WO2023164698A2 - Engageurs de lymphocytes t bi-spécifiques ciblant le récepteur alpha de folate et leurs utilisations - Google Patents

Engageurs de lymphocytes t bi-spécifiques ciblant le récepteur alpha de folate et leurs utilisations Download PDF

Info

Publication number
WO2023164698A2
WO2023164698A2 PCT/US2023/063359 US2023063359W WO2023164698A2 WO 2023164698 A2 WO2023164698 A2 WO 2023164698A2 US 2023063359 W US2023063359 W US 2023063359W WO 2023164698 A2 WO2023164698 A2 WO 2023164698A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
human
bite
tumor
Prior art date
Application number
PCT/US2023/063359
Other languages
English (en)
Other versions
WO2023164698A3 (fr
Inventor
Kunle Odunsi
Robert MCGRAY
Takemasa Tsuji
Original Assignee
Health Research, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Health Research, Inc. filed Critical Health Research, Inc.
Publication of WO2023164698A2 publication Critical patent/WO2023164698A2/fr
Publication of WO2023164698A3 publication Critical patent/WO2023164698A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • A61K2239/59—Reproductive system, e.g. uterus, ovaries, cervix or testes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2302—Interleukin-2 (IL-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2307—Interleukin-7 (IL-7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20—Cytokines; Chemokines
    • C12N2501/23—Interleukins [IL]
    • C12N2501/2315—Interleukin-15 (IL-15)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells

Definitions

  • ACT adoptive T cell transfer
  • TILs autologous tumor-infiltrating T cells
  • TIL abundance correlates with improved survival in OC 8
  • recent evidence suggests most CD8+ TILs in OC patient tumors do not recognize cancer cells 9 , instead comprised predominantly of bystander TILs 10 .
  • Bystander TILs do not upregulate inhibitory receptors and persist as functional effector T cells n . Therefore, ACT-based approaches that effectively engage and mechanistically redirect bystander TILs for antitumor immunity are likely to overcome local immune suppression and enhance tumor attack.
  • Bispecific T cell engagers can redirect T cells for antigen-specific targeting 12 and are currently in development for OC 13-15 .
  • conventional BiTEs have an intrinsically short circulating half-life 16 , necessitating repeated or continuous infusion to achieve therapeutic BiTE exposure, in addition to a prerequisite for adequate intratumoral T cell availability to elicit responses 17 .
  • generating BiTE- secreting T cells (BiTE-T cells) has emerged as a promising modality 18-21 , where unlike conventional CAR- or TCR-engineering strategies, BiTE-T cells secrete BiTEs to redirect both BiTE-T cells and host T cells, thereby magnifying therapeutic responses.
  • FRa folate receptor alpha
  • ADC FRa-targeted antibody drug conjugate
  • MIRV mirvetuximab soravtansine
  • the present disclosure relates to modifying T cell to secrete BiTEs so that the modified T cells can be used as an adoptive cell therapy.
  • one binding portion of the described BiTEs targets Folate Receptor alpha (FRa).
  • FRa Folate Receptor alpha
  • the disclosure demonstrates that BiTE-secreting T cells (BiTE-T cells) can overcome challenges of durable BiTE delivery, which has previously been common to soluble BiTE formats.
  • the present disclosure also overcomes the requirement for repeated (such as daily infusions) BiTEs that are common in preclinical tumor models.
  • the disclosure demonstrates that BiTE-T cells can be efficiently generated using retroviral transduction.
  • BiTE-T cells redirect BiTE T cells and nontransduced bystander T cells, leading to activation and robust target cell killing in an antigendependent manner.
  • BiTE-T cells modified to contain an FRa targeted BiTE FR-B; FR-B T cells
  • FR-B FRa targeted BiTE
  • the disclosure demonstrates that, when delivered via loco-regional injection, FR-B-T cells can mediate potent anti -tumor immunity in the absence of systemic inflammation.
  • BiTE-T cell persistence following tumor antigen encounter can be improved through preconditioning of the T cells, illustrated using certain cytokines, such as Interleukin 15 (IL- 15).
  • IL- 15 Interleukin 15
  • BiTE T cells can be delivered as a tuneable cell therapy using multi-dosing to enhance therapeutic efficacy.
  • Figure 1 FR-Bh T cells target FRa+ tumor cells and initiate antitumor immune responses against OC patient specimens.
  • B) % SKOV-6 target cell lysis (left) and IFN-y production (right) following 24hr co-culture with FR-Bh or CONT- ENG T cells at specified E:T ratios (n 3 /condition)
  • C) % FRa+ cancer cells across tested OC patient specimens (n 10)
  • D-F FRa+ and FRa- tumor cell number and corresponding IFN-y production (• (black)) from 48hr OC patient co-cultures following the addition of CONT- ENG or FR-Bh T cells.
  • FIG. 2 FR-Bh T cells and endogenous OC patient T cells are activated by BiTEs when directed against FRa+ OC patient samples.
  • D) Graphical representation of data in C) across all FRa+ patients (n 7).
  • Figure 3 Therapeutic Delivery of murine FR-B T cells improves tumor control and survival in OC tumor-bearing mice
  • Parental IE9-mpl cells (hFRa-) were used as a target antigen negative control.
  • D) Experimental Design (left) and survival (right) of IE9-mpl-hFRa tumor bearing mice treated locoregionally with FR-B T cells or Unarmed Control T cells by IP injection (n 10-l 1/group). Data presented as mean ⁇ SEM. Data in A-C is from one representative experiment. Data in D) compiled from 2 independent experiments. Data in B) Two-Way ANOVA & D) Log-rank Test, * p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001.
  • E) Enumeration of FR-B T cells following serial co-culture with IE9-mpl-hFRa target cells at a fixed 6: 1 E:T ratio (n 6 wells/time point). T cells were harvested, counted and replated on fresh tumor cells as indicated ( ⁇ )
  • F) IE9-mpl-hFRa target cell counts (n 8-9 ROI/condition) following final 72hr co-culture with FR-B 2/7, FR-B 2/15, or Unarmed Control T cells (serial co-culture stress test).
  • G) Survival of IE9-mpl-hFRa tumor bearing mice treated locoregionally with FR-B T cells or Unarmed Control T cells by IP injection (n 10/group). Data presented as mean ⁇ SEM. Data in A-D) &
  • C- E Representative FACs plots showing the frequency of Ki67+ (C), CD39+/CD69+ (D) and TCF-1+ (E) FR-B CD8+ TALs following 2/7 or 2/15 preconditioning.
  • F) Volcano plot of differentially expressed genes between FR-B 2/7 and FR-B 2/15 CD8+ TALs (n 2-3/group).
  • Figure 6 Proposed Mechanism of action for durable antitumor immunity following locoregional infusion of FR-B T cells in Ovarian Cancer: Left) FR-B 2/7 T cells have robust effector function, but limited persistence in either the peritoneal TME or solid tumor lesions, leading to short-term BiTE-mediated antitumor immunity and therapeutic failure. Right) FR- B 2/15 T cells develop a stem-like phenotype and effectively persist with high frequency within the extratumoral peritoneal TME to functionally direct antitumor immune responses, resulting in prolonged BiTE activity and durable antitumor immunity.
  • FIG. 7 Generation of FRa-targeted FR-Bh BiTE and Functional testing of FR-Bh T cells: A) Graphical depiction of FR-Bh retroviral construct configuration (left) and specific binding of FR-Bh to FRa+ cells and T cells (right). CONT-ENG (which lacks human CD3 binding) and Control Supernatant (Cont Sup) containing no BiTEs/Engagers, as well as CD 19+ B cells were included as staining controls.
  • the EAAAK sequence on Figure 7A is SEQ ID NOV.
  • the full sequence (GEAAAKEAAAKEAAAK) is SEQ ID NO:8.
  • the GSTSGSGKSSEGKG is SEQ ID NO: 13.
  • the Leader sequence MNSGLQLVFFVLTLKGIQ is SEQ ID NO: 14.
  • the SGSGHHHHHH (with the His tag shown as His6) is SEQ ID NO: 15.
  • the RAKRSGSG (P2A) sequence is SEQ ID NO: 16.
  • SKOV-6 target cells were plated in the lower chamber, with UTD or BiTE-producing T cells added to the upper/lower chambers as indicated.
  • D) SKOV-6 tumor growth following therapeutic delivery of CONT- ENG or FR-Bh T cells, delivered by split dose injection (IV/Intratumoral delivery, n 3/group). Data presented as mean ⁇ SEM. Data in C) is from one representative experiment and data in D) is from one experiment. C) One-way ANOVA, D) Two-way ANOVA, ** p ⁇ 0.01, **** p ⁇ 0.0001.
  • Figure 8 Development of a translational model to test FR-Bh T cells against ovarian cancer patient specimens: A) Schematic diagram illustrating experimental setup for OC patient co-cultures B) Representative FACs plots demonstrating surface FRa levels in Fra 10 (left) and Fra 111 (right) OC patients. C) FRa+ ( ⁇ ) and FRa- ( ⁇ ) tumor cell number and corresponding IFN-y production ( ⁇ ) from 48hr OC patient co-cultures following addition of CONT-ENG or FR-Bh T cells for patients not shown in the main text figures. Baseline tumor cell number and IFN-y (co-cultures containing endogenous TALs only) shown for comparison.
  • Figure 10 Generation FRa-targeted FR-B BiTE for use in preclinical mouse models and therapeutic testing of FR-B T cells: A) Graphical depiction of FR-B retroviral construct configuration.
  • the EAAAK is SEQ ID NO:7.
  • the full sequence is SEQ ID NO:8.
  • the GSTSGSGKSSEGKG sequence is SEQ ID NO: 13.
  • the SGSGHHHHHH (with the His tag shown as His6) is SEQ ID NO: 15.
  • FR-Bh (which lacks mouse CD3 binding), Control Supernatant (Cont Sup) containing no BiTEs, and CD 19+ B cells were included as staining controls.
  • C) Experimental Design (left), tumor growth (middle), and survival of PanO2-hFRa tumor bearing mice treated locoregionally with FR-B T cells or Unarmed Control T cells by IP injection (n 6/group).
  • D) Mice were lymphodepleted by delivery of 5Gy TBI immediately prior to tumor implantation, with delivery of FR-B T cells 5 days later. Tumor progression was tracked based on accumulation of peritoneal ascites, measured as increased abdominal circumference (n 5/group).
  • Figure 11 Graphical depiction of serial stress test co-culture system to model persistent and repeated antigen stimulation of FR-B T cells.
  • FACs Fluorescence activated cell sorting
  • FBS Fetal bovine serum
  • FRa Folate receptor alpha
  • FR-B T cells Folate receptor alpha bispecific T cell engager-secreting T cells (mouse)
  • FR-Bh T cells Folate receptor alpha bispecific T cell engager-secreting T cells (human)
  • GFP Green fluorescent protein
  • GM-CSF Granulocyte-macrophage colony-stimulating factor
  • Gynecologic oncology hFRa Human Folate receptor alpha hrs: Hours
  • IFN-y Interferon gamma
  • IL-2, 5, 6, 7, 13, 15 Interleukin 2, 5, 6, 7, 13, 15
  • Luc/GFP Luciferase-Green fluorescent protein fusion protein
  • MIP-la/p Macrophage inflammatory protein 1 alpha and beta
  • MIRV mirvetuximab soravtansine ml: Milliliter mM: Millimolar
  • PBS Phosphate buffered saline
  • PDX Patient-derived xenograft
  • RNAseq RNA sequencing scFv: Single chain variable fragment
  • TALs Tumor-associated lymphocytes
  • TCR T cell receptor
  • TILs Tumor infiltrating T cells
  • TME Tumor microenvironment
  • Tregs Regulatory T cells
  • TSCM Stem cell memory T cells
  • the disclosure includes all polynucleotide and amino acid sequences described herein. Amino acids of all protein sequences and all polynucleotide sequences encoding them are also included, including but not limited to sequences included by way of sequence alignments. Sequences of from 80.00% - 99.99% identical to any sequence (amino acids and nucleotide sequences) of this disclosure are included.
  • the disclosure includes all amino acid and polynucleotide sequences that are identified herein by way of a database entry as the sequences exist in the database as of the effective filing date of this application.
  • the disclosure provides binding partners provided as bispecific T cell engagers (BiTEs).
  • the binding partners are in certain examples are multivalent.
  • leukocytes including but not necessarily limited to T cells, express a BiTE.
  • the present disclosure combines BiTE-based technologies and the therapeutic approach of targeting FRa to develop a novel ACT approach for OC and other cancers that utilizes engineered FRa-targeted BiTE-T cells (referred to from time to time herein as FR-Bh T cells for human T cells, and FR-B T cells for mouse T cells).
  • FR-Bh T cells were highly effective against both FRa+ OC patient samples and in immunocompetent preclinical tumor models.
  • mechanistic studies revealed that improved therapeutic efficacy was accompanied by preferential accumulation of less differentiated stem-like FR-B T cells in the extratumoral peritoneal OC TME over solid tumor lesions.
  • FR-B T cells in remote locations can promote tumor destruction in OC (by secreting BiTEs and engaging endogenous T cells) without a requirement for direct accumulation in solid tumors.
  • the disclosure is therefore expected to be suitable for use as an ACT therapy used to treat solid tumors, including but not necessarily limited to OC, where limited tumor reactivity from endogenous T cells can create therapeutic challenges.
  • binding partners of this disclosure may comprise linking sequences.
  • Suitable amino acid linkers may be mainly composed of relatively small, neutral amino acids, such as glycine, serine, and alanine, and can include multiple copies of a sequence enriched in glycine and serine.
  • the linker comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, and 20 amino acids.
  • the linker may be the glycine-serine-alanine linker G4SA3 (SEQ ID NO: 18) or a glycine-serine linker (G4S)4 (SEQ ID NO: 19) linker.
  • Representative examples of linking sequences are provided below in the described sequences.
  • a peptide linker may be used, and may comprise a cleavable or non-cleavable linker.
  • the peptide linker comprises any self-cleaving signal.
  • the self-cleaving signal may be present in the same open reading frame (ORF) as the ORF that encodes the binding partner.
  • ORF open reading frame
  • a self-cleaving amino acid sequence is typically about 18-22 amino acids long. Any suitable sequence can be used, non-limiting examples of which include: T2A, P2A, E2A, and F2A, the sequences of which are known in the art.
  • a binding partner may include a secretion signal.
  • the present disclosure therefore provides modified cells, such as T cells, that secrete a described binding partner.
  • any suitable secretion signal can be used and many are known in the art.
  • the secretion signal comprises MALPVTALLLPLALLLHA (SEQ ID NO: 1), METDTLLLWVLLLWVPGSTG (SEQ ID NO:2), or MGWSCIILFLVATATGVHSD (SEQ ID NO:3) or GEAAAKEAAAKEAAAK (SEQ ID NO:8).
  • MALPVTALLLPLALLLHA SEQ ID NO: 1
  • METDTLLLWVLLLWVPGSTG SEQ ID NO:2
  • MGWSCIILFLVATATGVHSD SEQ ID NO:3
  • GEAAAKEAAAKEAAAK SEQ ID NO:8
  • amino acid sequences of this disclosure that include amino acids that comprise purification or protein production tags, including but not limited to HIS tags, the disclosure includes the proviso that the sequences of any described tag may be excluded from the claimed amino acid sequences.
  • any suitable linker sequence may be substituted for the described sequence.
  • Linker sequences and/or purification tag sequences may be excluded from sequence similarity values described herein. Any binding partner described herein may be fully or partially humanized.
  • a described binding partner may be delivered as mRNA or DNA polynucleotides that encode the binding partner. It is considered that administering a DNA or RNA encoding any binding partner described herein is also a method of delivering such binding partners to an individual or to one or more cells, provided the DNA is transcribed and the mRNA is translated, and/or the RNA itself is delivered and translated. Methods of delivering DNA and RNAs encoding proteins are known in the art and can be adapted to deliver the binding partners, given the benefit of the present disclosure.
  • one or more expression vectors are used and comprise viral vectors. Thus, in embodiments, a viral expression vector is used.
  • Viral expression vectors may be used as naked polynucleotides, or may comprises any of viral particles, including but not limited to defective interfering particles or other replication defective viral constructs, and virus-like particles.
  • the expression vector comprises a modified viral polynucleotide, such as from an adenovirus, a herpesvirus, or a retroviral vector.
  • the retroviral vector is adapted from a murine Moloney leukemia virus (MLV) or a lentiviral vector may be used, such as a lentiviral vector adapted from human immunodeficiency virus type 1 (HIV-1).
  • MMV murine Moloney leukemia virus
  • HAV-1 human immunodeficiency virus type 1
  • a recombinant adeno-associated virus (AAV) vector may be used.
  • the expression vector is a self-complementary adeno- associated virus (scAAV).
  • cells modified according to this disclosure include mature T cells, or their progenitor cells such hematopoietic stem cells or any other time of T cell progenitor cells.
  • the disclosure includes progeny of progenitor cells.
  • cells that are modified to express any binding partner described herein include but are not necessarily limited CD4+ T cells, CD8+ T cells, Natural Killer T cells, y5 T cells, and cells that are progenitors of T cells, such as hematopoietic stem cells or other lymphoid progenitor cells, immature thymocytes (double-negative CD4-CD8-) cells, or double-positive thymocytes (CD4+CD8+).
  • the progenitor cells comprise markers, such as CD34, CD117 (c-kit) and CD90 (Thy-1).
  • a population of human peripheral blood mononuclear cells are modified using the described polynucleotides.
  • a polynucleotide that encodes a described binding partner selectively hybridizes to a polynucleotide encoding at least one protein that is a component of a binding partner, including but not limited to a heavy chain CDR1, CDR2, and CDR3 of any described binding partner.
  • the polynucleotide selectively hybridizes to a polynucleotide encoding a light chain CDR1, CDR2 and CDR3 of any described binding partner.
  • the polynucleotide selectively hybridizes to a polynucleotide encoding CDR1, CDR2 and CDR3 of a heavy and light chain of any described binding partner.
  • compositions containing binding partners are included in the disclosure, and can be prepared by mixing them with one or more pharmaceutically acceptable carriers.
  • Pharmaceutically acceptable carriers include solvents, dispersion media, isotonic agents and the like.
  • the carrier can be liquid, semi-solid, e.g. pastes, or solid carriers.
  • Examples of carriers include water, saline solutions or other buffers (such as phosphate, citrate buffers), oil, alcohol, proteins (such as serum albumin, gelatin), carbohydrates (such as monosaccharides, disaccharides, and other carbohydrates including glucose, sucrose, trehalose, mannose, mannitol, sorbitol or dextrins), gel, lipids, liposomes, resins, porous matrices, binders, fillers, coatings, stabilizers, preservatives, liposomes, antioxidants, chelating agents such as EDTA; salt forming counter-ions such as sodium; non-ionic surfactants such as TWEEN, PLURONICS or polyethylene glycol (PEG), or combinations thereof.
  • buffers such as phosphate, citrate buffers
  • oil such as phosphate, citrate buffers
  • alcohol such as serum albumin, gelatin
  • carbohydrates such as monosaccharides, disaccharides, and other carbohydrates including glucose, sucrose,
  • an effective amount of T cells expressing a described binding partner is administered to an individual in need thereof.
  • an effective amount is an amount that reduces one or more signs or symptoms of a disease and/or reduces the severity of the disease.
  • An effective amount may also inhibit or prevent the onset of a disease or a disease relapse.
  • a precise dosage can be selected by the individual physician in view of the patient to be treated. Dosage and administration can be adjusted to provide sufficient levels of binding partner to maintain the desired effect. Additional factors that may be taken into account include the severity and type of the disease state, age, weight and gender of the patient, desired duration of treatment, method of administration, time and frequency of administration, drug combination(s), reaction sensitivities, and/or tolerance/response to therapy.
  • an effective amount is an amount of modified T cells that express and secrete a binding partner and produces a therapeutic effect without of the modified T cells in a solid tumor that is 1-20% of the total T cells present in the solid tumor.
  • the engineered T cells are about 10% of the total T cells in a solid tumor (see, for example, Figure 5).
  • the described binding partners and T cells that express and secrete the binding partners can be administered directly or provided as pharmaceutical compositions and administered to an individual in need thereof using any suitable route, examples of which include intravenous, intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intraarticular, intrasy novi al, oral, topical, or inhalation routes, depending on the particular condition being treated. Intra-tumor injections may also be used.
  • the compositions may be administered parenterally or enterically.
  • the compositions may be introduced as a single administration or as multiple administrations or may be introduced in a continuous manner over a period of time, non-limiting examples of which are demonstrated herein.
  • the described compositions are suitable for use in humans.
  • the disclosure also includes the described constructs that are suitable for use in syngeneic immunocompetent mouse models.
  • the individual in need of a composition of this disclosure has been diagnosed with or is suspected of having cancer.
  • the cancer is a solid or liquid tumor.
  • the cancer is renal cell carcinoma, breast cancer, prostate cancer, pancreatic cancer, lung cancer, liver cancer, ovarian cancer, cervical cancer, colon cancer, esophageal cancer, glioma, glioblastoma, or another brain cancer, stomach cancer, bladder cancer, testicular cancer, head and neck cancer, melanoma or another skin cancer, any sarcoma, including but not limited to fibrosarcoma, angiosarcoma, adenocarcinoma, and rhabdomyosarcoma, and any blood cancer, including all types of leukemia, lymphoma, and myeloma.
  • administering a described binding partner such as by way of administering T cells that are modified to secrete the described binding partner, exhibits an improved activity relative to a control.
  • the control comprises administration of a BiTE without using T cells that secrete the BiTE.
  • the control comprises a BiTE that is secreted by a cell that is not a T cell.
  • the described T cells that express the described binding partners can be combined with any other therapeutic agent, non-limiting examples of which include conventional chemotherapeutic agents, and immune checkpoint inhibitors, the latter of which are known in the art, and target CTLA4, PD-1, or PD-L1.
  • the disclosure includes combination therapy using one or more described binding partners and any of CTLA-4 inhibitors, PD-1 inhibitors and PD-L1 inhibitors.
  • anti -PD-1 agents include Pembrolizumab and Nivolumab.
  • Anti-PD-Ll examples include Avelumab and Atezolizumab.
  • An anti-CTLA-4 example is Ipilimumab.
  • the binding partners may also be combined with any other form of adoptive immunotherapy.
  • the modified T cells may be used in autologous or allogenic therapies.
  • the disclosure includes the described expression vectors that encode the BiTEs, and all methods of making T cells that are described herein and by way of the figures.
  • the disclosure provides for obtaining T cells from an individual and subjecting the T cells to cytokine treatment to prepare the T cells for use as an adoptive immunotherapy, and modifying the T cells to express the described BiTEs.
  • the T cells may be modified to express the described BiTEs before, during or after cytokine treatment, but the cytokine treatment is before perfusion into an individual.
  • the cytokine treatment comprises repeated IL- 15 treatments.
  • the cytokine treatment comprises IL-2 + IL-7, or IL-2 + IL-15.
  • substituting IL-15 in place of IL-7 enhances properties of the T cells, such as expansion/persistence following infusion, a stem-like phenotype, and improved tumor control, as illustrated in the Figures.
  • BiTEs incorporate single-chain variable fragments (scFvs) and are composed of a tumor-targeted scFv providing tumor antigen target specificity, linked in tandem to a T cell specific scFv, which provides T cell activation (typically an anti-CD3 scFv).
  • scFvs single-chain variable fragments
  • GEAAAKEAAAKEAAAK (SEQ ID NO: 8) linker sequence; Rigid and long linker sequence between scFv was tested in parallel with multiple linkers of varying length/flexibility and was found to result in optimal antigen binding by both CD3e and FRa targeted scFv’s in the current format and resulted in optimal in vivo activity
  • hCD3e scFV x hFRa scFv Human FRa targeted BiTE (hCD3e scFV x hFRa scFv)
  • hCD3e scFv UCHT1 clone
  • hFRa scFv Movl9 clone
  • a binding partner of this disclosure includes a sequence that is an anti-human CD3e scFv as shown in SEQ ID NO:5.
  • a binding partner of this disclosure includes a sequence that is an anti-human FRa scFv sequence as shown in SEQ ID NO:6.
  • a binding partner of this disclosure includes both a sequence that is an anti-human CD3e sequence and a sequence that is an antihuman FRa, such as the sequence shown in SEQ ID NO: 10) wherein said sequence includes amino acids 1-531 only and therefore excludes the HIS tag.
  • SK-OV-6 cervical
  • SK-OV-3 ovarian
  • OV167 ovarian
  • OVCAR8 ovarian
  • OVCAR3 (ovarian), K562 (Leukemia), IE9-mpl (ovarian), IE9-mpl-hFRa (ovarian), Pan02- hFRa (pancreatic) cancer cell lines were grown in complete RPMI (cRPMI) containing 10% FBS, 25mM Hepes, 2mM L-Glutamine, 100 lU/ml Pen/Strep, ImM Sodium Pyruvate, lx Non-Essential Amino Acids, and 0.05mM P-Mercaptoethanol. 293T, PG13, and PLAT-E cell lines were grown in complete DMEM (cDMEM) containing 10% FBS and 100 lU/ml
  • Pen/Strep Cell lines were IMPACT tested and/or confirmed mycoplasma negative prior to use. Generation of hFra-expressing cell lines, BiTE constructs and retroviral vectors
  • FR-Bh binds human FRa via a scFv derived from the M0vl9 antibody and human CD3s via a scFv derived from the UCHT1 antibody.
  • FR-B binds human FRa as above and mouse CD3s via a scFv derived from the 145-2C11 antibody.
  • T cells Human or mouse T cells were cultured for no less than 8 days post activation before assay set up. T cells were co-cultured with target cells at the indicated E:T ratios in cRPMI for 24 or 48hrs. For serial stress test studies involving repeated and prolonged co-culture of mouse T cells with target cells, T cells were harvested, counted, and resuspended in fresh cRPMI + cytokine support (IL-2 + IL-7 or IL-2 + IL- 15 as indicated) at the start of each new 3-day co-culture period. Additional details are included herein.
  • Cryopreserved OC patient ascites samples (Supplemental Table 1 (shown in Figure 14)) containing both immune cells and tumor cells were obtained from the Roswell Park Gyn One Tissue Bank under an approved BDR protocol and were collected from OC patients undergoing care at Roswell Park and processed for banking under approved IRB protocol 1215512. Thawed cells were washed, counted to determine tumor cell number, and plated in 6 well plates at 10 5 tumor cells/well in cRPMI. Patient samples were cultured ⁇ FR-Bh T cells or T cells secreting a control engager (CONT -ENG T cells) that were pre-labeled with CellTrace Violet and added at a BiTE-T cell: tumor cell ratio of 4: 1. OC patient ascites samples ⁇ FR-Bh/CONT-ENG T cells were co-cultured for 48hrs prior to harvest. Additional details related to these studies have are described herein. Preclinical mouse models and therapeutic delivery of T cells
  • FR-Bh T cell evaluation in the SK-OV-6 human xenograft model is described in the supplemental methods.
  • 6-8-week-old female C57BL/6J mice were purchased from the Jackson Laboratory and housed in the Roswell Park Comparative Oncology Shared Resource (COSR).
  • 5 x 10 6 IE9-mpl-hFRa cells IP in 500pl PBS
  • 2 x 10 6 PanO2-hFRa SQ in lOOul PBS
  • mice received 8.33 x 10 5 - 3 x 10 6 FR-B T cells or an equal number of unarmed control T cells (Luc/GFP transduced or mock transduced) delivered by loco- regional injection (IP or intratumoral delivery for SQ tumors), with timing/dosing as indicated.
  • FR-B T cell accumulation in the blood, peritoneal TME, or solid tumors was assessed 5 days post ACT. Additional details related to in vivo studies, tissue collection, processing, and analysis have been included in the supplemental methods.
  • Antibodies for flow cytometry were purchased from BioLegend or BD Biosciences and have been listed in Supplemental Table 2 (shown in Figure 15). Antibodies were titrated for optimal staining for 30 min at 4°C in FACs buffer (2% FBS in PBS), BD HorizonTM Brilliant Staining Buffer, or intracellular staining buffer as required. Additonal details related to sample staining and analysis have been included in the supplemental methods.
  • Two-tailed, unpaired and paired t tests were used to compare data between two groups.
  • One- and two-way Analysis of Variances (ANOVA) were used for data analysis of more than two groups and/or across multiple time points and a Tukey post-test was utilized to determine significant differences between groups. Survival data was compared using a Logrank test. Results were generated using GraphPad Prism software. Differences between means were considered significant at p ⁇ 0.05: * p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001, **** p ⁇ 0.0001.
  • Example 2 The results in the following Examples were produced using the materials and methods described in Example 1.
  • Example 2 The results in the following Examples were produced using the materials and methods described in Example 1.
  • FRa-specific BiTE To target FRa+ OC, we generated a FRa-specific BiTE by linking a human CD3s- specific scFv (UCHT1) and a MOV19-derived FRa-specific scFv using optimized linker sequences (7 Fig. 7A, Left Panel).
  • This BiTE hereafter referred to as FR-Bh, was confirmed to bind FRa+ cancer cells and human T cells (Fig. 7A, Right Panel).
  • Fig. 7A, Right Panel BiTE-secreting FR-Bh T cells were efficiently produced using retroviral transduction of activated primary human T cells (Fig.
  • FR-Bh T cells (but not CONT -ENG T cells) effectively lysed FRa 111 SKOV-6 target cells in vitro at even low effector to target (E:T) ratios (Fig. IB, Left Panel and Fig. 7B). Tumor cell lysis was accompanied by IFN-y production by FR-Bh T cells (Fig. IB, Right Panel), consistent with antigen-driven effector function.
  • FR-Bh T cells were confirmed to actively engage bystander T cells (via secreted BiTEs) using a transwell co-culture assay, where FR-Bh T cells plated in the upper chamber led to robust FRa+ target cell killing and effector function by untransduced (UTD) T cells in the lower chamber (Fig. 7C).
  • Therapeutic delivery of FR-Bh T cells to SK-OV-6 tumor-bearing NSG mice produced robust tumor regressions not observed with CONT-ENG T cell infusion (Fig. 7D), confirming therapeutic activity of FR-Bh T cells against growing tumors.
  • FR-Bh T cells were co-cultured at a T cell: tumor cell ratio of 4:1 with OC patient specimens (isolated from peritoneal ascites at the time of surgery, Suppl. Table 1, shown in Figure 14) containing tumor cells and the patient’s own immune cells Fig. 8A).
  • the frequency of FRa+ tumor cells (CD45-EpCAM+ cells) across OC patients was variable, ranging from 3.36% to 91.8% (Fig. 1C, Fig. 8B, & Suppl. Table 1), highlighting the heterogeneity of FRa positivity in OC.
  • the FRa+ tumor cell number was reduced in the majority of OC patient cocultures when FR-Bh T cells were added compared to cultures containing endogenous tumor- associated lymphocytes alone (patient T cells present in ascites; TALs only) or where CONT- ENG T cells were added (Fig. 1D-F & Fig. 8C), which was particularly evident for OC patients with Fra Int or Fra 111 tumor cell frequencies.
  • FR-Bh T cells can be efficiently generated using human T cells for OC targeting and elicit robust antitumor immunity against clinical OC by initiating robust inflammatory responses.
  • exogenously added T cells (comprised of engineered FR-Bh/CONT-ENG-producing and bystander non-transduced T cells) were labeled with CellTrace Violet (CTV) prior to addition to co-cultures, permitting discrete assessment of transferred [CTV+; transduced (GFP+) and UTD bystander (GFP-) T cells] and endogenous (CTV-GFP-) T cells (Fig.
  • FR-Bh T cells engaged/activated endogenous T cells in OC patient samples
  • a-directed BiTE-T cells in an immunocompetent OC mouse model.
  • an aggressively growing and immunotherapy -resistant variant of the IE9-mpl OC cell line 29 was engineered to stably express human FRa (IE9-mpl-hFRa) and a chimeric BiTE specific for human FRa and mouse CD3s was generated (hereafter referred to as FR-B) (Fig. 10A).
  • FR-B was confirmed to bind to both IE9-mpl-hFRa target cells and mouse T cells (Fig. 10B).
  • FR-B -secreting T cells were generated with high efficiency from activated mouse splenocytes by retroviral transduction (Fig. 3A) and demonstrated robust killing and antigen-driven effector function in co-culture assays with IE9-mpl-hFRa, but not FRa- parental IE9-mpl target cells (Fig. 3B).
  • Fig. 3A FR-Bh T cells
  • transduced CD8+ and CD4+ FR-B T cells and accompanying UTD bystander T cells were activated in the presence of hFRa+ target cells (Fig. 3C), consistent with FR-B-mediated redirection of bystander T cells.
  • IE9-mpl-hFRa tumor-bearing mice were treated with FR-B or unarmed control T cells (either UTD or T cells engineered to express a Luciferase-GFP fusion protein; Luc/GFP) and monitored for tumor progression and survival (Fig 3D).
  • FR-B or unarmed control T cells either UTD or T cells engineered to express a Luciferase-GFP fusion protein; Luc/GFP
  • Fig 3D As localized delivery of adoptively transferred CAR-T cells directly into the peritoneal OC TME can effectively control OC progression 30 ' 32 , tumor-bearing mice were treated by IP injection of T cells. Loco-regional delivery of FR-B T cells significantly delayed OC progression compared to control T cells (Fig.
  • TILs solid tumor
  • TALs ascites
  • Stem-like FR-B T cells can be produced through cytokine preconditioning and improve antitumor immunity following ACT
  • IL- 15 stimulation has been shown to promote a less-differentiated stem cell memory (TSCM) phenotype, increase mitochondrial metabolic fitness, and improve T cell persistence following infusion of CAR-T cells 33 , and can enhance the activity of BiTE-T cells 34 , we tested whether IL- 15 preconditioning prior to ACT would impact FR-B T cell efficacy and response durability against OC.
  • TSCM stem cell memory
  • FR-B T cells were produced in the presence of IL-2 and IL-7 (FR-B 2/7) in prior experiments, we directly compared this approach to FR-B T cells produced using IL-2 and IL-15 stimulation (FR-B 2/15).
  • FR-B 2/7 and FR-B 2/15 T cells were generated with similar efficiency by retroviral transduction (Fig. 4A), with FR-B 2/15 T cells having increased TCF-1 expression (Fig. 4B) and an elevated usage of mitochondrial metabolism (Fig. 4C) compared to FR-B 2/7 T cells, consistent with previous data 33 .
  • FR-B 2/15 T cells produced more than 10-fold less IFN-y than FR-B 2/7 T cells (Fig. 4D, Left Panel) and had a reduced capacity to kill IE9-mpl-hFRa cells in co-culture assays (Fig. 4D, Right Panel), consistent with a less differentiated T cell phenotype.
  • FR-B 2/15 T cells When tested in an in vitro serial co-culture ‘stress test’ of chronic antigen exposure (Fig. 11), the capacity of FR-B 2/15 T cells to promote durable antitumor activity emerged. While FR-B 2/7 T cells dramatically expanded (>5-fold) prior to abrupt contraction, FR-B 2/15 T cells demonstrated limited expansion in response to antigen stimulation over the entire co-culture period (Fig. 4E). However, while both FR-B 2/7 and FR-B 2/15 T cells cleared all tumor cells in the first two serial co-cultures, FR-B 2/7 T cells developed a reduced ability to lyse IE9-mpl-hFRa tumor cell targets by the third co-culture, while FR-B 2/15 T cell lytic function was maintained (Fig.
  • FR-B 2/15 T cells have a greater capacity to sustain antitumor activity over a prolonged period.
  • adoptive transfer of a single dose of FR-B 2/15 T cells 5 days post tumor implantation significantly improved tumor control and long-term survival of IE9-mpl-hFRa tumor-bearing mice compared to FR- B 2/7 T cells (Fig. 4G).
  • Fig. 4G FR- B 2/7 T cells
  • IL-2/IL-15 preconditioning improves FR-B T cell persistence in the extratumoral OC peritoneal TME
  • FR-B CD4+ T cells demonstrated limited accumulation in the blood, peritoneal TME (TALs), as well as solid tumor lesions (TILs), with no clear differences between 2/7 and 2/15 preconditioned FR-B CD4+ T cells (Fig 12A).
  • FR-B CD8+ T cells had limited accumulation in the blood, with a modest increase in abundance in solid tumor lesions (Fig 5A and Fig 12B), consistent with antigen-driven FR-B T cell accumulation at tumor sites.
  • FR-B 2/15 CD8+ TALs in the peritoneal cavity was elevated more than 3-fold compared to FR-B 2/7 TALs (Fig. 5B) and comprised an increased proportion of the total CD45+ immune infiltrate in the peritoneal TME (Fig. 12D), suggesting an overall improved capacity of FR-B 2/15 CD8+ T cells to persist in the extratumoral peritoneal OC TME.
  • Ki67+ FR-B 2/15 CD8+ TALs were observed compared to FR-B 2/7 CD8+ TALs (Fig. 5C & Fig 12E), suggesting ongoing T cell proliferation.
  • CD8+ FR-B 2/15 TALs had upregulated expression of genes associated with cell proliferation (E2f8, Ercc61, Cenph, Cdc7, Tripl3) and cell survival (Ifit3, Egrl), consistent with improved in vivo persistence observed at the cellular level. Additional upregulated genes associated with T cell activation and interferon response (Cstad, Ifitl), as well as cellular metabolism and energy homeostasis (Gstm5, Bcol, Ckb) were observed, suggesting that CD8+ FR-B 2/15 TALs can persist as activated T cells, potentially through changes in cellular metabolism.
  • FR-B 2/7 TALs upregulated genes related to apoptotic signaling (Rai 14) and negative regulation of transcription and NF-KB signaling (ZscanlO, Ppmln), consistent with poor in vivo persistence and limited T cell activity.
  • FR-B 2/7 TALs upregulated genes associated with fatty acid metabolism (Acot4) and regulation of endocytic process (Ston2), increased inflammatory response (CSF2), collagen binding (Coch), extracellular matrix adhesion (Tinagll), as well as responses to extracellular signaling (Pde4c, Plcb4), consistent with interactions between T cells and tumor stroma.
  • FR-B 2/7 TALs upregulation of CXCR5 and CCR6 by CD8+ FR-B 2/7 TALs suggested an increased capacity for tissue homing by FR-B 2/7 TALs.
  • Pathway analysis revealed key differences between preconditioning strategies, with FR-B 2/15 TALs enriched for pathways associated with cell replication and T cell function, whereas FR-B 2/7 TALs were enriched for TGF-P responsiveness, chemokine signaling, and ECM interaction (Fig. 5G).
  • Patsoukis N, Bardhan K, Chatterjee P, et al. PD-1 alters T-cell metabolic reprogramming by inhibiting glycolysis and promoting lipolysis and fatty acid oxidation. Nat Commun 2015;6:6692. doi: 10.1038/ncomms7692 [published Online First: 2015/03/27]
  • FR-B(h) T cells that was accompanied by engagement of endogenous T cells in the OC TME, thereby overcoming limited endogenous immunoreactivity or local tumor immunosuppression.
  • Delivery of T cells by IP injection has been shown to result in accumulation of infused T cells in solid tumors in the peritoneal cavity 32 , which is consistent with the present data shown for for FR-B T cells.
  • FR-B T cells comprised only a small fraction of the TILs found in solid OC and the improved therapeutic effects of FR-B 2/15 over FR-B 2/7 T cell therapy correlated with differences in FR-B T cell accumulation outside of solid tumors (Fig. 6).
  • ACT approaches Eg.
  • the instant data indicate that effector-like FR-B 2/7 CD8+ TALs increase fatty acid/lipid metabolism within the OC TME, metabolic reprogramming that has been associated with PD-1 signaling 38 and suggesting FR-B T cells can also be impacted by inhibitory cues in the broader peritoneal OC TME that may promote early T cell clearance.
  • FR-B T cells can also be impacted by inhibitory cues in the broader peritoneal OC TME that may promote early T cell clearance.
  • CD39-expressing CD8+ T cells can directly suppress the antitumor activity of tumor-specific T cells 39 suggests the predominantly CD39+ FR-B 2/7 FR-B TALs may actually limit tumor attack within the OC TME.
  • the disclosure includes use of the FR-B T cells to localize to other sites in the peritoneal space, including tumor-draining lymph nodes or the spleen.
  • a small frequency of FR-B T cells was also observed in circulation, supporting loco-regional delivery of FR-B T cells leading to antitumor immunity at distant metastatic sites.
  • the disclosure includes use of the described BiTE-T cells with a co-stimulatory signal and/oror cytokines. It is considered that because soluble BiTEs effectively combine with blockade of checkpoint receptors including PD-1 and CTLA-4 17 , it is considered likely that the described FR-B(h) T cells will synergize with checkpoint blockade for treating OC.
  • the disclosure includes multi-arming T cells, for example with CARs and the described BiTEs to target multiple tumor antigens which may overcome tumor heterogeneity and/or elicit immune attack on multiple target cell subsets.
  • results demonstrate the potent effects of FR-B(h) T cells for ACT in OC, which can effectively redirect endogenous T cells to amplify antitumor immunity.
  • results also reveal a unique attribute of FR-B T cells in OC to persist and direct antitumor activity from solid tumor-adjacent or extratumoral locations in the peritoneal TME, which may have distinct mechanistic advantages for enhancing response durability following ACT.
  • This Example provides supplemental methods in respect of the prior examples.
  • hFra-expressing cell lines BiTE constructs and retroviral constructs Human FRa (hFRa) was PCR amplified from cDNA of SK-MEL-37 melanoma cell line using the following primers FWD: TGTCGTGAAAACTACCCCGCGGCCGCCACCATGGCTCAGCGGATGACAACACA (SEQ ID NO: 11) and REV: TTCGTGGCTCCGGAGCCACTGCTGAGCAGCCACAGCAGCATT (SEP ID NO: 12).
  • the hFRa gene was genetically fused to the monomeric enhanced GFP (eGFP) reporter via SGSG-linker and a P2A translational skipping sequence and inserted into the pT2-EF sleeping beauty transposon plasmid 1 using NEBuilder® HIFI DNA assembly (New England Biolabs), with sequences confirmed by Sanger Sequencing at the Roswell Park Genomics Shared Resource.
  • the pT2-EF-hFRa-GFP vector was co-electroporated with the CMV(CAT)T7-SB100 transposase vector (Addgene plasmid # 34879;
  • RRID:Addgene_34879) into IE9-mpl and Pan02 cell lines using the Nucleofector 4D Instrument. Electroporated cells were cultured for 10-14 days prior to FACs sorting of GFP hi cells using a BD FACSAria II cell sorter. Sorted cells were confirmed to express hFRa by flow cytometry.
  • a hFRa-specific scFv with murine immunoglobulin kappa light chain was designed by fusing M0vl9 kappa chain (Sequence ID: X99994.1) and heavy chain (Sequence ID: X99993.1) sequences via a 212 polypeptide-containing linker (GSTSGSGKSSEGKG (SEQ ID NO: 13)) and was synthesized by Integrated DNA technologies gBlock.
  • FR-B is a chimeric BiTE that binds human FRa and mouse CD3e (via a previously described scFv derived from the 145-2C11 monoclonal antibody 2 .
  • scFvs are linked by a rigid and long G(EAAAK SEQ ID NO:9)x3 linker sequence that resulted in optimal antigen binding and in vivo FR-B activity compared to a panel of tested linkers (data not shown).
  • the BiTE leader sequence 2 and 145-2C11 derived scFv sequence were codon- optimized and synthesized by gBlock (Integrated DNA technologies), with the FR-B sequence designed to contain a 6x His Tag at the C terminus.
  • the FR-B sequence was genetically fused to the monomeric enhanced GFP (eGFP) reporter via a SGSG (SEQ ID NO:9)-linker and P2A translational skipping sequence to allow monitoring of transduction efficiency (Fig. 10A).
  • the FR-Bh sequence was generated from the FR-B BiTE by exchanging the 145-2C11 derived mouse CD3s binding scFv with the human CD3s-specific UCHT1 scFv sequence ordered from Integrated DNA technologies as a gBlock containing the same BiTE leader sequence as above and the UCHT1 scFv).
  • the DNA sequence corresponding to the G(EAAAK)3 (SEQ ID NO: 9) linker (GEAAAKEAAAKEAAAK (SEQ ID NO:8), followed by Movl9 scFv, 6x His Tag, Furin cleavage peptide, SGSG linker + P2A translational skipping sequence, and monomeric enhanced GFP (eGFP) reporter (to monitor transduction efficiency) was PCR amplified from an existing plasmid to generate overlapping DNA fragments amenable to assembly using NEBuilder (Fig. 7A).
  • FR-B and FR-Bh sequences along with GFP reporter genes were inserted into the previously described retroviral vector 1 using Notl and PacI restriction sites, with DNA fragments assembled using NEBuilder HIFI DNA assembly (New England Biolabs). Plasmid sequences were confirmed by Sanger Sequencing, and retroviruses used to transduce human or mouse cells produced in PG13 or PLAT-E retroviral packaging cells lines, respectively. For murine studies, control T cells were either transduced with a retrovirus expressing a codon-optimized Luciferase (Luc2)-P2A-GFP gene and produced in PLAT-E cells or were Mock transduced.
  • Luc2A-GFP codon-optimized Luciferase
  • Control Engager secreting (Cont-ENG) T cells were generated by transducing human T cells with the FR-B retroviral vector (produced in PG13 cells), where secreted Engagers can bind FRa+ target cells, but not human T cells due to lack of cross-reactivity of the 145- 2C11 scFv with human CD3 (confirmed by flow cytometry), thus preventing Engager- mediated T cell activation upon FRa binding.
  • cell culture supernatant from high- titer retrovirus producing clones was collected and used for viral transduction.
  • 293T cells were retrovirally transduced, followed by collection of 293T cell culture supernatants.
  • PBMC peripheral blood mononuclear cells
  • BDR Biospecimen and Data Research
  • splenocytes were harvested from female C57BL/6J or T-Lux 3 mice, subjected to RBC lysis using ACK lysis buffer, and activated using precoated plate-bound anti-mouse CD3s (145-2C11, 5pg/ml prepared in PBS, Bio X cell) for 48-72hrs in cRPMI containing anti-mouse CD28 antibody (37.51, 2pg/ml, Bio X Cell), human IL-2 (50U/ml, Peprotech), and either mouse IL-7 (lOng/ml, BioLegend) or mouse IL-15 (lOng/ml BioLegend).
  • T cells were harvested, counted, and loaded onto Retronectin (Takara) -coated non-tissue culture treated plates preloaded with retrovirus by spinning cleared cell supernatants from high-titer retrovirus-producing PG13 (human) or PLAT-E (mouse) cells at 3000 rpm for Aliquot at 32°C (2 cycles of retrovirus preloading completed prior to T cell loading).
  • T cell transduction was conducted on two consecutive days, followed by at least 24hr T cell expansion prior to assessment of T cell transduction efficiency (based on GFP+ cells, gated using GFP- mock transduced T cells) by flow cytometry.
  • T cells were maintained in cRPMI containing cytokine support (IL-2 + IL-7 or IL-15), which was replaced every 2-3 days.
  • Fc blocking was performed by using an anti-CD16/CD32 antibody (2.4G2, Bio X Cell, 15 min at 4°C) to inhibit non-specific antibody binding prior to surface staining.
  • the BD Transcription Factor Buffer Set (BD Biosciences) was used according to the manufacturer’s suggested protocol.
  • intracellular staining for GFP was additionally included to permit interrogation of FR-B T cells based on GFP in fixed cells.
  • T cells were gently washed from cultures using cold PBS and target cells were enumerated by counting a minimum of 4 randomly selected regions of interest (ROI’s) /well using the Cytation 5 instrument (Biotek) or quantified using the CellTiter-Glo 2.0 Cell Viability Assay (Promega) to determine % target cell killing compared to control wells containing target cells alone.
  • ROI regions of interest
  • T cell activation (FR-B, Luc/GFP, or Mock transduced T cells) was assessed after 24hr co-culture with IE9-mpl-hFRa target cells using CD69 surface staining and flow cytometry.
  • Co-cultures were plated in technical duplicate or triplicate and incubated for 48hrs in the presence of human IL-2 (50U/ml), at which point T cells were gently washed from the lower chamber and target cells harvested and viable cells counted. Culture supernatants were collected and analyzed for human IFN-y production by ELISA as described.
  • FR-Bh T cell therapeutic activity For evaluation of FR-Bh T cell therapeutic activity using a human xenograft model, 3 x 10 6 SK-OV-6 cells (prepared in lOOpl PBS) were implanted subcutaneously in the flanks of female 6-8-week-old female NSG mice bred in the Roswell Park Laboratory Animal Shared Resource (LASR). Tumor volumes were calculated as 0.5 x (Length x Width 2 ) and when tumors reached ⁇ 150mm 3 , mice were stratified into groups to remain untreated or receive 3 x 10 6 FR-Bh or Cont-ENG T cells (delivered as split dose between IV and intratumoral routes, prepared in 200pl PBS).
  • LASR Roswell Park Laboratory Animal Shared Resource
  • mice received 3 daily doses of 2 x 10 4 U of IL-2 (IP injection, 200pl PBS) beginning on the day of T cell infusion. Changes in tumor volume were determined twice/week for the duration of study. In studies involving depletion of endogenous lymphocytes in immunocompetent mice, mice were treated with 5 Gy Total body irradiation immediately prior to tumor implantation and lymphodepletion confirmed by flow cytometry prior to adoptive T cell transfer.
  • IP tumor progression was monitored based on increased abdominal distension (measured as changes in circumference) due to accumulation of peritoneal ascites, which closely correlates with solid tumor growth in this model 4 5 , with mice considered endpoint and euthanized when abdominal circumference reached 10cm (or at earlier measurements if mice developed decreasing health status due to peritoneal disease progression).
  • tumor volume was calculated at 0.5 x (Length x Width 2 ), with mice considered endpoint and euthanized when tumor dimensions exceed 10mm in both directions. All performed experiments and procedures were reviewed and approved by the Roswell Park IACUC prior to conducting experiments.
  • Blood was collected by retro-orbital blood draw, peritoneal lavage collected following IP injection of PBS, and solid tumors excised from the omental region of animals.
  • RBC lysis was performed on blood and peritoneal wash samples using ACK lysis buffer and solid tumors were processed using the gentleMACs Dissociator (Miltenyi Biotec), followed by passage through 70pm cell strainers. Samples were subsequently stained for flow cytometry analysis as outlined.
  • FR-B 2/7 or FR-B 2/15 T cells were generated for comparison of metabolic function using the Mitochondrial Stress Test conducted using the Seahorse XFe96 Analyzer. Briefly, the Mitochondrial Stress Test was performed in XF DMEM Base Media with no Phenol red containing lOmM glucose, ImM sodium pyruvate, and 2mM L-glutamine and the following inhibitors were added at the following final concentrations: Oligomycin (2pM), Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) (1.0 pM), Rotenone/ Antimycin A (0.5pM each).
  • FR-B 2/7 or FR-B 2/15 T cells (8.4 x 10 5 /mouse, prepared in 200pl PBS) were adoptively transferred by IP injection into IE9-mpl-hFRa tumor-bearing mice and peritoneal washes collected from mice 5 days later following IP injection of 5ml PBS. Collected cells were washed and immediately stained for cell viability (Zombie UV, prepared in PBS) followed by Fc blocking and surface phenotyping using antibodies prepared in BD FACs PreSort Buffer (BD Biosciences).
  • RNAseq analysis of sorted CD8+ FR-B TALs was conducted using the Takara Bio USA, Inc. SMART-Seq® v4 PLUS Kit. Final libraries were sequenced on an Illumina NovaSeq 6000 using 2X100 sequencing and an average of 50 million paired reads/sample were generated. Following sequencing, samples were passed through Illumina bcl2fastq v2.20 to generate fastq files for downstream analysis. Bioinformatics pre-processing and quality control (QC) steps were carried out by the Roswell Park Bioinformatics Shared Resource, using an established pipeline following commonly adopted practices for RNA-seq data analysis.
  • QC quality control
  • Raw reads that passed the Illumina RTA quality filter were demultiplexed and pre-processed using FastQC for sequencing base quality control.
  • Raw reads that passed the Illumina RTA quality filter were demultiplexed and pre-processed using FastQC for sequencing base quality control.
  • Reads were then mapped to the mouse reference genome (GRCm39) and reference transcriptome GENCODE (vM28) using STAR 6 .
  • Raw feature counts were normalized and differential expression analysis was carried out using DESeq2 7 .
  • Differential expression rank order was used for subsequent gene set enrichment analysis (GSEA) 8 , performed using the cluster profile package in R.
  • GSEA gene set enrichment analysis

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Peptides Or Proteins (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des cellules modifiées et des procédés pour leur utilisation dans le traitement du cancer. Les cellules sont modifiées pour exprimer et sécréter un engageur de lymphocytes T Bi-spécifiques (BiTE) qui comprend un segment qui se lie spécifiquement au récepteur alpha du folate humain (FRα) et un segment qui se lie spécifiquement au CD3 humain, tel que CD3e. Les cellules modifiées peuvent être des lymphocytes T. L'invention concerne également des procédés de production des cellules modifiées.
PCT/US2023/063359 2022-02-27 2023-02-27 Engageurs de lymphocytes t bi-spécifiques ciblant le récepteur alpha de folate et leurs utilisations WO2023164698A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263314448P 2022-02-27 2022-02-27
US63/314,448 2022-02-27

Publications (2)

Publication Number Publication Date
WO2023164698A2 true WO2023164698A2 (fr) 2023-08-31
WO2023164698A3 WO2023164698A3 (fr) 2023-10-12

Family

ID=87766804

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/063359 WO2023164698A2 (fr) 2022-02-27 2023-02-27 Engageurs de lymphocytes t bi-spécifiques ciblant le récepteur alpha de folate et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2023164698A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115491358A (zh) * 2021-06-17 2022-12-20 复星凯特生物科技有限公司 一种靶向b7-h3和folr1双打靶点car t的制备及应用

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0128510D0 (en) * 2001-11-28 2002-01-23 Novartis Ag Organic compounds
KR20230148844A (ko) * 2016-03-29 2023-10-25 유니버시티 오브 써던 캘리포니아 암을 표적하는 키메라 항원 수용체
EP4185616A1 (fr) * 2020-07-24 2023-05-31 Cellectis S.A. Lymphocytes t exprimant des activateurs de cellules immunitaires dans des réglages allogéniques

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115491358A (zh) * 2021-06-17 2022-12-20 复星凯特生物科技有限公司 一种靶向b7-h3和folr1双打靶点car t的制备及应用

Also Published As

Publication number Publication date
WO2023164698A3 (fr) 2023-10-12

Similar Documents

Publication Publication Date Title
Batra et al. Glypican-3–specific CAR T cells coexpressing IL15 and IL21 have superior expansion and antitumor activity against hepatocellular carcinoma
JP7008350B2 (ja) Ｃａｒ発現ベクター及びｃａｒ発現ｔ細胞
Dai et al. Chimeric antigen receptors modified T-cells for cancer therapy
Zhang et al. A chimeric antigen receptor with antigen-independent OX40 signaling mediates potent antitumor activity
US20240059754A1 (en) Chimeric antigen receptors and enhancement of anti-tumor activity
Alnefaie et al. Chimeric antigen receptor T-cells: an overview of concepts, applications, limitations, and proposed solutions
Lamb et al. Natural killer cell therapy for hematologic malignancies: successes, challenges, and the future
CN117305250A (zh) 工程化天然杀伤细胞及其用途
CN113164519A (zh) 用于免疫疗法的基因修饰的包含归巢受体或细胞因子和嵌合抗原受体的四顺反子系统
CN117721084A (zh) 靶向多种抗原的复合嵌合抗原受体（cCAR）及其组成和使用方法
WO2020118634A1 (fr) Cellules effectrices immunitaires ciblant gpc3 et leur utilisation
US20220325241A1 (en) Immune effector cell for co-expressing chemokine receptor
EP3184548A1 (fr) Récepteur d'antigène chimérique avec activation de récepteur de cytokine ou domaine de blocage
JP2024038512A (ja) がんを治療するための医薬、組み合わせ医薬、医薬組成物、免疫応答性細胞、核酸送達媒体、及び製品
WO2023164698A2 (fr) Engageurs de lymphocytes t bi-spécifiques ciblant le récepteur alpha de folate et leurs utilisations
Feng et al. Treatment of aggressive T-cell lymphoma/leukemia with anti-CD4 CAR T cells
Giordano Attianese et al. Coengineering specificity, safety, and function into T cells for cancer immunotherapy
Heiblig et al. Adoptive immunotherapy for acute leukemia: new insights in chimeric antigen receptors
JP7057975B2 (ja) 殺細胞効果を有するキメラ抗原受容体遺伝子改変リンパ球
Chaudhry et al. Chimeric antigen receptor-engineered natural killer cells: a promising cancer immunotherapy
US20230303974A1 (en) Immune Cells Defective for SOCS1
JP2024509917A (ja) 腫瘍溶解性ウイルスによる直交性ｉｌ－２の送達を用いた、固形腫瘍におけるｔ細胞の選択的刺激方法
US20230303643A1 (en) Constitutively active tcf1 to promote memory-associated traits in car t cells
US20230374104A1 (en) Methods and compositions comprising pd1 chimeric polypeptides
Fischer-Riepe et al. Preclinical Development of CAR T Cells with Antigen-Inducible IL18 Enforcement to Treat GD2-Positive Solid Cancers