capable of decreasing expression of a CXCL gene.
- the disclosure provides an expression repressor comprising: a first targeting moiety that binds to a target site, wherein the target site is within an IL-8 promoter, and optionally, a first effector moiety, wherein the expression repressor is capable of decreasing expression of IL-8.
- the target site (e.g., target site within the IL8 promoter) is within genomic coordinates chr4:74606112-74606462 (hg!9). In some embodiments, the target site (e.g., target site within the IL8 promoter) is located within 1 kb from chr:74606112-74606462 (e.g., chr4:74606112- 74606662, chr4:74606112-74606862, chr4:74606112-74607062, chr4:74606112-74607262, chr4:74606112-74607462, chr4:74605912-74606462, chr4:74605712-74606462, chr4:74605512- 74606462, chr4: 74605312-74606462, chr4:74605112-74606462, chr4:74605912-74606662, chr4:
- the target site (e.g., target site within the IL8 promoter) is located 500 bp upstream from the transcription start site. In certain embodiments, the target site (e.g., target site within the IL8 promoter) is located at chr4:74605723-74606223.
- the target site (e.g., target site within the IL8 promoter)is located at chr4:74605723-74606426, chr4:74605723-74606626, chr4:74605723-74606826, chr4:74605723-74607026, chr4:74605723-74607226, chr4:74605523- 74606226, chr4:74605323-74606226, chr4:74605123-74606226, chr4:74604923-74606226, chr4:74604723-74606226, chr4:74605523-74606426, chr4:74605523-74606626, chr4:74605523- 74606826, chr4:74605523-74607026, chr4:74605523-74607226, chr4:74605323-74606426, chr4:74
- the target site (e.g., target site within the 1L8 promoter) is located 1000 bp upstream from the transcription start site. In certain embodiments, the target site (e g., target site within the IL8 promoter) is located at chr4:74605223-74606223.
- the target site (e.g., target site within the IL8 promoter) is located at chr4:74605226- 74606426, chr4:74605226-74606626, chr4:74605226-74606826, chr4: 74605226-74607026, chr4: 74605226-74607226, chr4:74605026-74606226, chr4:74604826-74606226, chr4: 74604626- 74606226, chr4:74604426-74606226, chr4: 74604226-74606226, chr4:74605026-74606426, chr4:74605026-74606626, chr4:74605026-74606826, chr4: 74605026-74607026, chr4:74605026- 74607226, chr4:74604826-74606426,
- the disclosure provides an expression repressor comprising: a first targeting moiety that binds to a target site within genomic coordinates GRCh37: chr4:74606162-74606184, GRCh37: chr4: 74605723-74606223, or GRCh37: chr4: 74605223- 74606223 (based on hg!9 human genome reference assembly); and optionally, a first effector moiety, wherein the expression repressor is capable of decreasing expression of IL-8.
- the expression repressor binds to a target site is chosen from:
- the first targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site chosen from: iv) GRCh37: chr4:74605955-74605975; v) GRCh37: chr4:74605842-74605862; vi) GRCh37: chr4:74606145-74606165; vii) GRCh37: chr4:74606039-74606056; viii) GRCh37: chr4:74606113-74606130; ix) GRCh37: chr4:74606137-74606154; x) GRCh37: chr4:74606150-74606167; xi) GRCh37: chr4:74591882-74591899; xii) GRCh37: chr4:74591923-74591940; xiii) GRCh37:
- the first effector moiety comprises an effector described herein, e.g., KRAB, MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, EZH2, HDAC8, MeCP2, HP1, RBBP4, REST, FOG1, SUZ12, SETDB1, SETDB2, EHMT2 (i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2 or DNMT3, or a functional variant or fragment of any effector described here
- the first effector moiety is linked to the targeting moiety via a linker.
- the linker is a peptide linker.
- the linker may be between 2-30, 5-30, 10-30, 15-30, 20-30, 25-30, 2-25, 5-25, 10-25, 15-25, 20-25, 2-20, 5-20, 10-20, 15-20, 2-15, 5-15, 10-15, 2-10, 5-10, or 2-5 amino acids in length, or greater than or equal to 2, 5, 10, 15, 20, 25, or 30 amino acids in length (and optionally up to 50, 40, 30, 25, 20, 15, 10, or 5 amino acids in length).
- the first effector moiety is C-terminal of the targeting moiety.
- the first effector moiety is N-terminal of the targeting moiety.
- the first effector moiety is encoded by a nucleotide sequence chosen from any of SEQ ID NOs: 10, 14, 16, 18, 66, 68, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the first effector moiety comprises an amino acid sequence according to any of SEQ ID NOs: 1 1 , 12, 13, 15, 17, 19, 67 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the first effector moiety is MQ1 or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 11 or 12 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the first effector moiety is C-terminal of the first targeting moiety.
- the first effector moiety is KRAB, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 13 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the first effector moiety is C-terminal of the first targeting moiety.
- the first effector moiety is DNMT3a/3L, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 15 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the first effector moiety is C-terminal of the first targeting moiety.
- the first effector moiety is EZH2, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 17 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the first effector moiety is HDAC8, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 19 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the first effector moiety is C-terminal of the first targeting moiety.
- the first effector moiety is G9A, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 67 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the first effector moiety is N-terminal of the first targeting moiety.
- the effector moiety comprises a DNA methyltransferase, e.g., MQ1 or a fragment or variant thereof.
- the effector moiety comprises a transcription repressor, e.g., comprises KRAB or a fragment or variant thereof.
- the target site has a length of 15-20, 20-25, 25-30, or 30-35 nucleotides.
- the first targeting moiety comprises a zinc finger domain.
- the zinc finger domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 zinc fingers (and optionally no more than 11, 10, 9, 8, 7, 6, or 5 zinc fingers).
- the zinc finger domain comprises 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-
- the zinc finger domain comprises 3, 7, or 9 zinc fingers. In some embodiments, the zinc finger domain targets a site comprising 21 nucleotides.
- the first targeting moiety comprises a CRISPR-Cas domain.
- the expression repressor described herein is capable of decreasing expression of a plurality of CXCL genes (e.g., 2, 3, 4, 5, 6, 7, or 8 CXCL genes). In certain embodiments, the expression repressor described herein is capable of decreasing expression of one or more of (e.g., 2, 3, 4, 5, 6, 7, or 8 of) CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, or IL-8.
- the first effector moiety is a durable effector moiety or a transient effector moiety.
- the first targeting moiety comprises a zinc finger domain
- the first effector moiety comprises a transcription repressor, e.g., KRAB or a fragment or variant thereof.
- the first targeting moiety comprises a zinc finger domain
- the first effector moiety comprises an epigenetic modifying moiety, e.g., a DNA methyltransferase, e.g., MQ1 or a fragment or variant thereof.
- the expression repressor comprises an amino acid sequence of any one of SEQ ID NOs: 152-161, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto, or a sequence with no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4,
- the expression repressor described herein (i) comprises one or more nuclear localization signal sequences (NLS), or (ii) does not comprise an NLS.
- the expression repressor described herein comprises a first NLS at the N terminus, e.g., wherein the first NLS has a sequence of SEQ ID NO: 63 or 64.
- the expression repressor described herein comprises an NLS, e.g., a second NLS, at the C terminus, e g., having a sequence of SEQ ID NO: 63 or 64.
- the first and the second NLS have the same sequence. In certain embodiments, the first and the second NLS have different sequences. In certain embodiments, binding of the expression repressor to the target site increases methylation at a site in the CXCL locus, e g., increases methylation at the El cis-acting regulatory element of the CXCL locus or the E2 cis-acting regulatory element of the CXCL locus.
- the disclosure provides a system comprising: a) a first expression repressor according to any of the previous embodiments, and b) a second expression repressor, e.g., a second expression repressor that decreases expression of a CXCL gene.
- the second expression repressor comprises: a second targeting moiety that binds to a second target site within the CXCL locus, and optionally, a second effector moiety.
- second expression repressor binds to the El cis-acting regulatory element of the CXCL locus, E2 cis-acting regulatory element of the CXCL locus, or IL8 promoter.
- the second target site is within coordinates GRCh37: chr4:74606162- 74606184, GRCh37: chr4: 74605723-74606223, or GRCh37: chr4: 74605223-74606223.
- the second target site is within coordinates: a) chr4:74606112-74606462, chr4:74606112-74606662, chr4:74606112-74606862, chr4:74606112-74607062, chr4:74606112-74607262, chr4:74606112-74607462, chr4:74605912- 74606462, chr4:74605712-74606462, chr4:74605512-74606462, chr4:74605312-74606462, chr4:74605112-74606462, chr4:74605912-74606662, chr4:74605912-74606862, chr4:74605912- 74607062, chr4:74605912-74607262, chr4:74605912-74607462, chr4:74605712-74606666
- the second target site is within GRCh37: chr4:74606162-74606184.
- the second target site is chosen from: i) GRCh37: chr4:74605780-74605800; n) GRCh37: chr4:74605961-74605981; lii) GRCh37: chr4:74606122-74606142; iv) GRCh37: chr4:74605955-74605975; v) GRCh37: chr4:74605842-74605862; vi) GRCh37: chr4:74606145-74606165; vii) GRCh37: chr4:74606039-74606056; vm) GRCh37: chr4:74606113-74606130; ix) GRCh37: chr4:74606137-74606154; x) GRCh37: chr4:74606150-74606167; xi) GRCh37: chr4:74591882-74
- the second target site is located within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site chosen from: i) GRCh37: chr4:74605780-74605800; li) GRCh37: chr4:74605961-74605981;
- the second targeting moiety is a clustered regulatory interspaced short palindromic repeat (CRISPR) Cas domain.
- CRISPR clustered regulatory interspaced short palindromic repeat
- the disclosure provides a nucleic acid encoding an expression repressor described herein.
- the disclosure provides a nucleic acid encoding: a first expression repressor of any described herein and a second expression repressor, e.g., a second expression repressor that decreases expression of a CXCL gene, e g., an expression repressor of the system of any of the previous aspects of embodiments.
- the disclosure provides a nucleic acid system comprising: a) a first nucleic acid encoding a first expression repressor as described herein, and b) a second nucleic acid encoding a second expression repressor, e.g., a second expression repressor that decreases expression of a CXCL gene, e.g., an expression repressor of the system of any of the previous aspects of embodiments.
- nucleic acid or nucleic acid system comprises a region encoding the first targeting moiety, wherein the region encoding the first targeting moiety comprises a nucleotide sequence of any one of SEQ ID NO: 122-131, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.
- nucleic acid or nucleic acid system comprises a region encoding the first targeting moiety, wherein the region encoding the first targeting moiety comprises a nucleotide sequence of any one of SEQ ID NOs: 194-199, 248-253, or 276-291, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.
- the nucleic acid or nucleic acid system comprises a region encoding the first effector moiety, wherein the region encoding the first effector moiety comprises a nucleotide sequence of any one of SEQ ID NO: 10, 14, 16, 18, 66, 68, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.
- the nucleic acid or nucleic acid system further comprises a region encoding an NLS.
- the region encoding the NLS comprises a nucleotide sequence of SEQ ID NO: 63 or 64, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.
- nucleic acid or nucleic acid system comprises DNA or RNA (e.g., mRNA).
- the disclosure provides a vector comprising the nucleic acid or nucleic acid system of any one of the previous aspects or embodiments.
- the disclosure provides a pharmaceutical composition comprising the expression repressor, nucleic acid, or nucleic acid system of any of the preceding aspects or embodiments.
- the pharmaceutical composition comprises an LNP, e.g., wherein the nucleic acid or nucleic acid system is formulated as an LNP.
- the disclosure provides a human cell comprising: an expression repressor as described herein, a nucleic acid or nucleic acid system as described herein, or a vector as described herein.
- the disclosure provides a human cell having decreased expression of a CXCL gene, wherein the cell was produced by a method comprising contacting the cell with an expression repressor of any of the previous aspects or embodiments, a nucleic acid or nucleic acid system of any of the previous aspects or embodiments, or a vector of any of the previous aspects or embodiments.
- the human cell has decreased expression of a first and a second CXCL gene. In certain embodiments, the human cell has decreased expression of a third CXCL gene. In certain embodiments, the human cell has decreased expression of a fourth CXCL gene. In some embodiments, the human cell has decreased expression of a fifth CXCL gene. In certain embodiments, the human cell has decreased expression of a sixth CXCL gene. In some embodiments, the human cell has decreased expression of a seventh CXCL gene. In some embodiments, the human cell has decreased expression of an eighth CXCL gene.
- the human cell has decreased expression of one or more of (e g., 2, 3, 4, 5, 6, 7, or 8 of) CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, or IL-8. In some embodiments, the human cell has decreased expression of one or more of CXCL1, CXCL2, CXCL3, and IL8. In one aspect, the disclosure provides a method of decreasing expression of one or more CXCL genes in a cell, comprising contacting the cell with an expression repressor, a system, a nucleic acid or nucleic acid system, or a vector of any one of the previous aspects or embodiments.
- the disclosure provides a method of decreasing expression of IL-8 in a cell, the method comprising contacting the cell with an expression repressor, a system, a nucleic acid or nucleic acid system described herein.
- the disclosure provides a method of decreasing expression of one or more CXCL genes in a cell, comprising contacting the cell with an expression repressor, or a nucleic acid comprising a sequence encoding the expression repressor, wherein the expression repressor comprises: a first targeting moiety that binds to a target site, wherein the target site is within an El cis-acting regulatory element of a CXCL locus or an E2 cis-acting regulatory element of a CXCL locus, and optionally, a first effector moiety, thereby decreasing expression of a CXCL gene.
- the target site is within genomic coordinates chr4: 74591400-74593000 or chr4:74982639-74983600 (based on hgl9 human genome reference assembly).
- expression of one or more of (e.g., 2, 3, 4, 5, 6, 7, or 8 of) CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, or IL-8 is decreased.
- expression is decreased for at least 1, 2, 3, 4, 5, 6, 7, 10, or 14 days, or at least 1, 2, 3, 4, or 5 weeks.
- the cell is a cell of a subject having an inflammatory disease, e.g., an immune mediated inflammatory disease.
- the inflammatory disease is an autoimmune disorder, e.g., rheumatoid arthritis.
- the inflammatory disease is associated with a pathogenic infection, e.g., viral infection, e.g., SARS-CoV2 infection.
- a pathogenic infection e.g., viral infection, e.g., SARS-CoV2 infection.
- the inflammatory disease is associated with a superinfection, e.g., infection caused by two or more pathogenic agents, e.g., by a virus and a bacterium, (e.g., by SARS- CoV2 and Streptococcus pneumoni), e.g., by a virus and a fungus, (e.g., by SARS-CoV2 and mucormycosis).
- a superinfection e.g., infection caused by two or more pathogenic agents, e.g., by a virus and a bacterium, (e.g., by SARS- CoV2 and Streptococcus pneumoni), e.g., by a virus and a fungus, (e.g., by SARS-CoV2 and mucormycosis).
- the cell is a cell of a subject having rheumatoid arthritis, inflammatory, arthritis, gout, asthma, neutrophilic asthma, neutrophilic dermatosis, paw edema, acute respiratory disease syndrome (ARDS), COVID-19, psoriasis, inflammatory bowel disease, infection (e.g., by a pathogen, e.g., a bacteria, a viruses, or a fungus), external injury (e.g., scrapes or foreign objects), effects of radiation or chemical injury, osteoarthritis, osteoarthritic joint pain, joint pain, inflammatory pain, acute pain, chronic pain, cystitis, bronchitis, dermatitis, dermatosis, cardiovascular disease, neurodegenerative disease, liver disease, lung disease, kidney disease, pain, swelling, stiffness, tenderness, redness, warmth, or elevated biomarkers related to disease states (e.g., cytokines, chemokines, grow th factors, immune receptors, infection markers
- the cell is a cell of a subject having rheumatoid arthritis, psoriasis, or inflammatory bowel disease.
- the cell is a cell of a subject having rheumatoid arthritis, gout, neutrophilic asthma, neutrophilic dermatosis, acute respiratory disease syndrome (ARDS), or COVID-19.
- the cell is a cell of a subject having cancer.
- the cancer is lung cancer (e.g., non-small cell lung cancer), breast cancer, hepatocellular carcinoma (HCC), prostate cancer, colon cancer, skin cancer, cervical cancer, ovarian cancer, uterine endometrioid carcinoma, endometrial cancer, mature B-cell lymphoma, bladder cancer, esophagogastric cancer, esophageal adenocarcinoma, bone cancer, melanoma, hepatobiliary cancer, thyroid cancer, mature B-cell neoplasms, glioma, head-neck squamous cell carcinoma, kidney renal clear cell carcinoma, pancreatic cancer (e.g., pancreatic ductal adenocarcinoma), sarcoma, or stomach adenocarcinoma.
- lung cancer e.g., non-small cell lung cancer
- breast cancer e.g., breast cancer, hepatocellular carcinoma (HCC)
- HCC hepatocellular carcinoma
- prostate cancer colon cancer
- the cell is situated in a subject.
- the cell is ex vivo.
- the cell is a mammalian cell, e g., a human cell.
- the cell is a somatic cell.
- the cell is a primary cell.
- the step of contacting is performed ex vivo.
- the method further comprises, prior to tire step of contacting, a step of removing the cell (e.g., mammalian cell) from a subject.
- a step of removing the cell e.g., mammalian cell
- the method further comprises, after the step of contacting, a step of administering the cells (e.g., mammalian cells) to a subject.
- a step of administering the cells e.g., mammalian cells
- the step of contacting comprises administering a composition comprising the expression repressor to a subject.
- the expression repressor is administered as a monotherapy.
- the expression repressor is administered in combination with a second therapeutic agent.
- the disclosure provides a reaction mixture comprising a cell (e.g., a human cell, e.g., a primary human cell) and an expression repressor, or system of any of the previous aspects or embodiments.
- a method of treating a subject having an inflammatory disorder comprising: administering to the subject an expression repressor, system, nucleic acid, nucleic acid system, or reaction mixture of any of the previous aspects or embodiments, in an amount sufficient to treat the disorder (e.g., inflammatory disorder), thereby treating the disorder (e.g., inflammatory disorder).
- the inflammatory disorder is rheumatoid arthritis, psoriasis, or inflammatory bowel disease.
- the inflammatory disorder is rheumatoid arthritis, gout, neutrophilic asthma, neutrophilic dermatosis, acute respiratory disease syndrome (ARDS), alcohol hepatitis, chronic obstructive pulmonary disease (COPD), or COVID-19.
- the inflammatory disorder is an autoimmune disorder, e.g., rheumatoid arthritis.
- the inflammatory disease is associated with a pathogenic infection, e.g., viral infection, e.g., SARS-CoV2 infection.
- a pathogenic infection e.g., viral infection, e.g., SARS-CoV2 infection.
- the inflammatory disease is associated with a superinfection, e.g., infection caused by two or more pathogenic agents, e.g., by a virus and a bacterium, (e.g., by SARS- CoV2 and Streptococcus pneumoni), e.g., by a virus and a fungus, (e.g., by SARS-CoV2 and mucormycosis).
- a superinfection e.g., infection caused by two or more pathogenic agents, e.g., by a virus and a bacterium, (e.g., by SARS- CoV2 and Streptococcus pneumoni), e.g., by a virus and a fungus, (e.g., by SARS-CoV2 and mucormycosis).
- the disclosure provides a method of treating a subject having cancer, comprising: administering to the subject an expression repressor, system, nucleic acid, nucleic acid system, or reaction mixture of any of claims 1-102 in an amount sufficient to treat the cancer, thereby treating the cancer.
- the cancer is lung cancer (e.g., non-small cell lung cancer), breast cancer, hepatocellular carcinoma (HCC), prostate cancer, colon cancer, skin cancer, cervical cancer, ovarian cancer, uterine endometrioid carcinoma, endometrial cancer, mature B-cell lymphoma, bladder cancer, esophagogastric cancer, esophageal adenocarcinoma, bone cancer, melanoma, hepatobiliary cancer, thyroid cancer, mature B-cell neoplasms, glioma, head-neck squamous cell carcinoma, kidney renal clear cell carcinoma, pancreatic cancer (e.g., pancreatic ductal adenocarcinoma), sarcoma, or stomach adenocarcinoma.
- lung cancer e.g., non-small cell lung cancer
- breast cancer e.g., breast cancer, hepatocellular carcinoma (HCC)
- HCC hepatocellular carcinoma
- prostate cancer colon cancer
- the subject has an El cis-acting regulatory element sequence comprising the sequence of SEQ ID NO: 162, or a sequence with no more than 8, 7, 6, 5, 4, 3, 2, or 1 alterations relative thereto.
- the subject has an E2 cis-acting regulatory element sequence comprising the sequence of SEQ ID NO: 163, or a sequence with no more than 8, 7, 6, 5, 4, 3, 2, or 1 alterations relative thereto.
- the disclosure is directed to a nucleic acid encoding the first expression repressor, second expression repressor, both, or a component thereof (e.g., a gRNA, a mRNA).
- the nucleic acid encoding the expression repressor system is a poly-cistronic sequence.
- the poly-cistronic sequence is a bi-cistronic sequence.
- the present disclosure provides an expression repressor, the expression repressor comprising a targeting moiety that targets an enhancer operably linked to a plurality of genes.
- the present disclosure provides a method of reducing expression of a plurality of genes, comprising contacting a cell comprising the plurality of genes with an expression repressor, the expression repressor comprising a targeting moiety that targets an enhancer operably linked to the plurality of genes.
- the plurality of genes comprise CXCL genes.
- the expression repressor targets the El cRE of the CXCL locus.
- the expression repressor or system comprising an expression repressor may be used in combination with a site-specific disrupting agent described herein.
- a site-specific disrupting agent described herein.
- an expression repressor that targets a cis-acting regulatory element of the CXCL locus may be used in combination with a site-specific disrupting agent that targets an anchor sequence of the CXCL locus.
- the site-specific disrupting agent is a site-specific disrupting agent of any one of embodiments B1-B232.
- the site-specific disrupting agent is a site-specific disrupting agent described herein.
- the site-specific disrupting agent is one described in International Application PCT/US2021/052720, which is incorporated herein by reference in its entirety.
- a site-specific disrupting agent comprises a targeting moiety that binds specifically to a first anchor sequence or proximal to the first anchor sequence in an ASMC.
- binding of the site-specific disrupting agent occurs in an amount sufficient to modulate, e.g., decrease, expression of the plurality of target genes, e g., the first gene and second gene.
- the site-specific disrupting agent further comprises an effector moiety.
- modulation of expression of a target plurality of genes by a site-specific disrupting agent involves the binding of the site-specific disrupting agent to or proximal to the first anchor sequence.
- binding of the sitespecific disrupting agent to the first anchor sequence may disrupt binding of a nucleating polypeptide, e.g., CTCF, to the first anchor sequence, e.g., thereby disrupting formation and/or maintenance of the ASMC, e.g., and thereby modulating, e.g., decreasing, expression of the plurality of genes.
- binding of the site-specific disrupting agent to or proximal to the first anchor sequence may localize a functionality of an effector moiety to the first anchor sequence and/or ASMC, e.g., thereby disrupting formation and/or maintenance of the ASMC, e.g., and thereby modulating, e.g., decreasing, expression of the plurality of genes.
- binding of the site-specific disrupting agent to or proximal to the first anchor sequence may localize a functionality of an effector moiety to the first anchor sequence and/or ASMC, e.g., thereby modulating, e.g., decreasing, expression of the plurality of genes.
- an effector moiety to the first anchor sequence and/or ASMC
- targeting a plurality of genes that are within the same ASMC may more effectively modulate, e.g., decrease, expression of the plurality of genes and/or more effectively achieve a therapeutic effect relating to the functionality of the plurality of genes.
- a targeted plurality of genes may all be pro-inflammatory genes; targeting the plurality of pro-inflammatory genes for modulation, e.g., reduction, in expression as taught herein may more effectively decrease inflammation than targeting individual genes.
- Targeting a plurality of genes comprised within the same genomic complex, e.g., ASMC, (e.g., by targeting the ASMC or an anchor sequence of the ASMC) may have an additive or synergistic effect (e.g., with regard to expression modulation or stability/duration of modulation) that is greater than the effect of targeting individual genes of the plurality.
- a method described herein comprises decreasing expression of a first gene and a second gene in a cell.
- the method comprises: contacting the cell with a sitespecific disrupting agent comprising a targeting moiety that binds specifically to a first anchor sequence or a site proximal to a first anchor sequence, in an amount sufficient to decrease expression of the first and second genes, the first and second genes being within an anchor sequence-mediated conjunction that comprises the first anchor sequence and a second anchor sequence.
- the first gene and the second gene are proinflammatory genes.
- the first gene and the second gene are CXCL genes.
- a system described herein comprises, or a method described herein involves the use of, a DNA-binding, e.g., a targeting moiety that binds specifically to or proximal to a first anchor sequence within a cell.
- the first anchor sequence is part of an anchor sequence-mediated conjunction that further comprises a second anchor sequence, a first gene, and a second gene.
- the first gene and the second gene are CXCL genes.
- a system described herein comprises, or a method described herein involves the use of, a site-specific disrupting agent, comprising: a targeting moiety that binds specifically to or proximal to a first anchor sequence within a cell, wherein the first anchor sequence is part of an anchor sequence-mediated conjunction that further comprises a second anchor sequence, a first gene, and a second gene, wherein the first gene and the second gene are CXCL genes.
- a site-specific disrupting agent comprising: a targeting moiety that binds specifically to or proximal to a first anchor sequence within a cell, wherein the first anchor sequence is part of an anchor sequence-mediated conjunction that further comprises a second anchor sequence, a first gene, and a second gene, wherein the first gene and the second gene are CXCL genes.
- a method described herein comprises decreasing expression of a first gene and a second gene in a cell, the method comprising: contacting the cell with a site-specific disrupting agent that comprises a targeting moiety that binds specifically to a first anchor sequence or a site proximal to a first anchor sequence, in an amount sufficient to decrease expression of the first and second genes, the first and second genes being within an anchor sequence-mediated conjunction that comprises the first anchor sequence and a second anchor sequence, wherein the first gene and the second gene are CXCL genes; thereby decreasing expression of the first and second genes.
- the disclosure is directed to a reaction mixture comprising a cell (e.g., a human cell, e.g., a primary human cell) a system as described herein (e.g., a system comprising an expression repressor described herein and optionally further comprising a site-specific disrupting agent described herein).
- a cell e.g., a human cell, e.g., a primary human cell
- a system as described herein e.g., a system comprising an expression repressor described herein and optionally further comprising a site-specific disrupting agent described herein.
- the disclosure is directed to a method of treating a subject having an inflammatory disorder, comprising administering to the subject a system as described herein (e.g., a system comprising an expression repressor described herein and optionally further comprising a sitespecific disrupting agent described herein) in an amount sufficient to treat the inflammatory disorder.
- a system as described herein e.g., a system comprising an expression repressor described herein and optionally further comprising a sitespecific disrupting agent described herein
- the disclosure is directed to a method of treating inflammation, e.g., local inflammation, in a subject having an infection, e.g., viral infection, e.g., COVID-19, comprising, administering to the subject a system as described herein (e.g., a system comprising an expression repressor described herein and optionally further comprising a site-specific disrupting agent described herein) in an amount sufficient to treat the inflammation.
- a system as described herein e.g., a system comprising an expression repressor described herein and optionally further comprising a site-specific disrupting agent described herein
- the disclosure is directed to a human cell having decreased expression of a first gene and a second gene, wherein tire first gene and the second gene are proinflammatory genes, wherein the cell comprises a disrupted (e.g., fully disrupted) anchor sequence-mediated conjunction that comprises the first and second genes.
- the human cell was previously contacted with a system described herein (e.g., a system comprising an expression repressor described herein and optionally further comprising a site-specific disrupting agent described herein).
- the human cell no longer comprises a system described herein.
- a human cell described herein comprises a mutation at genomic coordinates chr4:74595464-74595486, chr4:74595457-74595479, chr4:74595460-74595482, chr4:74595472-74595494, chr4:75000088-75000110, chr4:75000091-75000113, chr4:75000085- 75000107, chr4:75000157-75000179, chr4:75000156-75000178, chr4:74595215-74595237, chr4:74595370-74595392, chr4:74595560-74595582, chr4:74595642-74595664, chr4:74595787- 74595809, chr4:74528428-74528450, chr4:74528567-74528589, chr4: 745286
- a method of decreasing expression of a first gene and a second gene in a cell comprising: contacting the cell with a site-specific disrupting agent that comprises a targeting moiety that binds specifically to a first anchor sequence or a site proximal to a first anchor sequence, in an amount sufficient to decrease expression of the first and second genes, the first and second genes being within an anchor sequence-mediated conjunction that comprises the first anchor sequence and a second anchor sequence, wherein optionally the first gene and the second gene are proinflammatory genes; thereby decreasing expression of tire first and second genes.
- a site-specific disrupting agent comprising: a DNA-binding, e.g., a targeting moiety that binds specifically to or proximal to a first anchor sequence within a cell, wherein the first anchor sequence is part of an anchor sequence-mediated conjunction that further comprises a second anchor sequence, a first gene, and a second gene, wherein optionally the first gene and tire second gene are proinflammatory genes.
- a DNA-binding e.g., a targeting moiety that binds specifically to or proximal to a first anchor sequence within a cell
- the first anchor sequence is part of an anchor sequence-mediated conjunction that further comprises a second anchor sequence, a first gene, and a second gene, wherein optionally the first gene and tire second gene are proinflammatory genes.
- the site-specific disrupting agent of any of embodiments B2-B4 wherein the targeting moiety comprises a TAL effector molecule, a CRISPR/Cas molecule (e.g., a catalytically inactive CRISPR/Cas protein), a zinc finger domain, atetR domain, a meganuclease, or an oligonucleotide.
- a CRISPR/Cas molecule e.g., a catalytically inactive CRISPR/Cas protein
- zinc finger domain e.g., a catalytically inactive CRISPR/Cas protein
- atetR domain e.g., a catalytically inactive CRISPR/Cas protein
- a meganuclease e.g., a meganuclease, or an oligonucleotide.
- BIO The site-specific disrupting agent of any of embodiments B2-B9, wherein the effector moiety is encoded by a nucleotide sequence chosen from any of SEQ ID NOs: 10, 14, 16, 18, 66, 68, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17,
- any of embodiments B2-B 11, wherein the effector moiety is KRAB, or a functional variant or fragment thereof, e.g., wherein the effector moiety comprises an amino acid sequence of SEQ ID NO: 13 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity' thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the effector moiety is C-terminal of the targeting moiety.
- any of embodiments B2-B 1 1 wherein the effector moiety is DNMT3a/3L, or a functional variant or fragment thereof, e.g., wherein the effector moiety comprises an amino acid sequence of SEQ ID NO: 15 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the effector moiety is C-terminal of the targeting moiety.
- any of embodiments B2-B 11, wherein the effector moiety is EZH2, or a functional variant or fragment thereof, e.g., wherein the effector moiety comprises an amino acid sequence of SEQ ID NO: 17 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- any of embodiments B2-B 11, wherein the effector moiety is HDAC8, or a functional variant or fragment thereof, e.g., wherein the effector moiety comprises an amino acid sequence of SEQ ID NO: 19 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity' thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the effector moiety is C-termmal of the targeting moiety.
- any of embodiments B2-B 11, wherein the effector moiety is G9A, or a functional variant or fragment thereof, e.g., wherein the effector moiety comprises an amino acid sequence of SEQ ID NO: 67 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, wherein optionally the effector moiety is N-terminal of the targeting moiety.
- the site-specific disrupting agent of any of embodiments B2-B 19, wherein the effector moiety comprises a polymer e.g., an oligonucleotide; e.g., a gRNA.
- the targeting moiety further comprises a gRNA, e.g., a gRNA that binds a genomic locus comprising at least 14, 15, 16, 17, 18, 19, or 20 nucleotides of the sequence of any of SEQ ID NOs: 20-62, e g., wherein the gRNA comprises a sequence that comprises at least 14, 15, 16, 17, 18, 19, or 20 nucleotides of the sequence of any of SEQ ID NOs: 20-62.
- gRNA e.g., a gRNA that binds a genomic locus comprising at least 14, 15, 16, 17, 18, 19, or 20 nucleotides of the sequence of any of SEQ ID NOs: 20-62, e g., wherein the gRNA comprises a sequence that comprises at least 14, 15, 16, 17, 18, 19, or 20 nucleotides of the sequence of any of SEQ ID NOs: 20-62.
- the targeting domain comprises a CRISPR/Cas molecule, e.g., a catalytically inactive CRISPR/ Cas protein, and a gRNA, e.g., a gRNA that binds a genomic locus comprising at least 14, 15, 16, 17, 18, 19, or 20 nucleotides of the sequence of any of SEQ ID NOs: 20-62, e.g., wherein the gRNA comprises a sequence that comprises at least 14, 15, 16, 17, 18, 19, or 20 nucleotides of the sequence of any of SEQ ID NOs: 20-62 and the effector moiety comprises an effector chosen from DNMT3a/31, MQ1, KRAB, G9A, HDAC8, or EZH2.
- the effector moiety comprises an effector chosen from DNMT3a/31, MQ1, KRAB, G9A, HDAC8, or EZH2.
- the targeting domain comprises a CRISPR/Cas molecule, e.g., a catalytically inactive CRISPR/ Cas protein, and a gRNA, e.g., a gRNA that binds a genomic locus comprising at least 14, 15, 16, 17, 18, 19, or 20 nucleotides of the sequence of any of SEQ ID NOs: 20-62, e.g., wherein the gRNA comprises a sequence that comprises at least 14, 15, 16, 17, 18, 19, or 20 nucleotides of the sequence of any of SEQ ID NOs: 20-62, the first effector moiety comprises an effector chosen from DNMT3a/31, MQ1, KRAB, G9A, HDAC8, or EZH2, and the second effector moiety comprises an effector chosen from DNMT3a/31, MQ1, KRAB, G9A, HDAC8, or EZH2.
- the first effector moiety comprises an effector chosen from DNMT3a/31, MQ1, KRAB
- the site-specific disrupting agent of any of embodiments B2-B29 which: (i) comprises one or more nuclear localization signal sequences (NLS), or (ii) does not comprise an NLS, optionally wherein the NLS comprises an amino acid sequence of SEQ ID NO: 63 and/or 64.
- B31 The site-specific disrupting agent of any of embodiments B 18-B30, wherein the first and/or second effector moiety comprises a DNA methyltransferase, a histone methyltransferase, a histone deacetylase, a histone demethylase, or a recmiter of a histone modifying complex.
- B42 A human cell having decreased expression of a first gene and a second gene, wherein the first gene and the second gene are proinflammatory genes, wherein the cell comprises a disrupted (e.g., fully disrupted) anchor sequence -mediated conjunction that comprises the first and second genes.
- B43 The human cell of embodiment B42, which has reduced CTCF binding to an anchor sequence that is comprised by the anchor sequence -mediated conjunction, e g., reduced by at least 20, 30, 40, 50, 60, 70, 80, 90, or 100%.
- B52 The human cell of either of embodiments B27 or B28, wherein the mutation comprises a deletion, substitution, or insertion (e.g., of 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 nucleotides).
- a deletion, substitution, or insertion e.g., of 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 nucleotides.
- B53 The human cell of any of embodiments B50-B52, which has reduced CTCF binding to the mutation, e.g., reduced by at least 20, 30, 40, 50, 60, 70, 80, 90, or 100% compared to a human cell with an undisrupted ASMC.
- B54 The human cell of any of embodiments B42-B53, wherein expression of the first and second genes is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to a human cell with an undisrupted ASMC.
- a system comprising: a first site-specific disrupting agent comprising a first targeting moiety and optionally a first effector moiety, wherein the first site-specific disrupting agent binds specifically to a first anchor sequence of an anchor sequence mediated conjunction (ASMC), wherein the ASMC comprises a first gene and a second gene, and a second site-specific disrupting agent comprising a second targeting moiety and optionally a second effector moiety, wherein the second site-specific disrupting agent binds to a second anchor sequence of the ASMC.
- ASMC anchor sequence mediated conjunction
- B57 The system of embodiment B55 or B56, wherein the second anchor sequence is between IL-8 and RASSF6; between the IL-8 enhancer and RASSF6; between CXCL1 and CXCL4; between CXCL2 and EPGN; or between the E2 enhancer and EPGN.
- B59 The system of any of embodiments B55-B58, wherein the first anchor sequence is between the IL-8 enhancer and RASSF6 and the second anchor sequence is between the E2 enhancer and EPGN.
- B60 The system of any of embodiments B55-B59, wherein the first anchor sequence is between CXCL1 and CXCL4 and the second anchor sequence is between the E2 enhancer and EPGN.
- B66 The system of any of embodiments B55-B65, wherein the first effector and the second effector each independently comprises a protein chosen from HDAC 1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, or a functional variant or fragment of any thereof.
- B70 The system of any of embodiments B55-B69, wherein the first oligonucleotide and the second oligonucleotide are identical.
- B71 The system of any of embodiments B55-B70, wherein the first oligonucleotide and the second oligonucleotide are different.
- nucleic acid of embodiment B80 wherein a single nucleic acid encodes both of the first site-specific disrupting agent and tire second site-specific disrupting agent.
- nucleic acid of embodiment B81 wherein a first nucleic acid encodes the first sitespecific disrupting agent and a second nucleic acid encodes the second site-specific disrupting agent.
- a method of decreasing expression of a first gene and a second gene in a cell comprising contacting the cell with a system according to any of embodiments B55-B79 of a nucleic acid composition according to any of embodiments B80-B82.
- B86 The method, human cell, site-specific disrupting agent, or system of any of embodiments B1-B85, wherein the first gene is CXCL1 and the second gene is CXCL2.
- B87 The method, human cell, site-specific disrupting agent, or system of any of embodiments B1-B85, wherein the first gene is CXCL1 and the second gene is CXCL3.
- BIOL The method, human cell, site-specific disrupting agent, or system of any of embodiments B 1-B85, wherein the first gene is CXCL3 and the second gene is CXCL4.
- Bl 02. The method, human cell, site-specific disrupting agent, or system of any of embodiments B1-B85, wherein the first gene is CXCL3 and the second gene is CXCL5.
- B103 The method, human cell, site-specific disrupting agent, or system of any of embodiments B1-B85, wherein the first gene is CXCL3 and the second gene is CXCL6.
- B 104 The method, human cell, site-specific disrupting agent, or system of any of embodiments B 1-B85, wherein the first gene is CXCL3 and the second gene is CXCL7.
- Bl 05 The method, human cell, site-specific disrupting agent, or system of any of embodiments B 1-B85, wherein the first gene is CXCL4 and the second gene is CXCL5.
- B 106 The method, human cell, site-specific disrupting agent, or system of any of embodiments B 1-B85, wherein the first gene is CXCL4 and the second gene is CXCL6.
- B 109 The method, human cell, site-specific disrupting agent, or system of any of embodiments B1-B85, wherein the first gene is CXCL5 and the second gene is CXCL6.
- B 110 The method, human cell, site-specific disrupting agent, or system of any of embodiments B1-B85, wherein the first gene is CXCL5 and the second gene is CXCL7.
- Bi l l The method, human cell, site-specific disrupting agent, or system of any of embodiments B 1-B85, wherein the first gene is CXCL5 and the second gene is IL-8.
- B 112. The method, human cell, site-specific disrupting agent, or system of any of embodiments B 1-B85, wherein the first gene is CXCL6 and the second gene is CXCL7.
- Bl 13 The method, human cell, site-specific dismpting agent, or system of any of embodiments B 1-B85, wherein the first gene is CXCL6 and the second gene is IL-8.
- B 115 The method, human cell, site-specific dismpting agent, or system of any of embodiments B36-B85, wherein the first gene is CXCL1, the second gene is CXCL2, and the third gene is CXCL3.
- Bl 16 The method, human cell, site-specific dismpting agent, or system of any of embodiments B36-B85, wherein the first, second, and third genes are chosen from CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, or IL-8.
- Bl 18.
- B 120 The method, human cell, site-specific disrupting agent, or system of any of embodiments B36-B85, wherein the first, second, third, fourth, fifth, sixth, and seventh genes are chosen from CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, or IL-8.
- B 123 The method, human cell, site-specific disrupting agent, or system of any of the preceding embodiments, wherein the second gene is a cytokine.
- site-specific disrupting agent comprises a nucleic acid (e.g., DNA or RNA) comprising a nucleotide sequence chosen from SEQ ID NOs: 20-62, or a sequence having at least 90%, 95%, 98%, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto.
- a nucleic acid e.g., DNA or RNA
- site-specific disrupting agent of any of the preceding embodiments, wherein the site-specific disrupting agent comprises a nucleic acid (e.g., DNA or RNA) comprising a nucleotide sequence chosen from SEQ ID NOs: 21, 22, 24, 40, or a sequence having at least 90%, 95%, 98%, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto.
- a nucleic acid e.g., DNA or RNA
- SEQ ID NOs: 21, 22, 24, 40 or a sequence having at least 90%, 95%, 98%, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto.
- B 133 The method or site-specific disrupting agent of any of the preceding embodiments, wherein the site-specific disrupting agent binds to a sequence at least partially overlapping with the region having genomic coordinates chosen from Table 4 5, 6, 7, or a sequence that is within 5, 10, 15, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides of said region.
- B 135. The method or human cell of any of the preceding embodiments, wherein a level of a cytokine (e.g., a chemokine) is decreased, e.g., upon stimulation of the cell with TNF-alpha, e.g., measured as described in Examples 2-11.
- a cytokine e.g., a chemokine
- transcript level of one or more of (e.g., 2, 3, or all of) CXCL1, CXCL2, CXCL3, and IL8 is decreased, e.g., upon stimulation ofthe cell with TNF-alpha, e.g., measured as described in Examples 2 or 4-11.
- B138 The method or human cell of any of embodiments B132-B137, wherein the decrease is a decrease of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to pre-treatment levels or to a human cell with an undisrupted ASMC.
- B 140 The method or human cell of any of the preceding embodiments, wherein the protein level (e.g., secreted protein level) of one or more of (e.g., 2, 3, or all of) CXCL4, CXCL5, CXCL6, CXCL7, and IL8 is decreased, e.g., upon stimulation of the cell with TNF- alpha.
- protein level e.g., secreted protein level
- B141 The method or human cell of embodiment B140, wherein the decrease is a decrease of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to pre-treatment levels or to a human cell with an undisrupted ASMC.
- inflammatory disease is an autoimmune disorder, e.g., rheumatoid arthritis.
- inflammatory disease is associated with a pathogenic infection, e.g., viral infection, e.g., SARS-CoV2 infection.
- a pathogenic infection e.g., viral infection, e.g., SARS-CoV2 infection.
- tire inflammatory disease is associated with a superinfection, e.g., infection caused by two or more pathogenic agents, e.g., by a virus and a bacterium, (e.g., by SARS-CoV2 and Streptococcus pneumoni), e.g., by a virus and a fungus, (e.g., by SARS-CoV2 and mucormycosis).
- a superinfection e.g., infection caused by two or more pathogenic agents, e.g., by a virus and a bacterium, (e.g., by SARS-CoV2 and Streptococcus pneumoni), e.g., by a virus and a fungus, (e.g., by SARS-CoV2 and mucormycosis).
- the cell is a cell of a subject having rheumatoid arthritis, inflammatory, arthritis, gout, asthma, , neutrophilic asthma, neutrophilic dermatosis, paw edema, acute respiratory' disease syndrome (ARDS), COVID-19, psoriasis, inflammatory bowel disease, infection (e.g., by a pathogen, e.g., a bacteria, a viruses, or a fungus), external injury (e.g., scrapes or foreign objects), effects of radiation or chemical injury, osteoarthritis, osteoarthritic joint pain, joint pain, inflammatory pain, acute pain, chronic pain, cystitis, bronchitis, dermatitis, dermatosis, cardiovascular disease, neurodegenerative disease, liver disease, lung disease, kidney disease, pain, swelling, stiffness, tenderness, redness, warmth, or elevated biomarkers related to disease
- B 152 The method, human cell, site-specific disrupting agent, or system of any of the preceding embodiments, wherein the cell is a cell of a subject having rheumatoid arthritis, psoriasis, or inflammatory bowel disease.
- B155 The method, site-specific disrupting agent, or system of any of the preceding embodiments, wherein the second gene (and optionally the third, fourth, fifth, sixth, seventh, or eighth genes) is transcribed in the same direction as the first gene.
- the first anchor sequence comprises a binding motif selected from a CTCF binding motif, USF1 binding motif, YY1 binding motif, TAF3 binding motif, or ZNF143 binding motif.
- site-specific disrupting agent binds specifically to or proximal to the first anchor sequence with sufficient affinity that it competes with binding of an endogenous nucleating polypeptide (e.g., CTCF, USF1, YY1, TAF3, or ZNF143) within the cell.
- an endogenous nucleating polypeptide e.g., CTCF, USF1, YY1, TAF3, or ZNF143
- site-specific disrupting agent comprises a targeting moiety or effector moiety comprising a first CRISPR/Cas molecule comprising a first CRISPR/Cas protein and first guide RNA.
- first site-specific disrupting agent comprises a first targeting moiety or first effector moiety comprising a first CRISPR/Cas molecule comprising a first CRISPR/Cas protein and first guide RNA
- second site-specific disrupting agent comprises a second targeting moiety or second effector moiety comprising a second CRISPR/Cas molecule comprising a second CRISPR/Cas protein and second guide RNA.
- site-specific dismpting agent comprises a targeting moiety or effector moiety comprising TAL effector molecule, a CRISPR/Cas molecule, a zinc finger domain, a tetR domain, a meganuclease, or an oligonucleotide.
- the first sitespecific disrupting agent comprises a first targeting moiety or first effector moiety comprising TAL effector molecule, a CRISPR/Cas molecule, a zinc finger domain, a tetR domain, a meganuclease, or an oligonucleotide
- the second site-specific disrupting agent comprises a second targeting moiety or second effector moiety comprising TAL effector molecule, a CRISPR/Cas molecule, a zinc finger domain, a tetR domain, a meganuclease, or an oligonucleotide.
- site-specific disrupting agent comprises an effector moiety comprising a histone modifying functionality, e.g., a histone methyltransferase, histone demethylase, or histone deacetylase activity.
- a histone modifying functionality e.g., a histone methyltransferase, histone demethylase, or histone deacetylase activity.
- first and/or the second site-specific disrupting agent comprises an effector moiety comprising a histone modifying functionality, e.g., a histone methyltransferase, histone demethylase, or histone deacetylase activity.
- a histone modifying functionality e.g., a histone methyltransferase, histone demethylase, or histone deacetylase activity.
- B 166 The method, site-specific disrupting agent, or system of embodiment B 164 or B 165, wherein the effector moiety comprises a protein chosen from SETDB1, SETDB2, EHMT2 (i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, or a functional variant or fragment of any thereof.
- EHMT2 i.e., G9A
- EHMT1 i.e., GLP
- the method, site-specific disrupting agent, or system of embodiment B 164 or B 165 wherein the effector moiety comprises a protein chosen from HDAC 1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, or a functional variant or fragment of any thereof.
- site-specific disrupting agent comprises an effector moiety comprising a DNA modifying functionality, e.g., a DNA methyltransferase.
- first and/or the second site-specific disrupting agent comprises an effector moiety comprising a DNA modifying functionality, e.g., a DNA methyltransferase.
- B172 The method, site-specific disrupting agent, or system of embodiment Bl 70 or B171, wherein the effector moiety comprises a protein chosen from MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, DNMT3a/31, or a functional variant or fragment of any thereof.
- the effector moiety comprises a protein chosen from MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, DNMT3a/31, or a functional variant or fragment of any thereof.
- DNMT3 e.g., DNMTSa, DNMT3L, DNMT3a/31, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, or DNMT3B6
- DNMT3 e.g., DNMTSa, DNMT3L, DNMT3a/31, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, or DNMT3B6
- site-specific disrupting agent comprises an effector moiety comprising a transcriptional repressor.
- B 184 The method, site-specific disrupting agent, or system of embodiment B 182, wherein the oligonucleotide has a sequence that comprises a complement of the second anchor sequence or to a sequence proximal to the second anchor sequence.
- B 185 The method, site-specific disrupting agent, or system of any of embodiments B 182-B 184, wherein the oligonucleotide comprises a chemical modification.
- site-specific disrupting agent comprises a peptide-nucleic acid mixmer.
- site-specific disrupting agent e.g., a targeting moiety or effector moiety of the site-specific disrupting agent
- the site-specific disrupting agent comprises a peptide or polypeptide.
- site-specific dismpting agent further comprises an effector moiety , e.g., an epigenetic modifying agent, e.g., a DNA methyltransferase, histone deacetylase, or a histone methyltransferase.
- an epigenetic modifying agent e.g., a DNA methyltransferase, histone deacetylase, or a histone methyltransferase.
- first and/or the second site-specific disrupting agent further comprises an effector moiety, e.g., an epigenetic modifying agent, e.g., a DNA methyltransferase, histone deacetylase, or a histone methyltransferase.
- an epigenetic modifying agent e.g., a DNA methyltransferase, histone deacetylase, or a histone methyltransferase.
- site-specific dismpting agent comprises a targeting moiety comprising a CRISPR/Cas molecule and an effector moiety comprising a transcriptional repressor, e.g., as a fusion molecule.
- Bl 98 The method or system of any preceding embodiment, wherein the first and/or the second site-specific dismpting agent comprises a targeting moiety comprising a CRISPR/Cas molecule and an effector moiety comprising a transcriptional repressor, e.g., as a fusion molecule.
- B 199 The method or site-specific disrupting agent of embodiment B 198, wherein the targeting moiety comprises dCas9 and the effector moiety KRAB or a functional variant or portion thereof.
- the first and/or the second site-specific disrupting agent comprises a targeting moiety comprising a CRISPR/Cas molecule and an effector moiety comprising a histone methyltransferase, e.g., as a fusion molecule.
- site-specific disrupting agent comprises a targeting moiety comprising a CRISPR/Cas molecule and an effector moiety comprising a DNA methyltransferase, e.g., as a fusion molecule.
- site-specific disrupting agent comprises a targeting moiety comprising a CRISPR/Cas molecule, a first effector moiety comprising a histone methyltransferase, and a second effector moiety comprising a transcriptional repressor, e.g., as a fusion molecule.
- site-specific disrupting agent comprises a targeting moiety comprising a CRISPR/Cas molecule, and an effector moiety comprising a histone deacetylase, e.g., as a fusion molecule.
- site-specific disrupting agent comprises a targeting moiety comprising a CRISPR/Cas molecule, a first effector moiety comprising a histone methyltransferase, and a second effector moiety comprising a histone deacetylase, e.g., as a fusion molecule.
- site-specific disrupting agent comprises an amino acid sequence encoded by a nucleic acid sequence chosen from SEQ ID NOs: 69, 71, 85, 201, 202, 204, 205, 207, 209, 211, 213, 215, 217, or 219- 242, a complementary or reverse complementary sequence of any thereof, or comprises a sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to any thereof.
- site-specific disrupting agent comprises an amino acid sequence chosen from any one of SEQ ID NOs:70, 72, 82, 84, 86, 203, 206, 208, 210, 212, 214, 216, or 218, or encoded by a sequence chosen from any one of SEQ ID NOs: 219-242, or comprises a sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to any thereof.
- B217 The method or site-specific disrupting agent, or system of any of the preceding embodiments, wherein the cell is a mammalian cell, e.g., a human cell.
- B219. The method, site-specific disrupting agent, or system of any of the preceding embodiments, wherein the cell is a primary cell.
- B220. The method of any of the preceding embodiments, wherein the step of contacting is performed ex vivo.
- invention B220 further comprising, prior to the step of contacting, a step of removing the cell (e.g., mammalian cell) from a subject.
- a step of removing the cell e.g., mammalian cell
- a reaction mixture comprising a cell (e.g., a human cell, e.g., a primary human cell) and a site-specific disrupting agent, or system of any of preceding embodiments.
- a cell e.g., a human cell, e.g., a primary human cell
- a site-specific disrupting agent e.g., a site-specific disrupting agent
- a method of treating a subject having an inflammatory disorder comprising: administering to tire subject a site-specific disrupting agent, system or reaction mixture of any preceding embodiments in an amount sufficient to treat the inflammatory disorder, thereby treating the inflammatory disorder.
- inflammatory disorder is an autoimmune disorder, e.g., rheumatoid arthritis.
- a superinfection e.g., infection caused by two or more pathogenic agents, e.g., by a virus and a bacterium, (e.g., by SARS-CoV2 and Streptococcus pneumom), e.g, by a virus and a fungus, (e.g., by SARS-CoV2 and mucormycosis).
- pathogenic agents e.g., by a virus and a bacterium, (e.g., by SARS-CoV2 and Streptococcus pneumom)
- a virus and a fungus e.g., by SARS-CoV2 and mucormycosis
- a method of treating a subject having cancer comprising: administering to the subject an expression repressor, system, nucleic acid, nucleic acid system, or reaction mixture of any of the preceding embodiments in an amount sufficient to treat the cancer, thereby treating the cancer.
- the cancer is lung cancer (e.g., non-small cell lung cancer), breast cancer, hepatocellular carcinoma (HCC), prostate cancer, colon cancer, skin cancer, cervical cancer, ovarian cancer, uterine endometrioid carcinoma, endometrial cancer, mature B-cell lymphoma, bladder cancer, esophagogastric cancer, esophageal adenocarcinoma, bone cancer, melanoma, hepatobiliary cancer, thyroid cancer, mature B-cell neoplasms, glioma, head-neck squamous cell carcinoma, kidney renal clear cell carcinoma, pancreatic cancer (e.g., pancreatic ductal adenocarcinoma), sarcoma, or stomach adenocarcinoma.
- lung cancer e.g., non-small cell lung cancer
- breast cancer breast cancer
- HCC hepatocellular carcinoma
- prostate cancer colon cancer
- skin cancer cervical cancer
- sequence database reference numbers All publications, patent applications, patents, and other references (e.g., sequence database reference numbers) mentioned herein are incorporated by reference in their entirety. For example, all GenBank, Unigene, and Entrez sequences referred to herein, e.g., in any Table herein, are incorporated by reference. Unless otherwise specified, the sequence accession numbers specified herein, including in any Table herein, refer to the database entries current as of March 30, 2022. When one gene or protein references a plurality of sequence accession numbers, all of the sequence variants are encompassed.
- Anchor sequence refers to a nucleic acid sequence recognized by a nucleating agent that binds sufficiently to form an anchor sequence-mediated conjunction, e.g., a complex.
- an anchor sequence comprises one or more CTCF binding motifs.
- an anchor sequence is not located within a gene coding region.
- an anchor sequence is located within an intergenic region.
- an anchor sequence is not located within either of an enhancer or a promoter.
- an anchor sequence is located at least 400 bp, at least 450 bp, at least 500 bp, at least 550 bp, at least 600 bp, at least 650 bp, at least 700 bp, at least 750 bp, at least 800 bp, at least 850 bp, at least 900 bp, at least 950 bp, or at least Ikb away from any transcription start site.
- an anchor sequence is located within a region that is not associated with genomic imprinting, monoallelic expression, and/or monoallelic epigenetic marks.
- the anchor sequence has one or more functions selected from binding an endogenous nucleating polypeptide (e.g., CTCF), interacting with a second anchor sequence to form an anchor sequence mediated conjunction, or insulating against an enhancer that is outside the anchor sequence mediated conjunction.
- an endogenous nucleating polypeptide e.g., CTCF
- technologies are provided that may specifically target a particular anchor sequence or anchor sequences, without targeting other anchor sequences (e.g., sequences that may contain a nucleating agent (e.g., CTCF) binding motif in a different context): such targeted anchor sequences may be referred to as the “target anchor sequence”.
- sequence and/or activity of a target anchor sequence is modulated while sequence and/or activity of one or more other anchor sequences that may be present in the same system (e.g., in the same cell and/or in some embodiments on the same nucleic acid molecule - e.g., the same chromosome) as the targeted anchor sequence is not modulated.
- the anchor sequence comprises or is a nucleating polypeptide binding motif. In some embodiments, the anchor sequence is adjacent to a nucleating polypeptide binding motif.
- Anchor sequence-mediated conjunction refers to a DNA structure, in some cases, a complex, that occurs and/or is maintained via physical interaction or binding of at least two anchor sequences in the DNA by one or more polypeptides, such as nucleating polypeptides, or one or more proteins and/or a nucleic acid entity (such as RNA or DNA), that bind the anchor sequences to enable spatial proximity and functional linkage between the anchor sequences.
- Two events or entities are “associated” with one another, as that term is used herein, if presence, level, form and/or function of one is correlated with that of the other.
- a particular entity e.g., polypeptide, genetic signature, metabolite, microbe, etc.
- two or more entities are physically “associated” with one another if they interact, directly or indirectly, so that they are and/or remain in physical proximity with one another.
- two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof.
- a DNA sequence is “associated with” a target genomic or transcription complex when the nucleic acid is at least partially within the target genomic or transcription complex, and expression of a gene in the DNA sequence is affected by formation or disruption of the target genomic or transcription complex.
- CXCL locus refers to the portion of the human genome that encodes CXCL 1-7 and IL-8, enhancers El and E2, and anchor sequences that form an ASMC comprising CXCL1-7 and IL-8, or the homologous region of the genome in a non-human animal. In some embodiments, the CXCL locus is situated on human chromosome 4.
- CXCL gene refers to human CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, or IL-8, or a homologous non-human gene.
- Human IL-8 is sometimes also referred to as CXCL8.
- Site-specific disrupting agent refers to an agent or entity that specifically inhibits, dissociates, degrades, and/or modifies one or more components of a genomic complex, e.g., ASMC, thereby modulating, e.g., decreasing, expression of a target plurality of genes as described herein.
- a site-specific disrupting agent interacts with one or more components of a genomic complex.
- a site-specific disrupting agent binds (e.g., directly or, in some embodiments, indirectly) to one or more genomic complex components.
- a site-specific disrupting agent binds to an anchor sequence, e.g., a first and/or second anchor sequence, that may be part of an ASMC comprising a target plurality of genes. In some embodiments, a site-specific disrupting agent binds to a site proximal to an anchor sequence, e.g., a first and/or second anchor sequence, that may be part of an ASMC comprising a target plurality of genes. In some embodiments, a site-specific disrupting agent modifies one or more genomic complex components. In some embodiments, a site-specific disrupting agent comprises an oligonucleotide. In some embodiments, a site-specific disrupting agent comprises a polypeptide.
- a site-specific disrupting agent comprises an antibody (e.g., a monospecific or multispecific antibody construct) or antibody fragment.
- a site-specific disrupting agent is directed to a particular genomic location and/or to a genomic complex by a targeting moiety, as described herein.
- a site-specific disrupting agent comprises a genomic complex component or variant thereof.
- a site-specific dismpting agent comprises a targeting moiety.
- a site-specific disrupting agent comprises an effector moiety.
- a site-specific disrupting agent comprises a plurality of effector moieties.
- a site-specific disrupting agent comprises a targeting moiety and one or more effector moieties.
- the site-specific disrupting agent specifically binds a first site in the genome with higher affinity than a second site in the genome (e.g., relative to any other site in the genome).
- the site-specific dismpting agent preferentially inhibits, dissociates, degrades, and/or modifies one or more components of a first genomic complex relative to a second genomic complex (e.g., relative to any other genomic complex).
- a site-specific disrupting agent may be an expression repressor, e.g., the site-specific disrupting agent may inhibit an ASMC, thereby reduce expression of a gene in the ASMC.
- domain refers to a section or portion of an entity.
- a “domain” is associated with a particular structural and/or functional feature of the entity so that, when the domain is physically separated from the rest of its parent entity, it substantially or entirely retains the particular structural and/or functional feature.
- a domain may be or include a portion of an entity that, when separated from that (parent) entity and linked with a different (recipient) entity, substantially retains and/or imparts on the recipient entity one or more structural and/or functional features that characterized it in the parent entity.
- a domain is or comprises a section or portion of a molecule (e.g., a small molecule, carbohydrate, lipid, nucleic acid, polypeptide, etc.). In some embodiments, a domain is or comprises a section of a polypeptide. In some such embodiments, a domain is characterized by a particular structural element (e.g., a particular amino acid sequence or sequence motif, alpha-helix character, beta-sheet character, coiled-coil character, random coil character, etc.), and/or by a particular functional feature (e.g., binding activity, enzymatic activity, folding activity, signaling activity, etc.).
- a particular structural element e.g., a particular amino acid sequence or sequence motif, alpha-helix character, beta-sheet character, coiled-coil character, random coil character, etc.
- a particular functional feature e.g., binding activity, enzymatic activity, folding activity, signaling activity, etc.
- El cis-acting regulatory element (El cRE): Tire term “El cRE” and “El cis-acting regulatory element), as used herein, refers to a nucleic acid sequence positioned proximal to (e.g., approximately 14kb upstream of) IL8 in the human genome (see Fig. 16B) and recognized by a trans-acting factor (e.g., a transcription factor, e.g., p65) that binds sufficiently to upregulate expression of one or more CXCL genes.
- a trans-acting factor e.g., a transcription factor, e.g., p65
- E2 cis-acting regulatory element E2 cRE: The term “E2 cRE” and “E2 cis-acting regulatory element), as used herein, refers to a nucleic acid sequence positioned proximal to CXCL2 in the human genome (see Fig. 16B) and recognized by a trans-acting factor (e.g., a transcription factor, e.g., p65) that binds sufficiently to upregulate expression of one or more CXCL genes.
- a trans-acting factor e.g., a transcription factor, e.g., p65
- effector moiety refers to a domain with one or more functionalities that modulate, e.g., decrease, expression of a target plurality of genes in a cell when appropriately localized in the nucleus of a cell.
- an effector moiety comprises a polypeptide.
- an effector moiety comprises a polypeptide and a nucleic acid.
- a functionality associated with an effector moiety may directly affect expression of a target plurality of genes, e.g., blocking recruitment of a transcription factor that would stimulate expression of the gene.
- a functionality associated with an effector moiety may indirectly affect expression of a target plurality of genes, e.g., introducing epigenetic modifications or recruiting other factors that introduce epigenetic modifications that induce a change in chromosomal topology that inhibits expression of a target plurality of genes.
- Expression repressor refers to an agent or entity with one or more functionalities that decreases expression of a target gene in a cell and that specifically binds to a DNA sequence (e.g., a DNA sequence associated with a target gene or a transcription control element operably linked to a target gene).
- An expression repressor comprises at least one targeting moiety and optionally one effector moiety .
- an expression repressor binds to a site proximal to an enhancer sequence that may be operably linked to a target plurality of genes.
- an expression repressor comprises an oligonucleotide.
- an expression repressor comprises a polypeptide.
- an expression repressor comprises a plurality of effector moieties.
- an expression repressor comprises a targeting moiety and one or more effector moieties.
- the expression repressor specifically binds a first site in the genome with higher affinity than a second site in the genome (e.g., relative to any other site in the genome).
- Genomic complex is a complex that brings together two genomic sequence elements that are spaced apart from one another on one or more chromosomes, via interactions between and among a plurality of protein and/or other components (potentially including, the genomic sequence elements).
- the genomic sequence elements are anchor sequences to which one or more protein components of the complex binds.
- a genomic complex may comprise an anchor sequence-mediated conjunction.
- a genomic sequence element may be or comprise a CTCF binding motif, a promoter and/or an enhancer.
- a genomic sequence element includes at least one or both of a promoter and/or regulatory site (e.g., an enhancer).
- complex formation is nucleated at tire genomic sequence element(s) and/or by binding of one or more of the protein component(s) to the genomic sequence element(s).
- co-localization e.g., conjunction
- a genomic complex comprises an anchor sequence-mediated conjunction, which comprises one or more loops.
- a genomic complex as described herein is nucleated by a nucleating polypeptide such as, for example, CTCF and/or Cohesin.
- a genomic complex as described herein may include, for example, one or more of CTCF, Cohesm, non-coding RNA (e.g., eRNA), transcriptional machinery proteins (e.g., RNA polymerase, one or more transcription factors, for example selected from the group consisting ofTFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, etc.), transcriptional regulators (e.g., Mediator, P300, enhancer-binding proteins, repressor-binding proteins, histone modifiers, etc.), etc.
- CTCF non-coding RNA
- eRNA e.g., eRNA
- transcriptional machinery proteins e.g., RNA polymerase, one or more transcription factors, for example selected from the group consisting ofTFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, etc.
- transcriptional regulators e.g., Mediator, P300, enhancer-binding proteins,
- a genomic complex as described herein includes one or more polypeptide components and/or one or more nucleic acid components (e.g., one or more RNA components), which may, in some embodiments, be interacting with one another and/or with one or more genomic sequence elements (e.g., anchor sequences, promoter sequences, regulatory sequences (e.g., enhancer sequences)) so as to constrain a stretch of genomic DNA into a topological configuration (e.g., a loop) that it does not adopt when the complex is not formed.
- genomic sequence elements e.g., anchor sequences, promoter sequences, regulatory sequences (e.g., enhancer sequences)
- nucleic acid refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain.
- a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage.
- nucleic acid refers to an individual nucleic acid residue (e g., a nucleotide and/or nucleoside); in some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising individual nucleic acid residues.
- a "nucleic acid” is or comprises RNA; in some embodiments, a “nucleic acid” is or comprises DNA.
- a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues.
- a nucleic acid is, comprises, or consists of one or more nucleic acid analogs.
- a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone.
- a nucleic acid is, comprises, or consists of one or more "peptide nucleic acids", which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.
- a nucleic acid has one or more phosphorothioate and/or 5'-N-phosphoramidite linkages rather than phosphodiester bonds.
- a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine).
- adenosine thymidine, guanosine, cytidine
- uridine deoxyadenosine
- deoxythymidine deoxy guanosine
- deoxycytidine deoxycytidine
- a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5- methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5- fluorouridine, C5 -iodouridine, C5 -propynyl-uridine, C5 -propynyl-cytidine, C5 -methylcytidine, 2- aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)- methylguanine, 2-thiocytidine, methylated bases, inter
- a nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'- deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids.
- a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein.
- a nucleic acid includes one or more introns.
- nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis.
- a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long.
- a nucleic acid is partly or wholly single stranded; in some embodiments, a nucleic acid is partly or wholly double stranded.
- a nucleic acid has a nucleotide sequence comprising at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide. In some embodiments, a nucleic acid has enzymatic activity. In some embodiments, a nucleic acid is an mRNA nucleic acid and may be monocistronic or polycistronic (e.g., bi-cistronic, tri- cistronic, etc.).
- operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
- a genomic regulatory element e.g., transcription control element
- operably linked to a functional element, e.g ., gene, is associated in such a way that expression and/or activity of the functional element, e.g., gene, is achieved under conditions compatible with the genomic regulatory element (e.g., transcription control element).
- an "operably linked" genomic regulatory element e.g., transcription control elements
- coding elements e.g., genes, of interest
- operably linked an genomic regulatory element acts in cis to or otherwise at a distance from the functional element, e.g., gene, of interest.
- an "operably linked" genomic regulatory element e.g., transcription control element
- a coding element e.g., gene, of interest
- an operably linked genomic regulatory 7 element e.g., transcription control element
- two operably linked nucleic acid sequences are comprised on the same nucleic acid.
- two operably linked nucleic acid sequences are proximal to one another on the same nucleic acid, e g., within 1000, 500, 100, 50, or 10 base pairs of each other or directly adjacent to each other.
- Peptide, Polypeptide, Protein refers to a compound comprised of amino acid residues covalently linked by peptide bonds, or by means other than peptide bonds.
- a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence.
- Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or by means other than peptide bonds.
- proximal refers to a closeness of two sites, e.g., nucleic acid sites, such that binding of an expression repressor or site-specific disrupting agent at the first site and/or modification of the first site by an expression repressor or site-specific disrupting agent will produce the same or substantially the same effect as binding and/or modification of the other site.
- a DNA-targeting moiety may bind to a first site that is proximal to an anchor sequence (the second site), and the effector moiety associated with said DNA-targeting moiety may epigenetically modify the first site such that the binding of the anchor sequence to an endogenous nucleating polypeptide modified, substantially the same as if the second site (the anchor sequence) had been bound and/or modified.
- sites that are proximal to one another are less than 5000, 4000, 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 50, 40, 30, 20, 10, or 5 base pairs from one another.
- sequence targeting polypeptide refers to a protein, e.g., a protein comprising a CRISPR/Cas domain, a TAL effector domain, or a Zn Finger domain, that recognizes or specifically binds to a target nucleic acid sequence.
- sequence targeting polypeptide is a catalytically inactive protein, such as dCas9, a TAL effector molecule, or a Zn Finger domain, that lacks endonuclease activity.
- Specific binding refers to an ability to discriminate between possible binding partners in the environment in which binding is to occur.
- a binding agent that interacts with one particular target when other potential targets are present is said to "bind specifically" to the target with which it interacts.
- specific binding is assessed by detecting or determining degree of association between the binding agent and its partner; in some embodiments, specific binding is assessed by detecting or determining degree of dissociation of a binding agent-partner complex. In some embodiments, specific binding is assessed by detecting or determining ability of the binding agent to compete with an alternative interaction between its partner and another entity. In some embodiments, specific binding is assessed by performing such detections or determinations across a range of concentrations.
- subject refers to any organism to which a provided compound or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject may be suffering from, and/or susceptible to a disease, disorder, and/or condition.
- animals e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.
- the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest.
- One of ordinary skill in the art will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result.
- the term “substantially” may therefore be used in some embodiments herein to capture potential lack of completeness inherent in many biological and chemical phenomena.
- Symptoms are reduced may be used when one or more symptoms of a particular disease, disorder or condition is reduced in magnitude (e.g., intensity, severity, etc.) and/or frequency. In some embodiments, a delay in the onset of a particular symptom is considered one form of reducing the frequency of that symptom.
- Target An agent or entity is considered to “target” another agent or entity, in accordance with the present disclosure, if it binds specifically to the targeted agent or entity under conditions in which they come into contact with one another.
- an antibody or antigen-binding fragment thereof targets its cognate epitope or antigen.
- a nucleic acid having a particular sequence targets a nucleic acid of substantially complementary sequence.
- a targeting moiety that specifically binds an anchor sequence targets the anchor sequence, the ASMC comprising the anchor sequence, and/or the plurality of genes within the ASMC.
- Target plurality of genes means a group of more than one gene (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or more genes) that is targeted for modulation, e.g., of expression.
- a target plurality of genes is part of a targeted genomic complex.
- each gene of a target plurality of genes is operably linked to an enhancer, e.g., an El enhancer, wherein the enhancer is targeted by an expression repressor as described herein.
- modulation comprises inhibition of expression of the target plurality of genes.
- a target plurality of genes is modulated by contacting the target plurality of genes or a genomic regulatory element (e.g., transcription control element) operably linked to one or more of the target plurality of genes with an expression repressor described herein.
- a target plurality of genes is aberrantly expressed (e.g., over-expressed) in a cell, e.g., a cell in a subject (e.g., patient).
- the target plurality of genes has related functionalities.
- the genes of a target plurality of genes may all have a pro-inflammatory effect when expressed; the genes of such a target plurality of genes may be referred to herein as pro-inflammatory genes or target pro-inflammatory genes.
- a gene of a target plurality of genes encodes a protein.
- a gene of a target plurality of genes encodes a functional RNA.
- Targeting moiety means an agent or entity that specifically interacts (e.g., targets) with a component or set of components, e.g., DNA.
- the component or components participates in a genomic complex as described herein (e g., an anchor sequence -mediated conjunction).
- a targeting moiety in accordance with the present disclosure targets one or more target component(s) of a genomic complex as described herein.
- a targeting moiety targets a genomic regulatory element (e.g., an El enhancer).
- a targeting moiety targets an anchor sequence.
- a targeting moiety targets a genomic complex component other than a genomic regulatory element.
- a targeting moiety targets a plurality or combination of genomic complex components, which plurality in some embodiments may include a genomic sequence element.
- effective inhibition, dissociation, degradation, and/or modification of one or more genomic complexes, as described herein, can be achieved by targeting complex component(s) comprising genomic sequence element(s).
- the present disclosure contemplates that improved (e.g., with respect to, for example, degree of specificity for a particular genomic complex as compared with other genomic complexes that may form or be present in a given system, effectiveness of the inhibition, dissociation, degradation, or modification [e.g., in terms of impact on number of complexes detected in a population]) inhibition, dissociation, degradation, or modification may be achieved by targeting one or more complex components that is not a genomic sequence element and, optionally, may alternatively or additionally include targeting a genomic sequence element, wherein improved inhibition, dissociation, degradation, or modification is relative to that typically achieved through targeting genomic sequence element(s) alone.
- improved inhibition, dissociation, degradation, or modification is relative to that typically achieved through targeting genomic sequence element(s) alone.
- a site-specific disrupting agent as described herein promotes inhibition, dissociation, degradation, or modification of a target genomic complex.
- a site-specific disrupting agent as described herein inhibits, dissociates, degrades (e.g., a component of), and/or modifies (e.g., a component of) an anchor sequence- mediated conjunction by targeting at least one component of a given genomic complex (e.g., comprising the anchor sequence-mediated conjunction).
- a site-specific disrupting agent as described herein inhibits, dissociates, degrades (e.g., a component of), and/or modifies (e.g., a component of) a particular genomic complex (i.e., a target genomic complex) and does not inhibit, dissociate, degrade (e.g., a component of), and/or modify (e.g., a component of) at least one other particular genomic complex (i.e., a non-target genomic complex) that, for example, may be present in other cells (e.g., in non-target cells) and/or that may be present at a different site in the same cell (i.e., within a target cell).
- An expression repressor or a site-specific disrupting agent as described herein may comprise a targeting moiety.
- a targeting moiety also acts as an effector moiety (e.g., disrupting moiety); in some such embodiments a provided expression repressor or site-specific disrupting agent may lack any effector moiety (e.g., disrupting, modifying, or other effector moiety) separate (or meaningfully distinct) from the targeting moiety.
- therapeutically effective amount means an amount of a substance (e.g., a therapeutic agent, composition, and/or formulation) that elicits a desired biological response when administered as part of a therapeutic regimen.
- a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the disease, disorder, and/or condition.
- an effective amount of a substance may vary depending on such factors as desired biological endpoint(s), substance to be delivered, target cell(s) ortissue(s), etc.
- an effective amount of compound in a formulation to treat a disease, disorder, and/or condition is an amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and/or reduces incidence of one or more symptoms or features of the disease, disorder, and/or condition.
- a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.
- Genomic regulatory sequence refers to a nucleic acid sequence that increases or decreases transcription of a gene.
- An “enhancing sequence” increases the likelihood of gene transcription.
- a “silencing or repressor sequence” decreases the likelihood of gene transcription.
- Examples of genomic regulatory sequences include promoters and enhancers.
- the genomic regulatory sequence is a cis-acting regulatory element.
- an ASMC comprises a genomic regulatory sequence. Such a genomic regulatory sequence is referred to as an internal genomic regulatory sequence (e.g., an enhancing sequence that is comprised within an ASMC is referred to as an internal enhancing sequence).
- Figure 1 shows a diagram showing exemplary positioning of gRNA sequences in an anchor sequence.
- Figure 1 discloses SEQ ID NOS 244-245, respectively, in order of appearance.
- Figure 2 shows a diagram showing exemplary positioning of gRNA sequences in an anchor sequence and restriction site information.
- Figure 2 discloses SEQ ID NOS 246-247, respectively, in order of appearance.
- Figure 3 shows a graph of expression (mRNA) of various chemokines in TNF-treated cells with and without treatment with a site-specific disrupting agent comprising a CRISPR/Cas molecule and first exemplary gRNA.
- Figure 4 shows a graph of expression (mRNA) of various chemokines in TNF-treated cells with and without treatment with a site-specific disrupting agent comprising a CRISPR/Cas molecule and a second exemplary gRNA.
- Figure 5 shows a diagram depicting different types of genomic complex, e.g., ASMCs, e.g., loops, and models for how to alter expression of genes contained within.
- ASMCs e.g., loops
- Figure 6 shows a graph of cytokine expression measured by RNA levels of CXCL1, CXCL2, CXCL3, and IL-8 in THP-1 cells treated with a site-specific disrupting agent comprising a CRISPR/Cas molecule and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- a site-specific disrupting agent comprising a CRISPR/Cas molecule and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- Figure 7 shows a graph of cytokine secretion (CXCL1 and IL-8) of THP-1 cells treated with sitespecific disrupting agent comprising a CRISPR/Cas molecule and different sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine -encoding genes.
- sitespecific disrupting agent comprising a CRISPR/Cas molecule and different sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine -encoding genes.
- Figure 8 shows a graph (top) of cytokine expression (CXCL3) measured by RNA level in THP-1 cells treated with a site-specific disrupting agent comprising a CRISPR/Cas molecule and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine -encoding genes, and a flow chart (bottom) showing how cells were processed in tire experiment.
- CXCL3 cytokine expression measured by RNA level in THP-1 cells treated with a site-specific disrupting agent comprising a CRISPR/Cas molecule and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine -encoding genes
- a genomic complex e.g., ASMC
- Figure 9A shows a graph (top) of cytokine expression (CXCL1) measured by RNA level in THP- 1 cells 3 weeks after treatment with a site-specific disrupting agent comprising a CRISPR/Cas molecule and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokineencoding genes, and a flow chart (bottom) showing how cells were processed in the experiment.
- a site-specific disrupting agent comprising a CRISPR/Cas molecule and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokineencoding genes
- Figure 9B shows a graph of cytokine expression (CXCL3) measured by RNA level in THP-1 cells 3 weeks after treatment with a site-specific disrupting agent comprising a CRISPR/Cas molecule and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- a site-specific disrupting agent comprising a CRISPR/Cas molecule and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- Figure 10 shows a graph of cytokine expression (CXCL1) measured by RNA level in THP-1 cells after treatment with a site-specific disrupting agent comprising a catalytically inactive CRISPR/Cas molecule and a transcriptional repressor (KRAB) and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- a site-specific disrupting agent comprising a catalytically inactive CRISPR/Cas molecule and a transcriptional repressor (KRAB) and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- KRAB transcriptional repressor
- Figure 11 shows a graph of cytokine expression (CXCL1) measured by RNA level in THP-1 cells after treatment with a site-specific disrupting agent comprising a catalytically inactive CRISPR/Cas molecule and a histone methyltransferase (EZH2) and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- CXCL1 cytokine expression measured by RNA level in THP-1 cells after treatment with a site-specific disrupting agent comprising a catalytically inactive CRISPR/Cas molecule and a histone methyltransferase (EZH2) and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- a site-specific disrupting agent comprising a catalytically inactive CRISPR/Cas molecule and a histone methyltransferas
- Figure 12 shows a graph of cytokine expression (CXCL1) measured by RNA level in THP-1 cells after treatment with a site-specific disrupting agent comprising a catalytically inactive CRISPR/Cas molecule and a DNA methyltransferase (MQ1) and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- CXCL1 cytokine expression measured by RNA level in THP-1 cells after treatment with a site-specific disrupting agent comprising a catalytically inactive CRISPR/Cas molecule and a DNA methyltransferase (MQ1) and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine-encoding genes.
- a site-specific disrupting agent comprising a catalytically inactive CRISPR/Cas molecule and a DNA methyltransferase (M
- Figure 13 shows a graph (top) of cytokine expression (CXCL1) measured by RNA level in THP- 1 cells after treatment with different site-specific disrupting agents for 72 hours, 3 weeks, or 4 weeks, and a flow chart (bottom) showing how cells were processed in the experiment.
- CXCL1 cytokine expression
- Figure 14 shows a graph (top) of cytokine expression (CXCL3) measured by RNA level in THP- 1 cells after treatment with different site-specific disrupting agents and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine -encoding genes, and a flow chart (bottom) showing how cells were processed in the experiment.
- CXCL3 cytokine expression
- Figure 15 shows a graph (top) of cytokine expression (CXCL1) measured by RNA level in THP- 1 cells after treatment with different site-specific disrupting agents and sgRNAs targeted to the anchor sequences of a genomic complex (e.g., ASMC) comprising cytokine -encoding genes.
- CXCL1 cytokine expression
- Figure 16 shows human CXCL IGD and gene cluster organization.
- Figure 16A shows a schematic Insulated Genomic Domain (IGD) illustrating the two loops within CXCL 1-8 gene cluster.
- CXCL8, CXCL6, and CXCL 1 genes reside on the left loop of the IGD.
- CXCL2-5 and CXCL7 genes reside on the right loop of the IGD.
- Figure 16B shows guides were designed to the four different CTCF targets: Left CTCF-2, Left CTCF, Middle CTCF, and Right CTCF.
- FIG. 17 shows CXCL1-8 genes were downregulated when dCas9-EZH2 guide 30183 targeted Middle CTCF motif located within the CXCL1-8 cluster in TNF-alpha treated Human A549 lung cancer epithelial cells. Cells stimulated with TNF alpha were treated as control.
- Figure 18 shows CXCL1, 2, 3, 8 genes were downregulated when dCas9-EZH2 guide 30183 targeted Middle CTCF motif located within the CXCL 1-8 cluster in TNF-alpha treated Human IMR-90 normal lung fibroblast cells. Cells stimulated with TNF alpha were treated as control.
- FIG 19 shows that CXCL1, 2, 3, 8 genes were downregulated when Controller A targeted Left CTCF motif located within the CXCL1-8 cluster in TNF-alpha treated Human monocytes. Cells stimulated with TNF alpha were treated as control.
- Figure 20 shows mouse CXCL IGD and gene cluster organization.
- Figure 20A shows a schematic Insulated Genomic Domain (IGD) illustrating the two loops within CXCL gene cluster.
- Figure 20B illustrates the two loops within the CXCL1-5, 7 and 15 gene cluster.
- CXCL4, CXCL5, and CXCL7 genes reside on the left loop of the IGD.
- CXCL1-3 and CXCL15 genes reside on the right loop of the IGD guides were designed to the four different CTCF targets: Left (L), Middle 1(M1), Middle 2 (M2), and Right (R) CTCF.
- Figure 21A shows IGD guides were designed to the four different CTCF targets: Middle 1(M1), Middle 2 (M2), and Right (R) CTCF.
- Figure 21B shows in vitro downregulation of mouse CXCL IGD in Hep 1.6 using dCas9-MQl.
- dCas9-MQl was transfected using guides targeting the right, or one of the two middle CTCF motifs in the CXCL gene cluster, which showed no down regulation in any of the seven CXCL genes after TNF alpha stimulation (orange).
- dCas9-MQl was transfected using combination guides targeting both middle CTCF and right, the entire gene cluster was down regulated (blue).
- FIG 22A shows schematic experimental design to determine the effect of dCas9-MQl on decreasing leukocyte filtration in inflamed lungs.
- Each mouse was treated with either LNP alone or with dCas9-MQl at 3 mg/kg targeting the two middle and right CTCF at -2 hour time point.
- the mice were simulated with 5 mg/kg LPS at zero hours followed by a second dose of LNP alone or a dCas9-MQ 1 at 3 mg/kg targeting the two middle and right CTCF at the +8 hour time point.
- Dexamethasone was administered intraperitoneal at 10 mg/kg dose at time 0, 24, and 48 hours. The animals were terminated at 72 hours and bronchiolar lavage fluid were collected from the lungs for flow staining.
- Figure 22B shows systemic administration of a dCas9-MQl decreased leukocyte infiltration in the inflamed lungs.
- Total leukocyte count/mL in the bronchiolar lavage fluid obtained from dCas9-MQl treated mice showed significant differences compared to LPS + disease animals.
- Figure 23A shows the composition of infiltrating cells found in the bronchiolar lavage fluid obtained from an inflamed lung of a mice.
- the leukocyte cell types that make up the majority of the infiltrating cells are neutrophils, followed by B cells, T cells, macrophages and other types of hematopoietic cells.
- Figure 23B shows dCas9-MQl decreased the count of neutrophils infiltrating tire lungs with significant difference compared to the +LPS disease group.
- Figure 24 shows the decrease of leukocyte cells in the BALF was lung specific and not due to the decrease of white blood cells in the peripheral blood. This graph illustrated that the effect of decreasing leukocyte count in the BALF with the dCas9-MQl treatment was lung specific and was not because the mouse itself had a decrease in leukocyte population. The hematopoietic cell population in the peripheral blood was similar across all groups.
- Figures 25A-G show CXCL1-5, CXCL7, and CXCL15 gene expression was decreased in the lung tissue.
- the lung tissues were processed to check for CXCL gene expression by qPCR methods. All CXCL genes show downregulation when treated with dCA9-MQl. CXCL2 expression was most downregulated.
- Figures 26A-D show decreasing CXCL expression and cellular recruitment to the site of inflammation had a beneficial downstream effect of decreasing the presence of other cytokines.
- the chemokine protein levels secreted in the BALF showed decrease in CXCL 1 and 2 protein levels. Decreasing CXCL expression and cellular recruitment to the site of inflammation had beneficial downstream effects of decreasing the presence of GM-CSF (Fig 26C) and IL6 (Fig. 26D).
- Figures 27 and 28 are bar graphs showing the % downregulation (vs. cells + IL-1A) of CXCL genes using expression repressors targeting different sites in an El cRE. Overall, these graphs show how numerous effectors targeted to two different sites in the El cRE are able to achieve downregulation of multiple genes near the El cRE.
- Figure 29 is a bar graph showing the % downregulation (vs. cells + IL-1A) of CXCL genes using expression repressors targeting a site in an E2 cRE.
- Figures 30 and 31 are bar graphs showing how dCas9-KRAB (Fig 30) and dCas9-MQl (Fig 31) targeting a site in an El cRE are able to achieve downregulation of multiple genes near the El cRE. *p ⁇ 0.05, ***p ⁇ 0.001, ****p ⁇ 0.0001
- Figures 32 and 33 are bar graphs showing how dCas9-KRAB (Fig. 32) and dCas9-MQl (Fig. 33) targeting a site in an El cRE are able to achieve downregulation of multiple genes near the El cRE. *p ⁇ 0.05, ***p ⁇ 0.001, ****p ⁇ 0.0001
- Figure 34 is a bar graph showing how an expression repressor (dCas9-KRAB) targeting tire IL8 promoter successfully downregulates IL8 expression.
- dCas9-KRAB expression repressor
- Figure 35 is a bar graph showing how two expression repressors comprising zinc finger domain targeting moieties directed to different sites in the El cRE are able to achieve downregulation of multiple genes near the El cRE. Furthermore, the graph shows a dCas9-KRAB expression repressor directed to the IL8 promoter decreased expression of IL8 greater than 90%.
- Figure 36 is a bar graph showing a El cRE targeting expression repressor (zinc finger-KRAB), an IL8 promoter targeting expression repressor (dCas9-KRAB), and a combination of the two, do not interfere with one another and that the combination of expression repressors has a greater effect on IL8 compared to either expression repressor alone.
- Figure 37 is a bar graph showing decreasing expression of IL8 using expression repressors targeting a site in the El cRE or the IL8 promoter as measured by IL8 mRNA one hour after ILIA stimulation.
- Figures 38 and 39 are bar graphs showing decreasing expression of IL8 using expression repressor targeting as site m the El cRE or the 1L8 promoter, where 1L8 protein levels are measured by ELISA at 6 hours (Fig. 38) and 24 hours (Fig. 39) after ILI A stimulation.
- Figure 40 is a bar graph depicting the downregulation of mRNA levels of CXCL 1-3 and IL8 (percent downregulation calculated with normalization to ILIA treated control) by two expression repressors directed to two sites in the El cRE.
- Figure 41 is a bar graph showing the ability of two expression repressors (MR32105 and MR32104 comprising zinc finger targeting moieties and KRAB effector domains) directed to two sites in the El cRE to increase H3Kme3 as measured ChIP qPCR.
- Figure 42 is a bar graph showing the downregulation of CXCL1-3 and IL8 at 3-7 days post introduction of an expression repressor (MR32105) targeting the El cRE. Percent CXCL 1-3 and IL8 gene downregulation was calculated with normalization to IL-1A treated control. Downregulation of CXCL1, CXCL2, CXCL3, and IL8 are shown in order from left to right in groups of Day 3-7.
- MR32105 expression repressor
- Figure 43 is a bar graph showing the downregulation of IL8 using expression repressors targeting different sites in the IL8 promotor. Overall, this graph shows how numerous effectors targeted to different sites in the IL8 promotor are able to achieve downregulation of IL8.
- Figures 44A and 44B shows enrichment of El -targeting expression repressor derived from MR- 32105 to the El site (top panel), the resultant increase in on-target DNA histone methylation (H3K9me3) (middle panels) and decrease in on-target histone acetylation (H3K27ac) (bottom panels) (Fig. 44A).
- Fig. 44B shows a depletion of the P65 transcription factor at the El locus resulting from the expression repressor according to MR-32105.
- Figure 45 is a bar graph showing the downregulation of CXCL1-3 and IL8 relative to 1 hr ILIA stimulation after introduction of an expression repressor (MR-32104 or MR-32105) targeting the El cRE.
- an expression repressor MR-32104 or MR-32105
- Figures 46A and 46B are box and whisker blots showing CXCL gene downregulation after introduction of an expression repressor (MR-32104 and MR-32105) targeting the El cRE.
- Figure 47 shows enrichment of IL8-targeting expression repressor derived from MR-32712 at the target IL8 (top panel), the resultant increase in on-target DNA histone methylation (H3K9me3) (middle panels) and decrease in on-target P65 binding (bottom panels) by HA-ChIP Seq.
- Figure 48 is a bar graph showing CXCL gene expression in IMR-90 cells after an IL8 targeting expression repressor (MR-32712).
- Figure 49 shows box and whisker plots showing RNA levels for CXCL gene expression after introduction of an IL8-targeting expression repressor (MR-32172). Overall, the whisker plots show significant decrease of the IL8 RNA.
- Figure 50 shows enrichment of El -targeting expression repressor at 24 hours but no detectable signal at 24 hours by HA-ChIP Seq.
- Figure 51 are bar graphs showing the CXCL gene and protein downregulation in small airway epithelial cells (COPD) after introduction of an expression repressor targeting TL8 (MR-32172) and a bicistronic expression repressor (MR-32905) targeting the El cRE and IL8.
- Figure 52 are bar graphs showing the CXCL gene and protein downregulation in bronchial smooth muscle cells (asthma) after introduction of an expression repressor targeting IL8 (MR-32172) and a bicistronic expression repressor (MR-32905) targeting the El cRE and IL8.
- COPD small airway epithelial cells
- Figure 52 are bar graphs showing the CXCL gene and protein downregulation in bronchial smooth muscle cells (asthma) after introduction of an expression repressor targeting IL8 (MR-32172) and a bicistronic expression repressor (MR-32905) targeting the El cRE and IL8.
- Figure 53 are bar graphs showing the CXCL gene and protein downregulation in primary lung fibroblast cells after introduction of an expression repressor targeting IL8 (MR-32172) and a bicistronic expression repressor (MR-32905) targeting the El cRE and IL8.
- MR-32172 expression repressor targeting IL8
- MR-32905 bicistronic expression repressor
- Figure 54 are graphs showing the CXCL 1-3 and IL8 downregulation over 13 days after introduction of an expression repressor targeting IL8 (MR-32172) and a bicistronic expression repressor (MR-32905) targeting the El cRE and IL8.
- Figure 55 are graphs showing decreased neutrophil migration after introduction of an expression repressor targeting the El cRE (MR-32105) and/or an expression repressor targeting IL8 (MR-32712).
- Figures 56A and 56B are graphs showing decreased neutrophil migration after introduction of an expression repressor targeting IL8 (MR-32712) and/or a bicistronic expression repressor (MR-32905) targeting the El cRE and IL8.
- Figure 57 is an image depicting the locus of the functional enhancers at the CXCL cluster in mouse. Three candidate El locations tested in Example 41 are indicated with arrows.
- Figure 58 are bar graphs indicating CXCL1 and CXCL2 downregulation after instruction of an expression repressor with a guide targeting mouse Pl and P6, homologues to human El and E2, respectively.
- Figure 59 is a bar graph indicating CXCL2 RNA qPCR results after instruction of an expression repressor with a guide targeting mouse homologues to human CXCL.
- Figure 60 is a bar graph indicating CXCL1 RNA qPCR results after instruction of an expression repressor with a guide targeting mouse homologues to human CXCL.
- Figure 61 is a bar graph indicating CXCL1 protein expression results after introduction of an expression repressor with a guide targeting mouse homologues to human CXCL.
- Figure 62 are bar graphs indicating CXCL1 and CXCL2 downregulation in mouse homologues to human CXCL.
- Figure 63 is a bar graph indicating CXCL1 protein expression results after introduction of expression repressors targeting a mouse homologue to human CXCL1.
- Figure 64 is a bar graph indicating IL-8 mRNA level results after introduction of bicistronic expression repressor (MR-32905) targeting the El cRE and IL8 in multiple cancer cell lines.
- IL-8 mRNA levels are normalized to IL-8 mRNA in TNFa-stimulated cells.
- Figure 65 is a bar graph indicating IL-8 protein expression level results after introduction of bicistronic expression repressor (MR-32905) targeting the El cRE and IL8 in multiple cancer cell lines.
- IL-8 mRNA levels are normalized to IL-8 mRNA in TNFa-stimulated cells.
- Figure 66 is a bar graph indicating CXCL1 mRNA level results after introduction of bicistronic expression repressor (MR-32905) targeting the El cRE and IL8 in multiple cancer cell lines. CXCL1 mRNA levels are normalized to CXCL1 mRNA in TNFa-stimulated cells.
- MR-32905 bicistronic expression repressor
- Figure 67 is a bar graph indicating endogenous IL-8 mRNA level results after introduction of bicistronic expression repressor (MR-32905) targeting the El cRE and IL8 in a breast cancer cell line.
- IL-8 mRNA levels are normalized to IL-8 mRNA in TNFa-stimulated cells.
- Figure 68 is a graph indicating tumor volume (mm 3 ) in A549 NSCLC xenograft model after introduction of bicistronic expression repressor (MR-32905) targeting the El cRE and IL8.
- MR-32905 bicistronic expression repressor
- Figure 69 is a graph indicating the mean percent weight change in A549 NSCLC xenograft model mouse groups. Error bars represent the standard error of the mean (SEM). This experiment was performed as described in Example 47.
- Figure 70 is a bar graph indicating the percent weight change Area Under the Curve (AUC) in A549 NSCLC xenograft model mouse groups. Tire percent weight change AUC was calculated for each animal in the study to Day 04. This calculation was made using the trapezoidal rule transformation. Error bars represent the SEM for each group. This experiment was performed as described in Example 47.
- Figure 71 is a graph depicting the mean tumor volumes (mm 3 ) in A549 NSCLC xenograft model after introduction of bicistronic expression repressor (MR-32905) or GFP control. Mean tumor volumes were calculated from the length and width measurements. Group means were calculated and are shown with error bars representing SEM for each group. This experiment was performed as described in Example 47.
- Figure 72 is a bar graph indicating the percent weight change Area Under the Curve (AUC) in A549 NSCLC xenograft model mouse groups.
- the AUC was calculated using the trapezoidal mle transformation for the tumor volume measured on each animal in the study. Group means were calculated and are shown with error bars representing SEM for each group. Groups were compared using an ANOVA test. This experiment was performed as described in Example 47.
- Figure 73 is a graph indicating the mean percent tumor volumes in A549 NSCLC xenograph model after introduction of bicistronic expression repressor (MR-32905) or GFP control. Mean Tumor Volumes were calculated from the length and width measurements. Group means were calculated and are shown with error bars representing SEM for each group. This experiment was performed as described in Example 47.
- Figure 74 is bar graph indicating the percent weight change Area Under the Curve (AUC) in A549 NSCLC xenograft model mouse groups. The AUC was calculated for the tumor volume measured on each animal in the study. This calculation was made using the trapezoidal rule transformation. Group means were calculated and are shown with error bars representing SEM for each group. Groups were compared using an ANOVA test. This experiment was performed as described in Example 47.
- Figure 75 is a schematic experimental design to determine the effects of expression repressors for use in acute respiratory distress syndrome (ARDS). This experiment was performed as described in Example 48.
- Figure 76 is a graph showing change in body weight (BW) percent from baseline in LPS induced C57BL/6 mice. This experiment was performed as described in Example 48.
- Figure 77 is a bar graph showing BALF cell concentration in C57BL/6 mice. This experiment was performed as described in Example 48.
- Figures 78A-78E are bar graphs showing BALF immune cell concentrations in LPS induced C57BL/6 mice.
- Fig. 78A is a bar graph showing BALF mouse leukocyte concentration (Cells/mL).
- Fig. 78B is a bar graph showing BALF mouse alveolar macrophage concentration (Cells/mL).
- Fig. 78C is a bar graph showing BALF mouse neutrophil concentration (Cells/mL).
- Fig. 78D is a bar graph showing BALF mouse T cell concentration (Cells/mL).
- Fig. 78E is a bar graph showing BALF mouse B cell concentration (Cells/mL). This experiment was performed as described in Example 48.
- Figures 79A-79D are bar graphs indicating BALF immune cell frequency in LPS induced C57BL/6 mice. This experiment was performed as described in Example 48.
- Figures 80A-80E are bar graphs indicating blood immune cell concentrations in LPS induced C57BL/6 mice. This experiment was performed as described in Example 48.
- Figures 81A-81D are bar graphs indicating blood immune cell frequency in LPS induced C57BL/6 mice. This experiment was performed as described in Example 48.
- Figures 82A-82F are bar graphs indicating the histology score and assessment in LPS induced C57BL/6 mice. This experiment was performed as described in Example 48.
- an expression repressor comprises a targeting moiety.
- an expression repressor comprises a targeting moiety and an effector moiety.
- Inhibition of the enhancer may be an improved approach to decreasing expression of the target plurality of genes (e.g., with respect to improved efficiency, efficacy, and/or stability of alteration) over modulation of individual target genes.
- the expression repressor may be used in combination with a site-specific disrupting agent, e.g., a site-specific disrupting agent that disrupts an anchor sequence mediated conjunction.
- the sitespecific disrupting agent may also repress expression of a plurality of genes (e.g., the same plurality of genes as the expression repressor or an overlapping plurality of genes). Said improvements may translate to corresponding improvements in the treatment of diseases and conditions associated with the target plurality of genes.
- a plurality of genes may be CXCL genes and an expression repressor can target an El cRE, operably linked to the plurality of genes to decrease expression of the plurality of genes and thereby achieve an anti-inflammatory effect (e.g., a superior anti-inflammatory effect relative to individually targeting the genes of the plurality).
- an expression repressor can target an El cRE, operably linked to the plurality of genes to decrease expression of the plurality of genes and thereby achieve an anti-inflammatory effect (e.g., a superior anti-inflammatory effect relative to individually targeting the genes of the plurality).
- An expression repressor may decrease expression of a target plurality of genes by one or more modalities.
- an expression repressor to a target site e.g., an El cRE
- physical or steric blockage of an enhancer sequence e.g., an El cRE
- binding of a factor to the enhancer sequence is inhibited (e.g., prevented)
- an expression repressor may modulate, e.g., decrease, expression of a target plurality of genes.
- An expression repressor may destabilize the interaction of a factor) with an enhancer sequence, e.g., by altering (e.g., decreasing) the affinity and/or avidity at which the factor binds the enhancer sequence.
- Blocking or destabilizing binding of a factor to a target sequence may be accomplished by one or more means, including: epigenetic modification of the enhancer sequence or a sequence proximal thereto, genetic modification of the enhancer sequence or a sequence proximal thereto, or binding of the expression repressor to the enhancer sequence or a sequence proximal thereto.
- an expression repressor comprises a targeting moiety, a first effector moiety, and a second effector moiety.
- the first effector moiety has a sequence that is different from the sequence of the second effector moiety.
- the first effector moiety has a sequence that is identical to the sequence of the second effector moiety.
- An expression repressor described herein may also be used in combination with a site-specific disrupting agent (e.g., one that targets an anchor sequence.)
- a site-specific disrupting agent comprises a targeting moiety.
- a site-specific disrupting agent comprises a targeting moiety and an effector moiety.
- Modulation, e.g., disruption, of a genomic complex, e g., ASMC, comprising (wholly or in part) a target plurality of genes may be an improved approach to altering (e.g., decreasing) expression of the target plurality of genes (e.g., with respect to improved efficiency, efficacy, and/or stability of alteration) over modulation of individual target genes.
- Said improvements may translate to corresponding improvements in the treatment of diseases and conditions associated with the target plurality of genes.
- a plurality of genes may be associated with a pro-inflammatory effect and a site-specific disrupting agent can target a genomic complex, e.g., ASMC, comprising (wholly or in part) the plurality of genes to modulate, e.g., decrease, expression of the plurality of genes and thereby achieve an anti-inflammatory effect (e.g., a superior anti-inflammatory effect relative to individually targeting the genes of the plurality).
- a site-specific disrupting agents, targeting moieties, effector moieties, and target pluralities of genes are provided herein.
- a site-specific disrupting agent may modulate, e.g., decrease, expression of a target plurality of genes by one or more modalities.
- a site-specific disrupting agent binds to a target site, e.g., anchor sequence, and physically or sterically competes for binding with other genomic complex components, e.g., a nucleating polypeptide.
- a site-specific disrupting agent may modulate, e.g., decrease, expression of a target plurality of genes.
- a site-specific disrupting agent may destabilize the interaction of a genomic complex component (e.g., nucleating polypeptide) with an anchor sequence, e.g., by altering (e.g., decreasing) the affinity and/or avidity at which the genomic complex component binds the anchor sequence.
- Blocking or destabilizing binding of a genomic complex component (e.g., nucleating polypeptide) to an anchor sequence may be accomplished by one or more means, including: epigenetic modification of the anchor sequence or a sequence proximal thereto, genetic modification of the anchor sequence or a sequence proximal thereto, or binding of the site-specific disrupting agent to the anchor sequence or a sequence proximal thereto.
- Inhibiting (e.g., preventing) binding of a genomic complex component (e.g., a nucleating polypeptide) to an anchor sequence may inhibit (e.g., disrupt or prevent formation of) a genomic complex, e.g., ASMC.
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety, and a second effector moiety.
- the first effector moiety has a sequence that is different from the sequence of the second effector moiety.
- the first effector moiety has a sequence that is identical to the sequence of the second effector moiety.
- the disclosure further provides in part, a system comprising two or more expression repressors, each comprising a targeting moiety and optionally an effector moiety.
- the targeting moieties target two or more different sequences (e.g., each expression repressor may target a different sequence).
- the first expression repressor binds to a first genomic regulatory element (e.g., an enhancer, e.g., an El cRE) operably linked to a target plurality of genes, e.g., human CXCL1-8
- a second genomic regulatory element e.g., an enhancer, a promoter, or a transcription start site TSS
- the system comprises an expression repressor and a sitespecific disrupting agent.
- the expression repressor binds to a transcription regulatory element (e.g., an enhancer (e.g., an El cRE) operably linked to a target plurality of genes, e.g., human CXCL1-8 and the site-specific disrupting agent binds to an anchor sequence of an anchor sequence mediated conjunction (ASMC) comprising a target plurality of genes, e.g., human CXCL1-8.
- a transcription regulatory element e.g., an enhancer (e.g., an El cRE) operably linked to a target plurality of genes, e.g., human CXCL1-8
- ASMC anchor sequence mediated conjunction
- modulation of expression of a target plurality of genes involves the binding of tire first expression repressor and second expression repressor to the first and second DNA sequences, respectively.
- modulation of expression of a target plurality of genes e.g., human CXCL 1-8 by a system involves the binding of the expression repressor and the site-specific dismpting agent to the first and second DNA sequences, respectively. Binding of the first and second DNA sequences localizes the functionalities of the first and second effector moieties to those sites.
- first and second effector moieties stably represses expression of a target plurality of gene associated with or comprising the first and/or second DNA sequences, e.g., wherein the first and/or second DNA sequences are or comprise sequences of the target plurality of gene or one or more operably linked genomic regulatory elements (e.g., transcription control elements).
- first and/or second DNA sequences are or comprise sequences of the target plurality of gene or one or more operably linked genomic regulatory elements (e.g., transcription control elements).
- an expression repressor comprises a targeting moiety.
- the targeting moiety specifically binds a DNA sequence, e.g., an El cRE, and thereby modulates, e.g., disrupts, the function of that DNA sequence.
- an expression repressor comprises a targeting moiety and an effector moiety.
- the targeting moiety specifically binds a DNA sequence, thereby localizing the effector moiety’s functionality to the DNA sequence or an area proximal thereto.
- an expression repressor comprises one targeting moiety and one effector moiety.
- an expression repressor comprises one targeting moiety and more than one effector moiety, e.g., two, three, four, or five effector moieties, each of which may be the same or different from another of the more than one effector moieties.
- an expression repressor may comprise two effector moieties where the first effector moiety comprises a different functionality than the second effector moiety.
- an expression repressor may comprise two effector moieties, where the first effector moiety comprises DNA methyltransferase functionality (e.g., comprises MQ1, G9A, or EZH2, or a functional fragment or variant thereof) and the second effector moiety comprises a transcriptional repressor functionality (e.g., comprises KRAB or a functional fragment or variant thereof).
- an expression repressor comprises effector moieties whose functionalities are complementary to one another with regard to decreasing expression of a target plurality of gene, where the functionalities together inhibit expression and, optionally, do not inhibit or negligibly inhibit expression when present individually.
- an expression repressor comprises a plurality of effector moieties, wherein each effector moiety complements each other effector moiety, each effector moiety decreases expression of a target plurality of gene.
- an expression repressor comprises a combination of effector moieties whose functionalities synergize with one another with regard to decreasing expression of a target plurality of gene.
- epigenetic modifications to a genomic locus are cumulative, in that multiple transcription activating epigenetic markers (e.g., multiple different types of epigenetic markers and/or more extensive marking of a given type) individually together inhibit expression more effectively than individual modifications alone (e.g., producing a greater decrease in expression and/or a longer-lasting decrease in expression).
- an expression repressor comprises a plurality of effector moieties, wherein each effector moiety synergizes with each other effector moiety, e.g., each effector moiety decreases expression of a target plurality of gene.
- an expression repressor (comprising a plurality of effector moieties which synergize with one another) is more effective at inhibiting expression of a target plurality of gene, than an expression repressor comprising an individual effector moiety.
- an expression repressor comprising said plurality of effector moieties is at least 1.05x (i.e., 1.05 times), 1. lx, 1.
- an expression repressor comprises one or more targeting moieties, e.g., a Cas domain, TAL effector domain, or Zn Finger domain.
- a system comprises two or more targeting moieties of the same type, e.g., two or more Cas domains or two or more Zn Finger Domains
- the targeting moieties specifically bind two or more different sequences.
- an expression repressor system comprising two or more Zinc Finger domains
- the two or more Zinc Finger domains may be chosen or altered such that they only appreciably bind their target sequence (e.g., and do not appreciably bind the target of another Zinc Finger domain).
- the two or more Cas domains may be chosen or altered such that they only appreciably bind the gRNA corresponding to their target sequence (e g., and do not appreciably bind the gRNA corresponding to the target of another Cas domain).
- an expression repressor comprises a targeting moiety and an effector moiety that are covalently linked, e.g., by a peptide bond.
- the targeting moiety and effector moiety are situated on the same polypeptide chain, e.g., connected by one or more peptide bonds and/or a linker.
- an expression repressor comprises a fusion molecule, e.g., comprising the targeting moiety and effector moiety linked by a peptide bond and/or a linker.
- an expression repressor comprises a targeting moiety that is disposed N-terminal of an effector moiety on the same polypeptide chain.
- an expression repressor comprises a targeting moiety that is disposed C-terminal of an effector moiety on the same polypeptide chain. In some embodiments, an expression repressor comprises a targeting moiety and an effector moiety that are covalently linked by a non-peptide bond. In some embodiments, a targeting moiety is conjugated to an effector moiety by a non-peptide bond.
- an expression repressor comprises a targeting moiety and a plurality of effector moieties, wherein the targeting moiety and the plurality of effector moieties are covalently linked, e.g., by peptide bonds (e.g., the targeting moiety and plurality of effector moieties are all connected by a series of covalent bonds, although each individual moiety may not share a covalent bond with every other moiety).
- an expression repressor comprises a targeting moiety and an effector moiety that are not covalently linked, e.g., that are non-covalently associated with one another.
- an expression repressor comprises a targeting moiety that non-covalently binds to an effector moiety or vice versa.
- an expression repressor comprises a targeting moiety and a plurality of effector moieties, wherein the targeting moiety and at least one effector moiety are not covalently linked, e.g., are non-covalently associated with one another, and wherein the targeting moiety and at least one other effector moiety are covalently linked, e.g., by a peptide bond.
- an expression repressor comprises a first effector moiety comprising G9A and a second effector moiety comprising KRAB. In some embodiments an expression repressor comprises a first effector moiety comprising G9A and a second effector moiety comprising EZH2. In some embodiments, an expression repressor comprises a first effector moiety comprising EZH2 and a second effector moiety comprising KRAB.
- an expression repressor comprises a targeting moiety and an effector moiety, wherein the C-terminal end of the effector moiety, e.g., an effector moiety' chosen from, KRAB or MQ1 or a functional variant or fragment thereof and the N-terminal end of the targeting moiety are covalently linked.
- an expression repressor comprises a targeting moiety and an effector moiety wherein the N-terminal end of the effector moiety, e.g., an effector moiety chosen from HDAC8, MQ 1, DNMT3a/3L, KRAB, or a functional variant or fragment thereof and the C-terminal end of the targeting moiety are covalently linked.
- an expression repressor comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein, the C-terminal end of the first effector moiety and the N-terminal end of the targeting moiety are covalently linked and the C- terminal end of the targeting moiety and the N-terminal end of the second effector moiety are covalently linked.
- the covalent linkage may be, e.g., via a linker sequence.
- an expression repressor comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein the first effector moiety is EZH2, or a functional variant or fragment thereof, e.g., wherein tire first effector moiety comprises an amino acid sequence of SEQ ID NO: 17 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and the first effector moiety is N-terminal of the targeting moiety; and the second effector moiety is KRAB, or a functional variant or fragment thereof, e.g., wherein the second effector moiety comprises an amino acid sequence of SEQ ID NO: 13 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein the first effector moiety is EZH2, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 17 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and the first effector moiety is N-terminal of the targeting moiety; and the second effector moiety is HDAC8, or a functional variant or fragment thereof, e.g., wherein the second effector moiety comprises an amino acid sequence of SEQ ID NO: 19 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity' thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein the first effector moiety is G9A, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 67 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and the first effector moiety is N-terminal of the targeting moiety; and the second effector moiety is KRAB, or a functional variant or fragment thereof, e.g., wherein the second effector moiety comprises an amino acid sequence of SEQ ID NO: 13 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein the first effector moiety is G9A, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 67 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and tire first effector moiety is N-terminal of the targeting moiety; and the second effector moiety is EZH2, or a functional variant or fragment thereof, e.g., wherein the second effector moiety comprises an amino acid sequence of SEQ ID NO: 17 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity' thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1
- the first effector moiety comprises a histone methyltransferase activity and the second effector moiety comprises a different histone methyltransferase activity. In some embodiments, the first effector moiety comprises a histone methyltransferase activity and the second effector moiety comprises the same histone methyltransferase activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a histone deacetylase activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a DNA methyltransferase activity.
- the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a DNA demethylase activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a transcription repressor activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a different histone demethylase activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises the same histone demethylase activity.
- the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises a DNA methyltransferase activity. In some embodiments, the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises a DNA demethylase activity. In some embodiments, the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises a transcription repressor activity. In some embodiments, the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises a different histone deacetylase activity.
- the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises the same histone deacetylase activity. In some embodiments, the first effector moiety comprises a DNA methyltransferase activity and the second effector moiety comprises a DNA demethylase activity. In some embodiments, the first effector moiety comprises a DNA methyltransferase activity and the second effector moiety comprises a transcription repressor activity. In some embodiments, the first effector moiety comprises a DNA methyltransferase activity and the second effector moiety comprises a different DNA methyltransferase activity.
- the first effector moiety comprises a DNA methyltransferase activity and the second effector moiety comprises the same DNA methyltransferase activity. In some embodiments, the first effector moiety comprises a DNA demethylase activity and the second effector moiety comprises a transcription repressor activity. In some embodiments, the first effector moiety comprises a DNA demethylase activity and the second effector moiety comprises a different DNA demethylase activity. In some embodiments, the first effector moiety comprises a DNA demethylase activity and the second effector moiety comprises the same DNA demethylase activity.
- the first effector moiety comprises a transcription repressor activity and the second effector moiety comprises a different transcription repressor activity. In some embodiments, the first effector moiety comprises a transcription repressor activity and tire second effector moiety comprises the same transcription repressor activity.
- the first effector moiety comprises DNMT3a/31, MQ1, KRAB, G9A, HDAC8, or EZH2 and the second effector moiety comprises DNMT3a/31, MQ1, KRAB, G9A, HDAC8, or EZH2.
- a site-specific disrupting agent comprises a targeting moiety.
- the targeting moiety specifically binds a DNA sequence, e.g., an anchor sequence, and thereby modulates, e g., disrupts, a genomic complex (e g., ASMC) comprising said DNA sequence.
- a site-specific disrupting agent comprises a targeting moiety and an effector moiety.
- the targeting moiety specifically binds a DNA sequence, thereby localizing the effector moiety’s fiinctionality to the DNA sequence, thereby modulating, e g., disrupting, a genomic complex (e.g., ASMC) comprising said DNA sequence.
- a site-specific disrupting agent comprises one targeting moiety and one effector moiety. In some embodiments, a site-specific disrupting agent comprises one targeting moiety and more than one effector moiety, e.g., two, three, four, or five effector moieties, each of which may be the same or different from another of the more than one effector moieties. In some embodiments, a site-specific disrupting agent may comprise two effector moieties where the first effector moiety comprises a different functionality than the second effector moiety.
- a site-specific disrupting agent may comprise two effector moieties, where the first effector moiety comprises DNA methyltransferase functionality (e.g., comprises G9A or EZH2 or a functional fragment or variant thereof) and the second effector moiety comprises a transcriptional repressor functionality (e.g., comprises KRAB or a functional fragment or variant thereof).
- a site-specific disrupting agent comprises effector moieties whose functionalities are complementary to one another with regard to decreasing expression of a target plurality of gene, where the functionalities together inhibit expression and, optionally, do not inhibit or negligibly inhibit expression when present individually.
- a site-specific disrupting agent comprises a plurality of effector moieties, wherein each effector moiety complements each other effector moiety, each effector moiety decreases expression of a target plurality of gene.
- a site-specific disrupting agent comprises a combination of effector moieties whose functionalities synergize with one another with regard to decreasing expression of a target plurality of gene.
- epigenetic modifications to a genomic locus are cumulative, in that multiple transcription activating epigenetic markers (e.g., multiple different types of epigenetic markers and/or more extensive marking of a given type) individually together inhibit expression more effectively than individual modifications alone (e.g., producing a greater decrease in expression and/or a longer-lasting decrease in expression).
- a site-specific disrupting agent comprises a plurality of effector moieties, wherein each effector moiety synergizes with each other effector moiety, e.g., each effector moiety decreases expression of a target plurality of gene.
- a site-specific disrupting agent (comprising a plurality of effector moieties which synergize with one another) is more effective at inhibiting expression of a target plurality of gene, than a site-specific disrupting agent comprising an individual effector moiety.
- a site-specific disrupting agent comprising said plurality of effector moieties is at least 1.05x (i.e., 1.05 times), l.lx, 1.15x, 1.2x, 1.25x, 1.3x, 1.35x, 1.4x, 1 ,45x, 1 ,5x, 1 ,55x, 1 ,6x, 1 ,65x, 1 ,7x, 1 ,75x, 1 ,8x, 1 ,85x, 1 9x, 1 ,95x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 1 Ox, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, or lOOx as effective at decreasing expression of a target plurality of gene, than a site-specific disrupting agent comprising an individual effector moiety.
- a site-specific disrupting agent comprises one or more targeting moieties e.g., a Cas domain, TAL effector domain, or Zn Finger domain.
- the targeting moieties when system comprises two or more targeting moieties of the same type, e.g., two or more Cas domains, the targeting moieties specifically bind two or more different sequences.
- the two or more Cas domains may be chosen or altered such that they only appreciably bind the gRNA corresponding to their target sequence (e.g., and do not appreciably bind the gRNA corresponding to the target of another Cas domain).
- a site-specific disrupting agent comprises a targeting moiety and an effector moiety that are covalently linked, e.g., by a peptide bond.
- the targeting moiety and effector moiety are situated on the same polypeptide chain, e.g., connected by one or more peptide bonds and/or a linker.
- a site-specific disrupting agent comprises a fusion molecule, e.g., comprising the targeting moiety and effector moiety linked by a peptide bond and/or a linker.
- a site-specific disrupting agent comprises a targeting moiety that is disposed N-terminal of an effector moiety on the same polypeptide chain.
- a sitespecific disrupting agent comprises a targeting moiety that is disposed C-terminal of an effector moiety on the same polypeptide chain. In some embodiments, a site-specific disrupting agent comprises a targeting moiety and an effector moiety that are covalently linked by a non-peptide bond. In some embodiments, a targeting moiety is conjugated to an effector moiety by a non-peptide bond.
- a site-specific disrupting agent comprises a targeting moiety and a plurality of effector moieties, wherein the targeting moiety and the plurality of effector moieties are covalently linked, e.g., by peptide bonds (e.g., the targeting moiety and plurality of effector moieties are all connected by a series of covalent bonds, although each individual moiety may not share a covalent bond with every other moiety).
- a site-specific disrupting agent comprises a targeting moiety and an effector moiety that are not covalently linked, e.g., that are non-covalently associated with one another.
- a site-specific disrupting agent comprises a targeting moiety that non-covalently binds to an effector moiety or vice versa.
- a site-specific disrupting agent comprises a targeting moiety and a plurality of effector moieties, wherein the targeting moiety and at least one effector moiety are not covalently linked, e.g., are non-covalently associated with one another, and wherein the targeting moiety and at least one other effector moiety are covalently linked, e.g., by a peptide bond.
- a site-specific disrupting agent comprises a first effector moiety comprising G9A and a second effector moiety comprising KRAB. In some embodiments, a site-specific disrupting agent comprises a first effector moiety comprising G9A and a second effector moiety comprising EZH2. In some embodiments, a site-specific disrupting agent comprises a first effector moiety comprising EZH2 and a second effector moiety comprising KRAB.
- a site-specific disrupting agent comprises a targeting moiety and an effector moiety, wherein the C-terminal end of the effector moiety, e.g., an effector moiety chosen from, EZH2, or G9A or a functional variant or fragment thereof and the N-tenninal end of the targeting moiety are covalently linked.
- a site-specific disrupting agent comprises a targeting moiety and an effector moiety wherein the N-terminal end of the effector moiety, e.g., an effector moiety chosen from HDAC8, MQ1, DNMT3a/3L, KRAB, or a functional variant or fragment thereof and the C-terminal end of the targeting moiety are covalently linked.
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein, the C- terminal end of the first effector moiety, e g., a effector moiety chosen from EZH2, G9A, or a functional variant or fragment thereof, and the N-terminal end of the targeting moiety are covalently linked and the C-terminal end of the targeting moiety and the N-terminal end of the second effector moiety, e.g., a effector moiety chosen from HDAC8, MQ1, DNMT3a/3L, KRAB or a functional variant or fragment thereof are covalently linked.
- the covalent linkage may be, e g., via a linker sequence.
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein the first effector moiety is EZH2, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 17 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and the first effector moiety is N-terminal of the targeting moiety; and the second effector moiety is KRAB, or a functional variant or fragment thereof, e.g., wherein the second effector moiety comprises an amino acid sequence of SEQ ID NO: 13 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein the first effector moiety is EZH2, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 17 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and the first effector moiety is N-terminal of the targeting moiety; and the second effector moiety is HDAC8, or a functional variant or fragment thereof, e.g., wherein the second effector moiety comprises an amino acid sequence of SEQ ID NO: 19 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity' thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein the first effector moiety is G9A, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 67 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and the first effector moiety is N-terminal of the targeting moiety; and the second effector moiety is KRAB, or a functional variant or fragment thereof, e.g., wherein the second effector moiety comprises an amino acid sequence of SEQ ID NO: 13 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions
- a site-specific disrupting agent comprises a targeting moiety, a first effector moiety and a second effector moiety, wherein the first effector moiety is G9A, or a functional variant or fragment thereof, e.g., wherein the first effector moiety comprises an amino acid sequence of SEQ ID NO: 67 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and the first effector moiety is N-terminal of the targeting moiety; and the second effector moiety is EZH2, or a functional variant or fragment thereof, e.g., wherein the second effector moiety comprises an amino acid sequence of SEQ ID NO: 17 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity' thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1
- the first effector moiety comprises a histone methyltransferase activity and the second effector moiety comprises a different histone methyltransferase activity. In some embodiments, the first effector moiety comprises a histone methyltransferase activity and the second effector moiety comprises the same histone methyltransferase activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a histone deacetylase activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a DNA methyltransferase activity.
- the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a DNA demethylase activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a transcription repressor activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises a different histone demethylase activity. In some embodiments, the first effector moiety comprises a histone demethylase activity and the second effector moiety comprises the same histone demethylase activity.
- the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises a DNA methyltransferase activity. In some embodiments, the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises a DNA demethylase activity. In some embodiments, the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises a transcription repressor activity. In some embodiments, the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises a different histone deacetylase activity.
- the first effector moiety comprises a histone deacetylase activity and the second effector moiety comprises the same histone deacetylase activity. In some embodiments, the first effector moiety comprises a DNA methyltransferase activity and the second effector moiety comprises a DNA demethylase activity. In some embodiments, the first effector moiety comprises a DNA methyltransferase activity and the second effector moiety comprises a transcription repressor activity. In some embodiments, the first effector moiety comprises a DNA methyltransferase activity and the second effector moiety comprises a different DNA methyltransferase activity.
- the first effector moiety comprises a DNA methyltransferase activity and the second effector moiety comprises the same DNA methyltransferase activity. In some embodiments, the first effector moiety comprises a DNA demethylase activity and the second effector moiety comprises a transcription repressor activity. In some embodiments, the first effector moiety comprises a DNA demethylase activity and the second effector moiety comprises a different DNA demethylase activity. In some embodiments, the first effector moiety comprises a DNA demethylase activity and the second effector moiety comprises the same DNA demethylase activity.
- the first effector moiety comprises a transcription repressor activity and the second effector moiety comprises a different transcription repressor activity. In some embodiments, the first effector moiety comprises a transcription repressor activity and the second effector moiety comprises the same transcription repressor activity.
- the first effector moiety comprises, DNMT3a/31, MQ1, KRAB, G9A, HDAC8, or EZH2 and the second effector moiety comprises DNMT3a/31, MQ1, KRAB, G9A, HDAC8, or EZH2.
- An expression repressor and/or a site-specific disrupting agent may comprise one or more linkers.
- a linker may connect a targeting moiety to an effector moiety, an effector moiety to another effector moiety, or a targeting moiety to another targeting moiety.
- a linker may be a chemical bond, e.g., one or more covalent bonds or non-covalent bonds.
- a linker is covalent.
- a linker is non-covalent.
- a linker is a peptide linker.
- Such a linker may be between 2-30, 5-30, 10-30, 15-30, 20-30, 25-30, 2-25, 5-25, 10-25, 15-25, 20-25, 2-20, 5-20, 10- 20, 15-20, 2-15, 5-15, 10-15, 2-10, 5-10, or 2-5 amino acids in length, or greater than or equal to 2, 5, 10, 15, 20, 25, or 30 amino acids in length (and optionally up to 50, 40, 30, 25, 20, 15, 10, or 5 amino acids in length).
- a linker can be used to space a first moiety from a second moiety, e g., a targeting moiety from an effector moiety.
- a linker can be positioned between a targeting moiety and an effector moiety, e.g., to provide molecular flexibility of secondary and tertiary structures.
- a site-specific disrupting agent may comprise a first effector moiety linked to the targeting moiety via a first linker and a second effector moiety linked to the targeting moiety via a second linker.
- the first linker has a sequence that is identical to the sequence of the second linker.
- the first linker has a sequence that is not identical to the sequence of the second linker.
- the first effector moiety is N-terminal of the targeting moiety.
- the C-terminal of the targeting moiety In some embodiments, the C-terminal end of the first effector moiety is linked to the N-terminal end of the targeting moiety via the first linker and the N- terminal end of the second effector moiety is linked to the C-terminal end of the targeting moiety via tire second linker.
- a linker may comprise flexible, rigid, and/or cleavable linkers described herein.
- a linker includes at least one glycine, alanine, and serine amino acids to provide for flexibility.
- a linker is a hydrophobic linker, such as including a negatively charged sulfonate group, polyethylene glycol (PEG) group, or pyrophosphate diester group.
- a linker is cleavable to selectively release a moiety (e.g., polypeptide) from a modulating agent, but sufficiently stable to prevent premature cleavage.
- one or more moieties of an expression repressor described herein are linked with one or more linkers. In some embodiments, one or more moieties of a site-specific disrupting agent described herein are linked with one or more linkers.
- GS linker As will be known by one of skill in the art, commonly used flexible linkers have sequences consisting primarily of stretches of Gly and Ser residues (“GS” linker). Flexible linkers may be useful for joining domains/moieties that require a certain degree of movement or interaction and may include small, non-polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids. Incorporation of Ser or Thr can also maintain the stability of a linker in aqueous solutions by forming hydrogen bonds with water molecules, and therefore reduce unfavorable interactions between a linker and moieties/domains.
- Gly non-polar
- Ser or Thr polar amino acids
- Rigid linkers are useful to keep a fixed distance between domains/moieties and to maintain their independent functions. Rigid linkers may also be useful when a spatial separation of domains is critical to preserve the stability or bioactivity of one or more components in the fusion. Rigid linkers may have an alpha helix-structure or Pro-rich sequence, (XP) n , with X designating any amino acid, preferably Ala, Lys, or Glu.
- Cleavable linkers may release free functional domains/moieties in vivo.
- linkers may be cleaved under specific conditions, such as presence of reducing reagents or proteases.
- In vivo cleavable linkers may utilize reversible nature of a disulfide bond.
- One example includes a thrombin-sensitive sequence (e.g., PRS) between the two Cys residues.
- PRS thrombin-sensitive sequence between the two Cys residues.
- SEQ ID NO: 243 results in the cleavage of a thrombin-sensitive sequence, while a reversible disulfide linkage remains intact.
- Such linkers are known and described, e.g., in Chen et al. 2013.
- Tn vivo cleavage of linkers in fusions may also be carried out by proteases that are expressed in vivo under certain conditions, in specific cells or tissues, or constrained within certain cellular compartments. Specificity of many proteases offers slower cleavage of the linker in constrained compartments.
- molecules suitable for use in linkers described herein include a negatively charged sulfonate group; lipids, such as a poly (— CH 2 — ) hydrocarbon chains, such as polyethylene glycol (PEG) group, unsaturated variants thereof, hydroxylated variants thereof, amidated or otherw ise N-containing variants thereof; noncarbon linkers; carbohydrate linkers; phosphodiester linkers, or other molecule capable of covalently linking two or more components of a site-specific disrupting agent.
- lipids such as a poly (— CH 2 — ) hydrocarbon chains, such as polyethylene glycol (PEG) group, unsaturated variants thereof, hydroxylated variants thereof, amidated or otherw ise N-containing variants thereof
- PEG polyethylene glycol
- Non-covalent linkers are also included, such as hydrophobic lipid globules to which the polypeptide is linked, for example through a hydrophobic region of a polypeptide or a hydrophobic extension of a polypeptide, such as a series of residues rich in leucine, isoleucine, valine, or perhaps also alanine, phenylalanine, or even tyrosine, methionine, glycine, or other hydrophobic residue.
- Components of a site-specific disrupting agent may be linked using charge-based chemistry, such that a positively charged component of a sitespecific disrupting agent is linked to a negative charge of another component.
- the disclosure provides nucleic acid sequences encoding an expression repressor and/or a site-specific disrupting agent, a system, a targeting moiety and/or an effector moiety as described herein.
- RNA nucleic acid sequences encoding an expression repressor and/or a site-specific disrupting agent, a system, a targeting moiety and/or an effector moiety as described herein.
- T typically thymine
- U uracil
- nucleotide sequence when a nucleotide sequence is represented by a DNA sequence (e g , comprising, A, T, G, C), this disclosure also provides the corresponding RNA sequence (e.g., comprising, A, U, G, C) in which “U” replaces “T.”
- RNA sequence e.g., comprising, A, U, G, C
- Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5 '-end; the left-hand direction of a double -stranded polynucleotide sequence is referred to as the 5 '-direction.
- nucleotide sequences encoding a site-specific disrupting agent comprising DNA-targeting moiety and/or an effector moiety as described herein may be produced, some of which have similarity, e.g., 90%, 95%, 96%, 97%, 98%, or 99% identity to the nucleic acid sequences disclosed herein.
- codons AGA, AGG, CGA, CGC, CGG, and CGU all encode the amino acid arginine.
- the codon can be altered to any of the corresponding codons described above without altering the encoded polypeptide.
- a nucleic acid sequence encoding an expression repressor comprising a targeting moiety and/or one or more effector moieties may be part or all of a codon-optimized coding region, optimized according to codon usage in mammals, e.g., humans.
- a nucleic acid sequence encoding a targeting moiety and/or one or more effector moieties is codon optimized for increasing the protein expression and/or increasing the duration of protein expression.
- a protein produced by the codon optimized nucleic acid sequence is at least 1%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, or at least 50% higher compared to levels of the protein when encoded by a nucleic acid sequence that is not codon optimized.
- the nucleic acid is an mRNA. In some embodiments, the nucleic acid is monocistronic or polycistronic. In some embodiments, the nucleic acid is monocistronic. In certain embodiments, the nucleic acid is polycistronic (e.g., bi-cistronic, tri-cistronic, tetra-cistronic, etc.). In certain embodiments, the nucleic acid is bi-cistronic. In some embodiments, the nucleic acid is tri- cistronic. In certain embodiments, the nucleic acid is tetra-cistronic.
- a system described herein comprises, or a method described herein comprises the use of, a polypeptide comprising one or more (e.g., one) DNA-targeting moiety and one or more effector moiety, e.g., wherein the effector moiety is or comprises MQ1, e.g., bacterial MQ1, or a functional variant or fragment thereof.
- MQ1 is Spiroplasma monobiae MQ1, e.g., MQ1 from strain ATCC 33825 and/or corresponding to Uniprot ID P15840.
- MQ1 effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 10.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 10 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- MQ1 comprises an amino acid sequence of SEQ ID NO: 11. In some embodiments, MQ1 comprises an amino acid sequence of SEQ ID NO: 12. In some embodiments, an effector domain described herein comprises SEQ ID NO: 11 or 12, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- MQ1 for use in an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to wildtype MQ1 (e.g., SEQ ID NO: 11 or SEQ ID NO: 12).
- an MQ1 variant comprises one or more amino acid substitutions, deletions, or insertions relative to wildtype MQ1.
- an MQ1 variant comprises a K297P substitution.
- an MQ1 variant comprises aN299C substitution.
- an MQ1 variant comprises a E301Y substitution.
- an MQ1 variant comprises a Q147L substitution (e.g., and has reduced DNA methyltransferase activity relative to wildtype MQ1).
- an MQ1 variant comprises K297P, N299C, and E301Y substitutions (e.g., and has reduced DNA binding affinity relative to wildtype MQ1).
- an MQ1 variant comprises Q147L, K297P, N299C, and E301Y substitutions (e.g., and has reduced DNA methyltransferase activity and DNA binding affinity relative to wildtype MQ1).
- the expression repressor comprises one or more linkers described herein, e.g., connecting a moiety/domain to another moiety /domain.
- the expression repressor comprises a targeting moiety that is or comprises a CRISPR/Cas molecule, e.g., comprising a CRISPR/Cas protein, e.g., a dCas9 protein.
- the expression repressor is a fusion protein comprising an effector moiety that is or comprises MQ 1 and a DNA-targeting moiety that is or comprises a CRISPR/Cas molecule, e.g., comprising a CRISPR/Cas protein, e.g., a dCas9 protein; e.g., a dCas9m4.
- the expression repressor comprises an additional moiety described herein.
- the expression repressor decreases expression of a target gene or a plurality of target genes (e.g., a target gene or a plurality of target gene described herein).
- the expression repressor may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or genomic regulatory element (e.g., transcription control element) described herein.
- a system comprises two or more expression repressors.
- a system described herein comprises, or a method described herein comprises the use of, an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises Krueppel- associated box (KRAB) domain of Zinc Finger protein 10 e.g., as according to NP_056209.2 orthe protein encoded by NM_015394.5 or a functional variant or fragment thereof.
- KRAB Krueppel- associated box
- KRAB is a synthetic KRAB construct
- KRAB for use in an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to wildtype KRAB (e.g., e.g., as according to NP 056209.2 orthe protein encoded by NM 015394.5).
- a KRAB variant comprises one or more amino acid substitutions, deletions, or insertions relative to wildtype KRAB.
- a KRAB variant comprises a L37P substitution.
- KRAB comprises an amino acid sequence of SEQ ID NO: 13:
- the KRAB effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 14.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 14 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- KRAB for use in a polypeptide or an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to the KRAB sequence of SEQ ID NO: 13.
- a KRAB variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 13.
- the polypeptide or the expression repressor is a fusion protein comprising an effector moiety that is or comprises KRAB and a targeting moiety, e.g., a Zinc Finger domain or Crisper/Cas protein.
- the polypeptide or the expression repressor comprises an additional moiety described herein.
- the polypeptide or the expression repressor decreases expression of a target gene or a plurality of target genes.
- the polypeptide or the expression repressor may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or a plurality of target genes, e.g., a genomic regulatory element (e.g., transcription control element) described herein.
- a genomic regulatory element e.g., transcription control element
- a system described herein comprises, or a method described herein comprises the use of, an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises DNMT3a/3L complex, or a functional variant or fragment thereof.
- the DNMT3a/3L complex is a fusion construct.
- the DNMT3a/3L complex comprises DNMT3A, e.g., human DNMT3A, e.g., as according to NP 072046.2 or the protein encoded by NM 022552.4) or the protein encoded by NM_022552.4 or a functional variant or fragment thereof, e.g., aa 679-912 of human DNMT3A, e.g., as according to NP 072046.2 or the protein encoded by NM 022552.4).
- the DNMT3a/3L complex comprises human DNMT3L or a functional fragment or variant thereof (e.g., as according to NP 787063.
- DNMT3a/3L comprises an amino acid sequence of SEQ ID NO: 15.
- an effector moiety described herein comprises SEQ ID NO: 15, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- DNMT3a/3L is encoded by a nucleotide sequence of SEQ ID NO: 16.
- a nucleic acid described herein comprises a sequence of SEQ ID NO: 16 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- a system described herein comprises, or a method described herein comprises the use of, an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises EZH2, e.g., as according to NP-004447.2 or NP 001190176.1 2 or the protein encoded by NM 004456.5 or NM 001203247.2 or a functional variant or fragment thereof.
- an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises EZH2, e.g., as according to NP-004447.2 or NP 001190176.1 2 or the protein encoded by NM 004456.5 or NM 001203247.2 or a functional variant or fragment thereof.
- EZH2 for use in an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to EZH2, e.g., as according to NP-004447.2 or NP 001190176.1 2 or the protein encoded by NM 004456.5 or NM_001203247.2.
- an EZH2 variant comprises one or more amino acid substitutions, deletions, or insertions relative to wildtype EZH2.
- EZH2 comprises an amino acid sequence of SEQ ID NO: 17:
- the EZH2 effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 18.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 18 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- EZH2 for use in a polypeptide or expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to the EZH2 sequence of SEQ ID NO: 17.
- an EZH2 variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 17.
- the polypeptide or the expression repressor is a fusion protein comprising an effector moiety that is or comprises EZH2 and a targeting moiety. In some embodiments, the polypeptide or the expression repressor comprises an additional moiety described herein. In some embodiments, the polypeptide or the expression repressor decreases expression of a target gene or a plurality of target genes. In some embodiments, the polypeptide or the expression repressor may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or a plurality of target genes, e.g., a genomic regulatory element (e.g., transcription control element) described herein.
- a genomic regulatory element e.g., transcription control element
- a system described herein comprises, or a method described herein comprises the use of, an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises HDAC8, e.g., as according to NP 001159890 or NP_060956.1 or tire protein encoded by NM_001166418 or NM 018486.3 or a functional variant or fragment thereof.
- HDAC8 comprises an amino acid sequence of SEQ ID NO: 19:
- the HDAC8 effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 66.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 66 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the HDAC8 for use in a polypeptide or an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to the HDAC8 sequence of SEQ ID NO: 19.
- an HDAC8 variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 19.
- the polypeptide or the expression repressor is a fusion protein comprising an effector moiety that is or comprises HDAC8 and a targeting moiety. In some embodiments, the polypeptide or the expression repressor comprises an additional moiety described herein. In some embodiments, the polypeptide or the expression repressor decreases expression of a target gene or a plurality of target genes. In some embodiments, the polypeptide or the expression repressor may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or a plurality of target genes, e.g., a genomic regulatory element (e.g., transcription control element) described herein.
- a genomic regulatory element e.g., transcription control element
- a system described herein comprises, or a method described herein comprises the use of, an expression repressor or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises G9A e.g., as according to NP_001350618.1 or the protein encoded by NM_001363689.1 or a functional variant or fragment thereof, e.g., aa967-1250 of comprises G9A e.g., as according to NP 001350618.1 or the protein encoded by NM 001363689. 1.
- G9A comprises an amino acid sequence of SEQ ID NO: 67:
- the G9A effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 68.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 68 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- G9A for use in a polypeptide or an expression repressor described herein is a variant, e.g., comprising one or more mutations, relative to the G9A sequence of SEQ ID NO: 67.
- an G9A variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 67.
- the polypeptide or the expression repressor is a fusion protein comprising an effector moiety that is or comprises G9A and a targeting moiety. In some embodiments, the polypeptide or the expression repressor comprises an additional moiety described herein. In some embodiments, the polypeptide or the expression repressor decreases expression of a target gene or a plurality of target genes. In some embodiments, the polypeptide or the expression repressor may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or a plurality of target genes, e.g., a genomic regulatory element (e.g., transcription control element) described herein.
- a genomic regulatory element e.g., transcription control element
- a nucleic acid sequence encoding a site-specific disrupting agent comprising a targeting moiety and/or one or more effector moieties may be part or all of a codon- optimized coding region, optimized according to codon usage in mammals, e.g., humans.
- a nucleic acid sequence encoding a targeting moiety and/or one or more effector moieties is codon optimized for increasing the protein expression and/or increasing the duration of protein expression.
- a protein produced by the codon optimized nucleic acid sequence is at least 1%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, or at least 50% higher compared to levels of the protein when encoded by a nucleic acid sequence that is not codon optimized.
- a system described herein comprises, or a method described herein comprises the use of, a polypeptide comprising one or more (e.g., one) DNA-targeting moiety and one or more effector moiety, e.g., wherein the effector moiety is or comprises MQ1, e.g., bacterial MQ1, or a functional variant or fragment thereof.
- MQ1 is Spiroplasma monobiae MQ1, e.g., MQ1 from strain ATCC 33825 and/or corresponding to Uniprot ID P15840.
- MQ1 effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 10.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 10 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- MQ1 comprises an amino acid sequence of SEQ ID NO: 11. In some embodiments, MQ1 comprises an amino acid sequence of SEQ ID NO: 12. In some embodiments, an effector domain described herein comprises SEQ ID NO: 11 or 12, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- MQ1 for use in a site-specific disrupting agent described herein is a variant, e.g., comprising one or more mutations, relative to wildtype MQ1 (e.g., SEQ ID NO: 11 or SEQ ID NO: 12).
- an MQ1 variant comprises one or more amino acid substitutions, deletions, or insertions relative to wildtype MQ 1.
- an MQ 1 variant comprises a K297P substitution.
- an MQ1 variant comprises a N299C substitution.
- an MQ1 variant comprises a E301Y substitution.
- an MQ1 variant comprises a Q147L substitution (e.g., and has reduced DNA methyltransferase activity relative to wildtype MQ1).
- an MQ1 variant comprises K297P, N299C, and E301Y substitutions (e.g., and has reduced DNA binding affinity relative to wildtype MQ1).
- an MQ1 variant comprises Q147L, K297P, N299C, and E301Y substitutions (e.g., and has reduced DNA methyltransferase activity and DNA binding affinity relative to wildtype MQ1).
- the site-specific disrupting agent comprises one or more linkers described herein, e.g., connecting a moiety/domain to another moiety/domain.
- the sitespecific disrupting agent comprises a targeting moiety that is or comprises a CRISPR/Cas molecule, e.g., comprising a CRISPR/Cas protein, e.g., a dCas9 protein.
- the site-specific disrupting agent is a fusion protein comprising an effector moiety that is or comprises MQ 1 and a DNA- targeting moiety that is or comprises a CRISPR/Cas molecule, e.g., comprising a CRISPR/Cas protein, e.g., a dCas9 protein; e.g., a dCas9m4.
- the site-specific disrupting agent comprises an additional moiety described herein.
- the site-specific disrupting agent decreases expression of a target gene or a plurality of target genes (e.g., a target gene or a plurality of target gene described herein).
- the site-specific disrupting agent may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or genomic regulatory element (e.g., transcription control element) described herein.
- a system comprises two or more site-specific disrupting agents.
- a system described herein comprises, or a method described herein comprises the use of, a site-specific disrupting agent or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises Krueppel- associated box (KRAB) domain of Zinc Finger protein 10 e.g., as according to NP_056209.2 orthe protein encoded by NM_015394.5 or a functional variant or fragment thereof.
- KRAB Krueppel- associated box
- KRAB is a synthetic KRAB construct
- KRAB for use in a site-specific disrupting agent described herein is a variant, e.g., comprising one or more mutations, relative to wildtype KRAB (e.g., e.g., as according to NP 056209.2 or the protein encoded by NM 015394.5).
- a KRAB variant comprises one or more amino acid substitutions, deletions, or insertions relative to wildtype KRAB.
- a KRAB variant comprises a L37P substitution.
- KRAB comprises an amino acid sequence of SEQ ID NO: 13.
- the KRAB effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 14.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 14 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- KRAB for use in a polypeptide or a site-specific disrupting agent described herein is a variant, e.g., comprising one or more mutations, relative to the KRAB sequence of SEQ ID NO: 13.
- a KRAB variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 13.
- the polypeptide or the site-specific disrupting agent is a fusion protein comprising an effector moiety that is or comprises KRAB and a targeting moiety, e.g., a CRISPR/Cas protein.
- the polypeptide or the site-specific disrupting agent comprises an additional moiety described herein.
- the polypeptide or the site-specific disrupting agent decreases expression of a target gene or a plurality of target genes.
- the polypeptide orthe site-specific disrupting agent may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or a plurality of target genes, e.g., a genomic regulatory element (e.g., transcription control element) described herein.
- a genomic regulatory element e.g., transcription control element
- a system described herein comprises, or a method described herein comprises the use of, a site-specific disrupting agent or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises DNMT3a/3L complex, or a functional variant or fragment thereof.
- the DNMT3a/3L complex is a fusion construct.
- the DNMT3a/3L complex comprises DNMT3A, e g., human DNMT3A, e g., as according to NP 072046.2 orthe protein encoded by NM 022552.4) or the protein encoded by NM_022552.4 or a functional variant or fragment thereof, e.g., aa 679-912 of human DNMT3A, e.g., as according to NP 072046.2 or the protein encoded by NM 022552.4).
- the DNMT3a/3L complex comprises human DNMT3L or a functional fragment or variant thereof (e.g., as according to NP 787063.
- DNMT3a/3L comprises an amino acid sequence of SEQ ID NO: 15.
- an effector moiety described herein comprises SEQ ID NO: 15, or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- DNMT3a/3L is encoded by a nucleotide sequence of SEQ ID NO: 16.
- a nucleic acid described herein comprises a sequence of SEQ ID NO: 16 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17,
- a system described herein comprises, or a method described herein comprises the use of, a site-specific disrupting agent or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises EZH2, e.g., as according to NP-004447.2 or NP 001190176.1 2 or the protein encoded by NM 004456.5 or NM 001203247.2 or a functional variant or fragment thereof.
- EZH2 e.g., as according to NP-004447.2 or NP 001190176.1 2 or the protein encoded by NM 004456.5 or NM 001203247.2 or a functional variant or fragment thereof.
- MQ1 for use in a site-specific disrupting agent described herein is a variant, e.g., comprising one or more mutations, relative to EZH2, e.g., as according to NP-004447.2 or NP_001190176.1 2 or the protein encoded by NM 004456.5 or NM 001203247.2.
- an EZH2 variant comprises one or more amino acid substitutions, deletions, or insertions relative to wildtype EZH2.
- EZH2 comprises an amino acid sequence of SEQ ID NO: 17.
- tire EZH2 effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 18.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 18 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- EZH2 for use in a polypeptide or a site-specific disrupting agent described herein is a variant, e.g., comprising one or more mutations, relative to the EZH2 sequence of SEQ ID NO:
- an EZH2 variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 17.
- the polypeptide or the site-specific disrupting agent is a fusion protein comprising an effector moiety that is or comprises EZH2 and a targeting moiety. In some embodiments, the polypeptide or the site-specific disrupting agent comprises an additional moiety described herein. In some embodiments, the polypeptide or the site-specific disrupting agent decreases expression of a target gene or a plurality of target genes.
- the polypeptide or the site-specific disrupting agent may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or a plurality of target genes, e.g., a genomic regulatory element (e.g., transcription control element) described herein.
- a genomic regulatory element e.g., transcription control element
- a system described herein comprises, or a method described herein comprises the use of, a site-specific disrupting agent or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises HDAC8, e.g., as according to NP 001159890 or NP_060956.1 or the protein encoded by NM_001166418 or NM 018486.3 or a functional variant or fragment thereof.
- HDAC8 comprises an amino acid sequence of SEQ ID NO: 19.
- the HDAC8 effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 66.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 66 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the HDAC8 for use in a polypeptide or a site-specific disrupting agent described herein is a variant, e.g., comprising one or more mutations, relative to the HDAC8 sequence of SEQ ID NO: 19.
- an HDAC8 variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 19.
- the polypeptide or the site-specific disrupting agent is a fusion protein comprising an effector moiety that is or comprises HDAC8 and a targeting moiety. In some embodiments, the polypeptide or the site-specific disrupting agent comprises an additional moiety described herein. In some embodiments, the polypeptide or the site-specific disrupting agent decreases expression of a target gene or a plurality of target genes.
- the polypeptide or tire site-specific disrupting agent may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or a plurality of target genes, e.g., a genomic regulatory element (e.g., transcription control element) described herein.
- a genomic regulatory element e.g., transcription control element
- a system described herein comprises, or a method described herein comprises the use of, a site-specific disrupting agent or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moiety, wherein the effector moiety is or comprises G9A e.g., as according to NP_001350618.1 or the protein encoded by NM_001363689.1 or a functional variant or fragment thereof, e.g., aa967-1250 of comprises G9A e.g., as according to NP 001350618.1 or the protein encoded by NM 001363689.1 .
- G9A comprises an amino acid sequence of SEQ ID NO: 67.
- the G9A effector moiety is encoded by a nucleotide sequence of SEQ ID NO: 68.
- a nucleotide sequence described herein comprises a sequence of SEQ ID NO: 68 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- G9A for use in a polypeptide or a site-specific disrupting agent described herein is a variant, e.g., comprising one or more mutations, relative to the G9A sequence of SEQ ID NO: 67.
- a G9A variant comprises one or more amino acid substitutions, deletions, or insertions relative to SEQ ID NO: 67.
- the polypeptide or the site-specific disrupting agent is a fusion protein comprising an effector moiety that is or comprises G9A and a targeting moiety. In some embodiments, the polypeptide or the site-specific disrupting agent comprises an additional moiety described herein. In some embodiments, the polypeptide or the site-specific disrupting agent decreases expression of a target gene or a plurality of target genes.
- the polypeptide or the site-specific disrupting agent may be used in methods of modulating, e.g., decreasing, gene expression, methods of treating a condition, or methods of epigenetically modifying a target gene or a plurality of target genes, e.g., a genomic regulatory element (e.g., transcription control element) described herein.
- a genomic regulatory element e.g., transcription control element
- an expression repressor system comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more, expression repressors (and optionally no more than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2).
- system targets two or more different sequences (e.g., a 1st and 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, and/or further DNA sequence, and optionally no more than a 20th, 19th, 18th, 17th, 16th, 15th, 14th, 13th, 12th, 11th, 10th, 9th, 8th, 6th, 5th, 4th, 3rd, or 2nd sequence).
- sequences e.g., a 1st and 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, and/or further DNA sequence, and optionally no more than a 20th, 19th, 18th, 17th, 16th, 15th, 14th, 13th, 12th, 11th, 10th, 9th, 8th, 6th, 5th, 4th, 3rd, or 2nd sequence).
- system comprises a plurality of expression repressors, wherein each member of the plurality of expression repressors does not detectably bind, e.g., does not bind, to another member of the plurality of expression repressors.
- system comprises a first expression repressor and a second expression repressor, wherein the first expression repressor does not detectably bind, e.g., does not bind, to the second expression repressor.
- a system of the present disclosure comprises two or more expression repressors, wherein the expression repressors are present together in a composition, pharmaceutical composition, or mixture. In some embodiments, a system of the present disclosure comprises two or more expression repressors, wherein one or more expression repressors is not admixed with at least one other expression repressor.
- a system may comprise a first expression repressor and a second expression repressor, wherein the presence of the first expression repressor in the nucleus of a cell does not overlap with the presence of the second expression repressor in the nucleus of the same cell, wherein the system achieves a decrease in expression of a plurality of genes via the non-overlapping presences of the first and second expression repressors.
- the first expression repressor and a second expression repressor may act simultaneously or sequentially.
- the expression repressors of a system each comprise a different targeting moiety (e.g., the first, second, third, or further expression repressors each comprise different targeting moieties from one another).
- a system may comprise a first expression repressor and a second expression repressor wherein the first expression repressor comprises a first targeting moiety (e.g., a Zn Finger domain, Cas9 domain, or TAL effector domain), and the second expression repressor comprises a second targeting moiety (e.g., a Zn Finger domain, Cas9 domain, or TAL effector domain) different from the first targeting moiety.
- different can mean comprising distinct types of targeting moiety, e.g., the first targeting moiety comprises a Cas9 domain, and the second DNA- targeting moiety comprises a Zn finger domain.
- different can mean comprising distinct variants of the same type of targeting moiety, e.g., the first targeting moiety comprises a first Cas9 domain (e.g., from a first species) and the second targeting moiety comprises a second Cas9 domain (e.g., from a second species).
- systems of the present disclosure may comprise one or more expression repressors and one or more site-specific disrupting agents.
- the system comprises one or more expression repressors (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more (and optionally no more than 15,
- the system comprises one or more sitespecific disrupting agents (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more (and optionally no more than
- a system targets two or more different sequences (e.g., a 1st and 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, and/or further DNA sequence, and optionally no more than a 20th, 19th, 18th, 17th, 16th, 15th, 14th, 13th, 12th, 11th, 10th, 9th, 8th, 6th, 5th, 4th, 3rd, or 2nd sequence).
- sequences e.g., a 1st and 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, and/or further DNA sequence, and optionally no more than a 20th, 19th, 18th, 17th, 16th, 15th, 14th, 13th, 12th, 11th, 10th, 9th, 8th, 6th, 5th, 4th, 3rd, or 2nd sequence).
- the system comprises one or more expression repressors and one or more site-specific disrupting agents, wherein each of the one or more expression repressors and each of the one or more site-specific disrupting agents do not detectably bind, e.g., does not bind, to another expression repressor and/or site-specific disrupting agent.
- the system comprises an expression repressor and a site-specific disrupting agent, wherein each of the expression repressor and the site-specific disrupting agent do not detectably bind, e.g., does not bind, to one another.
- the system comprises one or more expression repressors and one or more site-specific disrupting agents, wherein each of the one or more expression repressors and each of the one or more site-specific disrupting agents independently bind a different target.
- the system comprises an expression repressor and a site-specific disrupting agent, wherein each of the expression repressor and the site-specific disrupting agent independently bind a different target.
- a system of the present disclosure comprises one or more expression repressors and one or more site-specific disrupting agents, wherein the expression repressors and sitespecific disrupting agents are present together in a composition, pharmaceutical composition, or mixture.
- a system of the present disclosure comprises one or more expression repressors and one or more site-specific disrupting agents, wherein the one or more expression repressors and the one or more site-specific disrupting agents are not admixed with at least one other expression repressor and/or site-specific disrupting agent.
- a system may comprise an expression repressor and a site-specific disrupting agent, wherein the presence of the expression repressor in the nucleus of a cell does not overlap with the presence of the site-specific disrupting agent in the nucleus of the same cell, wherein the system achieves a decrease in expression of a plurality of genes via the nonoverlapping presences of the expression repressor and the site-specific disrupting agent.
- the expression repressor and a site-specific disrupting agent may act simultaneously or sequentially.
- the expression repressors and tire site-specific disrupting agents of a system each comprise a different targeting moiety (e.g., the first, second, third, or further expression repressors each comprise different targeting moieties from one another and/or a first, second, third, or further site-specific disrupting agents each comprise different targeting moieties from one another).
- the one or more expression repressors comprise different targeting moieties from the one or more site-specific disrupting agents.
- a system may comprise an expression repressor and a site-specific disrupting agent wherein tire expression repressor comprises a first targeting moiety (e.g., a Zn Finger domain, Cas9 domain, or TAL effector domain), and the site-specific disrupting agent comprises a second targeting moiety (e.g., a Zn Finger domain, Cas9 domain, or TAL effector domain) different from the first targeting moiety.
- first targeting moiety e.g., a Zn Finger domain, Cas9 domain, or TAL effector domain
- second targeting moiety e.g., a Zn Finger domain, Cas9 domain, or TAL effector domain
- different can mean comprising distinct types of targeting moiety, e.g., the first targeting moiety comprises a Cas9 domain, and the second DNA- targeting moiety comprises a Zn finger domain.
- different can mean comprising distinct variants of the same type of targeting moiety, e.g., the first targeting moiety comprises a first Cas9 domain (e.g., from a first species) and the second targeting moiety comprises a second Cas9 domain (e.g., from a second species).
- first targeting moiety comprises a first Cas9 domain (e.g., from a first species)
- second targeting moiety comprises a second Cas9 domain (e.g., from a second species).
- the targeting moieties when a system comprises two or more targeting moieties of the same type, e.g., two or more Cas9 or Zn finger domains, the targeting moieties specifically bind two or more different sequences.
- the two or more Cas9 domains may be chosen or altered such that they only appreciably bind the gRNA corresponding to their target sequence (e.g., and do not appreciably bind the gRNA corresponding to the target of another Cas9 domain).
- the two or more effector moieties may be chosen or altered such that they only appreciably bind to their target sequence (e.g., and do not appreciably bind the target sequence of another effector moiety).
- a system comprises three or more site-specific disrupting agents and two or more site-specific disrupting agents comprise the same targeting moiety.
- a system may comprise three site-specific disrupting agents, wherein the first and second site-specific disrupting agents both comprise a first targeting moiety and the third site-specific disrupting agent comprises a second different targeting moiety.
- a system may comprise four site-specific disrupting agents, wherein the first and second site-specific disrupting agents both comprise a first targeting moiety and the third and fourth site-specific disrupting agents comprises a second different targeting moiety.
- a system may comprise five site-specific disrupting agents, wherein the first and second site-specific disrupting agents both comprise a first targeting moiety, the third and fourth sitespecific disrupting agents both comprise a second different targeting moiety, and the fifth site-specific disrupting agent comprises a third different targeting moiety.
- different can mean comprising different types of -targeting moieties or comprising distinct variants of the same type of targeting moiety.
- the site-specific disrupting agents of a sy stem each bind to a different DNA sequence (e.g., the first, second, third, or further site-specific disrupting agents each bind DNA sequences that are different from one another).
- a system may comprise a first site-specific disrupting agent and a second site-specific disrupting agent wherein the first site-specific disrupting agent binds to a first DNA sequence, and the second site-specific disrupting agent binds to a second DNA sequence.
- the first DNA sequence may be situated on a first genomic DNA strand and the second DNA sequence may be situated on a second genomic DNA strand. In some embodiments, the first DNA sequence may be situated on the same genomic DNA strand as the second DNA sequence.
- a system comprises three or more expression repressors and two or more of the expression repressors bind the same DNA sequence.
- a system may comprise three expression repressors, wherein a first and a second expression repressor both bind a first DNA sequence, and a third expression repressor binds a second different DNA sequence.
- a system may comprise four expression repressors, wherein a first and a second expression repressor both bind a first DNA sequence and a third and a fourth expression repressor both bind a second DNA sequence.
- a system may comprise five expression repressors, wherein a first and a second expression repressor both bind a first DNA sequence, a third and a fourth expression repressor both bind a second DNA sequence, and a fifth expression repressor binds a third DNA sequence.
- different can mean that there is at least one position that is not identical between the DNA sequence bound by one expression repressor and the DNA sequence bound by another expression repressor, or that there is at least one position present in the DNA sequence bound by one expression repressor that is not present in the DNA sequence bound by another expression repressor.
- a system comprises one or more expression repressors and one or more site-specific disrupting agents.
- a system comprises two or more (e.g., two) expression repressors and a plurality (e.g., two) of the expression repressors comprise targeting moieties that bind to different DNA sequences.
- a first targeting moiety may bind to a first DNA sequence and a second targeting moiety may bind to a second DNA sequence, wherein the first and the second DNA sequences are different and do not overlap.
- the first DNA sequence is separated from the second DNA sequence by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 base pairs (and optionally, no more than 500, 400, 300, 200, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, or 50 base pairs).
- the first DNA sequence is separated from the second DNA sequence by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 base pairs (and optionally, no base pairs, e.g., the first and second sequence are directly adjacent one another).
- the first DNA sequence is separated from the second DNA sequence by at least 1 kb, 2 kb, 3 kb, 4 kb, or 5 kb.
- a system comprises two or more (e.g., two) site-specific disrupting agents and a plurality (e.g., two) of the site-specific disrupting agents comprise targeting moieties that bind to different DNA sequences.
- a first targeting moiety may bind to a first DNA sequence and a second DNA-targeting moiety may bind to a second DNA sequence, wherein the first and the second DNA sequences are different and do not overlap.
- the first DNA sequence is separated from the second DNA sequence by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 base pairs (and optionally, no more than 500, 400, 300, 200, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, or 50 base pairs).
- the first DNA sequence is separated from the second DNA sequence by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 base pairs (and optionally, no base pairs, e.g., the first and second sequence are directly adjacent one another).
- the expression repressors and/or site-specific disrupting agents of a system each, independently, comprise a different effector moiety (e.g., the first, second, third, or further expression repressors each independently comprise a different effector moiety from one another and/or the first, second, third, or further site-specific disrupting agents each independently comprise a different effector moiety from one another).
- a system may comprise a first expression repressor and a second expression repressor wherein the first expression repressor comprises a first effector moiety, and the second expression repressor comprises a second effector moiety different from the first effector moiety.
- a system may comprise an expression repressor and a site-specific disrupting agent wherein the expression repressor comprises a first effector moiety, and the site-specific disrupting agent comprises a second effector moiety different from the first effector moiety.
- the different effector moieties comprise distinct types of effector moiety. In other embodiments, the different effector moieties comprise distinct variants of the same type of effector moiety.
- the present disclosure provides an expression repressor system comprising a first expression repressor and a second expression repressor.
- the first expression repressor comprises a first targeting moiety.
- the first targeting moiety comprises a zinc finger domain.
- the first targeting moiety comprises a CRISPR/Cas (e.g., a Cas9 or dCas9) domain.
- the first targeting moiety comprises a TAL effector domain.
- the first expression repressor comprises a first effector moiety.
- the first effector moiety comprises a DNA methyltransferase, e.g., MQ1 or a functional fragment thereof, and/or KRAB, e.g., a KRAB domain.
- the second expression repressor comprises a second targeting moiety.
- the second targeting moiety comprises a zinc finger domain.
- the second expression repressor comprises a second effector moiety.
- the second effector moiety comprises a DNA methyltransferase, e g., MQ1 or a functional fragment thereof, and/or KRAB, e.g., a KRAB domain.
- the expression repressor system is encoded by a first nucleic acid encoding the first expression repressor, e.g., the first targeting moiety and first effector moiety, wherein expression is driven by a first promoter or IRES, and a second nucleic acid encoding the second expression repressor, e.g., the second targeting moiety and second effector moiety, wherein expression is driven by a second promoter or IRES.
- the expression repressor system is encoded by a nucleic acid wherein expression is not driven by a promotor or IRES, e.g., an mRNA.
- mono-cistronic sequences are used.
- the nucleic acid encoding the expression repressor system is a poly-cistronic sequence.
- the poly-cistronic sequence is a bi-cistronic sequence.
- the poly-cistronic sequence comprises a sequence encoding the first expression repressor and a sequence encoding the second expression repressor.
- the poly-cistronic sequence encodes a self-cleavable peptide sequence, e.g., a 2A peptide sequence, e.g., a T2A peptide sequence, a P2A sequence.
- the poly-cistronic sequence encodes a T2A peptide sequence and a P2A peptide sequence. In some embodiments, the poly-cistronic sequence encodes a tandem 2A sequence, e.g., a tPT2A sequence. In some embodiments, the bi-cistronic construct further comprises a polyA tail.
- a single mRNA transcript encoding the first expression repressor, and the second expression repressor are produced, which upon translation gets cleaved, e.g., after the glycine residue within the 2A peptide, to yield the first expression repressor and the second expression repressor as two separate proteins.
- the first and the second expression repressor are separated by “ribosome-skipping”.
- the first expression repressor and/ or the second expression repressor retains a fragment of the 2A peptide after ribosome skipping.
- the expression level of the first and second expression repressor are equal.
- the expression level of the first and the second expression repressor are different.
- tire protein level of tire first expression repressor is within 1%, 2%, 5%, or 10% of (greater than or less than) the protein level of the second expression repressor.
- the present disclosure provides a system comprising at least one expression repressor as described herein and at least one site-specific dismpting agent (e.g., any site-specific disrupting agent described herein).
- the system comprises a first expression repressor and a first site-specific disrupting agent.
- the first expression repressor comprises a first targeting moiety, hr some embodiments, the first targeting moiety comprises a zinc finger domain. In some embodiments, the first expression repressor comprises a first effector moiety.
- the first effector moiety comprises a DNA methyltransferase, e.g., MQ1 or a functional fragment thereof, and/or KRAB, e.g., a KRAB domain.
- the sitespecific disrupting agent comprises a second targeting moiety, wherein the second targeting moiety targets an anchor sequence of the CXCL locus.
- the site-specific disrupting agent comprises a second effector moiety (e g., a site-specific disrupting agent effector moiety).
- the second effector moiety (e.g., a site-specific disrupting agent effector moiety) comprises a DNA methyltransferase, e.g., MQ1 or a functional fragment thereof, and/or KRAB, e.g., a KRAB domain.
- the expression repressor effector moiety is the same as the site-specific disrupting agent effector moiety.
- the first effector moiety e.g., the expression repressor effector moiety
- the second effector moiety e.g., the site-specific disrupting agent effector moiety.
- the first effector moiety e.g., the expression repressor effector moiety
- the second effector moiety e.g., the site-specific disrupting agent moiety
- each, independently comprise methyltransferase activity, e.g., comprise DNA methyltransferase activity.
- the expression repressor system is encoded by a first nucleic acid encoding the first expression repressor, e.g., the first targeting moiety and first effector moiety, wherein expression is driven by a first promoter or IRES, and a second nucleic acid encoding the site-specific disrupting agent, e.g., the second targeting moiety and second effector moiety, wherein expression is driven by a second promoter or IRES.
- the expression repressor system is encoded by a nucleic acid wherein expression is not driven by a promotor or IRES, e.g., an mRNA.
- mono-cistronic sequences are used.
- the nucleic acid encoding the expression repressor system is a poly-cistronic sequence.
- the poly-cistronic sequence is a bi-cistronic sequence.
- the multi-cistronic sequence comprises a sequence encoding the first expression repressor and a sequence encoding the site-specific disrupting agent.
- the poly-cistronic sequence encodes a self-cleavable peptide sequence, e.g., a 2A peptide sequence, e.g., a T2A peptide sequence, a P2A sequence.
- the poly- cistronic sequence encodes a T2A peptide sequence and a P2A peptide sequence. In some embodiments, the poly-cistronic sequence encodes a tandem 2A sequence, e.g., a tPT2A sequence. In some embodiments, the bi-cistronic construct further comprises a polyA tail.
- a single mRNA transcript encoding the first expression repressor, and the site-specific disrupting agent are produced, which upon translation gets cleaved, e.g., after the glycine residue within the 2A peptide, to yield the first expression repressor and the site-specific disrupting agent as two separate proteins.
- the first expression repressor and the site-specific disrupting agent are separated by “ribosome-skipping”.
- the first expression repressor and/ or the site-specific disrupting agent retains a fragment of the 2A peptide after ribosome skipping.
- the expression level of the first expression repressor and the site-specific dismpting agent are equal. In some embodiments, the expression level of the first expression repressor and the site-specific dismpting agent are different. In some embodiments, the protein level of the first expression repressor is within 1%, 2%, 5%, or 10% of (greater than or less than) the protein level of the site-specific dismpting agent.
- Targeting moieties may specifically bind a DNA sequence, e.g., a DNA sequence associated with a target plurality of genes, e.g., a genomic regulatory element or an anchor sequence of an ASMC comprising the target plurality of genes. Any molecule or compound that specifically binds a DNA sequence may be used as a targeting moiety.
- a targeting moiety comprises a nucleic acid, e.g., comprising a sequence that is complementary to an enhancer sequence, e.g., an sequence operably linked to the target plurality of genes.
- a targeting moiety of a site-specific disrupting agent comprises a nucleic acid, e.g., comprising a sequence that is complementary to an anchor sequence, e.g., an anchor sequence of an ASMC comprising the target plurality of genes.
- the nucleic acid is an oligonucleotide that physically/sterically blocks binding of a factor (e.g., a transcription factor, e.g., P65, or a nucleating polypeptide, e.g., CTCF) to a sequence (e.g., an enhancer sequence or an anchor sequence).
- a factor e.g., a transcription factor, e.g., P65, or a nucleating polypeptide, e.g., CTCF
- the nucleic acid comprises a guide RNA (gRNA), e.g., compatible with a CRISPR/Cas molecule.
- gRNA guide RNA
- a targeting moiety comprises a CRISPR/Cas molecule, a TAL effector molecule, a Zn finger molecule, a tetR domain, a meganuclease, a peptide nucleic acid (PNA) or a nucleic acid.
- the targeting moiety specifically binds to a nucleic acid sequence within an El or E2 cRE of the CXCL locus. In some embodiments, the targeting moiety specifically binds to a nucleic acid sequence within the El cRE of the CXCL locus. In certain embodiments, the targeting moiety (e.g., an El-targeting moiety) specifically binds a region within the nucleic acid sequence of SEQ ID NO: 162, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an El-targeting moiety specifically binds a region within the nucleic acid sequence of SEQ ID NO: 162, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having
- the targeting moiety specifically binds to a nucleic acid sequence with the E2 cRE of the CXCL locus.
- the targeting moiety e.g., an E2 -targeting moiety
- the targeting moiety specifically binds to a nucleic acid sequence within the IL8 promoter.
- the target site (e.g., target site within the IL8 promoter) is within genomic coordinates chr4:74606112-74606462 (hg!9). In some embodiments, the target site (e.g., target site within the IL8 promoter) is located within 1 kb from chr:74606112-74606462 (e.g., chr4:74606112-74606662, chr4:74606112-74606862, chr4:74606112-74607062, chr4: 74606112- 74607262, chr4:74606112-74607462, chr4:74605912-74606462, chr4:74605712-74606462, chr4:74605512-74606462, chr4:74605312-74606462, chr4:74605112-74606462, chr4:74605912- 74606662, chr4:
- the target site (e.g., target site within the IL8 promoter) is located 500 bp upstream from the transcription start site. In certain embodiments, the target site (e.g., target site within the IL8 promoter) is located at chr4:74605723-74606223.
- the target site (e.g., target site within the IL8 promoter) is located at chr4:74605723-74606426, chr4:74605723-74606626, chr4:74605723-74606826, chr4:74605723-74607026, chr4:74605723-74607226, chr4:74605523- 74606226, chr4:74605323-74606226, chr4:74605123-74606226, chr4:74604923-74606226, chr4:74604723-74606226, chr4:74605523-74606426, chr4:74605523-74606626, chr4:74605523- 74606826, chr4:74605523-74607026, chr4:74605523-74607226, chr4:74605323-74606426, chr4:74
- the target site (e.g., target site within the IL8 promoter) is located 1000 bp upstream from the transcription start site. In certain embodiments, the target site (e.g., target site within the IL8 promoter) is located at chr4:74605223-74606223.
- the target site (e g., target site within the IL8 promoter) is located at chr4:74605226-74606426, chr4:74605226-74606626, chr4:74605226-74606826, chr4:74605226-74607026, chr4:74605226-74607226, chr4:74605026- 74606226, chr4:74604826-74606226, chr4:74604626-74606226, chr4: 74604426-74606226, chr4:74604226-74606226, chr4:74605026-74606426, chr4: 74605026-74606626, chr4:74605026- 74606826, chr4:74605026-74607026, chr4: 74605026-74607226, chr4: 74604826-74606426, chr4:74
- a targeting moiety binds to its target sequence with a KD of less than or equal to 500, 450, 400, 350, 300, 250, 200, 150, 100, 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02, 0.01, 0.005, 0.002, or 0.001 nM (and optionally, a KD of at least 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.09, 0.08, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02, 0.01, 0.005, 0.002, or 0.001 nM).
- a targeting moiety binds to its target sequence with a K D of 0.001 nM to 500 nM, e.g., 0.1 nM to 5 nM, e.g., about 0.5 nM. In some embodiments, a targeting moiety binds to a non-target sequence with a KD of at least 500, 600, 700, 800, 900, 1000, 2000, 5000, 10,000, or 100,000 nM (and optionally, does not appreciably bind to a non-target sequence). In some embodiments, a targeting moiety does not bind to a non-target sequence.
- a targeting moiety of an expression repressor or a site-specific dismpting agent comprises a nucleic acid comprising a sequence complementary to a sequence selected from Table 8 or 8A or a sequence having at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto.
- a targeting moiety of an expression repressor or a site-specific disrupting agent comprises a nucleic acid comprising a sequence selected from Table 8 or 8A, or a sequence having at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto.
- the targeting moiety of an expression repressor or a site-specific disrupting agent binds to a target site having a sequence of Table 8 or 8A. It is understood that, in some embodiments, the targeting moiety comprises an RNA sequence in which each position indicated as a T in Table 8 or 8A is occupied by a U. Table 8: Exemplary sequence or target sequences of gRNA spacers
- Table 8A Exemplary sequence or target sequences of gRNA spacers, c.g.. for use in a murine model
- a targeting moiety comprises a nucleic acid comprising a sequence selected from Table 9 or 9A, or a sequence having at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95 ,96, 97, 98, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto.
- a targeting moiety comprises a nucleic acid comprising a spacer sequence within a sequence of Table 9 or 9A, or a sequence having at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95 ,96, 97, 98, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto. It is understood that, in some embodiments, the targeting moiety comprises an RNA sequence in which each position indicated as a T in Table 9 or 9A is occupied by a U.
- Table 9A Exemplary guide sequences, e.g.. for use in a murine model
- a targeting moiety comprises a nucleic acid comprising a sequence that is complementary to at least a portion of the sequence of a cRE (e.g., an El cRE), or having no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 positions of non-complementarity thereto.
- a targeting moiety comprises a nucleic acid comprising a sequence that is complementary to at least a portion of the sequence of a non-human cRE (e.g., a non-human El cRE) homologous to a human cRE (e.g., a mouse cRE), or having no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 positions of non-complementarity thereto.
- a targeting moiety comprises a nucleic acid comprising a sequence that at least partially overlaps with a region having genomic coordinates GRCh37: chr4:74591768-74591790, GRCh37: chr4:74591844-74591866, GRCh37: chr4:74591892-74591914, GRCh37: chr4:74592088- 74592110, GRCh37: chr4:74982748-74982770, GRCh37: chr4:74982841-74982863, GRCh37: chr4:74982882-74982904, GRCh37: chr4:74982960-74982982, GRCh37: chr4:74983108-74983130, GRCh37: chr4:74983181-74983203, or GRCh37: chr4: 74606162-74606184.
- a targeting moiety binds to a sequence at genomic position GRCh37: chr4:74591768-74591790, GRCh37: chr4:74591844-74591866, GRCh37: chr4:74591892-74591914, GRCh37: chr4:74592088-74592110, GRCh37: chr4: 74982748-74982770, GRCh37: chr4:74982841- 74982863, GRCh37: chr4:74982882-74982904, GRCh37: chr4:74982960-74982982, GRCh37: chr4:74983108-74983130, GRCh37: chr4:74983181-74983203, or GRCh37: chr4:74606162-74606184.
- a targeting moiety binds to a cRE (e.g., an El cRE) or to a site proximal to a cRE (e.g., an El cRE), e.g., a cRE operably linked to a target plurality of genes.
- a cRE e.g., an El cRE
- a site proximal to a cRE e.g., an El cRE
- a cRE operably linked to a target plurality of genes.
- a targeting moiety or a site-specific disrupting agent comprises a nucleic acid comprising a sequence selected from Table 7 or a sequence having at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto. It is understood that, in some embodiments, the targeting moiety comprises an RNA sequence in which each position indicated as a T in Table 7 is occupied by a U.
- a targeting moiety comprises a nucleic acid comprising a sequence selected from Table 6 or a sequence having at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95 ,96, 97, 98, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto. It is understood that, in some embodiments, the targeting moiety comprises an RNA sequence in which each position indicated as a T in Table 6 is occupied by a U.
- a targeting moiety comprises a nucleic acid comprising a sequence that is complementary to the sequence of an anchor sequence, e.g., of an ASMC comprising the target plurality of genes, or having no more than 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 positions of non-complementarity thereto.
- a targeting moiety comprises a nucleic acid comprising a sequence that at least partially overlaps with a region having genomic coordinates chr4:74595464-74595486, chr4:74595457-74595479, chr4:74595460-74595482, chr4:74595472-74595494, chr4:75000088- 75000110, chr4:75000091-75000113, chr4:75000085-75000107, chr4:75000157-75000179, chr4:75000156-75000178, chr4:74595215-74595237, chr4:74595370-74595392, chr4:74595560- 74595582, chr4:74595642-74595664, chr4:74595787-74595809, chr4:74528428-74528450, chr4:745285
- a targeting moiety binds to a sequence at genomic position chr4:74595464-74595486, chr4:74595457-74595479, chr4:74595460-74595482, chr4:74595472- 74595494, chr4:75000088-75000110, chr4:75000091-75000113, chr4:75000085-75000107, chr4:75000157-75000179, chr4:75000156-75000178, chr4:74595215-74595237, chr4:74595370- 74595392, chr4: 74595560-74595582, chr4:74595642-74595664, chr4:74595787-74595809, chr4:74528428-74528450, chr4:74528567-74528589, chr4:745286
- a targeting moiety binds to an anchor sequence or to a site proximal to an anchor sequence, e.g., an anchor sequence that is part of an ASMC comprising, wholly or in part, a target plurality of genes.
- a targeting moiety comprises a CRISPR/Cas molecule.
- an effector moiety comprises a CRISPR/Cas molecule.
- a CRISPR/Cas molecule comprises a protein involved in the clustered regulatory interspaced short palindromic repeat (CRISPR) system, e.g., a Cas protein, and optionally a guide RNA, e.g., single guide RNA (sgRNA).
- CRISPR systems are adaptive defense systems originally discovered in bacteria and archaea.
- CRISPR systems use RNA-guided nucleases tenned CRISPR-associated or “Cas” endonucleases (e.g., Cas9 or Cpfl) to cleave foreign DNA.
- Cas CRISPR-associated endonucleases
- an endonuclease is directed to a target nucleotide sequence (e.g., a site in the genome that is to be sequence-edited) by sequence-specific, non-coding “guide RNAs” that target single- or double-stranded DNA sequences.
- Three classes (I-III) of CRISPR systems have been identified.
- the class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins).
- One class II CRISPR system includes a type II Cas endonuclease such as Cas9, a CRISPR RNA (“crRNA”), and a trans-activating crRNA (“tracrRNA”).
- the crRNA contains a “guide RNA”, typically about 20-nucleotide RNA sequence that corresponds to a target DNA sequence.
- crRNA also contains a region that binds to the tracrRNA to form a partially double-stranded structure which is cleaved by RNase III, resulting in a crRNA/tracrRNA hybrid.
- a crRNA/tracrRNA hybrid then directs Cas9 endonuclease to recognize and cleave a target DNA sequence.
- a target DNA sequence must generally be adjacent to a “protospacer adjacent motif’ (“PAM”) that is specific for a given Cas endonuclease; however, PAM sequences appear throughout a given genome.
- PAM protospacer adjacent motif
- CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; examples of PAM sequences include 5’-NGG (Streptococcus pyogenes), 5’-NNAGAA (Streptococcus thermophilus CRISPR1), 5’-NGGNG (Streptococcus thermophilus CRISPR3), and 5’- NNNGATT (Neisseria meningiditis).
- Some endonucleases e.g., Cas9 endonucleases, are associated with G-rich PAM sites, e.
- 5’-NGG e.g., TGG, e.g., CGG, e.g., AGG
- Another class II CRISPR system includes the type V endonuclease Cpfl, which is smaller than Cas9; examples include AsCpfl (from Acidaminococcus sp.) and LbCpfl (from Lachnospiraceae sp.).
- Cpfl -associated CRISPR arrays are processed into mature crRNAs without the requirement of a tracrRNA; in other words, a Cpfl system requires only Cpfl nuclease and a crRNA to cleave a target DNA sequence.
- Cpfl endonucleases are associated with T-rich PAM sites, e. g., 5’-TTN.
- Cpfl can also recognize a 5’-CTA PAM motif.
- Cpfl cleaves a target DNA by introducing an offset or staggered double-strand break with a 4- or 5- nucleotide 5’ overhang, for example, cleaving a target DNA with a 5 -nucleotide offset or staggered cut located 18 nucleotides downstream from (3 ’ from) from a PAM site on the coding strand and 23 nucleotides downstream from the PAM site on the complimentary strand; the 5 -nucleotide overhang that results from such offset cleavage allows more precise genome editing by DNA insertion by homologous recombination than by insertion at blunt-end cleaved DNA. See, e.g., Zetsche et al. (2015) Cell, 163:759 - 771.
- Cas proteins A variety of CRISPR associated (Cas) genes or proteins can be used in the technologies provided by the present disclosure and the choice of Cas protein will depend upon the particular conditions of the method. Specific examples of Cas proteins include class II systems including Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Cpfl, C2C1, or C2C3.
- a Cas protein e.g., a Cas9 protein
- a particular Cas protein e.g., a particular Cas9 protein, is selected to recognize a particular protospacer-adjacent motif (PAM) sequence.
- PAM protospacer-adjacent motif
- a targeting moiety includes a sequence targeting polypeptide, such as a Cas protein, e.g., Cas9.
- a Cas protein e.g., a Cas9 protein
- a Cas protein may be obtained from a bacteria or archaea or synthesized using known methods.
- a Cas protein may be from a gram positive bacteria or a gram negative bacteria.
- a Cas protein may be from a Streptococcus (e.g., a S. pyogenes, or a S. thermophilus), a Francisella (e.g., an F. novicida), a Staphylococcus (e.g., an S.
- an Acidaminococcus e.g., an Acidaminococcus sp. BV3L6
- a Neisseria e.g., an N. meningitidis
- a Cryptococcus e.g., a Corynebacterium, a Haemophilus, a Eubacterium, a Pasteurella, a Prevotella, a Veillonella, or a Marinobacter.
- a Cas protein requires a protospacer adjacent motif (PAM) to be present in or adjacent to a target DNA sequence for the Cas protein to bind and/or function.
- the PAM is or comprises, from 5’ to 3’, NGG, YG, NNGRRT, NNNRRT, NGA, TYCV, TATV, NTTN, or NNNGATT, where N stands for any nucleotide, Y stands for C or T, R stands for A or G, and V stands for A or C or G.
- a Cas protein is a protein listed in Table 1.
- a Cas protein comprises one or more mutations altering its PAM.
- a Cas protein comprises E1369R, E1449H, and R1556A mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a Cas protein comprises E782K, N968K, and R1015H mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a Cas protein comprises DI 135V, R1335Q, and T1337R mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a Cas protein comprises S542R and K607R mutations or analogous substitutions to the amino acids corresponding to said positions. In some embodiments, a Cas protein comprises S542R, K548V, and N552R mutations or analogous substitutions to the amino acids corresponding to said positions.
- the Cas protein is catalytically active and cuts one or both strands of the target DNA site. In some embodiments, cutting the target DNA site is followed by formation of an alteration, e.g., an insertion or deletion, e.g., by the cellular repair machinery.
- the Cas protein is modified to deactivate the nuclease, e.g., nuclease- deficient Cas9.
- nuclease e.g., nuclease- deficient Cas9.
- wild-type Cas9 generates double-strand breaks (DSBs) at specific DNA sequences targeted by a gRNA
- a number of CRISPR endonucleases having modified functionalities are available, for example: a “nickase” version of Cas9 generates only a single-strand break; a catalytically inactive Cas9 (“dCas9”) does not cut target DNA.
- dCas9 binding to a DNA sequence may interfere with transcription at that site by steric hindrance.
- dCas9 binding to an anchor sequence may interfere with (e.g., decrease or prevent) genomic complex (e.g., ASMC) formation and/or maintenance.
- a targeting moiety comprises a catalytically inactive Cas9, e.g., dCas9, e.g., Cas9m4.
- dCas9 comprises mutations in each endonuclease domain of the Cas protein, e.g., D10A and H840A mutations.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein comprises a D 11 A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein, e.g., dCas9 comprises a N995A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein comprises DI 1A, H969A, and N995A mutations or analogous substitutions to the amino acids corresponding to said positions.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein comprises a D839A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein, e.g., dCas9 comprises a N863A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e.g., dCas9, comprises D10A, D839A, H840A, and N863A mutations or analogous substitutions to the amino acids corresponding to said positions.
- a catalytically inactive Cas9 protein e.g., dCas9, comprises a E993A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein comprises a D917A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein, e.g., dCas9 comprises a D1255A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e.g., dCas9, comprises D917A, E1006A, and D1255A mutations or analogous substitutions to the amino acids corresponding to said positions.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein comprises a D16A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e.g., dCas9
- a catalytically inactive Cas9 protein, e.g., dCas9 comprises a H588A mutation or an analogous substitution to the amino acid corresponding to said position.
- a catalytically inactive Cas9 protein e g., dCas9
- a catalytically inactive Cas9 protein e.g., dCas9
- a system described herein comprises, or a method described herein comprises the use of, an expression repressor or a site-specific disrupting agent or a polypeptide comprising one or more (e.g., one) targeting moiety and one or more effector moieties (e.g., one or two effector moieties), wherein the one or more targeting moiety is or comprises a CRISPR/Cas molecule comprising a Cas protein, e.g., catalytically inactive Cas9 protein, e.g., sadCas9, dCas9, e.g., dCas9m4, or a functional variant or fragment thereof.
- dCas9 comprises an amino acid sequence of SEQ ID NO: 5, 6, or 7.
- gRNA Guide RNA
- a targeting moiety may comprise a Cas molecule comprising or linked (e.g., covalently) to a gRNA.
- a gRNA is a short synthetic RNA composed of a “scaffold” sequence necerney for Cas-protein binding and a user-defined ⁇ 20 nucleotide targeting sequence for a genomic target.
- guide RNA spacer sequences are generally designed to have a length of between 17 - 24 nucleotides (e.g., 19, 20, or 21 nucleotides) and be complementary to the targeted nucleic acid sequence.
- the gRNA comprises 3-6 flanking phosphorothioate (PS) linkages, e.g., 3 flanking PS linkages at each end.
- PS phosphorothioate
- sgRNA single guide RNA
- sgRNA single guide RNA
- tracrRNA for binding the nuclease
- crRNA to guide the nuclease to the sequence targeted for editing
- Chemically modified sgRNAs have also been demonstrated to be effective for use with Cas proteins; see, for example, Hendel et al. (2015) Nature Biotechnol., 985 - 991.
- a gRNA comprises a nucleic acid sequence that is complementary to a DNA sequence associated with a target gene.
- the DNA sequence is, comprises, or overlaps an expression control element that is operably linked to the target gene.
- a gRNA comprises a nucleic acid sequence that is at least 90, 95, 99, or 100% complementary to a DNA sequence associated with a target gene.
- a gRNA for use with a targeting moiety that comprises a Cas molecule is an sgRNA.
- a gRNA comprises a sequence selected from Table 8 or Table 9 or a sequence having at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity thereto, or differing at no more than 1 , 2, 3, 4, or 5 positions relative thereto.
- a gRNA for use with a CRISPR/Cas molecule of an expression repressor specifically binds a target sequence associated with one or more of CXCL1-8 gene expression (e.g., an El cRE).
- a gRNA may comprise a target-binding sequence selected from any one of SEQ ID NOs: 90- 100.
- an expression repressor comprises a targeting moiety that binds a target site within genomic coordinates chr4: 74591400-74593000 or chr4:74982639-74983600. In some embodiments, an expression repressor comprises a targeting moiety that binds a target site within genomic coordinates chr4: 74591400-74593000. In some embodiments, an expression repressor comprises a targeting moiety that binds a target site within genomic coordinates chr4:74982639- 74983600.
- the targeting moiety binds a target site chosen from k) GRCh37: chr4:74591768-74591790; 1) GRCh37: chr4:74591844-74591866; m) GRCh37: chr4:74591892- 74591914; n) GRCh37: chr4:74592088-74592110; o) GRCh37: chr4:74982748-74982770; p) GRCh37: chr4:74982841-74982863; q) GRCh37: chr4:74982882-74982904; r) GRCh37: chr4:74982960- 74982982; s) GRCh37: chr4:74983108-74983130; and t) GRCh37: chr4:74983181-74983203.
- the targeting moiety binds a target site with genomic coordinates GRCh37: chr4:74591768- 74591790. In some embodiments, the targeting moiety binds a target site with genomic coordinates GRCh37: chr4:74591844-74591866. In some embodiments, the targeting moiety binds atarget site with genomic coordinates GRCh37: chr4:74591892-74591914. In some embodiments, the targeting moiety binds a target site with genomic coordinates GRCh37: chr4:74592088-74592110.
- the targeting moiety binds atarget site with genomic coordinates GRCh37: chr4:74982748-74982770. In some embodiments, the targeting moiety binds a target site with genomic coordinates GRCh37: chr4:74982841-74982863. In some embodiments, the targeting moiety binds a target site with genomic coordinates GRCh37: chr4:74982882-74982904. In some embodiments, the targeting moiety binds a target site with genomic coordinates GRCh37: chr4:74982960-74982982.
- the targeting moiety binds atarget site with genomic coordinates GRCh37: chr4: 74983108-74983130. In some embodiments, the targeting moiety binds a target site with genomic coordinates GRCh37: chr4: 74983181-74983203. As used in this disclosure, the genomic coordinates are based on hgl9 human genome reference assembly unless specified otherwise.
- an expression repressor comprises a targeting moiety that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates chr4: 74591400-74593000 or chr4:74982639-74983600. In some embodiments, an expression repressor comprises a targeting moiety that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates chr4: 74591400-74593000.
- an expression repressor comprises a targeting moiety that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates chr4:74982639- 74983600.
- the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site chosen from k) GRCh37: chr4:74591768-74591790; 1) GRCh37: chr4:74591844-74591866; m) GRCh37: chr4:74591892-74591914; n) GRCh37: chr4:74592088- 74592110; o) GRCh37: chr4:74982748-74982770; p) GRCh37: chr4:74982841-74982863; q) GRCh37: chr4:74982882-74982904; r) GRCh37: chr4:74982960-74982982; s) GRCh37: chr4:74983108- 74983130; and t) GRCh37: chr4:
- the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of atarget site with genomic coordinates GRCh37: chr4:74591768-74591790. In some embodiments, the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of atarget site with genomic coordinates GRCh37: chr4:74591844-74591866. In some embodiments, the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74591892 -74591914.
- the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of atarget site with genomic coordinates GRCh37: chr4:74592088-74592110. In some embodiments, the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74982748-74982770. In some embodiments, the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74982841-74982863.
- the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74982882-74982904. In some embodiments, the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74982960-74982982. In some embodiments, the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74983108-74983130.
- the targeting moiety binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74983181-74983203.
- genomic coordinates are based on hgl9 human genome reference assembly unless specified otherwise.
- the expression repressor is used in combination with a site-specific disrupting agent.
- the site-specific disrupting agent comprises a CRISPR/Cas molecule.
- a gRNA for use with a targeting moiety of a site-specific disrupting agent that comprises a Cas molecule is an sgRNA.
- a gRNA binds to a nucleic acid sequence comprising a sequence selected from Table 4, Table 5, Table 6, Table 7 or a sequence having at least 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity thereto, or differing at no more than 1, 2, 3, 4, or 5 positions relative thereto.
- the gRNA binds to a strand of a double stranded DNA, wherein one of the strands of the DNA has a sequence set out in any of Tables 4-7.
- a gRNA for use with a CRISPR/Cas molecule of the site-specific disrupting agent specifically binds a target sequence associated with one or more of CXCL1-8 gene expression.
- a gRNA may comprise a target-binding sequence selected from SEQ ID NOs: 20-62.
- a targeting moiety is or comprises a Zn finger domain.
- a Zn finger domain comprises a Zn finger, e.g., a naturally occurring Zn finger or engineered Zn finger, or fragment thereof. Many Zn fingers are known to those of skill in the art and are commercially available, e.g., from Sigma-Aldrich. Generally, a Zn finger domain comprises a plurality of Zn fingers, wherein each Zn finger recognizes three nucleotides.
- a Zn finger protein can comprise a Zn finger domain and optionally one or more other domains.
- the zinc finger domain comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 zinc fingers (and optionally no more than 11, 10, 9, 8, 7, 6, or 5 zinc fingers).
- the zinc finger domain comprises 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 1-9, 7-8, 8-10, 8-9, or 9-10 zinc fingers.
- the zinc finger domain comprises 3 or 9 zinc fingers. In some embodiments, the zinc finger domain comprises 3 zinc fingers. In some embodiments, the zinc finger domain comprises 9 zinc fingers. In some embodiments, the zinc finger domain comprises 7 zinc fingers. In certain embodiments, the zinc domain targets a site comprising 21 nucleotides.
- a Zn finger domain comprises a non-naturally occurring Zn finger protein that is engineered to bind to a target DNA sequence of choice.
- a target DNA sequence of choice See, for example, Beerli, et al. (2002) Nature Biotechnol. 20: 135-141; Pabo, et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan, et al. (2001) Nature Biotechnol. 19:656-660; Segal, et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo, et al. (2000) Curr. Opm. Struct. Biol. 10:411-416; U.S. Pat. Nos.
- An engineered Zn finger protein may have a novel binding specificity, compared to a naturally- occurring Zn finger protein.
- Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual Zn finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, U.S. Pat. Nos. 6,453,242 and 6,534,261, incorporated by reference herein in their entireties.
- Exemplary selection methods including phage display and two-hybrid systems, are disclosed in U.S. Pat. Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as International Patent Publication Nos. WO 98/37186; WO 98/53057; WO 00/27878; and WO 01/88197 and GB 2,338,237.
- enhancement of binding specificity for zinc finger proteins has been described, for example, in International Patent Publication No. WO 02/077227.
- zinc finger domains and/or multi-fingered zinc finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
- the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
- enhancement of binding specificity for zinc finger binding domains has been described, for example, in co-owned International Patent Publication No. WO 02/077227.
- Zn finger proteins and methods for design and construction of fusion proteins are known to those of skill in the art and described in detail in U.S. Pat. Nos. 6,140,0815; 789,538; 6,453,242; 6,534,261; 5,925,523; 6,007,988; 6,013,453; and 6,200,759; International Patent Publication Nos.
- Zn finger proteins and/or multi-fingered Zn finger proteins may be linked together, e.g., as a fusion protein, using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
- the Zn finger molecules described herein may include any combination of suitable linkers between the individual zinc finger proteins and/or multi-fingered Zn finger proteins of the Zn finger molecule.
- the targeting moiety comprises a Zn finger domain comprising a plurality of engineered zinc fingers that bind (in a sequence-specific manner) to a target DNA sequence.
- a Zn finger domain comprises one Zn finger or fragment thereof.
- the Zn finger domain comprises a plurality of Zn fingers (or fragments thereof), e.g., 2, 3, 4, 5, 6 or more Zn fingers (and optionally no more than 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 Zn fingers).
- tire Zn finger domain comprises at least three Zn fingers.
- the Zn finger domain comprises four, five or six Zn fingers.
- the Zn finger domain comprises 8, 9, 10, or 11 Zn fingers.
- a Zn finger domain comprising three Zn finger proteins recognizes a target DNA sequence comprising 9 or 10 nucleotides. In some embodiments, a Zn finger domain comprising four Zn fingers recognizes a target DNA sequence comprising 12 to 14 nucleotides. In some embodiments, a Zn finger domain comprising six Zn fingers recognizes a target DNA sequence comprising 18 to 21 nucleotides.
- a Zn finger protein comprises a two-handed Zn finger protein.
- Two handed zinc finger proteins are those proteins in which two clusters of zinc finger proteins are separated by intervening amino acids so that the two zinc finger domains bind to two discontinuous target DNA sequences.
- An example of a two handed type of zinc finger binding protein is SIP1, where a cluster of four zinc finger proteins is located at the amino terminus of the protein and a cluster of three Zn finger proteins is located at the carboxyl terminus (see Remade, et al. (1999) EMBO Journal 18(18):5073-5084).
- Each cluster of zinc fingers in these proteins is able to bind to a unique target sequence and the spacing between the two target sequences can comprise many nucleotides.
- an expression repressor comprises a targeting moiety comprising a zinc finger domain of Table 10. In some embodiments, an expression repressor comprises a targeting moiety comprising a zinc finger domain encoded by the nucleic acid sequence of Table 11. In some embodiments, an expression repressor comprises a targeting moiety comprising a zinc finger domain of any one of SEQ ID NOs: 112-121 or 170-175. In some embodiments, the zinc finger domain binds to a sequence of Table 12. In some embodiments, an expression repressor comprises a targeting moiety comprising a zinc finger domain that binds a target site within genomic coordinates chr4: 74591400- 74593000 or chr4:74982639-74983600.
- an expression repressor comprises a targeting moiety comprising a zinc finger domain that binds a target site within genomic coordinates chr4: 74591400-74593000. In some embodiments, an expression repressor comprises a targeting moiety comprising a zinc finger domain that binds a target site within genomic coordinates chr4:74982639- 74983600.
- the zinc finger domain binds a target site chosen from a) GRCh37: chr4:74591777-74591797; b) GRCh37: chr4:74591834-74591854; c) GRCh37: chr4:74591896- 74591916; d) GRCh37: chr4:74592082-74592102; e) GRCh37: chr4:74592107-74592127; f) GRCh37: chr4:74592156-74592176; g) GRCh37: chr4: 74592210-74592230; h) GRCh37: chr4:74592057- 74592077; i) GRCh37: chr4:74591977-74591997; j) GRCh37: chr4:74591856-74591876.
- the zinc finger domain binds a target site with genomic coordinates GRCh37: chr4:74591777-74591797. In some embodiments, the zinc finger domain binds a target site with genomic coordinates GRCh37: chr4: 74591834-74591854. In some embodiments, the zinc finger domain binds a target site with genomic coordinates GRC1137: chr4: 74591896-74591916. In some embodiments, the zinc finger domain binds atarget site with genomic coordinates GRCh37: chr4: 74592082-74592102.
- the zinc finger domain binds a target site with genomic coordinates GRCh37: chr4: 74592107-74592127. In some embodiments, the zinc finger domain binds a target site with genomic coordinates GRCh37: chr4: 74592156-74592176. In some embodiments, the zinc finger domain binds a target site with genomic coordinates GRCh37: chr4: 74592210-74592230. In some embodiments, the zinc finger domain binds atarget site with genomic coordinates GRCh37: chr4: 74592057-74592077.
- the zinc finger domain binds a target site with genomic coordinates GRCh37: chr4: 74591977-74591997. In some embodiments, the zinc finger domain binds a target site with genomic coordinates GRCh37: chr4: 74591856-74591876. As used in this disclosure, the genomic coordinates are based on hgl9 human genome reference assembly unless specified otherwise.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 112 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds a target site with genomic coordinates GRCh37: chr4:74591777-74591797.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 113 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds a target site with genomic coordinates GRCh37: chr4: 74591834-74591854.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 114 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds atarget site with genomic coordinates GRCh37: chr4: 74591896-74591916.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 115 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds a target site with genomic coordinates GRCh37: chr4: 74592082-74592102.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 116 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds a target site with genomic coordinates GRCh37: chr4: 74592107-74592127.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 117 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds atarget site with genomic coordinates GRCh37: chr4: 74592156-74592176.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 118 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds atarget site with genomic coordinates GRCh37: chr4: 74592210-74592230.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 119 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds a target site with genomic coordinates GRCh37: chr4: 74592057-74592077.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 120 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds atarget site with genomic coordinates GRCh37: chr4: 74591977-74591997.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 121 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto, and binds atarget site with genomic coordinates GRCh37: chr4: 74591856-74591876.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 170 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 171 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 172 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 173 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 174 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the zinc finger domain comprises an amino acid sequence of SEQ ID NO: 175 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises a targeting moiety comprising a zinc finger domain of Table 10. In some embodiments, an expression repressor comprises a targeting moiety comprising a zinc finger domain encoded by the nucleic acid sequence of Table 11. It is understood that, in some embodiments, the nucleic acid comprises an RNA sequence in which each position indicated as a T in Table 11 is occupied by a U. In some embodiments, a nucleic acid described herein comprises a sequence set out in Table 11, or a sequence having at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises a targeting moiety comprising a zinc finger domain of any one of SEQ ID NOs: 112-121 or 170-175.
- the zinc finger domain binds to a sequence of Table 12.
- an expression repressor comprises a targeting moiety comprising a zinc finger domain that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates chr4: 74591400- 74593000 or chr4:74982639-74983600.
- an expression repressor comprises a targeting moiety comprising a zinc finder domain that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates chr4: 74591400-74593000. In some embodiments, an expression repressor comprises a targeting moiety comprising a zinc finger domain that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates chr4:74982639-74983600.
- the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site chosen from a) GRCh37: chr4: 74591777-74591797; b) GRCh37: chr4:74591834-74591854; c) GRCh37: chr4:74591896-74591916; d) GRCh37: chr4:74592082-74592102; e) GRCh37: chr4 : 74592107- 74592127; f) GRCh37: chr4:74592156-74592176; g) GRCh37: chr4:74592210-74592230; h) GRCh37: chr4:74592057-74592077; i) GRCh37: chr4:74591977-74591997; j) GRCh37: chr4: chr4
- the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74591777-74591797. In some embodiments, the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4: 74591834-74591854. In some embodiments, the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4: 74591896-74591916.
- the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4: 74592082-74592102. In some embodiments, the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4: 74592107-74592127. In some embodiments, the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4: 74592156-74592176.
- the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRC1137: chr4: 74592210-74592230. In some embodiments, the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4: 74592057-74592077. In some embodiments, the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4: 74591977-74591997.
- the zinc finger domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRC1137: chr4: 74591856-74591876.
- genomic coordinates are based on hgl9 human genome reference assembly unless specified otherwise.
- Table 10 Exemplary Zinc finger domains. e.giller for use in expression repressors that further comprise an effector moiety such as a KRAB moiety
- Table 11 Exemplary nucleic acids encoding zinc finger domains
- Table 12 Exemplary Zinc finger domain target sequences, e.g.. for an expression repressor comprising an effector moiety, e.g.. KRAB
- the disclosure provides an expression repressor comprising a first targeting moiety that binds atarget site comprising at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29, nucleotides of tire sequence of any one of SEQ ID NOs: 162 or 163.
- the expression repressor comprises a first effector moiety.
- the expression repressor is capable of decreasing expression of a CXCL gene.
- the disclosure provides an expression repressor comprising a first targeting moiety that binds to a target site, wherein the target site is within an IL-8 promoter.
- the target site is within chr4:74606112-7460646, or within a site beginning 2 kb upstream and/or 2 kb downstream of chr4:74606112-7460646.
- the expression repressor comprises a first effector moiety.
- the expression repressor is capable of decreasing expression of IL-8.
- the disclosure provides an expression repressor comprising a first targeting moiety that binds to a target site within genomic coordinates chr4:74606112-7460646 (based on hgl9 human genome reference assembly).
- the expression repressor comprises a first effector moiety.
- the expression repressor is capable of decreasing expression of IL-8.
- a targeting moiety is or comprises a TAL effector molecule.
- a TAL effector molecule e g., a TAL effector molecule that specifically binds a DNA sequence, comprises a plurality of TAL effector domains or fragments thereof, and optionally one or more additional portions of naturally occurring TAL effectors (c.g., N- and/or C-tcnninal of the plurality of TAL effector domains).
- Many TAL effectors are known to those of skill in the art and are commercially available, e g., from Thermo Fisher Scientific.
- TALs are natural effector proteins secreted by numerous species of bacterial pathogens including the plant pathogen Xanthomonas which modulates gene expression in host plants and facilitates bacterial colonization and survival.
- the specific binding of TAL effectors is based on a central repeat domain of tandemly arranged nearly identical repeats of typically 33 or 34 amino acids (the repeat-variable diresidues, RVD domain).
- the number of repeats ranges from 1.5 to 33.5 repeats and the C-terminal repeat is usually shorter in length (e.g., about 20 amino acids) and is generally referred to as a “half-repeat”.
- Each repeat of the TAL effector feature a one-repeat-to-one-base-pair correlation with different repeat types exhibiting different base-pair specificity (one repeat recognizes one base-pair on the target gene sequence).
- the smaller the number of repeats the weaker the protein-DNA interactions.
- a number of 6.5 repeats has been shown to be sufficient to activate transcription of a reporter gene (Scholze et al., 2010).
- Non-limiting examples of TAL effectors from Xanthomonas include, Hax2, Hax3, Hax4, AvrXa7, AvrXalO and AvrBs3.
- the TAL effector domain of the TAL effector molecule of the present disclosure may be derived from a TAL effector from any bacterial species (e.g., Xanthomonas species such as the African strain of Xanthomonas oryzae pv. Oryzae (Yu et al. 2011), Xanthomonas campestris pv. raphani strain 756C and Xanthomonas oryzae pv. oirz/co/astrain BLS256 (Bogdanove et al. 2011).
- Xanthomonas species such as the African strain of Xanthomonas oryzae pv. Oryzae (Yu et al. 2011), Xanthomonas campestris pv. raphani strain 756C and Xanthomonas oryzae pv. oirz/co/astrain BLS256 (Bogdanove et
- the TAL effector domain in accordance with the present disclosure comprises an RVD domain as well as flanking sequence(s) (sequences on the N-terminal and/or C-terminal side of the RVD domain) also from the naturally occurring TAL effector. It may comprise more or fewer repeats than the RVD of the naturally occurring TAL effector.
- the TAL effector molecule of the present disclosure is designed to target a given DNA sequence based on the above code and others known in the art. The number of TAL effector domains (e.g., repeats (monomers or modules)) and their specific sequence are selected based on the desired DNA target sequence.
- TAL effector domains may be removed or added in order to suit a specific target sequence.
- the TAL effector molecule of the present disclosure comprises between 6.5 and 33.5 TAL effector domains, e.g., repeats.
- TAL effector molecule of the present disclosure comprises between 8 and 33.5 TAL effector domains, e.g., repeats, e.g., between 10 and 25 TAL effector domains, e.g., repeats, e.g., between 10 and 14 TAL effector domains, e.g., repeats.
- the TAL effector molecule comprises TAL effector domains that correspond to a perfect match to the DNA target sequence.
- a mismatch between a repeat and a target base-pair on the DNA target sequence is permitted as along as it allows for the function of the expression repressor or site-specific disrupting agent comprising the TAL effector molecule.
- TALE binding is inversely correlated with the number of mismatches.
- the TAL effector molecule of a site-specific disrupting agent of the present disclosure comprises no more than 7 mismatches, 6 mismatches, 5 mismatches, 4 mismatches, 3 mismatches, 2 mismatches, or 1 mismatch, and optionally no mismatch, with the target DNA sequence.
- the smaller the number of TAL effector domains in the TAL effector molecule the smaller the number of mismatches will be tolerated and still allow for the function of the site-specific disrupting agent comprising the TAL effector molecule.
- the binding affinity is thought to depend on the sum of matching repeat-DNA combinations. For example, TAL effector molecules having 25 TAL effector domains or more may be able to tolerate up to 7 mismatches.
- the TAL effector molecule of the present disclosure may comprise additional sequences derived from a naturally occurring TAL effector.
- the length of the C- terminal and/or N-terminal sequence(s) included on each side of the TAL effector domain portion of the TAL effector molecule can vary and be selected by one skilled in the art, for example based on the studies of Zhang et al. (2011). Zhang et al., have characterized a number of C-terminal and N-terminal truncation mutants in Hax3 derived TAL-effector based proteins and have identified key elements, which contribute to optimal binding to the target sequence and thus activation of transcription.
- transcriptional activity is inversely correlated with the length of N-terminus.
- C-terminus an important element for DNA binding residues within the first 68 amino acids of the Hax 3 sequence was identified. Accordingly, in some embodiments, the first 68 amino acids on the C-terminal side of the TAL effector domains of the naturally occurring TAL effector is included in the TAL effector molecule of a site-specific disrupting agent of the present disclosure.
- a TAL effector molecule of the present disclosure comprises 1) one or more TAL effector domains derived from a naturally occurring TAL effector; 2) at least 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 170, 180, 190, 200, 220, 230, 240, 250, 260, 270, 280 or more amino acids from the naturally occurring TAL effector on the N-terminal side of the TAL effector domains; and/or 3) at least 68, 80, 90, 100, 110, 120, 130, 140, 150, 170, 180, 190, 200, 220, 230, 240, 250, 260 or more amino acids from the naturally occurring TAL effector on the C-terminal side of the TAL effector domains.
- an expression repressor comprises a targeting moiety comprising a TAL domain of Table 13. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain encoded by the nucleic acid sequence of Table 14. In some embodiments, a nucleic acid described herein comprises a sequence set out in Table 14, or a sequence having at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises a targeting moiety comprising a TAL domain of any one of SEQ ID NOs: 268-275, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto, or a sequence with no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain of binds to a sequence of Table 15 or 15 A, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto, or a sequence with no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRC1137: chr4:74606162-74606184, GRCh37: chr4: 74605723-74606223, or GRCh37: chr4: 74605223-74606223.
- an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRCh37: chr4:74606039-74606056. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRCh37: chr4:74606113-74606130. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRCh37: chr4:74606137-74606154.
- an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRCh37: chr4:74606150-74606167. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRCh37: chr4:74591882-74591899. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRCh37: chr4:74591923-74591940.
- an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRCh37: chr4:74591897-74591914. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain that binds a target site within genomic coordinates GRCh37: chr4:74591873-74591890.
- the genomic coordinates are based on hgl9 human genome reference assembly unless specified otherwise.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 260 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 261 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 262 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9,
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 263 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 264 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 265 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 266 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 267 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10,
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 268 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 269 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 270 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 271 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 272 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 273 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 274 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the TAL domain comprises an amino acid sequence of SEQ ID NO: 275 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises a targeting moiety comprising a TAL domain of Table 13. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain encoded by the nucleic acid sequence of Table 14. It is understood that, in some embodiments, the nucleic acid comprises an RNA sequence in which each position indicated as a T in Table 14 is occupied by a U. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain of any one of SEQ ID NOs: 260-275. In some embodiments, the TAL domain binds to a sequence of Table 15 or 15A.
- an expression repressor comprises a targeting moiety comprising a TAL domain that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates GRCh37: chr4:74606162-74606184, GRCh37: chr4: 74605723-74606223, or GRCh37: chr4: 74605223-74606223.
- an expression repressor comprises a targeting moiety comprising a TAL domain that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates chr4: GRCh37: chr4:74606162-74606184. In some embodiments, an expression repressor comprises a targeting moiety comprising a TAL domain that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates GRCh37: chr4: 74605723-74606223.
- an expression repressor comprises a targeting moiety comprising a TAL domain that binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site within genomic coordinates GRCh37: chr4: 74605223-74606223.
- the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site chosen from: i) GRC1137: chr4:74606039-74606056; ii) GRCh37: chr4:74606113-74606130; iii) GRCh37: chr4:74606137-74606154; iv) GRCh37: chr4 : 74606150- 74606167; v) GRCh37: chr4:74591882-74591899; vi) GRCh37: chr4:74591923-7459I940; vii) GRCh37: chr4:74591897-74591914; or viii) GRC1137: chr4:74591873-74591890.
- the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74606039-74606056. In some embodiments, the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74606113-74606130. In some embodiments, the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74606137-74606154.
- the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74606150-74606167. In some embodiments, the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74591882-74591899. In some embodiments, the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74591923-74591940.
- the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74591897-74591914. In some embodiments, the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site with genomic coordinates GRCh37: chr4:74591873-74591890.
- tire genomic coordinates are based on hgl9 human genome reference assembly unless specified otherwise.
- Table 13 Exemplary TAL domains, e g., for use in expression repressors that further comprise an effector moiety such as a KRAB moiety
- Table 14 Exemplary nucleic acids encoding TAL domains
- Table 15 Exemplary TAL domain target sequences, e.g.. for an expression repressor comprising an effector moiety, e.g.. KRAB
- Table 15A Exemplary TAL domain target sequences, e.g., for an expression repressor comprising an effector moiety, e.g., KRAB, e.g., for use in a murine model
- the disclosure provides an expression repressor comprising a first targeting moiety that binds to a target site, wherein the target site is within an IL-8 promoter (e.g., chr4:74606112- 7460646, or within a site beginning 2 kb upstream and/or 2 kb downstream of chr4:74606112-7460646).
- the expression repressor comprises a first effector moiety.
- the expression repressor is capable of decreasing expression of IL-8.
- the disclosure provides an expression repressor comprising a first targeting moiety that binds to a target site within genomic coordinates chr4:74606112-7460646 (based on hgl9 human genome reference assembly).
- the expression repressor comprises a first effector moiety.
- the expression repressor is capable of decreasing expression of IL-8.
- the disclosure provides an expression repressor comprising a first targeting moiety, e.g., a TAL domain, wherein the targeting domain targets a site chosen from: i) GRCh37: chr4:74606039-74606056; li) GRCh37: chr4:74606113-74606130; lii) GRCh37: chr4:74606137-74606154; iv) GRCh37: chr4:74606150-74606167; v) GRCh37: chr4:74591882-74591899; vi) GRCh37: chr4:74591923-74591940; vii) GRCh37: chr4:74591897-74591914; and viii) GRCh37: chr4:74591873-74591890.
- the disclosure provides an expression repressor comprising a first targeting moiety, e.g., a TAL domain, wherein tire targeting domain targets a mouse site chosen from: i) GRCm38: chr5:90891101-90891118; n) GRCm38: chr5:90890903-90890920; lii) GRCm38: chr5:90903571-90903588; or iv) GRCm38: chr5: 90903800-90903817.
- a first targeting moiety e.g., a TAL domain
- the TAL domain binds within 500, 300, 200, 100, or 50 nucleotides upstream or downstream of a target site chosen from: i) GRCm38: chr5:90891101-90891118; ii) GRCm38: chr5:90890903-90890920; iii) GRCm38: chr5:90903571-90903588; and iv) GRCm38: chr5:90903800-90903817.
- a target site chosen from: i) GRCm38: chr5:90891101-90891118; ii) GRCm38: chr5:90890903-90890920; iii) GRCm38: chr5:903571-90903588; and iv) GRCm38: chr5:90903800-90903817.
- a targeting moiety is or comprises a DNA-binding domain from a nuclease.
- the recognition sequences of homing endonucleases and meganucleases such as I- Scel, I-Ceul, PI-PspI, Pl-Sce, 1-SceIV, I-CsmI, I-PanI, I-Scell, I-Ppol, 1-SceIII, I-Crel, I-TevI, I-TevII and I-TevIII are known. See also U.S. Pat. Nos. 5,420,032; 6,833,252; Belfort, et al. (1997) Nucleic Acids Res.
- a targeting moiety comprises a nucleic acid.
- a nucleic acid that may be included in a targeting moiety may be or comprise DNA, RNA, and/or an artificial or synthetic nucleic acid or nucleic acid analog or mimic.
- a nucleic acid may be or include one or more of genomic DNA (gDNA), complementary DNA (cDNA), a peptide nucleic acid (PNA), a peptide- oligonucleotide conjugate, a locked nucleic acid (LNA), a bridged nucleic acid (BNA), a polyamide, a triplex- forming oligonucleotide, an antisense oligonucleotide, tRNA, mRNA, rRNA, miRNA, gRNA, siRNA or other RNAi molecule (e.g., that targets a non-coding RNA as described herein and/or that targets an expression product of a particular gene associated with a targeted genomic complex as described herein), etc.
- genomic DNA genomic DNA
- cDNA complementary DNA
- PNA peptide nucleic acid
- LNA locked nucleic acid
- BNA bridged nucleic acid
- a polyamide a triplex- forming oligonucleotide
- a nucleic acid may include one or more residues that is not a naturally occurring DNA or RNA residue, may include one or more linkages that is/are not phosphodiester bonds (e.g., that may be, for example, phosphorothioate bonds, etc), and/or may include one or more modifications such as, for example, a 2’0 modification such as 2’-OMeP.
- linkages e.g., that may be, for example, phosphorothioate bonds, etc
- modifications such as, for example, a 2’0 modification such as 2’-OMeP.
- a variety of nucleic acid structures useful in preparing synthetic nucleic acids is known in the art (see, for example, WO2017/0628621 and W02014/012081) those skilled in the art will appreciate that these may be utilized in accordance with the present disclosure.
- a nucleic acid suitable for use in an expression repressor or a site-specific disrupting agent, e.g., in a targeting moiety may include, but is not limited to, DNA, RNA, modified oligonucleotides (e.g., chemical modifications, such as modifications that alter backbone linkages, sugar molecules, and/or nucleic acid bases), and artificial nucleic acids.
- a nucleic acid includes, but is not limited to, genomic DNA, cDNA, peptide nucleic acids (PNA) or peptide oligonucleotide conjugates, locked nucleic acids (LNA), bridged nucleic acids (BNA), polyamides, triplex forming oligonucleotides, modified DNA, antisense DNA oligonucleotides, tRNA, mRNA, rRNA, modified RNA, miRNA, gRNA, and siRNA or other RNA or DNA molecules.
- PNA peptide nucleic acids
- LNA locked nucleic acids
- BNA bridged nucleic acids
- polyamides polyamides
- a targeting moiety comprises a nucleic acid with a length from about 15- 200, 20-200, 30-200, 40-200, 50-200, 60-200, 70-200, 80-200, 90-200, 100-200, 110-200, 120-200, 130- 200, 140-200, 150-200, 160-200, 170-200, 180-200, 190-200, 215-190, 20-190, 30-190, 40-190, 50-190, 60-190, 70-190, 80-190, 90-190, 100-190, 110-190, 120-190, 130-190, 140-190, 150-190, 160-190, 170- 190, 180-190, 15-180, 20-180, 30-180, 40-180, 50-180, 60-180, 70-180, 80-180, 90-180, 100-180, 110- 180, 120-180, 130-180, 140-180, 150-180, 160-180, 170-180, 15-170, 20-170, 30-170, 40-170,
- An expression repressor or a site-specific disrupting agent of the present disclosure may comprise one or more effector moieties.
- An effector moiety has one or more functionalities that, when used as part of a site-specific disrupting agent described herein, modulate, e.g., decrease, expression of a target plurality of genes in a cell.
- an effector moiety physically or sterically blocks an anchor sequence, e.g., such that binding of a genomic complex component (e.g., a nucleating polypeptide) to the anchor sequence is inhibited (e.g., prevented).
- an effector moiety destabilizes the interaction of a genomic complex component (e.g., nucleating polypeptide) with an anchor sequence, e.g., by altering (e.g., decreasing) the affinity and/or avidity at which the genomic complex component binds the anchor sequence.
- a genomic complex component e.g., nucleating polypeptide
- an effector moiety may recruit a factor that inhibits formation of or destabilizes a genomic complex, e.g., ASMC, or it may inhibit recruitment of a factor (e.g., a genomic complex component or transcription factor) necessary for formation or maintenance of a genomic complex (e.g., ASMC).
- an effector moiety has epigenetic modification functionality in that it modulates the epigenetic landscape of the target site (e.g., the El cRE, or a sequence proximal thereto, or an anchor sequence or a sequence proximal to the anchor sequence), e.g., by promoting (e.g., catalyzing) application or removal of one or more epigenetic modifications to the DNA or a histone associated thereto, to decrease expression of a target plurality of genes.
- the target site e.g., the El cRE, or a sequence proximal thereto, or an anchor sequence or a sequence proximal to the anchor sequence
- an effector moiety has genetic modification functionality, e.g., it introduces an alteration (e.g., an insertion, deletion, or substitution) to a target site (e.g., an El cRE or a sequence proximal thereto, or an anchor sequence or a sequence proximal thereto) or a sequence proximal thereto.
- a target site e.g., an El cRE or a sequence proximal thereto, or an anchor sequence or a sequence proximal thereto
- an effector moiety comprises a CRISPR/Cas molecule, a TAL effector molecule, a Zn finger molecule, a tetR domain, or a meganuclease.
- an effector moiety has genetic modification functionality, e.g., a CRISPR/Cas molecule, a TAL effector molecule, a Zn finger molecule with endonuclease activity capable of making a genetic alteration in a method described herein.
- genetic modification functionality e.g., a CRISPR/Cas molecule, a TAL effector molecule, a Zn finger molecule with endonuclease activity capable of making a genetic alteration in a method described herein.
- an effector moiety comprises a histone modifying functionality, e.g., a histone methyltransferase, histone demethylase, or histone deacetylase activity.
- a histone methyltransferase functionality comprises H3K9 targeting methyltransferase activity.
- a histone methyltransferase functionality comprises H3K56 targeting methyltransferase activity.
- a histone methyltransferase functionality comprises H3K27 targeting methyltransferase activity.
- a histone methyltransferase or demethylase functionality transfers one, two, or three methyl groups.
- a histone demethylase functionality comprises H3K4 targeting demethylase activity.
- an effector moiety comprises a protein chosen from SETDB1, SETDB2, EHMT2 (i.e., G9A), EHMT1 (i.e., GLP), SUV39H1, EZH2, EZH1, SUV39H2, SETD8, SUV420H1, SUV420H2, or a functional variant or fragment of any thereof, e g., a SET domain of any thereof.
- an effector moiety comprises aprotein chosen from KDM1A (i.e., LSD1), KDM1B (i.e., LSD2), KDM2A, KDM2B, KDM5A, KDM5B, KDM5C, KDM5D, KDM4B, NO66, or a functional variant or fragment of any thereof.
- an effector moiety comprises a protein chosen from HDAC1, HDAC2, HDAC3, HDAC4, HDAC5, HDAC6, HDAC7, HDAC8, HDAC9, HDAC10, HDAC11, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, SIRT8, SIRT9, or a functional variant or fragment of any thereof.
- an effector moiety comprises a DNA modifying functionality, e.g., a DNA methyltransferase.
- an effector moiety comprises a protein chosen from MQ1, DNMT1, DNMT3A1, DNMT3A2, DNMT3B1, DNMT3B2, DNMT3B3, DNMT3B4, DNMT3B5, DNMT3B6, DNMT3L, or a functional variant or fragment of any thereof.
- an effector moiety comprises a transcription repressor.
- the transcription repressor blocks recruitment of a factor that stimulates or promotes transcription, e.g., of the target gene.
- the transcription repressor recruits a factor that inhibits transcription, e.g., of the target gene.
- an effector moiety, e.g., transcription repressor is or comprises a protein chosen from KRAB, MeCP2, HP1, RBBP4, REST, FOG1 , SUZ12, or a functional variant or fragment of any thereof.
- an effector moiety comprises a protein having a functionality described herein. In some embodiments, an effector moiety comprises a protein selected from:
- KRAB e.g., as according to NP_056209.2 or the protein encoded by NM 015394.5
- a SET domain e.g., the SET domain of:
- SETDB1 (e.g., as according to NP_001353347.1 or the protein encoded by NM OO 1366418.1);
- EZH2 (e.g., as according to NP-004447.2 or NP_001190176.1 or the protein encoded by NM_004456.5 or NM_001203247.2);
- G9A e.g., as according to NP 001350618. 1 or the protein encoded by NM 001363689. 1
- SUV39H1 e.g., as according to NP 003164.1 or the protein encoded by NM 003173.4
- histone demethylase LSD1 e.g., as according to NP_055828.2 or the protein encoded by
- FOG1 e.g., the N-terminal residues of FOG1 (e.g., as according to NP 722520.2 or the protein encoded by NM 153813.3); or
- an effector moiety comprises a protein selected from:
- DNMT3A e.g., human DNMT3A (e.g., as according to NP_072046.2 or the protein encoded by NM_022552.4);
- DNMT3B (e.g., as according to NP 008823.1 or the protein encoded by NM_006892.4);
- DNMT3L (e.g., as according to NP 787063. 1 or the protein encoded by NM_175867.3);
- an effector moiety comprises a mature bacterial MQ1 (e.g., as according to CAA35058.1 obtained from strain ATCC 33825 or Uniprot ID P15840.3
- An exemplary effector moiety may include, but is not limited to: ubiquitin, bicyclic peptides as ubiquitin ligase inhibitors, transcription factors, DNA and protein modification enzymes such as topoisomerases, topoisomerase inhibitors such as topotecan, DNA methyltransferases such as the DNMT family (e.g., DNMT3A, DNMT3B, DNMT3L), protein methyltransferases (e.g., viral lysine methyltransferase (vSET), protein-lysine N-methyltransferase (SMYD2), deaminases (e.g., APOBEC, UG1), histone methyltransferases such as enhancer of zeste homolog 2 (EZH2), PRMT1, histone-lysine- N-methyltransferase (Setdbl), histone methyltransferase (SET2), Vietnamese histone-lysine N- methyltransferase
- a candidate domain may be determined to be suitable for use as an effector moiety by methods known to those of skill in the art.
- a candidate effector moiety may be tested by assaying whether, when the candidate effector moiety is present in the nucleus of a cell and appropriately localized (e.g., to a target gene or genomic regulatory element (e.g., transcription control element) operably linked to said target gene, e.g., via a targeting moiety), the candidate effector moiety decreases expression of the target gene in the cell, e.g., decreases the level of RNA transcript encoded by the target gene (e.g., as measured by RNASeq or Northern blot) or decreases the level of protein encoded by the target gene (e.g., as measured by ELISA).
- an expression repressor comprises an effector moiety that does not bind (e.g., does not detectably bind) to another copy of the effector moiety, e.g., the effector moiety is monomeric and does not associate into multimers.
- an expression repressor comprises an effector moiety that associates with a further copy of the effector moiety into a multimer, e.g., dimers, trimers, tetramers, or further.
- an expression repressor comprises a plurality of effector moieties, wherein each effector moiety does not detectably bind, e.g., does not bind, to another effector moiety.
- an effector moiety for use in the compositions and methods described herein is functional in a monomeric, e.g., non-dimeric, state.
- a site-specific disrupting agent comprises an effector moiety that does not bind (e.g., does not detectably bind) to another copy of the effector moiety, e.g., the effector moiety is monomeric and does not associate into multimers.
- a site-specific disrupting agent comprises an effector moiety that associates with a further copy of the effector moiety into a multimer, e.g., dimers, trimers, tetramers, or further.
- a site-specific disrupting agent comprises a plurality of effector moieties, wherein each effector moiety does not detectably bind, e.g., does not bind, to another effector moiety.
- an effector moiety for use in the compositions and methods described herein is functional in a monomeric, e.g., non-dimeric, state.
- an effector moiety of an expression repressor or a site-specific disrupting agent comprises an epigenetic modifying moiety, e.g., that modulates the two-dimensional structure of chromatin (i.e., that modulate structure of chromatin in a way that would alter its two-dimensional representation).
- Epigenetic modifying moieties useful in methods and compositions of the present disclosure include agents that affect epigenetic markers, e.g., DNA methylation, histone methylation, histone acetylation, histone sumoylation, histone phosphorylation, and RNA-associated silencing.
- Exemplary epigenetic enzymes that can be targeted to a genomic sequence element as described herein include DNA methylases (e.g., DNMT3a, DNMT3b, DNMTL, MQ1), DNA demethylation (e.g., the TET family), histone methyltransferases, histone deacetylase (e.g., HDAC1, HDAC2, HDAC3), sirtuin 1, 2, 3, 4, 5, 6, or 7, lysine-specific histone demethylase 1 (LSD1), histone-lysine-N-methyltransferase (Setdbl), euchromatic histone-lysine N-methyltransferase 2 (G9a), histone-lysine N-methyltransferase (SUV39H1), enhancer of zeste homolog 2 (EZH2), viral lysine methyltransferase (vSET), histone methyltransferase (SET2), and protein-lysine N-methyltransferase (
- an expression repressor or site-specific disrupting agent e.g., comprising an epigenetic modifying moiety, useful herein comprises or is a construct described in Koferle et al. Genome Medicine 7.59 (2015): 1-3 incorporated herein by reference.
- a site-specific disrupting agent comprises or is a construct found in Table 1 of Koferle et al., e.g., histone deacetylase, histone methyltransferase, DNA demethylation, or H3K4 and/or H3K9 histone demethylase described in Table 1 (e.g., dCas9-p300, TALE-TET1, ZF-DNMT3A, or TALE-LSD1).
- An expression repressor may further comprise one or more additional moieties (e.g., in addition to one or more targeting moieties and one or more effector moieties).
- an additional moiety is selected from a tagging or monitoring moiety, a cleavable moiety (e.g., a cleavable moiety positioned between a targeting moiety and an effector moiety or at the N- or C-terminal end of a polypeptide), a small molecule, a membrane translocating polypeptide, or a pharmacoagent moiety.
- a site-specific disrupting agent may further comprise one or more additional moieties (e.g., in addition to one or more targeting moieties and one or more effector moieties).
- an additional moiety is selected from a tagging or monitoring moiety, a cleavable moiety (e.g., a cleavable moiety positioned between a targeting moiety and an effector moiety or at the N- or C-terminal end of a polypeptide), a small molecule, a membrane translocating polypeptide, or a pharmacoagent moiety.
- an expression repressor comprises a targeting moiety (e.g., comprising dCas9, e.g., an S. pyogenes dCas9), and an effector moiety comprising KRAB, e.g., a KRAB domain.
- the expression repressor is encoded by the nucleic acid sequence of SEQ ID NOs: 204 (e.g., a plasmid encoding the expression repressor) and/or 205 (e.g., a nucleic acid (e.g., mRNA) encoding the expression repressor).
- a nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 204 or 205 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the targeting moiety is encoded by the nucleic acid sequence of SEQ ID NO. 8 and the effector moiety is encoded by the nucleic acid sequence of SEQ ID NO. 14.
- an expression repressor comprises the amino acid sequence of SEQ ID NOs: 206 or 75.
- a nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 206 or 75 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the expression repressor comprises a targeting moiety (e.g., comprising dCas9, e.g., an S. Pyogenes dCas9 or a functional variant or mutant thereof; e.g., Cas9m4), and an effector moiety comprising MQ1, e.g., bacterial MQ1.
- a targeting moiety e.g., comprising dCas9, e.g., an S. Pyogenes dCas9 or a functional variant or mutant thereof; e.g., Cas9m4
- MQ1 e.g., bacterial MQ1.
- expression repressor is encoded by the nucleic acid sequence of SEQ ID NOs: 207 (e.g., a nucleic acid (e.g., mRNA) encoding the site-specific disrupting agent).
- a nucleic acid described herein comprises a nucleic acid sequence of SEQ ID NO: 207 or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the targeting moiety is encoded by the nucleic acid sequence of SEQ ID NO: 8 and/or the effector moiety is encoded by the nucleic acid sequence of SEQ ID NO: 10.
- an expression repressor comprises a targeting moiety (e.g., a zinc finger domain, e.g., a zinc finger domain of Table 10), and an effector moiety comprising KRAB, e.g., a KRAB domain.
- a targeting moiety e.g., a zinc finger domain, e.g., a zinc finger domain of Table 10
- an effector moiety comprising KRAB, e.g., a KRAB domain.
- an expression repressor is encoded by a nucleic acid sequence of Table 16 (e.g., a nucleic acid sequence of any one of SEQ ID NOs: 142-151 or 248-253).
- an expression repressor is encoded by a nucleic acid sequence of Table 16, e.g., a nucleic acid sequence of any one of SEQ ID NOs: 142-151 or 248-253, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- a sequence described herein may comprise an RNA sequence in which each position indicated as a T in Table 16 is occupied by a U.
- the 3’ poly-A sequence shown in a sequence of Table 16 is omitted.
- a 3 ’ poly-A sequence is included in the nucleic acid, wherein the 3 ’ poly-A sequence is up to the length shown in a sequence of Table 16.
- Table 16 Exemplary expression repressor encoding mRNA
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 142, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 143, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 144, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 145, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 146, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 147, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 148, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 149, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 150, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 151, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13,
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 248 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 249 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 250 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 251 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 252 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 253 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises a targeting moiety (e.g., a zinc finger domain, e.g., a zinc finger domain of Table 10), and an effector moiety comprising KRAB, e.g., a KRAB domain.
- a targeting moiety e.g., a zinc finger domain, e.g., a zinc finger domain of Table 10
- an effector moiety comprising KRAB, e.g., a KRAB domain.
- an expression repressor comprises an amino acid sequence of Table 17 (e.g., amino acid sequence of any one of SEQ ID NOs: 152-161 or 164-169.
- an expression repressor comprises an ammo acid sequence of Table 17, e.g., an amino acid sequence of any one of SEQ ID NOs: 152-161 or 164-169, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than_20, 19, 18, 17, 16, 15, 14,
- Table 17 Exemplary expression repressor polypeptide sequences (bold italics: targeting moiety, underline: effector moiety)
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 152, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 153, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 154, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 155, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 156, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 157, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 158, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 159, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 160, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 161, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 164 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 165 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 166 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 167 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 168 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 169 or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises a targeting moiety (e.g., a TAL domain, e.g., a TAL domain of Table 13), and an effector moiety comprising KRAB, e.g., a KRAB domain.
- a targeting moiety e.g., a TAL domain, e.g., a TAL domain of Table 13
- an effector moiety comprising KRAB, e.g., a KRAB domain.
- an expression repressor is encoded by a nucleic acid sequence of Table 18 (e.g., a nucleic acid sequence of any one of SEQ ID NOs: 284-291).
- an expression repressor is encoded by a nucleic acid sequence of Table 18, e.g., a nucleic acid sequence of any one of SEQ ID NOs: 284-291, or anucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- a nucleic acid described herein has a sequence set out in Table 18, or a sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto. It is understood that, when provided as an mRNA, a sequence described herein may comprise an RNA sequence in which each position indicated as a T in Table 18 is occupied by a U. In some embodiments, the 3’ poly-A sequence shown in a sequence of Table 18 is omitted. In some embodiment, a 3 ’ poly-A sequence is included in the nucleic acid, wherein the 3 ’ poly-A sequence is up to the length shown in a sequence of Table 18.
- Table 18 Exemplary expression repressor encoding mRNA
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 284, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 285, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 286, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 287, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 288, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 289, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 290, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 291, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises a targeting moiety (e.g., a TAL domain, e.g., a TAL domain of Table 13), and an effector moiety comprising KRAB, e.g., a KRAB domain.
- a targeting moiety e.g., a TAL domain, e.g., a TAL domain of Table 13
- an effector moiety comprising KRAB, e.g., a KRAB domain.
- an expression repressor comprises an amino acid sequence of Table 19 (e.g., amino acid sequence of any one of SEQ ID NOs: 260-267).
- an expression repressor comprises an amino acid sequence of Table 19, e.g., an amino acid sequence of any one of SEQ ID NOs: 260-267, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 260, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 261, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 262, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 263, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 264, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 265, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 266, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor comprises an amino acid sequence of SEQ ID NO: 267, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or an amino acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- the disclosure provides a bicistronic construct.
- the bicistronic construct may comprise a first expression repressor (e.g., a first expression repressor described herein) and a second expression repressor (e.g., a second expression repressor described herein).
- the first expression repressor targets El
- the second expression repressor targets IL-8 promoter.
- a bicistronic nucleic acid encoding ZF36-KRAB_tPT2a_TAL06-KRAB (also called MR-32905) is provided in Table 32 below.
- Table 32 Bicistronic construct and components
- the bicistronic construct encodes a first expression repressor that binds the El locus at the target site GCCAAAGACATTGCACAGGAT (SEQ ID NO: 134). In some embodiments, the first expression repressor binds the El locus at chr4:74591896-74591916. In some embodiments, the bicistronic construct encodes a second expression repressor that binds the IL-8 promoter at the target site TACTGAAGCTCCACAATT (SEQ ID NO: 292). In some embodiments, the second expression repressor binds the IL-8 promoter at GRCh37: chr4:74606039-74606056.
- the first expression repressor comprises a first targeting moiety having an amino acid sequence according to SEQ ID NO: 114, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto.
- first expression repressor comprises a first effector moiety having an amino acid sequence according to SEQ ID NO: 13, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto, wherein optionally the first effector moiety is C-terminal of the first targeting moiety.
- a linker is disposed between the first targeting moiety and the first effector moiety.
- the first expression repressor comprises an NLS.
- the first expression repressor has an amino acid sequence according to SEQ ID NO: 306, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto.
- the second expression repressor comprises a second targeting moiety having an amino acid sequence according to SEQ ID NO: 268, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto.
- second expression repressor comprises a second effector moiety having an amino acid sequence according to SEQ ID NO: 13, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto, wherein optionally the second effector moiety is C-terminal of the second targeting moiety.
- a linker is disposed between the second targeting moiety and the second effector moiety.
- the second expression repressor comprises an NLS.
- the second expression repressor has an amino acid sequence according to SEQ ID NO: 307, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto. In some embodiments, the second expression repressor is used together with the first expression repressor of the bicistronic construct. In other embodiments, the second expression repressor is used as a monotherapy or in combination with a second agent other than tire first expression repressor.
- first effector moiety and the second effector moiety have the same amino acid sequence. In other embodiments, the first effector moiety and the second effector moiety have different amino acid sequences.
- the bicistronic construct comprises a nucleic acid encoding the first repressor, wherein the first expression repressor comprises a first targeting moiety and a first effector moiety, wherein the nucleic acid encoding the first targeting moiety has a nucleic acid sequence according to SEQ ID NO: 302, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto.
- the nucleic acid encoding the first effector moiety' has a nucleic acid sequence according to SEQ ID NO: 303, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto.
- the bicistronic construct comprises a nucleic acid encoding the second expression repressor, wherein the second expression repressor comprises a targeting moiety and a second effector moiety, wherein the nucleic acid encoding the second targeting moiety has a nucleic acid sequence according to SEQ ID NO: 304, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto.
- the nucleic acid encoding the second effector moiety has a sequence according to SEQ ID NO: 305, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto.
- the nucleic acid encoding the second expression repressor is used together with a nucleic acid encoding the first expression repressor. In other embodiments, the nucleic acid encoding the second expression repressor is used as a monotherapy or in combination with a second agent other than a nucleic acid encoding the first expression repressor.
- the bicistronic construct comprises a nucleic acid having a sequence according to SEQ ID NO: 301, or a sequence having at least 80, 85, 90, 95, or 99% identity thereto.
- the nucleic acid is RNA.
- the nucleic acid is DNA.
- an expression repressor comprises a nuclear localization sequence (NLS).
- the expression repressor comprises an NLS, e.g., an SV40 NLS at the N-terminus.
- the expression repressor comprises an NLS, e.g., an SV40 NLS at the C-terminus.
- the expression repressor comprises an NLS, e.g., a nucleoplasmin NLS at the C- terminus.
- the expression repressor comprises a first NLS at the N-terminus and a second NLS at the C-terminus. In some embodiments the first and the second NLS have the same sequence.
- the first and the second NLS have different sequences.
- the expression repressor comprises a first NLS at the N-terminus, a second NLS, and a third NLS at the C-terminus. In some embodiments, at least two NLSs have the same sequence. In some embodiments, the first and the second NLS have the same sequence and the third NLS has a different sequence than the first and the second NLS.
- tire expression repressor comprises an SV40 NLS, e.g., the expression repressor comprises a sequence according to PKKKRK (SEQ ID NO: 63).
- the site-specific disrupting agent comprises a nucleoplasmin NLS, e.g., the expression repressor comprises a sequence of KRPAATKKAGQAKKK (SEQ ID NO: 64).
- the expression repressor comprises a C-terminal sequence comprising one or more of, e.g., any one or both of: a nucleoplasmin nuclear localization sequence and an HA-tag.
- expression repressor comprises an epitope tag, e.g., an HA tag: YPYDVPDYA (SEQ ID NO: 65).
- the expression repressor may comprise two copies of the epitope tag.
- an expression repressor lacks an epitope tag.
- an expression repressor described herein comprises a sequence provided herein (or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto), but lacking the HA tag of SEQ ID NO: 65.
- a nucleic acid described herein comprises a sequence provided herein (or a sequence with at least 80, 85, 90, 95, 99, or 100% identity thereto, or having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto), but lacking a region encoding the HA tag of SEQ ID NO: 65.
- the expression repressor does not comprise an NLS.
- the expression repressor does not comprise an epitope tag.
- the expression repressor does not comprise an HA tag.
- the expression repressor does not comprise an HA tag sequence according to SEQ ID NO: 65.
- a nucleic acid for use in a method or composition described herein comprises a nucleic acid sequence of any one of SEQ ID NOs: 122-131, a complementary or reverse complementary sequence of any thereof, or comprises a sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to any thereof.
- an expression repressor for use in a method or composition described herein comprises an amino acid sequence of any one of SEQ ID NOs: 122-131, or comprises a sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to any thereof.
- an expression repressor for use in a method or composition described herein comprises an amino acid sequence encoded by any one of SEQ ID NOs: 122-131, or an amino acid sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity to any thereof.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 122, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 123, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 124, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 125, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 126, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 127, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 128, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 129, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 130, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid comprising a nucleic acid sequence of SEQ ID NO: 131, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 142, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 143, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 144, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 145, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 146, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 147, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 148, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12,
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 149, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 150, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions of difference thereto.
- an expression repressor is encoded by a nucleic acid sequence of SEQ ID NO: 151, or a nucleic acid sequence with at least 80%, 85%, 90%, 95%, 99%, or 100% identity thereto, or a nucleic acid sequence having no more than 20, 19, 18, 17, 16, 15, 14, 13,
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Pulmonology (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/852,300 US20250195625A1 (en) | 2022-03-30 | 2023-03-29 | Cxcl-modulating compositions and methods |
| JP2024558018A JP2025511184A (ja) | 2022-03-30 | 2023-03-29 | Cxcl調節組成物及び方法 |
| CN202380031799.8A CN119032172A (zh) | 2022-03-30 | 2023-03-29 | 调节cxcl的组合物和方法 |
| AU2023243459A AU2023243459A1 (en) | 2022-03-30 | 2023-03-29 | Cxcl-modulating compositions and methods |
| CA3255769A CA3255769A1 (en) | 2022-03-30 | 2023-03-29 | CXCL COMPOSITIONS AND MODULATION METHODS |
| EP23782038.6A EP4499836A2 (en) | 2022-03-30 | 2023-03-29 | Cxcl-modulating compositions and methods |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263325524P | 2022-03-30 | 2022-03-30 | |
| US63/325,524 | 2022-03-30 | ||
| US202263379849P | 2022-10-17 | 2022-10-17 | |
| US63/379,849 | 2022-10-17 | ||
| US202363478855P | 2023-01-06 | 2023-01-06 | |
| US63/478,855 | 2023-01-06 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2023192911A2 true WO2023192911A2 (en) | 2023-10-05 |
| WO2023192911A3 WO2023192911A3 (en) | 2023-10-26 |
Family
ID=88203460
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/065108 Ceased WO2023192911A2 (en) | 2022-03-30 | 2023-03-29 | Cxcl-modulating compositions and methods |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20250195625A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4499836A2 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2025511184A (cg-RX-API-DMAC7.html) |
| CN (1) | CN119032172A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2023243459A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3255769A1 (cg-RX-API-DMAC7.html) |
| TW (1) | TW202345871A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2023192911A2 (cg-RX-API-DMAC7.html) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6444801B1 (en) * | 1996-11-15 | 2002-09-03 | Institute Of Cytosignal Research Inc. | Transcriptional inhibitor protein and the encoding DNA |
| EP2066335A4 (en) * | 2006-09-26 | 2010-01-20 | Univ Case Western Reserve | ZYTOKINSIGNALISIERUNG |
| HK1212628A1 (zh) * | 2012-06-27 | 2016-06-17 | 吉安特科技公司 | 用於抑制炎症的抗-cxcl9、抗-cxcl10、抗-cxcl11、抗-cxcl13、抗-cxcr3和抗-cxcr5试剂 |
| WO2018044940A1 (en) * | 2016-08-30 | 2018-03-08 | Beth Israel Deaconess Medical Center | Compositions and methods for treating a tumor suppressor deficient cancer |
-
2023
- 2023-03-29 US US18/852,300 patent/US20250195625A1/en active Pending
- 2023-03-29 CN CN202380031799.8A patent/CN119032172A/zh active Pending
- 2023-03-29 WO PCT/US2023/065108 patent/WO2023192911A2/en not_active Ceased
- 2023-03-29 EP EP23782038.6A patent/EP4499836A2/en active Pending
- 2023-03-29 AU AU2023243459A patent/AU2023243459A1/en active Pending
- 2023-03-29 TW TW112112099A patent/TW202345871A/zh unknown
- 2023-03-29 JP JP2024558018A patent/JP2025511184A/ja active Pending
- 2023-03-29 CA CA3255769A patent/CA3255769A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| US20250195625A1 (en) | 2025-06-19 |
| TW202345871A (zh) | 2023-12-01 |
| CA3255769A1 (en) | 2023-10-05 |
| WO2023192911A3 (en) | 2023-10-26 |
| JP2025511184A (ja) | 2025-04-15 |
| EP4499836A2 (en) | 2025-02-05 |
| CN119032172A (zh) | 2024-11-26 |
| AU2023243459A1 (en) | 2024-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230399640A1 (en) | Compositions and methods for inhibiting gene expression | |
| US20240132559A1 (en) | Compositions and methods for modulating myc expression | |
| US20220403387A1 (en) | Modulating genomic complexes | |
| KR20250068590A (ko) | Myc 발현을 조절하기 위한 제형 | |
| JP2025169372A (ja) | フラタキシン発現を調節し、フリードライヒ運動失調症を治療するための方法及び組成物 | |
| US20230374549A1 (en) | Compositions and methods for inhibiting the expression of multiple genes | |
| US20250195625A1 (en) | Cxcl-modulating compositions and methods | |
| US20220267756A1 (en) | Compositions and methods for modulating genomic complex integrity index | |
| WO2024040229A2 (en) | Combination therapies comprising myc modulators and checkpoint inhibitors | |
| CA3196827A1 (en) | Compositions and methods for inhibiting gene expression | |
| WO2024238723A1 (en) | Methods and compositions for modulating pcsk9 expression | |
| CN116829175A (zh) | 用于调节myc表达的组合物和方法 | |
| AU2023289663A1 (en) | Combination therapies comprising myc modulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23782038 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380031799.8 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024558018 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2023243459 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023782038 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023782038 Country of ref document: EP Effective date: 20241030 |
|
| ENP | Entry into the national phase |
Ref document number: 2023243459 Country of ref document: AU Date of ref document: 20230329 Kind code of ref document: A |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23782038 Country of ref document: EP Kind code of ref document: A2 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18852300 Country of ref document: US |