WO2023177181A1 - 돼지 만능성 줄기세포 배양용 배지 조성물 - Google Patents

돼지 만능성 줄기세포 배양용 배지 조성물 Download PDF

Info

Publication number
WO2023177181A1
WO2023177181A1 PCT/KR2023/003393 KR2023003393W WO2023177181A1 WO 2023177181 A1 WO2023177181 A1 WO 2023177181A1 KR 2023003393 W KR2023003393 W KR 2023003393W WO 2023177181 A1 WO2023177181 A1 WO 2023177181A1
Authority
WO
WIPO (PCT)
Prior art keywords
stem cells
pluripotent stem
cells
porcine
culturing
Prior art date
Application number
PCT/KR2023/003393
Other languages
English (en)
French (fr)
Inventor
이창규
최광환
이동경
Original Assignee
주식회사 스페이스에프
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020230032368A external-priority patent/KR102581040B1/ko
Application filed by 주식회사 스페이스에프, 서울대학교산학협력단 filed Critical 주식회사 스페이스에프
Publication of WO2023177181A1 publication Critical patent/WO2023177181A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to a medium composition for culturing porcine pluripotent stem cells.
  • pluripotency in stem cells is achieved or maintained by activation of relevant genes through external factors such as metabolites, signaling molecules, and extracellular matrix (ECM).
  • Metabolites such as carbohydrates, amino acids, and lipids are basic components necessary for culturing cells in vitro and regulate the physiological characteristics and pluripotency of stem cells.
  • Various signaling molecules including cytokines and hormones, play an important role in supporting pluripotency and inhibiting differentiation of stem cells by triggering the activation of cell signaling systems.
  • pluripotency changes dynamically during embryonic development and constitutes a continuum consisting of several stages, such as na ⁇ ve, formative and primed states. It has been demonstrated that pluripotency at each stage is regulated by different combinations of signaling molecules, and numerous efforts are underway to discover new molecules to maintain pluripotency.
  • the extracellular matrix is composed of structural proteins such as collagen, laminin, and fibronectin, and provides a physical environment for cell attachment and survival.
  • Cells recognize extracellular matrix proteins through integrin receptors to regulate cell proliferation, survival, and aging.
  • Feeder cells made from mouse fibroblasts have been used for a long time to cultivate pluripotent stem cells in vitro.
  • the support cells are known to maintain the pluripotency of pluripotent stem cells by providing paracrine factors and an adherent ECM surface.
  • feeder cells Although the use of feeder cells is advantageous for culturing pluripotent stem cells in vitro, several issues have been raised regarding xenobiotic contamination and cell-to-cell variation. Therefore, numerous studies have been attempted to replace support cells derived from mouse fibroblasts. First, conditioned media of mouse embryonic fibroblasts is used instead of support cells, or foreskin fibroblasts and endometrium-derived cells are used in human embryonic stem cell research. and developed new culture conditions using allogenic cells such as mesenchymal stem cells.
  • pluripotency-supportive feeder cells such as FGF2, TGF ⁇ 1, and Activin A
  • various cytokines including WNT
  • Porcine pluripotent stem cells such as embryonic stem cells
  • embryonic stem cells are considered an applicable cell source for agricultural biotechnology and comparative developmental biology research.
  • many researchers have failed to establish embryonic stem cells in pigs.
  • our research team discovered various growth factors involved in pig pluripotency and developed a chemically defined medium containing a new pig-specific combination of growth factors, which was mixed with mouse fibroblast-derived support cells and By using them together, pig embryonic stem cells with in vivo differentiation potential were established for the first time in the world.
  • pig embryonic stem cells were cultured in an environment without support cells using the previously developed culture medium composition, they did not maintain pluripotency and differentiated.
  • Support cells made from mouse embryonic fibroblasts contain fibroblast growth factor 2 (FGF2), transforming growth factor ⁇ 1 (TGF ⁇ 1), activin A, WNT, oncostatin M, and interleukin-6 (IL-6). ) produces various cytokines, including Among them, FGF2 has been used as a key element in maintaining the pluripotency of human embryonic stem cells, and activin A, a standard for the quality of supporting cells, is abundant in conditioned media in which mouse embryonic fibroblasts are cultured. In fact, medium containing activin A and WNT helped maintain pluripotency of human embryonic stem cells in the absence of feeder cells.
  • FGF2 fibroblast growth factor 2
  • TGF ⁇ 1 transforming growth factor ⁇ 1
  • IL-6 interleukin-6
  • porcine embryonic stem cells failed to be cultured in vitro under similar conditions. This demonstrates that in order to culture porcine embryonic stem cells in vitro without support cells, it is necessary to establish new culture conditions containing additional growth factors or signaling molecules.
  • the inventors of the present invention studied the composition for cultivating porcine pluripotent stem cells from various angles and confirmed that, when using the composition for culturing porcine pluripotent stem cells of the present invention, it is possible to culture porcine pluripotent stem cells that are independent of support cells.
  • the present invention has been completed.
  • Patent Document 1 Korean Patent No. 10-2142400 (Registration Date: 2020.08.03.)
  • Non-patent Document 1 Choi KH, Lee DK, Oh JN, Kim SH, Lee M, Woo SH, Kim DY, Lee CK. Pluripotent pig embryonic stem cell lines originating from in vitro-fertilized and parthenogenetic embryos. Stem Cell Res. 2020 Dec;49:102093.
  • Non-patent Document 2 Choi KH, Lee DK, Oh JN, Kim SH, Lee M, Kim SW, Lee CK. Transcriptome profiling of pluripotent pig embryonic stem cells originating from uni- and biparental embryos. BMC Res Notes. 2020 Mar 11;13(1):144.
  • Non-patent Document 3 Choi KH, Lee DK, Kim SW, Woo SH, Kim DY, Lee CK. Chemically Defined Media Can Maintain Pig Pluripotency Network In Vitro. Stem Cell Reports. 2019 Jul 9;13(1):221-234.
  • the purpose of the present invention is to provide a medium composition for culturing porcine pluripotent stem cells.
  • Another object of the present invention is to provide a method for cultivating pig pluripotent stem cells that is independent of feeder cells using a medium composition for culturing pig pluripotent stem cells.
  • the present invention provides a medium composition for culturing porcine pluripotent stem cells containing LDN-193189.
  • the medium composition for culturing porcine pluripotent stem cells may further include one or more components selected from FGF2, activin A, IWR-1, and CHIR99021.
  • the present invention provides a method for cultivating porcine pluripotent stem cells using a medium composition for culturing porcine pluripotent stem cells containing LDN-193189.
  • the present invention provides a porcine pluripotent stem cell culture medium additive composition containing LDN-193189.
  • the medium composition for culturing porcine pluripotent stem cells according to the present invention can maintain pluripotency/stem cell function even without support cells, thereby solving problems that may arise due to support cell-dependent culture methods.
  • Figure 1 shows cell morphology when porcine embryonic stem cells cultured without feeder cells were treated with LDN-193189 at different concentrations (100x magnification).
  • Figure 2 shows the results of analyzing the expression of various genes in porcine stem cells cultured without support cells (ff-ESCs LDN- ., ff-ESCs LDN+ ) and porcine embryonic stem cells cultured with support cells (control).
  • Figure 2A shows the results of immunological staining of pluripotency genes and the SMAD signaling system
  • Figure 2B shows the results showing the expression levels of genes related to the SMAD signaling system secreted from supporting cells
  • Figure 2C shows the results of pluripotency marker genes. This is the result of qPCR analysis for expression
  • Figure 2D is the result of qPCR analysis for the expression of trophectoderm marker gene.
  • Figure 3 shows the results of analyzing the optimal concentration of LDN-193189 in porcine embryonic stem cells cultured without support cells.
  • Figure 3A is the result of Annexin V staining by dividing the concentration of LDN-193189
  • Figure 3B is the result showing the cell death rate due to the Annexin V staining treatment
  • Figure 3C is the result of WST-8 assay
  • Figure 3D is the result of Ki-67 staining.
  • Figure 4 shows the results of qPCR analysis of the expression of pluripotency-related genes in LDN-193189-treated porcine embryonic stem cells cultured with various concentrations of FGF2, activin A, and CHIR99021.
  • Figure 5 shows the results of analyzing the characteristics of porcine embryonic stem cells cultured without support cells.
  • Figure 5A shows typical morphology and AP staining of porcine embryonic stem cells (bottom, AP staining image). (Scale bar, 400 ⁇ m)
  • Figure 5B is the karyotype of porcine embryonic stem cells
  • Figure 5C is the result of immunostaining for pluripotency marker genes in porcine embryonic stem cells (scale bar, 200 ⁇ m)
  • Figure 5D is supporting cells. This is the result of qPCR analysis of the expression of pluripotency and differentiation marker genes in pig embryonic stem cells cultured without.
  • Figure 6 relates to embryoid bodies derived from porcine embryonic stem cells cultured without support cells
  • Figure 6A shows the shape of embryoid bodies derived from porcine embryonic stem cells (scale bar, 400 ⁇ m)
  • Figure 6B shows porcine embryonic stem cells. and qPCR analysis results for the expression of pluripotency and differentiation marker genes in differentiated cells.
  • Figure 7 shows the results of histological analysis of teratomas formed from porcine embryonic stem cells.
  • Figure 8 shows the results of culturing porcine embryonic stem cells cultured on fibronectin, laminin, poly-L-lysine, or type 1 collagen as various extracellular matrices.
  • Figure 9 shows the results of analyzing the function of LDN-193189 in culture medium in which KSR was replaced with FBS.
  • Figure 10 shows the results showing the effect of LDN-193189 on pig embryonic stem cells grown on feeder cells.
  • the terms “medium”, “culture medium”, “culture medium”, “medium composition” or “culture composition” include nutrients that can support the growth and survival of stem cells in in vitro culture conditions. It refers to a culture medium that is not differentiated in this specification and can be used interchangeably.
  • culture of porcine pluripotent stem cells refers to porcine pluripotent stem cells maintaining pluripotency/stemness, not differentiating into cells of a specific lineage, and cell proliferation. It means to do.
  • Pig pluripotent stem cells may be pig embryonic stem cells or pig induced pluripoetent stem cells, and the pluripotent stem cells are usually produced using any method known in the art. You can obtain it by doing this.
  • embryonic stem cell refers to an inner cell mass extracted from a blastocyst stage embryo just before the fertilized egg implants in the mother's uterus and cultured in vitro, which can differentiate into cells of all tissues of the individual. It refers to cells that are pluripotent or can be totipotent, and in a broad sense includes embryoid bodies derived from embryonic stem cells. Embryonic bodies are intermediate structures formed by stem cells during the spontaneous differentiation of embryonic stem cells into various tissue types, and are in the form of aggregates formed during culture of embryonic stem cells. Meanwhile, the embryonic stem cells of the present invention are porcine embryonic stem cells derived from pigs.
  • Embryonic stem cells can differentiate into ectoderm, mesoderm, and endoderm stem cells.
  • the term “differentiation” refers to a phenomenon in which the structure or function of a cell becomes specialized while the cell divides, proliferates, and grows.
  • Pluripotent stem cells can be differentiated into lineage-limited progenitor cells (e.g., ectodermal cells, mesodermal cells, or endodermal cells, etc.) and then further differentiated into other types of progenitor cells (e.g., hemangioblasts, etc.). ), and can then be differentiated into terminally differentiated cells (e.g., vascular endothelial cells and vascular smooth muscle cells, etc.) that play characteristic roles in specific tissues (e.g., blood vessels, etc.).
  • lineage-limited progenitor cells e.g., ectodermal cells, mesodermal cells, or endodermal cells, etc.
  • other types of progenitor cells e.g., hemangioblasts, etc.
  • terminally differentiated cells e.g.
  • the pluripotency of the porcine pluripotent embryonic stem cells of the present invention is differentiated into ectoderm, mesoderm, and endoderm cells when a certain number of porcine embryonic stem cells cultured using the medium composition of the present invention are transplanted into immunosuppressed mice. It can be analyzed as to whether it can be done or not.
  • induced pluripotent stem cell or “iPSC (induced pluripotent stem cell)” refers to a cell that has pluripotent differentiation by processing somatic cells or already differentiated cells. Processing methods herein include, but are not limited to, compounds, genetic transformation, or culturing under specific conditions. “Porcine induced pluripotent stem cells” or “piPSCs” refer to cells that have acquired pluripotent differentiation by processing pig somatic cells or pig differentiated cells.
  • culture refers to a method of continuously cultivating generations of cells by periodically transferring some of the cells to a new culture vessel and changing the culture medium in order to continuously cultivate cells in a healthy state for a long period of time. it means.
  • passage refers to the growth of pluripotent stem cells from the initial seed culture in a culture vessel to the time when cells actively grow (confluence) in the same culture vessel. As the number of cells increases in a culture vessel with limited space, growth nutrients are consumed or contaminants accumulate and the cells die naturally after a certain period of time.
  • the method of subculturing can be any method known in the art without limitation, but is preferably performed by mechanical separation or enzymatic separation.
  • the inventors of the present invention developed a medium composition for culturing pig pluripotent stem cells containing LDN-193189.
  • the LDN-193189 is included at a concentration of 10 nM to 1000 nM.
  • the porcine pluripotent stem cells are porcine embryonic stem cells or porcine induced pluripotent stem cells.
  • the medium composition for culturing porcine pluripotent stem cells can be used for supporter cell-independent culture of porcine pluripotent stem cells.
  • the support cell-independent culture is cell culture in a culture vessel coated with extracellular matrix (ECM) or Matrigel® or a substitute thereof.
  • ECM extracellular matrix
  • the support cell-independent culture involves culturing cells in a culture vessel coated with fibronectin, laminin, poly-L-lysine, type 1 collagen, or Matrigel®.
  • the medium composition for culturing porcine pluripotent stem cells may further include FGF2, Activin A, and CHIR99021.
  • the concentration of FGF2 is 0.1 ng/ml to 100 ng/ml
  • the concentration of activin A is 0.1 ng/ml to 10 ng/ml
  • the concentration of CHIR99021 is 0.1 to 4.5 ⁇ M
  • the concentration of IWR-1 may be 0.1 ⁇ M to 5 ⁇ M.
  • the medium composition for culturing porcine pluripotent stem cells promotes the proliferation of porcine pluripotent stem cells and inhibits cell death.
  • the medium composition for culturing porcine pluripotent stem cells increases the number of porcine pluripotent stem cell colonies and increases the size of the colonies.
  • the medium composition for culturing porcine pluripotent stem cells enhances the stem cell function/pluripotency of porcine pluripotent stem cells.
  • the medium composition for culturing porcine pluripotent stem cells may contain 0.1 to 3% by weight of serum-free or serum components.
  • a composition for adding porcine pluripotent stem cell culture medium containing LDN-193189 as an active ingredient is provided.
  • the LDN-193189 may be included at a concentration of 10 nM to 1000 nM in the composition for adding the porcine pluripotent stem cell culture medium.
  • the present invention includes the step of treating and culturing porcine pluripotent stem cells with the medium composition for culturing porcine pluripotent stem cells of the present invention, wherein the porcine pluripotent stem cells are porcine embryonic stem cells or porcine induced pluripotent stem cells.
  • the porcine pluripotent stem cell culture method can be cultured independently of support cells.
  • the feeder cell-independent culture method can culture cells in a culture vessel coated with extracellular matrix (ECM) or Matrigel.
  • ECM extracellular matrix
  • Matrigel extracellular matrix
  • the support cell-independent culture may be performed by culturing cells in a culture vessel coated with fibronectin, laminin, poly-L-lysine, type 1 collagen, or Matrigel.
  • the extracellular matrix may include extracellular matrices commonly used in this technical field in addition to fibronectin, laminin, poly-L-lysine, and type 1 collagen.
  • the medium composition for culturing porcine pluripotent stem cells of the present invention contains LDN-193189, thereby promoting the proliferation or growth of porcine pluripotent stem cells, inhibiting stem cell death, and increasing the number and size of stem cell colonies. It has the effect of strengthening the stemness and differentiation ability of stem cells.
  • LDN-193189 can be used by adding it to the medium used for culturing stem cells.
  • the LDN-193189 is a BMP (bone morphogenetic) pathway inhibitor and is known to inhibit ALK1, ALK2, ALK3, and ALK6. LDN-193189 is known to induce differentiation of human pluripotent stem cells into neural progenitor cells or pancreatic cells, and is known to induce differentiation of mouse pluripotent stem cells.
  • BMP bone morphogenetic pathway inhibitor
  • LDN-193189 has the effect of maintaining stem cell potency/pluripotency and inhibiting differentiation of pig pluripotent stem cells. This effect is contrary to the existing effect of LDN-193189, which means that the mechanism for maintaining stem cell function is different depending on the species of embryonic stem cells, and the medium for culturing embryonic stem cells is also different from the species of embryonic stem cells. This result indicates that it should be used differently depending on the situation.
  • the concentration of LDN-193189 contained in the medium composition for culturing porcine pluripotent embryonic stem cells is 10 nM to 1000 nM. If the concentration of LDN-193189 is less than 10 nM, it has no particular effect, and if it exceeds 1000 nM, it shows cytotoxicity.
  • LDN-193189 included in the medium composition for culturing porcine pluripotent embryonic stem cells according to one embodiment of the present invention has a concentration of 100 nM, but is not limited thereto.
  • the medium composition for culturing porcine pluripotent stem cells of the present invention may additionally include FGF2, activin A, CHIR99021, and IWR-1.
  • FGF2, activin A, CHIR99021, and IWR-1 additionally included in the medium composition for culturing porcine pluripotent stem cells according to an embodiment of the present invention are 0.1 ng/ml to 100 ng/ml, and 0.1 ng/ml to 100 ng/ml, respectively. ng/ml, 0.1 ⁇ M to 4.5 ⁇ M and 0.1 ⁇ M to 5 ⁇ M. If the concentration of FGF2 is less than 0.1 ng/ml, there is no particular effect, and if it is more than 100 ng/ml, there is no additional effect due to the increase in concentration or it is toxic to cells.
  • concentration of activin A is less than 0.1 ng/ml, there is no particular effect, and if it is more than 10 ng/ml, there is no additional effect due to increased concentration or it is toxic to cells.
  • concentration of CHIR99021 is less than 0.1 ⁇ M, it has no particular effect, and if it exceeds 4.5 ⁇ M, it is toxic to cells.
  • concentration of IWR-1 is less than 0.1 ⁇ M, there is no particular effect, and if it is more than 5 ⁇ M, there is no additional effect due to increased concentration or it is toxic to cells.
  • FGF2, activin A, CHIR99021, and IWR-1 contained in the medium composition for culturing porcine pluripotent stem cells according to one embodiment of the present invention have concentrations of 20 ng/ml, 5 ng/ml, 0.5 ⁇ M, and 0.5 ⁇ M, respectively. has, but is not limited to.
  • the basic medium for culturing porcine pluripotent stem cells of the present invention can be used without limitation as long as it is a medium widely known to those skilled in the art.
  • the basic medium can be manufactured by artificial synthesis, or a commercially manufactured medium can be used.
  • commercially prepared media include DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, and ⁇ -MEM ( ⁇ -Minimal). essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Isocove's Modified Dulbecco's Medium), and DMEM/F-12 can be used, but are not limited to these.
  • DMEM/F-12 basic medium is used.
  • the culture medium composition of the present invention preferably uses antibiotics, antifungal agents, and/or substances commonly used in the industry to prevent the growth of mycoplasma to prevent infections such as bacteria and fungi.
  • antibiotics all antibiotics commonly used in cell culture, such as penicillin and streptomycin, can be used.
  • Antifungal agents include alporericin B, and mycoplasma inhibitors include gentamicin, ciprofloxacin, and azithromycin. Any material may be used, but is not limited thereto. Additionally, commercially available antibiotic-antimycotic (AA) (Gibco) can be used.
  • the culture composition of the present invention may include 1% glutamax (or glutamine) and 0.1 mM beta-mercaptoethanol.
  • the medium composition for culturing porcine pluripotent stem cells of the present invention can be used for culturing porcine pluripotent stem cells that are independent of feeder cells.
  • support cells such as mouse fibroblasts have been used to maintain pluripotency or stem cell function when culturing pluripotent stem cells or embryonic stem cells (support cell-dependent culture), but problems such as in vitro contamination/cell-to-cell variation are common.
  • pluripotent stem cells have been used to maintain pluripotency or stem cell function when culturing pluripotent stem cells or embryonic stem cells (support cell-dependent culture), but problems such as in vitro contamination/cell-to-cell variation are common.
  • porcine pluripotent stem cells pluripotency/stem cell function was not maintained when feeder cell-independent culture medium used for human embryonic stem cells was used.
  • porcine pluripotent stem cells of the present invention it was confirmed that the pluripotency/stem cell function of porcine pluripotent stem cells was maintained even without support cells.
  • the medium composition for culturing porcine pluripotent stem cells of the present invention may be serum-free or contain 0.1 to 3% by weight of serum components.
  • the serum-free medium refers to any culture medium that does not contain more than a certain amount of serum derived from animals, including humans (animal-derived serum).
  • the serum-free medium may contain less than 0.1% by weight or less than 0.01% by weight of animal-derived serum based on the total composition content, and may specifically not contain animal-derived serum.
  • the present invention provides a porcine pluripotent stem cell culture fluid additive composition containing LDN-193189 as an active ingredient.
  • porcine pluripotent stem cells can be stably propagated and cultured, and reproducible testing and production processes can be established.
  • the present invention relates to a method for cultivating porcine pluripotent stem cells, which includes the step of treating porcine pluripotent stem cells with the medium composition for culturing porcine pluripotent stem cells of the present invention and culturing them.
  • the porcine pluripotent stem cells can be cultured in a support cell-independent manner.
  • the porcine pluripotent stem cells are cultured using extracellular matrix or Matrigel® or its substitutes (gelatin, collagen, laminin fibronectin, poly- It may be cultured in a culture vessel coated with D-lysine (poly-D-lysine, poly-L-lysine, etc.), but is not limited thereto.
  • Example 1 Analysis of culturability of porcine embryonic stem cells according to culture medium
  • Example 1-1 Isolation of pig embryonic stem cells
  • IACUC Seoul National University Laboratory Animal Ethics Committee
  • Pregnant ICR mice and athymic nude mice were purchased from Samtaco Bio Inc. (Korea) and OrientBio Inc. (Korea), respectively. Mice were maintained according to the standard protocols of the Laboratory Animal Resources Management Center of Seoul National University.
  • Example 1-2 Feeder cell-dependent culture of porcine embryonic stem cells
  • the 'embryonic stem cell culture medium' used to culture porcine embryonic stem cells with supporting cells is a DMEM/F12-based medium containing 15% (v/v) knock-out serum replacement (KSR), 0.1% ( v/v) Chemically defined lipid concentrate (LC), 1X GlutaMAX®, 0.1 mM ⁇ -mercaptoethanol, 1X MEM non-essential amino acids, and 1X antibiotics-antimycotics (All of the aforementioned materials were purchased from Gibco, Gaithersburg, MD, USA), 20 ng/mL hrFGF2 (fibroblast growth factor 2) (R&D Systems, Minneapolis, MN, USA), 5 ng/mL ActA (activin) A) (R&D Systems), containing 1.5 ⁇ M CHIR99021 (CH, Cayman Chemical, Ann Arbor, MI, USA) and 2.5 ⁇ M IWR-1 (Sigma-Aldrich, St. Louis, MO, USA).
  • KSR knock-out serum replacement
  • LC Chemically defined lipid concentrate
  • Porcine embryonic stem cells were subcultured with feeder cells every 5-7 days. 24 hours before subculture, porcine embryonic stem cells were cultured with the previously mentioned ‘embryonic stem cell culture medium’ containing 10 ⁇ M Y-27632 (Santa Cruz Biotechnology, Dallas, TX, USA). Fully grown embryonic stem cell populations were separated into small clumps using TrypLE® Express (Gibco). This cell mass is transferred to a new feeder cell and cultured for 24 hours with 'embryonic stem cell culture medium' containing 10 ⁇ M Y-27632 (Santa Cruz Biotechnology). After 24 hours, the embryonic stem cells attached to the support cells are cultured for 4-6 days with 'embryonic stem cell culture medium' that does not contain Y-27632. The medium was changed every 24 hours and cultured under conditions of 5% CO 2 and 37°C.
  • Example 1-3 Supporter cell-independent culture of porcine embryonic stem cells
  • porcine embryonic stem cells cultured in feeder cells were cultured in 'Embryonic stem cell culture medium for feeder-free culture (hereinafter referred to as 'FF-embryonic stem cells'). Culture medium') was used and cultured in a culture dish (SPL Life Sciences, Pocheon, Korea) coated with Matrix TM at a split ratio of 1:5 to 1:10.
  • FF-embryonic stem cell culture medium is a DMEM/F12 based medium containing 15% (v/v) KSR, 0.1% (v/v) LC, 1X Glutamax, 0.1 mM ⁇ -mercaptoethanol, 1X MEM non-essential amino acids, and 20 ng/mL hrFGF2 (R&D Systems), 5 ng/mL ActA (R&D Systems), 1.5 ⁇ M CHIR99021 (CH, Cayman Chemical), 2.5 ⁇ M IWR-1 (Sigma-Aldrich), 1X antibiotics -antibiotics-antimycotics (all previously mentioned substances were purchased from Gibco, Gaithersburg, MD, USA), and 100 nM LDN-193189 (Cayman Chemical).
  • Porcine embryonic stem cells were subcultured every 5-7 days. 24 hours before subculture, porcine embryonic stem cells were cultured with 'FF-embryonic stem cell culture medium' containing 10 ⁇ M Y-27632 (Santa Cruz Biotechnology, Dallas, TX, USA). Next, the cultured stem cells were separated into small clumps using TrypLE® Express (Gibco). These cells were transferred to a new Matrix TM coated plate and cultured for 24 hours with 'FF-embryonic stem cell culture medium' containing 10 ⁇ M Y-27632 (Santa Cruz Biotechnology). Next, the attached stem cells were cultured with 'FF-embryonic stem cell culture medium' without Y-27632 for 4-6 days. The medium was changed every 24 hours and cultured under conditions of 5% CO 2 and 37°C.
  • Example 1-4 Analysis of the effect of LDN-193189 in feeder cell-independent culture of porcine embryonic stem cells (cell shape analysis)
  • porcine embryonic stem cells were grown in 'FF-Embryonic Stem Cell Culture Medium' (ff-ESCs LDN+) containing 100 nM LDN-193189 without feeder cells. ), and 'FF-Embryonic Stem Cell Culture Medium' (ff-ESCs LDN- ) that does not contain LDN-193189, and as a control, porcine embryonic stem cells were cultured together with support cells as mentioned above. Cultured using medium (Control ESCs).
  • Figure 2A shows the results showing immunological staining of pluripotency genes and the SMAD signaling system
  • Figure 2B shows the results showing the expression levels of genes related to the SMAD signaling system secreted from supporting cells.
  • Example 2 Analysis of the optimal concentration of LDN-193189 and the effect of FGF2, Activin 2, and CHIR99021 by concentration in feeder cell-independent culture of porcine embryonic stem cells
  • Figure 4A shows the results of confirming the proliferation rate through Ki-67 staining
  • Figure 4B shows the results of confirming cell activity through WST-8 assay.
  • Activin A was confirmed to have reduced cytotoxicity and proliferation rate at concentrations above 10 ng/ml in both Ki-67 staining and WST-8 assay results. Therefore, it was confirmed that the optimal concentration of Activin A is 1 ng/ml to 5 ng/ml.
  • the proliferation rate of CHIR99021 gradually decreased as the concentration increased compared to the group not treated with CHIR99021.
  • the results of WST-8 confirmed that the activity and proliferation rate of stem cells were improved when the substance was treated at a concentration of 0.1 ⁇ M to 0.5 ⁇ M.
  • IWR-1 As the concentration of IWR-1 increased, the proportion of dividing cells gradually increased. However, IWR-1 showed cytotoxicity at high concentrations, showing the highest cellular activity when treated at a concentration of 0.5 ⁇ M.
  • Pig embryonic stem cells cultured without support cells For immunocytochemical analysis, cell samples were left at 4°C for 10 min and fixed in 4% (w/v) paraformaldehyde for 30 min. After washing twice with DPBS (Dulbecco's phosphate buffered saline), the sample was treated with DPBS containing 10% (v/v) goat serum for 1 hour to prevent non-specific binding. Serum-treated cells were labeled with OCT4 (1:200; SC-9081, Santa Cruz Biotechnology), SOX2 (1:200; AB5603, Millipore, Billerica, MA, USA), NANOG (1:200; 500-P236, Peprotech, NJ).
  • OCT4 1:200; SC-9081, Santa Cruz Biotechnology
  • SOX2 (1:200; AB5603, Millipore, Billerica, MA, USA
  • NANOG 1:200; 500-P236, Peprotech, NJ.
  • SSEA1 (1:200; MAB4301, Millipore
  • SSEA4 (1:200; MAB4304, Millipore) were used for immunocytochemical analysis.
  • nuclear proteins e.g., OCT4, SOX2, and NANOG
  • Magenta Fluor-conjugated secondary antibody was treated at room temperature for 3 hours.
  • the nuclei of cells were identified with Hoechst 33342 (Molecular Probes, Eugene, OR, USA).
  • the experimental results were visualized as images of stained cells using an inverted fluorescence microscope (Eclipse TE2000-U, Nikon, Konan, Japan).
  • AP staining For alkaline phosphatase (AP) staining, cells were fixed in 4% (w/v) paraformaldehyde for 30 minutes, then nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate toluidine salt. Cells were stained for 30 minutes at room temperature with a buffer solution containing stock solution (Roche, Basel, Switzerland). Stained cells were visualized under an inverted microscope.
  • Stem cells cultured without support cells showed alkaline phosphatase activity (bottom of Figure 5A) and, like porcine embryonic stem cells cultured with support cells, pluripotent cells such as OCT4, SOX2, NANOG, SSEA1, and SSEA4. Sex marker (protein) was expressed (Figure 5C).
  • qPCR analysis showed that during long-term culture of porcine embryonic stem cells without feeder cells, pluripotency-related genes such as OCT4, SOX2, and NANOG and trophoblast differentiation-related genes were stably expressed compared with genes in control porcine embryonic stem cells (Figure 5D).
  • Example 4-1 Induction of differentiation of pig embryonic stem cells using the embryoid body method
  • Embryonic stem cells cultured without feeder cells were isolated into single cells using TrypLE Express (Gibco) and incubated with 15% (v/v) FBS and 10 ⁇ M Y-27632 without other cytokines for 5 days (only on day 1). Treatment) was cultured in suspension using DMEM containing . After suspension culture, the dissociated cells aggregated to form embryoid bodies, which were cultured in DMEM containing 15% (v/v) FBS in a culture dish coated with 0.1% (w/v) gelatin for 2-3 weeks. Adhesion culture was performed.
  • Porcine embryonic stem cells cultured without support cells formed embryoid bodies through suspension culture, which then attached to the culture dish and differentiated spontaneously (Figure 6A).
  • porcine embryonic stem cells highly expressed three germ layer markers (PAX6 [ectoderm], AMY2 [endoderm], and BMP4 [mesoderm]), but pluripotency marker genes were analyzed by qPCR. As shown, it was gradually downregulated (Figure 6B).
  • porcine embryonic stem cells cultured without feeder cells were added to 200 ⁇ L containing 50% (v/v) BD Matrigel Matrix (BD Biosciences, Franklin Lakes, NJ, USA) and 10 ⁇ M Y-27632. It was resuspended in 'Embryonic Stem Cell Culture Medium'. Next, the resuspended pig stem cells were subcutaneously injected into 5-week-old athymic nude mice (OrientBio). 2-3 months after transplantation, a 1-2 cm teratoma was collected, fixed in 4% (w/v) paraformaldehyde, embedded in paraffin, and stained with hematoxylin and eosin for light microscopy.
  • porcine embryonic stem cells cultured without support cells differentiated into teratomas when transplanted subcutaneously into immunodeficient mice (nude mice).
  • the teratoma was histologically composed of various tissues representing three germ layers ( Figure 7). Therefore, it was confirmed that porcine embryonic stem cells cultured without support cells also have pluripotent differentiation capacity (ectoderm, mesoderm, endoderm).
  • Example 6 Analysis of culture fluid in various extracellular matrices
  • FIG. 8 shows the results of culturing porcine embryonic stem cells cultured on fibronectin, laminin, poly-L-lysine, or type 1 collagen as various extracellular matrices.
  • Figure 9 shows the results of analyzing the function of LDN-193189 in a culture medium in which KSR was replaced with FBS
  • Figure 9A shows the analysis of the characteristics of porcine embryonic stem cells through pluripotency marker NANOG and SSEA4 (white dotted border: differentiated portion)
  • Figure 9B is a result showing changes in the expression of genes related to pluripotency and mesoderm tissue development according to treatment with LDN-193189 in culture medium containing FBS.
  • Figure 10 is a result showing the effect of LDN-193189 on porcine embryonic stem cells grown on feeder cells
  • Figure 10A shows pluripotency markers (NANOG, SSEA4) of porcine embryonic stem cells grown on feeder cells treated with LDN-193189. This is a result showing the expression (white dotted border: differentiated cell population)
  • Figure 10B is a result showing the effect of LDN-193189 on the expression of phosphor-SMAD1/5
  • Figure 10C is a result showing the effect of LDN-193189 on the expression of phosphor-SMAD2/3.
  • LDN-193189 reduced the spontaneous differentiation of porcine embryonic stem cells grown on feeder cells and enhanced the expression of the SSEA4 marker. This is presumed to be because it suppresses the SMAD1/5 signaling system involved in mesoderm differentiation and activates the SMAD2/3 signaling involved in stem cell proliferation. Additionally, qPCR analysis confirmed that treatment with LDN-193189 reduced the expression of genes involved in the development of various mesodermal tissues.

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 돼지 만능성 줄기세포 배양용 배지 조성물에 관한 것으로, 본 발명의 배양용 배지 조성물은 돼지 만능성 줄기세포의 만능성 및 줄기세포능을 장기간 체외에서 유지시킬 수 있고, 지지세포 비의존적으로 줄기세포를 배양할 수 있다.

Description

돼지 만능성 줄기세포 배양용 배지 조성물
본 출원은 2022년 3월 14일자 한국 특허출원 제10-2022-0031249호 및 2023년 3월 13일자 한국 특허출원 제10-2023-0032368호에 기초한 우선권의 이익을 주장하며, 해당 한국 특허 출원의 문헌에 개시된 모든 내용을 본 명세서의 일부로서 포함한다.
본 발명은 돼지 만능성 줄기세포의 배양용 배지 조성물에 관한 것이다.
줄기세포 (stem cells)에서 만능성(pluripotency)의 획득 및 유지는 대사 산물, 신호 분자 및 세포외기질(ECM; extracellular matrix)과 같은 외부 요인을 통해 관련 유전자의 활성화에 의해 달성 또는 유지된다. 탄수화물, 아미노산, 지질과 같은 대사 산물은 체외에서 세포를 배양하는데 필요한 기본 구성 요소로서 줄기 세포의 생리학적 특징과 만능성을 조절한다. 사이토카인(cytokines) 및 호르몬(hormones)을 포함한 다양한 신호 분자(signaling molecules)는 세포 신호 전달체계의 활성화를 촉발하여 만능성을 지원하고 줄기 세포의 분화를 억제하는데 중요한 역할을 한다. 보고된 바에 따르면, 만능성은 배아 발달 동안 동적으로 변하며, naive, formative 및 primed 상태와 같은 여러 단계로 구성된 연속체를 구성한다. 각 단계에서의 만능성은 신호 분자들의 서로 다른 조합에 의해 조절된다는 것이 입증되었으며, 만능성을 유지하기 위한 새로운 분자를 발견하기 위해 수많은 노력이 진행 중이다.
세포외기질은 콜라겐(collagen), 라미닌(laminin), 피브로넥틴(fibronectin) 등의 구조 단백질로 구성되어 있으며 세포 부착 및 생존할 수 있는 물리적 환경을 제공한다. 세포는 인테그린 수용체에 의해 세포외기질 단백질을 인식하여 세포 증식, 생존 및 노화를 조절한다. 만능성 줄기세포의 체외 배양을 위해 오랫동안 생쥐 섬유아세포(fibroblasts)로 만들어진 지지세포(feeder cells)가 사용되어 왔다. 상기 지지세포는 주변분비 인자와 부착성 ECM 표면을 제공함으로써 만능성 줄기세포의 만능성을 유지하는 것으로 알려져 있다.
지지세포의 사용은 체외에서 만능성 줄기세포를 배양하는 데 이점이 있지만, 생체외 오염(xenobiotic contamination) 및 세포 간 편차(cell-to-cell variation)에 관한 몇 가지 문제가 제기되었다. 따라서, 생쥐 섬유아세포에서 유래한 지지세포를 대체하기 위한 수많은 연구가 시도되었다. 먼저, 지지세포를 대신하여 생쥐 배아 섬유아세포(mouse embryonic fibroblasts) 배양 배양액 (conditioned media)을 사용하거나, 인간 배아 줄기세포 연구에서는 포피 섬유아세포(foreskin fibroblasts), 자궁내막 유래 세포(endometrium-derived cells) 및 중간엽 줄기 세포(mesenchymal stem cells)와 같은 동종(allogenic) 세포를 사용하여 새로운 배양 조건을 개발했다.
하지만 일부 배양 조건은 세포 기원에 따라 만능성 줄기세포의 미분화 상태를 지원할 수 없었지만, 몇몇 단백질체(proteome) 분석을 통해 만능성에 도움이 되는 지지세포(pluripotency-supportive feeder cells)가 FGF2, TGFβ1, Activin A, WNT를 포함하는 다양한 사이토카인을 높게 발현하는 것으로 확인했다. 이러한 분자들은 지지세포가 없이도 만능성줄기세포에서 만능성 관련 유전자의 발현을 향상시키는 것으로 입증되었다.
또한, 지지세포에 의해 제공되는 세포외기질은 Matrigel, 또는 콜라겐, 라미닌, 피브로넥틴과 같은 단일 성분으로의 대체 가능성에 대해 연구되고 있다.
배아 줄기세포(embryonic stem cells)와 같은 돼지 만능성 줄기세포는 농업생명공학 및 비교 발달 생물학 연구에 적용할 수 있는 세포원으로 간주된다. 하지만, 돼지는 만능성이 확립되는 초기 착상 전 배아발달에서 생쥐와 사람의 배아와 비교하여 독특한 분자생물학적 특징을 가지고 있기 때문에, 많은 연구자들이 돼지에서 배아 줄기세포 확립에 실패하였다. 이에 앞선 발명에서 본 연구진은 돼지 만능성에 관여하는 다양한 성장인자를 발굴하여 돼지 특이적 새로운 성장인자 조합이 포함된 화학적으로 정의된 배지(chemically defined medium)를 개발하였고, 이를 생쥐 섬유아세포 유래 지지세포와 함께 사용하여 생체 내 분화능(in vivo differentiation potential)이 있는 돼지 배아 줄기세포를 세계 최초로 확립하였다. 하지만, 앞서 개발한 배양액 조성으로 돼지 배아 줄기세포를 지지세포가 없는 환경에서 배양하였을 때 만능성을 유지하지 못하고 분화가 되는 것을 확인하였다.
생쥐의 배아 섬유아세포(mouse embryonic fibroblasts)로 만들어진 지지세포는 섬유아세포 성장 인자 2(FGF2), 형질전환 성장 인자 β1(TGFβ1), 액티빈 A, WNT, 온코스타틴 M 및 인터루킨-6(IL-6)을 비롯한 다양한 사이토카인을 생성한다. 그 중 FGF2는 사람 배아 줄기세포의 만능성을 유지하는 핵심 요소로 사용되어 왔으며, 지지세포 품질의 기준인 액티빈 A는 생쥐 배아 섬유아세포를 배양한 배양배지 (conditioned media)에 풍부하다. 실제로, 액티빈 A와 WNT를 포함하는 배지는 지지세포가 없는 상태에서 인간 배아 줄기세포의 만능성 유지를 도왔다. 그러나 FGF2, Activin A 또는 TGFβ1 및 WNT 길항제는 지지세포가 없는 환경에서 인간 만능성줄기세포와 달리, 유사한 조건에서 돼지 배아 줄기세포는 체외배양에 실패하였다. 이는 지지세포 없이 돼지 배아 줄기세포를 체외배양하기 위해서는 추가적인 성장인자 혹은 신호전달물질 (signaling molecules)가 포함된 새로운 배양 조건의 확립이 필요하다는 것을 입증한다.
이러한 배경하에서, 본 발명의 발명자들은 돼지 만능성 줄기세포 배양용 조성물을 다각도로 연구한 결과, 본 발명의 배양용 조성물을 사용하는 경우 지지세포에 비의존적인 돼지 만능성 줄기세포 배양이 가능함을 확인하여 본 발명을 완성하였다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 한국 등록특허 제10-2142400호 (등록일: 2020.08.03.)
[비특허문헌]
(비특허문헌 1) Choi KH, Lee DK, Oh JN, Kim SH, Lee M, Woo SH, Kim DY, Lee CK. Pluripotent pig embryonic stem cell lines originating from in vitro-fertilized and parthenogenetic embryos. Stem Cell Res. 2020 Dec;49:102093.
(비특허문헌 2) Choi KH, Lee DK, Oh JN, Kim SH, Lee M, Kim SW, Lee CK. Transcriptome profiling of pluripotent pig embryonic stem cells originating from uni- and biparental embryos. BMC Res Notes. 2020 Mar 11;13(1):144.
(비특허문헌 3) Choi KH, Lee DK, Kim SW, Woo SH, Kim DY, Lee CK. Chemically Defined Media Can Maintain Pig Pluripotency Network In Vitro. Stem Cell Reports. 2019 Jul 9;13(1):221-234.
본 발명은 돼지 만능성 줄기세포 배양용 배지 조성물을 제공하는 것을 목적으로 한다.
본 발명의 또 다른 목적은 돼지 만능성 줄기세포 배양용 배지 조성물을 이용하여 지지세포 비의존적 돼지 만능성 줄기세포 배양 방법을 제공하는 것을 목적으로 한다.
상기 목적을 달성하기 위해, 본 발명은 LDN-193189를 포함하는 돼지 만능성 줄기세포 배양용 배지 조성물을 제공한다.
본 발명의 일 구현예에 따라, 상기 돼지 만능성 줄기세포 배양용 배지 조성물은 추가로 FGF2, 액티빈 A, IWR-1, 및 CHIR99021에서 선택되는 어느 하나 이상의 성분을 포함할 수 있다.
본 발명의 일 구현예에 따라, 본 발명은 상기 LDN-193189가 포함된 돼지 만능성 줄기세포 배양용 배지 조성물을 이용한 돼지 만능성 줄기세포 배양 방법을 제공한다.
본 발명의 일 구현예에 따라, 본 발명은 LDN-193189를 포함하는 돼지 만능성 줄기세포 배양액 첨가액 조성물을 제공한다.
본 발명에 따른 돼지 만능성 줄기세포 배양용 배지 조성물은 지지세포 없이도 만능성/줄기세포능을 유지할 수 있으므로, 지지세포 의존 배양 방법으로 인해 발생가능한 문제점을 해소할 수 있다.
도 1은 지지세포 없이 배양된 돼지 배아 줄기세포에 LDN-193189를 농도별로 처리했을 때의 세포 형태이다(배율 100배).
도 2는 지지세포 없이 배양된 돼지 줄기세포(ff-ESCsLDN-., ff-ESCsLDN+) 및 지지세포와 함께 배양된 돼지 배아 줄기세포(control)에서의 다양한 유전자 발현을 분석한 결과이다. 도 2A는 만능성 유전자 및 SMAD 신호전달체계의 면역학적 염색을 나타낸 결과이고, 도 2B는 지지세포에서 분비되는 SMAD 신호전달체계 관련 유전자의 발현량을 나타낸 결과이고, 도 2C는 만능성 표지 유전자의 발현에 대한 qPCR 분석결과이고, 도 2D는 영양외배엽 마커 유전자의 발현에 대한 qPCR 분석 결과이다.
도 3은 지지세포 없이 배양된 돼지 배아 줄기세포에서, LDN-193189의 최적의 농도를 분석한 결과이다. 도 3A는 LDN-193189의 농도를 세분화하여 Annexin V 염색을 처리한 결과이고, 도 3B는 상기 Annexin V 염색 처리로 인한 세포사멸율을 나타낸 결과이고, 도 3C는 WST-8 assay 결과이고, 도 3D는 Ki-67 염색 결과이다.
도 4는 다양한 농도의 FGF2, 액티빈 A, 및 CHIR99021로 배양한 LDN-193189 처리된 돼지 배아 줄기세포에서 만능성 관련 유전자의 발현을 qPCR로 분석한 결과이다.
도 5는 지지세포 없이 배양된 돼지 배아 줄기세포의 특성을 분석한 결과이다. 도 5A는 돼지 배아 줄기세포의 전형적인 형태 및 AP 염색(하단, AP 염색 이미지). (스케일 바, 400μm) 결과이고, 도 5B는 돼지 배아 줄기세포의 핵형이고, 도 5C는 돼지 배아 줄기세포에서 만능성 표지 유전자에 대한 면역염색 결과이고(스케일 바, 200μm), 도 5D는 지지세포 없이 배양된 돼지 배아 줄기세포에서 만능성 및 분화 표지 유전자의 발현에 대한 qPCR 분석결과이다.
도 6은 지지세포 없이 배양된 돼지 배아 줄기세포에서 유래한 배아체에 관한 것으로, 도 6A는 돼지 배아 줄기세포에서 유래한 배아체의 형태(스케일 바, 400μm)이고, 도 6B는 돼지 배아 줄기세포 및 분화된 세포에서 만능성 및 분화 표지 유전자의 발현에 대한 qPCR 분석결과이다.
도 7은 돼지 배아 줄기세포에서 형성된 기형종의 조직학적 분석 결과이다.
도 8은 다양한 세포외기질로서 피브로넥틴, 라미닌, 폴리-L-리신 또는 1형 콜라겐에서 배양한 돼지 배아줄기세포의 배양을 나타낸 결과이다.
도 9는 KSR을 FBS로 대체한 배양액에서 LDN-193189의 기능을 분석한 결과이다.
도 10은 LDN-193189의 지지세포 위에서 키운 돼지 배아줄기세포에 대한 효과를 나타낸 결과이다.
이하, 본 발명을 보다 상세하게 설명한다.
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 지식을 가진 자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 또한, 본 명세서에는 바람직한 방법이나 시료가 기재되나, 이와 유사하거나 동등한 것들도 본 발명의 범주에 포함된다. 본 명세서에 참고문헌으로 기재되는 모든 간행물의 내용은 전체가 본 명세서에 참고로 통합된다.
본 개시내용의 특정의 특성을 기술하고 청구함에 있어서, 다음의 용어는 달리 지정되지 않는 한 이하에 기술된 정의에 따라 사용될 것이다.
본 명세서에서 어떤 양태들이 “~를 포함하는”이란 용어와 함께 기술되더라도, “~로 구성된” 및/또는 “본질적으로 ~로 구성된”의 관점에서 기술된 다른 유사 양태들 또한 제공된다는 것이 이해되어야 한다.
본 발명에서 용어 “배지”, “배양 배지”, “배양용 배지”, “배지 조성물” 또는 “배양용 조성물”은 체외 배양 조건에서 줄기세포의 성장 및 생존을 지지할 수 있게 하는 영양물질을 포함하는 배양액을 의미하는 것으로서 본 명세서에서는 구분되지 않고, 혼용하여 사용할 수 있다.
본 발명에서 “돼지 만능성 줄기세포의 배양”은 돼지 만능성 줄기세포가 만능성(pluripotency)/줄기세포능(stemness)을 유지한 채로, 특정 계열(lineage)의 세포로 분화하지 않고, 세포증식하는 것을 의미한다.
돼지 만능성 줄기세포에는 돼지 배아 줄기세포(pig embryonic stem cell) 또는 돼지 유도 만능줄기세포(pig induced pluripoetent stem cell)일 수 있고, 상기 만능성 줄기세포는 통상적으로 당업계에 공지된 어떠한 방법을 이용하여 획득할 수 있다.
본 발명에서 용어 “배아 줄기세포”는 수정란이 모체의 자궁에 착상하기 직전인 포배기 배아에서 내세포괴(inner cell mass)를 추출하여 체외에서 배양한 것으로서, 개체의 모든 조직의 세포로 분화할 수 있는 만능성(pluripotent)이거나 전능성(totipotent)일 수 있는 세포를 의미하며, 넓은 의미로는 배아 줄기세포로부터 유래한 배아체(embryoid bodies)도 포함한다. 배아체는 배아 줄기세포의 다양한 조직 형태로의 자발적 분화 과정에서 줄기세포에 의해 형성된 중간구조이며, 배아 줄기세포의 배양 중에 형성된 응집물(aggregate) 형태이다. 한편, 본 발명의 배아 줄기세포는 돼지에서 유래한 돼지 배아 줄기세포이다.
배아 줄기세포는 외배엽, 중배엽 및 내배엽성 줄기세포로 분화할 수 있다.
본 발명에서 용어 “분화(differentiation)”란 세포가 분열 증식하여 성장하는 동안에 세포의 구조나 기능이 특수 화되는 현상을 의미한다. 다능성 베아줄기세포는 계통이 한정된 전구세포(예컨대, 외배엽성 세포, 중배엽성 세 포 또는 내배엽성 세포 등)로 분화한 후, 다른 형태의 전구세포로 더 분화될 수 있고(예컨대, 혈관모세포 등), 그 뒤 특정 조직(예컨대, 혈관 등)에서 특징적인 역할을 수행하는 말기 분화세포(예컨대, 혈관내피세포 및 혈관 평활근세포 등)로 분화될 수 있다.
따라서, 본 발명의 돼지 만능성 배아 줄기세포의 만능성은 본 발명의 배지 조성물을 이용하여 배양된 돼지 배아 줄기세포의 일정수를 면역억제 마우스에 이식하였을 때, 외배엽, 중배엽 및 내배역성 세포로 분화할 수 있는지 여부로 분석할 수 있다.
본 발명에서 용어 “유도 만능 줄기세포” 또는 “iPSC(induced pluripotent stem cell)”는 체세포 또는 이미 분화된 세포를 처리하여 만능 분화성을 갖게된 세포를 의미한다. 여기에서 처리하는 방법은 화합물, 유전적 변환 또는 특정 조건으로 배양하는 방법 등을 포함하나 이에 한정되는 것은 아니다. “돼지 유도 만능 줄기세포” 또는 “piPSC”는 돼지의 체세포 또는 돼지의 분화된 세포를 처리하여 만능분화성을 갖게 된 세포를 의미한다.
본 발명 용어, “계대 배양”은 세포를 건강한 상태로 지속적으로 장기간 배양하기 위해 주기적으로 세포의 일부를 새로운 배양용기에 옮긴 후 배양배지를 갈아주면서 세포의 대(代)를 계속 이어서 배양하는 방법을 의미한다. 상기 용어, “계대(passage)”는 배양 용기에서 초기 종배양부터 동일한 배양 용기에 세포가 왕성하게 자라는 시기(confluence)까지의 다능성 줄기세포로의 성장을 의미한다. 한정된 공간을 가진 배양용기 내에서 세포의 수가 늘어나면서 일정시간이 지나면 증식 영양분이 소비되거나 오염 물질이 쌓여 세포가 자연히 죽게 되므로, 건강한 세포의 수를 늘리기 위한 방법으로 사용되며, 통상적으로 한 차례 배지(배양용기)를 교체하는 것 또는 세포군을 나누어 배양하는 것을 1 계대 (1 passage)라고 한다. 계대 배양의 방법은 당업계에 공지된 방법을 제한 없이 사용할 수 있으나, 바람직하게는 기계적 분리 또는 효소적 분리로 수행될 수 있다.
본 발명의 발명자들은 돼지 만능성 줄기세포 배양용 배지 조성물을 개발하기 위해 다양한 방법으로 연구를 지속한 결과, LDN-193189를 포함하는 돼지 만능성 줄기세포 배양용 배지 조성물을 개발하였다.
발명의 일 실시예에서, 상기 LDN-193189는 10 nM 내지 1000 nM의 농도로 포함한다.
발명의 일 실시예에서, 상기 돼지 만능성 줄기세포는 돼지 배아 줄기세포 또는 돼지 유도 만능 줄기세포이다.
발명의 일 실시예에서, 상기 돼지 만능성 줄기세포 배양용 배지 조성물은 돼지 만능성 줄기세포의 지지세포 비의존적 배양에 사용될 수 있다.
발명의 일 실시예에서, 상기 지지세포 비의존적 배양은 세포외기질(Extracellular Matrix; ECM) 또는 매트리젤(Matrigel®) 또는 이의 대체제가 코팅된 배양용기에서 세포배양되는 것이다.
발명의 일 실시예에서, 상기 지지세포 비의존적 배양은 피브로넥틴, 라미닌, 폴리-L-리신, 1형 콜라겐 또는 매트리젤(Matrigel®)이 코팅된 배양용기에서 세포를 배양하는 것이다.
발명의 일 실시예에서, 상기 돼지 만능성 줄기세포 배양용 배지 조성물에는, FGF2, 액티빈 A(Activin A), 및 CHIR99021이 추가로 포함될 수 있다.
발명의 일 실시예에서, 상기 FGF2의 농도는 0.1 ng/ml 내지 100 ng/ml이고, 상기 액티빈 A의 농도는 0.1 ng/ml 내지 10 ng/ml이고, 상기 CHIR99021의 농도는 0.1 내지 4.5 μM이고, 상기 IWR-1의 농도는 0.1 μM 내지 5 μM 일 수 있다.
발명의 일 실시예에서, 상기 돼지 만능성 줄기세포 배양용 배지 조성물은 돼지 만능성 줄기세포의 증식을 촉진하고, 세포 사멸을 저해한다.
발명의 일 실시예에서, 상기 돼지 만능성 줄기세포 배양용 배지 조성물은 돼지 만능성 줄기세포 콜로니의 숫자를 증가시키고, 콜로니의 크기를 증가시킨다.
발명의 일 실시예에서, 상기 돼지 만능성 줄기세포 배양용 배지 조성물은 돼지 만능성 줄기세포의 줄기세포능/전분화능을 강화시킨다.
발명의 일 실시예에서, 상기 돼지 만능성 줄기세포 배양용 배지 조성물은 무혈청 또는 혈청성분을 0.1 내지 3 중량%를 함유할 수 있다.
발명의 일 실시예에서, LDN-193189를 유효성분으로 포함하는 돼지 만능성 줄기세포 배양액 첨가용 조성물을 제공한다.
발명의 일 실시예에서, 상기 돼지 만능성 줄기세포 배양액 첨가용 조성물에서 상기 LDN-193189는 10 nM 내지 1000 nM의 농도로 포함될 수 있다.
본 발명은 본 발명의 돼지 만능성 줄기세포 배양용 배지 조성물을 돼지 만능성 줄기세포에 처리하여 배양하는 단계를 포함하고, 상기 돼지 만능성 줄기세포는 돼지 배아 줄기세포 또는 돼지 유도만능 줄기세포인 것인, 돼지 만능성 줄기세포 배양 방법을 제공한다.
발명의 일 실시예에서, 돼지 만능성 줄기세포 배양 방법은 지지세포 비의존적으로 배양할 수 있다.
발명의 일 실시예에서, 상기 지지세포 비의존적 배양 방법은 세포외기질(Extracellular Matrix; ECM) 또는 매트리젤(Matrigel)이 코팅된 배양용기에서 세포를 배양할 수 있다.
발명의 일 실시예에서, 상기 지지세포 비의존적 배양은 피브로넥틴, 라미닌, 폴리-L-리신, 1형 콜라겐 또는 매트리젤(Matrigel)이 코팅된 배양용기에서 세포를 배양할 수 있다.
상기 세포외기질은 피브로넥틴, 라미닌, 폴리-L-리신, 1형 콜라겐 외에 이 기술분야에서 통상적으로 사용되는 세포외기질을 포함할 수 있다.
본 발명의 돼지 만능성 줄기세포 배양용 배지 조성물에는 LDN-193189이 포함됨으로써, 돼지 만능성 줄기세포의 증식 또는 성장 촉진되고, 줄기세포 사멸이 저해되고, 줄기세포 콜로니의 숫자 및 크기가 증가되고, 줄기세포의 줄기세포능(stemness) 및 분화능이 강화되는 효과를 가진다.
본 발명의 돼지 만능성 줄기세포 배양용 배지 조성물에 있어서, LDN-193189는 줄기 세포 배양에 사용되는 배지에 첨가되어 사용될 수 있다.
상기 LDN-193189은 BMP(bone morphogenetic) pathway 저해제로서, ALK1, ALK2, ALK3, 및 ALK6를 저해한다고 알려져 있다. LDN-193189는 인간 만능성 줄기세포에서 신경 원시세포(neural progenitor cell) 또는 췌장세포로의 분화를 유도하는 것으로 알려져 있고, 마우스 만능성 줄기세포의 분화를 유도하는 것으로 알려져 있다.
하지만, 본 발명에서 상기 LDN-193189는 돼지 만능성 줄기세포의 줄기세포능/만능성을 유지하고, 분화를 억제하는 효과를 가진다는 것을 발견하였다. 이와 같은 효과는 기존의 LDN-193189의 효과와는 상반된 결과이고, 이는 배아 줄기세포의 종에 따라 줄기세포능을 유지하는 기전이 상이하고, 배아 줄기세포 배양용 배지 역시 상기 배아 줄기세포의 종에 따라 다르게 사용되어야 한다는 점을 나타내는 결과이다.
상기 돼지 만능성 배아 줄기세포 배양용 배지 조성물에 포함된 LDN-193189의 농도는 10 nM 내지 1000 nM이다. LDN-193189의 농도가 10 nM 미만인 경우 특별한 효과가 없으며, 1000 nM 초과의 경우 세포 독성을 보인다. 본 발명의 일 구현예에 따른 돼지 만능성 배아 줄기세포 배양용 배지 조성물에 포함된 LDN-193189은 100 nM의 농도이지만, 이에 제한되지 않는다.
본 발명의 돼지 만능성 줄기세포 배양용 배지 조성물은 추가적으로 FGF2, 액티빈 A, CHIR99021 및 IWR-1가 포함될 수 있다.
본 발명의 일 구현예에 따른 돼지 만능성 줄기세포 배양용 배지 조성물에 추가적으로 포함된 FGF2, 액티빈 A, CHIR99021 및 IWR-1은 각각 0.1 ng/ml 내지 100 ng/ml, 0.1 ng/ml 내지 10 ng/ml, 0.1 μM 내지 4.5 μM 및 0.1 μM 내지 5 μM의 농도를 가진다. FGF2의 농도가 0.1 ng/ml 미만인 경우 특별한 효과가 없으며, 100 ng/ml 초과인 경우 농도 증가에 따른 추가적인 효과가 없거나, 세포에 독성을 가진다. 액티빈 A의 농도가 0.1 ng/ml 미만인 경우 특별한 효과가 없으며, 10 ng/ml 초과인 경우 농도 증가에 따른 추가적인 효과가 없거나, 세포에 독성을 가진다. CHIR99021의 농도가 0.1 μM 미만인 경우 특별한 효과가 없으며, 4.5 μM 초과인 경우 세포에 독성을 가진다. IWR-1의 농도가 0.1 μM 미만인 경우 특별한 효과가 없으며, 5 μM 초과인 경우 농도 증가에 따른 추가적인 효과가 없거나 세포에 독성을 가진다. 본 발명의 일 구현예에 따른 돼지 만능성 줄기세포 배양용 배지 조성물에 포함된 FGF2, 액티빈 A, CHIR99021 및 IWR-1은 각각 20 ng/ml, 5 ng/ml, 0.5 μM 및 0.5 μM의 농도를 가지지만, 이에 제한되지 않는다.
본 발명의 돼지 만능성 줄기세포 배양용 배지의 기본배지는 이 기술분야의 통상의 기술자들에게 널리 알려진 배지라면 제한없이 사용될 수 있다. 상기 기본배지는 인위적으로 합성하여 제조할 수 있으며, 상업적으로 제조된 배지를 사용할 수 있다. 상업적으로 제조되는 배지의 예를 들면, DMEM(Dulbecco's Modified Eagle's Medium), MEM(Minimal Essential Medium), BME(Basal Medium Eagle), RPMI 1640, F-10, F-12, α-MEM(α-Minimal essential Medium), G-MEM(Glasgow's Minimal Essential Medium), IMDM(Isocove's Modified Dulbecco's Medium), DMEM/F-12를 사용할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 일 실시예에서는 DMEM/F-12 기본 배지를 사용한다.
본 발명의 배양용 배지 조성물에는 추가적으로, 박테리아, 곰팡이 등의 감염을 막기 위해 항생제, 항진균제 및/또는 마이코플라스마의 성장을 예방하는 해당 업계에서 일반적으로 사용하는 물질을 사용하는 것이 바람직하다. 항생제로는 페니실린-스트렙토마이신 등 통상적으로 세포배양에 사용되는 항생제를 모두 이용 가능하며, 항진균제로는 알포레리신 B, 마이코플라즈마 억제제로는 젠타마이신, 시프로플로사신, 아지트로마이신 등의 일반적으로 사용하는 물질을 사용할 수 있지만, 이에 제한되지 않는다. 또한, 시판되는 항생제-항진균제(antibiotic-antimycotic; AA)(Gibco)가 사용될 수 있다.
또한, 본 발명의 배양용 조성물에는 1% 글루타맥스(또는 글루타민)과 0.1 mM 베타-머캅토에탄올을 포함될 수 있다.
본 발명의 돼지 만능성 줄기세포 배양용 배지 조성물은 지지세포 비의존성 돼지 만능성 줄기세포 배양에 사용될 수 있다.
일반적으로 만능성 줄기세포 또는 배아 줄기세포 배양시 만능성 또는 줄기세포능을 유지하기 위해 마우스 섬유아세포 등의 지지세포를 사용하여 왔으나(지지세포 의존성 배양), 생체외 오염/세포간 편차 등의 문제점이 있어, 만능성 줄기세포의 대량 배양은 지지세포 비의존적으로 수행하려는 시도가 있어왔다. 하지만, 돼지 만능성 줄기세포의 경우 인간 배아 줄기세포에서 이용되는 지지세포 비의존성 배양 배지를 사용하는 경우, 만능성/줄기세포능이 유지되지 않았다. 하지만, 본 발명의 돼지 만능성 줄기세포 배양용 배지 조성물을 이용하는 경우 지지세포 없이도 돼지 만능성 줄기세포의 만능성/줄기세포능이 유지되는 것을 확인하였다.
또한, 본 발명의 돼지 만능성 줄기세포 배양용 배지 조성물은 무혈청 또는 또는 혈청 성분을 0.1 내지 3 중량％ 함유하는 것일 수 있다.
상기 무혈청 배지는 인간을 포함한 동물로부터 유래된 혈청(동물 유래 혈청)을 일정 함량 이상 함유하지 않는 임의의 배양 배지를 의미한다. 예를 들어, 무혈청 배지는 동물 유래 혈청을 총 조성물 함량 대비 0.1 중량% 미만 또는 0.01 중량% 미만으로 포함할 수 있으며, 구체적으로 동물 유래 혈청을 함유하지 않을 수 있다.
본 발명은 LDN-193189를 유효성분으로 포함하는 돼지 만능성 줄기세포 배양액 첨가액 조성물을 제공한다.
본 발명의 조성물의 이용으로 돼지 만능성 줄기세포를 안정적으로 증식 및 배양할 수 있고, 재현성 있는 시험 및 생산 공정의 확립이 가능하다.
또한, 본 발명은 본 발명의 돼지 만능성 줄기세포 배양용 배지 조성물을 돼지 만능성 줄기세포에 처리하여 배양하는 단계를 포함하는 돼지 만능성 줄기세포 배양 방법에 관한 것이다.
상기 돼지 만능성 줄기세포의 배양은 지지세포 비의존적인 방법으로 배양될 수 있으며, 이때 돼지 만능성 줄기세포는 세포외기질 또는 매트리젤(Matrigel®) 또는 이의 대체제(젤라틴, 콜라겐, 라미닌 피브로넥틴, 폴리-D-리신(poly-D-lysine), 폴리-L-리신(poly-L-lysine) 등)가 코팅된 배양 용기에서 배양될 수 있으나, 이에 제한되지 않는다.
달리 나타내지 않는 한, 본 명세서 및 청구범위에 사용된 모든 숫자는, 언급되었든지 아니든지, 모든 경우에 용어 “약”에 의해 수식될 수 있는 것으로 이해되어야 한다. 또한, 본 명세서 및 특허청구범위에 사용된 정밀한 수치는 본 개시내용의 추가적인 실시양태를 형성하는 것으로 이해되어야 한다. 실시예에 개시된 수치의 정확성을 보장하기 위해 노력을 기울였다. 그러나, 측정된 모든 수치는 내재적으로 이의 각각의 측정 기법에서 실측된 표준 편차로부터 생성된 특정 오차값을 함유할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1. 배양 배지에 따른 돼지 배아 줄기세포의 배양능 분석
실시예 1-1. 돼지 배아 줄기세포의 분리
동물의 관리 및 실험적 사용은 서울대학교 실험동물윤리위원회(IACUC)의 승인을 받았다(승인번호: SNU-191025-4-4 및 SNU-201019-1-2). 임신한 ICR 마우스와 흉선이 없는 누드 마우스는 각각 Samtaco Bio Inc.(한국) 및 OrientBio Inc.(한국)에서 구입하였다. 생쥐는 서울대학교 실험동물자원관리원의 표준 프로토콜에 따라 유지하였다.
배반포로부터 돼지 배아 줄기세포의 분리 및 생쥐 섬유아세포를 이용한 지지세포의 생산은 KR10-2142400의 방법으로 하였다.
실시예 1-2. 돼지 배아 줄기세포의 지지세포 의존적 배양
돼지 배아 줄기세포를 지지체포와 함께 배양하는데 사용되는 '배아 줄기세포 배양 배지'는 DMEM/F12 기반 배지로서 15 %(v/v) 녹아웃 혈청 대체제(Knock-out serum replacement; KSR), 0.1 %(v/v) 화학적으로 정의된 지질 농축액(Lipid concentrate, LC), 1X GlutaMAX®, 0.1 mM β-머캅토에탄올(β-mercaptoethanol), 1X MEM 비필수 아미노산, 및 1X 항생제-항진균제(antibiotics-antimycotics) (앞서 언급한 물질은 모두 Gibco, Gaithersburg, MD, USA에서 구입하였다), 20 ng/mL hrFGF2(fibroblast growth factor 2) (R&D Systems, Minneapolis, MN, USA), 5ng/mL ActA(액티빈; activin A)(R&D Systems), 1.5 μM CHIR99021(CH, Cayman Chemical, Ann Arbor, MI, USA) 및 2.5 μM IWR-1(Sigma-Aldrich, St. Louis, MO, USA)을 포함한다.
돼지 배아 줄기세포를 지지세포와 함께 5-7일마다 계대배양하였다. 계대배양 24시간 전에 돼지 배아 줄기세포를 10 μM Y-27632(Santa Cruz Biotechnology, Dallas, TX, USA)를 포함하는 앞서 언급한 '배아 줄기세포 배양 배지'로 배양하였다. 충분히 자란 배아 줄기세포 군집은 TrypLE® Express(Gibco)를 사용하여 작은 덩어리로 분리하였다. 이 세포 덩어리를 새로운 지지세포로 옮기고 10 μM Y-27632(Santa Cruz Biotechnology)를 포함하는 '배아 줄기세포 배양 배지'로 24시간 동안 배양한다. 24시간 후에 지지세포에 부착된 배아 줄기세포를 Y-27632를 포함하지 않는 '배아 줄기세포 배양 배지'로 4-6일 동안 배양한다. 배지는 24시간마다 교체되었고 5 % CO2, 37 ℃의 조건에서 배양하였다.
실시예 1-3. 돼지 배아 줄기세포의 지지세포 비의존적 배양
돼지 배아 줄기세포의 지지세포 비의존적 배양(feeder-free culture)을 위해, 지지세포에서 배양된 돼지 배아 줄기세포를 '지지세포 비의존적 배양을 위한 배아 줄기세포 배양 배지 (이하 'FF-배아 줄기세포 배양 배지')를 사용하여 1:5 ~ 1:10 분할 비율로 MatrixTM로 코팅된 배양접시(SPL Life Sciences, Pocheon, Korea)에서 배양하였다.
FF-배아 줄기세포 배양배지는 DMEM/F12 기반 배지로서 15 %(v/v) KSR, 0.1 %(v/v) LC, 1X 글루타맥스, 0.1 mM β-머캅토에탄올(β-mercaptoethanol), 1X MEM 비필수 아미노산, 및 20 ng/mL hrFGF2(R&D Systems), 5 ng/mL ActA(R&D Systems), 1.5 μM CHIR99021(CH, Cayman Chemical), 2.5 μM IWR-1(Sigma-Aldrich), 1X 항생제-항진균제(antibiotics-antimycotics, 앞서 언급한 물질은 모두 Gibco, Gaithersburg, MD, USA에서 구입하였다), 및 100 nM LDN-193189(Cayman Chemical)를 포함한다.
돼지 배아 줄기세포를 5-7일마다 계대배양하였다. 계대배양 24시간 전에 돼지배아 줄기세포를 10 μM Y-27632(Santa Cruz Biotechnology, Dallas, TX, USA)를 포함하는 'FF-배아 줄기세포 배양 배지'로 배양하였다. 다음으로, TrypLE® Express(Gibco)를 사용하여 배양된 줄기세포를 작은 덩어리로 분리하였다. 이 세포를 새로운 MatrixTM 코팅 플레이트로 옮기고 10 μM Y-27632(Santa Cruz Biotechnology)를 포함하는 'FF-배아 줄기세포 배양 배지'로 24시간 동안 배양하였다. 다음으로, 부착된 줄기세포를 Y-27632가 없는 'FF-배아 줄기세포 배양 배지'로 4-6일 동안 배양하였다. 배지는 24시간마다 교체하였고 5 % CO2, 37 ℃의 조건에서 배양하였다.
실시예 1-4. 돼지 배아 줄기세포의 지지세포 비의존적 배양에 있어서, LDN-193189 효과 분석 (세포 형태 분석)
돼지 배아 줄기세포의 지지세포 비의존적 배양에 있어서, ALK2/3 억제제인 LDN-193189의 영향을 분석하기 위해 Annexin V 염색을 통한 LDN-193189 세포 독성을 확인하였다 (도 1). LDN-193189 처리의 최적 농도를 찾기 위하여 농도에 따른 세포독성 실험을 진행하였고, Annexin V 염색은 1000 nM 이상의 LDN-193189에서 높은 세포독성이 있음을 보여주었다. 또한 1000 nM 이상의 농도에서 24시간 이상의 처리는 대부분의 세포의 사멸을 유도하였다.
실시예 1-5. 돼지 배아 줄기세포의 지지세포 비의존적 배양에 있어서, LDN-193189 처리 효과 분석 (유전자 발현 분석)
배양 기간에 따른 만능성 관련 유전자, 분화 관련 유전자 등의 발현양을 분석하기 위해 돼지 배아 줄기세포를 지지세포 없이 100 nM LDN-193189을 포함하는 'FF-배아 줄기세포 배양 배지'(ff-ESCsLDN+), 및 LDN-193189을 포함하지 않는 'FF-배아 줄기세포 배양 배지'(ff-ESCsLDN-)를 이용하여 배양하였고, 대조군으로 돼지 배아 줄기세포를 지지세포와 함께 앞서 언급한 배아 줄기세포 배양 배지(Control ESCs)를 이용하여 배양하였다.
각각의 배지를 이용한 플레이팅 후 2일, 4일, 6일째 되는 날 세포를 수득하였다. Total RNA는 TRIzol 시약 (Invitrogen, Carlsbad, USA)을 사용하여 추출하고 cDNA는 High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, USA)를 사용하여 합성했다. cDNA는 표 1에 나열된 프라이머 세트와 DyNAmo HS SYBR Green qPCR 키트 (Thermo Fisher Scientific, Waltham, USA)를 사용하여 증폭하였다.
Species Genes Sequences Annealing Tm (℃) Size (bp)
Pig OCT4a 5'- CTTGGAGAGCCCTGGTTTTACT -3' 64 159
5'- GCCAGGTCCGAGGATCAAC -3'
SOX2 5'- CGGCGGTGGCAACTCTAC -3' 64 100
5'- TCGGGACCACACCATGAAAG -3'
NANOG 5'- CATCTGCTGAGACCCTCGAC -3' 60 195
5'- GGGTCTGCGAGAACACAGTT -3'
CDX2 5'- GCCAAGTGAAAACCAGGACGA -3' 60 120
5'- GCTCGGCCTTTCTCCGAATG -3'
TEAD4 5'- GTCGGCGCAAGATCATCCTA -3' 60 159
5'- CCTGGATCTCACGGGCTTTT -3'
EOMES 5'- CCAACCACGTCTGCACATTG -3' 60 206
5'- AAGCGGTGTACATGGAGTCG -3'
T 5'- CTGTGAGAGGTATCCTGCCCT -3' 64 184
5'- GGGACTCATGGGAAACATGC -3'
BMP2 5'- GAAGGAAGGGAACCCGGTC -3' 60 84
5'- CGGGGACACGTCCATTGAAA -3'
BMP4 5'- CGTTGGTCTCGAGTATCCCG -3' 60 106
5'- AGAGTTTTCGCTGGTCCCTG -3'
BMP7 5'- ACTTCGACGACAGCTCCAAC -3' 60 200
5'- AAATACCCTCACACGCCTGC -3'
PAX6 5'- AGAGAAGACAGGCCAGCAAC -3' 60 169
5'- GGCAGAGCACTGTAGGTGTT -3'
AMY2 5'- TGCTCTTGAATGTGAGCGGT -3' 60 206
5'- TACGGACGCCAACGTTGTTA -3'
GAPDH 5'- TGCTCCTCCCCGTTCGAC -3' 60 100
5'- ATGCGGCCAAATCCGTTC -3'
도 2에서와 같이, 지지세포 비의존적 배양시, 돼지 배아줄기세포의 특성 변화를 확인하였다. 도 2A는 만능성 유전자 및 SMAD 신호전달체계의 면역학적 염색을 나타낸 결과이고, 도 2B는 지지세포에서 분비되는 SMAD 신호전달체계 관련 유전자의 발현량을 나타낸 결과이다.
돼지 배아줄기세포를 배양할 때 필수적인 지지세포를 제거를 하면 줄기세포능을 잃고 다른 세포로 분화가 유도된다. 초기배아의 경우 중배엽성 조직으로 분화가 되도록 프로그래밍이 되어있어 이에 관여하는 신호전달체계중에 하나인 SMAD 신호전달 단백질의 발현을 확인하였다. 줄기세포의 증식에 관여하는 phosphor-SMAD2/3 단백질 외에도 분화에 관여하는 phosphor-SMAD1/5 단백질의 발현이 확인되었다. 실제로 배아줄기세포의 만능성 유지에 관여하는 지지세포에서 이 신호전달체계의 활성을 억제하는 다양한 유전자들 (Grem1, Grem2, Chrd, Nog)이 발현하는 것을 확인하였다(도 2A 2B).
또한, 도 2C 및 도 2D에서와 같이, SMAD1/5 신호전달 체계의 억제인 LDN-193189 (250 nM)의 처리가 돼지 배아줄기세포의 지지세포 비의존적 배양에 미치는 영향을 확인하였다.
지지세포에서 분비되는 SMAD1/5 신호전달체계의 억제 유전자가 돼지 배아줄기세포의 만능성 유지에 도움을 준다는 가설을 입증하기 위하여 SMAD1/5 신호전달체계 억제제인 LDN-193189를 지지세포가 없이 배양된 돼지 배아줄기세포에 처리하였다. 그 결과, 지지세포를 제거하였을 때 변화하였던 만능성 및 중배엽성 조직 발달에 관여하는 유전자가 지지세포위에서 배양한 수준으로 회복되는 것을 확인하였다.
실시예 2. 돼지 배아 줄기세포의 지지세포 비의존적 배양에 있어서, LDN-193189의 최적의 농도 및 FGF2, Activin 2 및 CHIR99021의 농도별 영향 분석
실시예 2-1. LDN-193189의 최적의 농도 분석
100 nM 내지 1000 nM 사이에서 LDN-193189를 포함하는 'FF-배아 줄기세포 배양 배지'의 최적의 농도를 확인하기 위하여 농도를 세분화하여 annexin V 염색을 진행하였다(도 3A). 750 nM 이상의 농도에서는 세포사멸율이 유의적으로 증가하는 것을 확인하였다(도 3B). Ki-67 염색 결과는 100 nM 내지 1000 nM 사이의 유의적인 차이는 보이지 않았지만(도 3D), WST-8 결과는 500 nM 이상의 농도에서 유의적인 세포 활성 감소를 확인하였다(도 3C). 실제로 LDN-193189는 높은 농도에서 LDN-193189는 줄기세포의 증식에 관여하는 Activin A 신호전달체계를 억제한다고 알려져있다. 따라서 최종 처리농도는 BMP 신호전달 체계만을 억제하고 세포 독성이 존재하지 않는 최대 농도인 100 nM로 확정하였다.
실시예 2-2. FGF2, Activin 2 및 CHIR99021의 농도별 분석
배양액에 포함되는 신호전달 물질의 농도 최적화를 위해, FGF2, Activin A, CHIR99021 및 IWR-1의 물질을 다양한 농도로 처리하였다(도 4A 및 4B). 도 4A는 Ki-67 염색을 통한 증식율을 확인한 결과이고, 도 4B는 WST-8 assay를 통해 세포활성을 확인한 결과이다.
Ki-67 염색을 통한 증식율을 확인한 결과, FGF2는 농도가 증가함에 따라 세포분열중인 세포의 비율이 점진적으로 증가하였다. 그러나, WST-8 assay를 통해 세포 증식과 세포독성을 동시에 측정한 결과, 100 ng/ml 이상의 농도에서는 세포독성으로 인해 세포 활성이 감소하는 것을 확인하였다.
Activin A는 Ki-67 염색 및 WST-8 assay의 결과에서 모두 10 ng/ml 이상의 농도에서는 세포독성 및 증식률이 저하되는 것을 확인하였다. 따라서, Activin A의 최적의 농도는 1 ng/ml 내지 5 ng/ml임을 확인하였다.
CHIR99021의 증식률은 CHIR99021을 처리하지 않은 그룹과 비교하면, 농도가 증가함에 따라 점진적으로 감소하였다. 하지만 WST-8의 결과는 0.1 μM 내지 0.5 μM의 농도로 해당 물질을 처리하였을 때 줄기세포의 활성 및 증식율이 개선되는 것을 확인하였다.
IWR-1은 농도가 증가할수록 분열중인 세포의 비율이 점진적으로 증가하였다. 하지만 IWR-1의 높은 농도에서 세포 독성을 보여 0.5 μM의 농도로 처리하였을 때 가장 높은 세포 활성을 보였다.
실시예 3. 지지세포 없이 배양된 돼지 배아 줄기세포의 특성화(characterization)
지지세포 없이 배양된 돼지 배아 줄기세포의 면역 세포화학 분석을 위해, 세포 샘플을 4 ℃에서 10분 동안 방치하고 30분 동안 4%(w/v) 파라포름알데히드에서 고정했다. DPBS(Dulbecco's phosphate buffered saline)로 2회 세척한 후, 샘플을 비특이적 결합 방지를 위해 염소 혈청(goat serum) 10%(v/v)이 포함된 DPBS으로 1시간 동안 처리하였다. 혈청 처리된 세포는 OCT4(1:200; SC-9081, Santa Cruz Biotechnology), SOX2(1:200; AB5603, Millipore, Billerica, MA, USA), NANOG(1:200; 500-P236, Peprotech, NJ, USA), SSEA1(1:200; MAB4301, Millipore) 및 SSEA4(1:200; MAB4304, Millipore)로 면역세포화학 분석을 진행하였다. 핵 단백질(예: OCT4, SOX2 및 NANOG)의 경우 항체를 적용하기 전 고정된 세포를 혈청 처리 전에 0.1%(v/v) Triton X-100(Sigma-Aldrich)으로 15분 동안 처리하였다. 1차 항체를 처리한 후, Alexa Fluor-conjugated 2차 항체를 실온에서 3시간 동안 처리하였다. 세포의 핵은 Hoechst 33342(Molecular Probes, Eugene, OR, USA)로 확인하였다. 실험결과는 도립 형광 현미경(Eclipse TE2000-U, Nikon, Konan, Japan)을 사용하여 염색된 세포의 이미지를 시각화하였다.
알칼리성 인산분해효소 (alkaline phosphatase, AP) 염색을 위해 세포를 30분 동안 4%(w/v) 파라포름알데히드에 고정시키고 nitro blue tetrazolium chloride와 5-bromo-4-chloro-3-indolyl phosphate toluidine salt stock solution(Roche, Basel, Switzerland)을 포함하는 완충용액으로 상온에서 30분간 세포를 염색하였다. 염색된 세포를 도립 현미경으로 시각화하였다.
지지세포 없이 매트리젤® 코팅된 배양 용기에서 LDN-193189가 포함된 “배아 줄기세포 배양 배지”를 처리하여 배양한 돼지 배아 줄기세포의 군집의 모습은 지지세포와 함께 배양된 돼지 배아 줄기세포의 군집과 유사하게 편평한 단층이었며, 높은 핵 대 세포질 비율을 갖는 상피세포 형태 즉, 전형적인 배아 줄기세포의 형태를 나타냈다(도면 5A). 또한, 지지세포 없이 배양된 줄기세포는 정상 핵형(36+XX)을 가지고(도 5B), 장기 배양(10회 계대 이상) 동안 안정적으로 유지되었다.
지지세포 없이 배양된 줄기세포는 알칼리성 인산분해효소(alkaline phosphatase) 활성을 나타내었고(도 5A 하단), 지지세포와 함께 배양된 돼지 배아 줄기세포와 마찬가지로 OCT4, SOX2, NANOG, SSEA1 및 SSEA4와 같은 만능성 표지인자(단백질)를 발현했다(도 5C). qPCR 분석은 돼지 배아 줄기세포가 지지세포 없이 장기간 배양하는 동안 OCT4, SOX2 및 NANOG와 같은 만능성 관련 유전자와 영양막 분화 관련 유전자가 대조군 돼지 배아 줄기세포의 유전자와 비교하여 안정적으로 발현되었음을 보여주었다(도 5D).
(IVF-ES-11, PG-ES-3: 돼지 배아줄기세포주, W/ feeder : 지지세포위에서 배양한 그룹, W/O feeder: 지지세포 비의존적 배양 그룹)
실시예 4. 배양 배지에 따른 돼지 배아 줄기세포의 분화능 분석
실시예 4-1. 배아체(Embryoid Body)법을 사용한 돼지 배아 줄기세포의 분화 유도
지지세포 없이 배양된 배아 줄기세포를 TrypLE Express(Gibco)를 사용하여 단일 세포로 분리하고 5일 동안 다른 사이토카인이 포함되지 않은 15 %(v/v) FBS 및 10 μM Y-27632(1일차에만 처리)를 포함하는 DMEM을 이용하여 부유 배양하였다. 부유 배양 후, 해리된 세포가 응집되어 배아체를 형성하였고, 이를 0.1 %(w/v) 젤라틴이 코팅된 배양접시에서 15 %(v/v) FBS를 함유하는 DMEM을 통해 2-3주 동안 부착배양하였다.
지지세포 없이 배양한 돼지 배아 줄기세포는 부유배양을 통해 배아체를 형성하였고, 이어서 배양 접시에 부착하여 자발적으로 분화되었다(도 6A). 체외 분화를 통해 돼지 배아 줄기세포는 3개의 생식층(germ layer) 마커(PAX6[외배엽], AMY2[내배엽], BMP4[중배엽])가 높게 발현을 하였지만, 만능성 마커 유전자는 qPCR에 의해 분석된 바와 같이 점진적으로 하향 조절되었다(도 6B).
(IVF-ES-11, PG-ES-3: 돼지 배아 줄기세포주, ESC: 배아 줄기세포, Ebs: 배아체, Diff. 배양 접시 부착에 의해 체외분화된 배아체)
실시예 5. 기형종 형성 분석
지지세포 없이 배양된 돼지 배아 줄기세포 약 5-10 Х 106 개를 50 %(v/v) BD Matrigel Matrix(BD Biosciences, Franklin Lakes, NJ, USA) 및 10 μM Y-27632를 포함하는 200 μL의 '배아 줄기세포 배양 배지'에 재현탁시켰다. 다음으로, 재현탁된 돼지 줄기세포를 5주령 무흉선 누드 마우스(athymic nude mice, OrientBio)의 피하에 주사하였다. 이식 후 2-3개월 후 1-2 cm 기형종을 채취하여 4 %(w/v) 파라포름알데히드에 고정하고 파라핀에 포매한 후 광학현미경 검사를 위해 헤마톡실린과 에오신으로 염색하였다.
그 결과, 지지세포가 없이 배양된 돼지 배아 줄기세포가 면역이 결핍된 생쥐(누드마우스)의 피하에 이식하면 기형종으로 분화되었음을 반복적으로 확인했다. 기형종은 조직학적으로 3개의 배엽층을 나타내는 다양한 조직으로 구성되었다(도 7). 따라서, 지지세포 없이 배양된 돼지 배아 줄기세포도 다능성 분화능(외배엽, 중배엽, 내배엽)을 가진다는 점을 확인하였다.
실시예 6. 다양한 세포외기질에서 배양액 분석
돼지 배아줄기세포의 지지체 비의존적 배양을 위한 배양배지의 다양한 세포외기질(ECM: extracellular matrix)에서의 활용 가능성을 평가하기 위하여 피브로넥틴, 라미닌, 폴리-L-리신, 1형 콜라겐으로 코팅된 세포배양접시에서 줄기세포의 배양을 시도하였다. 도 8은 다양한 세포외기질로서 피브로넥틴, 라미닌, 폴리-L-리신 또는 1형 콜라겐에서 배양한 돼지 배아줄기세포의 배양을 나타낸 결과이다.
만능성 표지인자인 NANOG와 SSEA4를 면역학적 염색법을 통해 확인한 결과, 세포외기질에 따른 세포의 만능성과 증식능과 같은 특성의 편차는 존재하였지만, 새로운 배양액을 이용하여 다양한 기질위에서 돼지 배아줄기세포의 특성 유지가 가능함을 확인하였다.
실시예 7. 소태아혈청(FBS)을 포함하는 배양 조건 분석
혈청대체제인 KSR이 포함된 배지에서 LDN-193189의 처리가 돼지 배아줄기세포의 지지세포 비의존적 배양에 효과가 있는 것을 확인하였다.
추가적으로 혈청대체제가 아닌 소태아혈청 (FBS; fetal bovine serum)이 포함된 배양액에서 해당 물질이 돼지 배아줄기세포의 만능성 유지에 도움이 되는지 확인하였다. 도 9는 KSR을 FBS로 대체한 배양액에서 LDN-193189의 기능을 분석한 결과로서, 도 9A는 만능성 표지 인자 NANOG와 SSEA4를 통한 돼지 배아줄기세포의 특성을 분석(흰색 점선 테두리: 분화된 부분)한 결과이고, 도 9B는 FBS가 포함된 배양배지에서 LDN-193189의 처리 여부에 따른 만능성 및 중배엽성 조직 발달 관련 유전자의 발현 변화를 나타낸 결과이다.
만능성 표지인자인 NANOG와 SSEA4를 면역학적 염색법을 통해 확인한 결과, FBS가 포함된 배양액은 돼지 배아줄기세포의 분화를 유도하여 NANOG 및 SSEA4의 발현이 감소한 세포 군집이 다수 발견이 되었다. 이러한 현상은 LDN-193189의 처리를 통해 완화되는 것을 확인하였고, qPCR 분석은 FBS가 포함된 환경내에서 LDN-193189의 처리를 통해 중배엽 관련 유전자의 발현을 감소시켜 줄기세포의 만능성 유지에 도움을 주는 결과를 보여주었다.
실시예 8. 지지 세포가 존재하는 배양조건에서의 활용 가능성 확인
LDN-193189가 포함된 지지세포 비의존적 배양을 위한 배지의 지지세포 위에서 키운 돼지 배아줄기세포에 대한 영향을 확인하였다.
도 10은 LDN-193189의 지지세포 위에서 키운 돼지 배아줄기세포에 대한 효과를 나타낸 결과로서, 도 10A는 LDN-193189 를 처리한 지지세포 상에서 키운 돼지 배아줄기세포의 만능성 표지인자 (NANOG, SSEA4)의 발현 (흰색 점선 테두리: 분화된 세포 군집)을 나타낸 결과이고, 도 10B는 phosphor-SMAD1/5의 발현에 대한 LDN-193189의 효과를 나타낸 결과이고, 도 10C는 phosphor-SMAD2/3의 발현에 대한 LDN-193189의 효과를 나타낸 결과이고, 도 10D는 qPCR을 통한 LDN-193189를 처리한 지지세포 상에서 키운 돼지 배아줄기세포의 만능성 및 중배엽성 조직 발달 관련 유전자의 발현 확인한 결과이다.
LDN-193189의 처리는 지지세포 위에서 키운 돼지 배아줄기세포의 자발적 분화를 감소시키고, SSEA4 표지인자의 발현을 강화시켰다. 이는 중배엽성 분화에 관여하는 SMAD1/5 신호전달 체계를 억제하고 줄기세포의 증식에 관여하는 SMAD2/3 신호전달을 활성화시키기 때문으로 추측된다. 또한, qPCR 분석은 LDN-193189의 처리는 다양한 중배엽성 조직 발달에 관여하는 유전자의 발현을 감소시키는 것으로 확인되었다.

Claims (18)

  1. 돼지 만능성 줄기세포 배양용 배지 조성물에 있어서, LDN-193189를 포함하는 돼지 만능성 줄기세포 배양용 배지 조성물.
  2. 제1항에 있어서,
    상기 LDN-193189는 10 nM 내지 1000 nM의 농도인 것인, 돼지 만능성 줄기세포 배양용 배지 조성물.
  3. 제1항에 있어서,
    상기 돼지 만능성 줄기세포는 돼지 배아 줄기세포 또는 돼지 유도 만능 줄기세포인 것인, 돼지 만능성 줄기세포 배양용 배지 조성물.
  4. 제1항에 있어서,
    상기 돼지 만능성 줄기세포 배양용 배지 조성물은 지지세포 비의존적 배양에 사용하기 위한, 돼지 만능성 줄기세포 배양용 배지 조성물.
  5. 제4항에 있어서,
    상기 지지세포 비의존적 배양은 세포외기질(Extracellular Matrix; ECM) 또는 매트리젤(Matrigel®)이 코팅된 배양용기에서 세포를 배양하는 것인, 돼지 만능성 줄기세포 배양용 배지 조성물.
  6. 제5항에 있어서,
    상기 지지세포 비의존적 배양은 피브로넥틴, 라미닌, 폴리-L-리신, 1형 콜라겐 또는 매트리젤(Matrigel®)이 코팅된 배양용기에서 세포를 배양하는 것인, 돼지 만능성 줄기세포 배양용 배지 조성물.
  7. 제1항에 있어서,
    상기 돼지 만능성 줄기세포 배양용 배지 조성물에는, FGF2, 액티빈 A(Activin A), CHIR99021 및 IWR-1이 추가로 포함하는 돼지 만능성 줄기세포 배양용 배지 조성물.
  8. 제7항에 있어서,
    상기 FGF2의 농도는 0.1 ng/ml 내지 100 ng/ml이고, 상기 액티빈 A의 농도는 0.1 ng/ml 내지 10 ng/ml이고, 상기 CHIR99021의 농도는 0.1 μM 내지 4.5 μM이고, 상기 IWR-1의 농도는 0.1 μM 내지 5 μM인, 돼지 만능성 줄기세포 배양용 배지 조성물.
  9. 제1항에 있어서,
    상기 돼지 만능성 줄기세포 배양용 배지 조성물은 줄기세포의 증식을 촉진하고, 세포 사멸을 저해하는 것을 특징으로 하는, 돼지 만능성 줄기세포 배양용 배지 조성물.
  10. 제1항에 있어서,
    상기 돼지 만능성 줄기세포 배양용 배지 조성물은 줄기세포 콜로니의 숫자를 증가시키고, 콜로니의 크기를 증가시키는 것을 특징으로 하는, 돼지 만능성 줄기세포 배양용 배지 조성물.
  11. 제1항에 있어서,
    상기 돼지 만능성 줄기세포 배양용 배지 조성물은 줄기세포의 줄기세포능/전분화능을 강화하는 것을 특징으로 하는, 돼지 만능성 줄기세포 배양용 배지 조성물.
  12. 제1항에 있어서,
    상기 돼지 만능성 줄기세포 배양용 배지 조성물은 무혈청 또는 혈청성분을 0.1 내지 3 중량%를 함유하는 것을 특징으로 하는, 돼지 만능성 줄기세포 배양용 배지 조성물.
  13. 돼지 만능성 줄기세포 배양액 첨가용 조성물에 있어서, 상기 조성물은 LDN-193189를 유효성분으로 포함하는 돼지 만능성 줄기세포 배양액 첨가용 조성물.
  14. 제13항에 있어서,
    상기 LDN-193189는 10 nM 내지 1000 nM의 농도인 것을 특징으로 하는, 돼지 만능성 줄기세포 배양액 첨가용 조성물.
  15. 제1항의 돼지 만능성 줄기세포 배양용 배지 조성물을 돼지 만능성 줄기세포에 처리하여 배양하는 단계를 포함하고,
    상기 돼지 만능성 줄기세포는 돼지 배아 줄기세포 또는 돼지 유도만능 줄기세포인 것인, 돼지 만능성 줄기세포 배양 방법.
  16. 제15항에 있어서,
    상기 배양방법은 지지세포 비의존적으로 배양하는 것을 특징으로 하는, 돼지 만능성 줄기세포 배양 방법.
  17. 제16항에 있어서,
    상기 지지세포 비의존적 배양은 세포외기질(Extracellular Matrix; ECM) 또는 매트리젤(Matrigel)이 코팅된 배양용기에서 세포를 배양하는 것인, 돼지 만능성 줄기세포 배양 방법.
  18. 제17항에 있어서,
    상기 지지세포 비의존적 배양은 피브로넥틴, 라미닌, 폴리-L-리신, 1형 콜라겐 또는 매트리젤(Matrigel)이 코팅된 배양용기에서 세포를 배양하는 것인, 돼지 만능성 줄기세포 배양 방법.
PCT/KR2023/003393 2022-03-14 2023-03-14 돼지 만능성 줄기세포 배양용 배지 조성물 WO2023177181A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2022-0031249 2022-03-14
KR20220031249 2022-03-14
KR10-2023-0032368 2023-03-13
KR1020230032368A KR102581040B1 (ko) 2022-03-14 2023-03-13 돼지 만능성 줄기세포 배양용 배지 조성물

Publications (1)

Publication Number Publication Date
WO2023177181A1 true WO2023177181A1 (ko) 2023-09-21

Family

ID=88024028

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/003393 WO2023177181A1 (ko) 2022-03-14 2023-03-14 돼지 만능성 줄기세포 배양용 배지 조성물

Country Status (1)

Country Link
WO (1) WO2023177181A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105814192A (zh) * 2013-10-09 2016-07-27 加利福尼亚大学董事会 哺乳动物视网膜干细胞产生方法和应用
KR102142400B1 (ko) * 2018-06-19 2020-08-07 서울대학교산학협력단 돼지 만능성 줄기세포 배양용 배지 조성물

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105814192A (zh) * 2013-10-09 2016-07-27 加利福尼亚大学董事会 哺乳动物视网膜干细胞产生方法和应用
KR102142400B1 (ko) * 2018-06-19 2020-08-07 서울대학교산학협력단 돼지 만능성 줄기세포 배양용 배지 조성물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
KIM EUNHYE, KIM MIRAE, HWANG SEON‐UNG, KIM JONGPIL, LEE GABSANG, PARK YOUNG SEOK, HYUN SANG‐HWAN: "Neural induction of porcine‐induced pluripotent stem cells and further differentiation using glioblastoma‐cultured medium", JOURNAL OF CELLULAR AND MOLECULAR MEDICINE, UNIVERSITY PRESS CAROL DAVILA, BUCHAREST, RO, vol. 23, no. 3, 1 March 2019 (2019-03-01), RO , pages 2052 - 2063, XP093093134, ISSN: 1582-1838, DOI: 10.1111/jcmm.14111 *
KINOSHITA MASAKI, KOBAYASHI TOSHIHIRO, PLANELLS BENJAMIN, KLISCH DORIS, SPINDLOW DANIEL, MASAKI HIDEKI, BORNELÖV SUSANNE, STIRPARO: "Pluripotent stem cells related to embryonic disc exhibit common self-renewal requirements in diverse livestock species", DEVELOPMENT, THE COMPANY OF BIOLOGISTS LTD., GB, vol. 148, no. 23, 1 December 2021 (2021-12-01), GB , XP093093133, ISSN: 0950-1991, DOI: 10.1242/dev.199901 *
YUAN YE, PARK JINKYU, TIAN YUCHEN, CHOI JUNGMIN, PASQUARIELLO ROLANDO, ALEXENKO ANDREI P., DAI AIHUA, BEHURA SUSANTA K., ROBERTS R: "A six-inhibitor culture medium for improving naïve-type pluripotency of porcine pluripotent stem cells", CELL DEATH DISCOVERY, vol. 5, no. 1, XP093093130, DOI: 10.1038/s41420-019-0184-4 *

Similar Documents

Publication Publication Date Title
Huang et al. The in vitro generation of lung and airway progenitor cells from human pluripotent stem cells
US10266807B2 (en) Methods and compositions for culturing endoderm progenitor cells in suspension
JP2022097516A (ja) 単細胞選別のための細胞培養プラットホームおよびｉＰＳＣの再プログラミングの増強
US10047341B2 (en) Generation of keratinocytes from pluripotent stem cells and maintenance of keratinocyte cultures
IL224431A (en) Basic media is simplified into multi-potential human cell culture
EP2527426A1 (en) Isolation, characterization and propagation of germline stem cells
Gu et al. Rapid conversion of human ESCs into mouse ESC-like pluripotent state by optimizing culture conditions
WO2020130713A1 (ko) 인간 줄기세포 유래 폐포 대식세포를 포함하는 3차원 폐 오가노이드의 제조방법
Esmaeilian et al. Putative germline and pluripotent stem cells in adult mouse ovary and their in vitro differentiation potential into oocyte-like and somatic cells
WO2015125926A1 (ja) 栄養膜幹細胞の樹立及び維持方法
WO2023177181A1 (ko) 돼지 만능성 줄기세포 배양용 배지 조성물
WO2019147025A1 (ko) Rad51 활성화제를 포함하는, 배아 발달용 조성물 및 이를 이용하여 배아 발달률을 향상시키는 방법
Chen et al. Mouse primed embryonic stem cells could be maintained and reprogrammed on human amnion epithelial cells
KR102581040B1 (ko) 돼지 만능성 줄기세포 배양용 배지 조성물
WO2018124605A1 (ko) 기형종 형성이 억제된 전분화능 줄기세포 유래 신경 전구체구의 제조 방법
WO2021002554A1 (ko) Cp1p 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 줄기세포 증식 촉진용 조성물
JP2023501003A (ja) 無血清ヒト多能性幹細胞培養培地
Elham et al. The roles of the co-culture of mEScs with pancreatic islets and liver stromal cells in the differentiation of definitive endoderm cells
KR102455288B1 (ko) 신경구로부터의 생식선 줄기세포로의 전환방법 및 이의 용도
Ahn et al. Development of reproducible and scalable culture conditions for in vitro maintenance of pig Embryonic stem cells using the Sandoz inbred Swiss mouse thioguanine-resistant ouabain-resistant cell line as a feeder layer
Malolina et al. Creation of a Model of Co-Culturing of Sertoli-Like Mouse Cells with Spermatogonial Cells
WO2021060637A1 (ko) 줄기세포로부터 도파민 신경전구세포 분화 유도 방법
Ghasemi Hamidabadi et al. Expression of Spermatogonial and Pluripotency Markers in Spermatogonial Stem Cells after Treatment with Different Culture Factors
Zonooz et al. Protocol-dependent morphological changes in human embryonic stem cell aggregates during differentiation towards early pancreatic fate
WO2020085527A1 (ko) 소포체 스트레스 완화제를 이용한 생체 외 배양 간세포 제조방법 및 이를 통해 마련된 생체 외 배양 간세포

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23771060

Country of ref document: EP

Kind code of ref document: A1