Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
  • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
  • C07D471/04—Ortho-condensed systems
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
  • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
  • A61K31/4355—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having oxygen as a ring hetero atom
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
  • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
  • A61K31/4365—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system having sulfur as a ring hetero atom, e.g. ticlopidine
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
  • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
  • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
  • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
  • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
  • A61K31/444—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/33—Heterocyclic compounds
  • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
  • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
  • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
  • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
  • A61P25/08—Antiepileptics; Anticonvulsants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
  • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
  • A61P25/16—Anti-Parkinson drugs
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
  • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
  • C07D471/12—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains three hetero rings
  • C07D471/14—Ortho-condensed systems
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D491/00—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
  • C07D491/02—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
  • C07D491/04—Ortho-condensed systems
  • C07D491/044—Ortho-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring
  • C07D491/048—Ortho-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring the oxygen-containing ring being five-membered
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07D—HETEROCYCLIC COMPOUNDS
  • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
  • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
  • C07D495/04—Ortho-condensed systems

Definitions

• Innate immunity is considered a first line cellular stress response defending the host cell against invading pathogens and initiating signaling to the adaptive immunity system. These processes are triggered by conserved pathogen-associated molecular patterns (PAMPs) through sensing by diverse pattern recognition receptors (PRRs) and subsequent activation of cytokine and type I interferon gene expression.
• PAMPs pathogen-associated molecular patterns
• PRRs pattern recognition receptors
• the major antigen-presenting cells such as monocytes, macrophages, and dendritic cells produce interferons and are critical for eliciting adaptive T- and B-cell immune system responses.
• the major PRRs detect aberrant, i.e.
• Cyclic GMP-AMP synthase (cGAS/MB2lDl) is the predominant sensor for cytosolic dsDNA originating from pathogens or mislocalization of nuclear or mitochondrial self-dsDNA.
• Binding of dsDNA to cGAS activates the synthesis of c[G(2’,5’)pA(3’,5’)p], a diffusible cyclic dinucleotide referred to as cGAMP, which travels to and activates the endoplasmic reticulum membrane-anchored adaptor protein, Stimulator of interferon genes (STING/TMEM173).
• STING Stimulator of interferon genes
• Activated STING recruits and activates TANK binding kinase 1 (TBK1), which in turn phosphorylates the transcription factor family of interferon regulatory factors (IRFs) inducing cytokine and type I interferon mRNA expression.
• IRFs interferon regulatory factors
• Type I interferons are expressed from over ten IFNA genes and one IFNB1 gene.
• the critical role of cGAS in dsDNA sensing has been established in different pathogenic bacteria, viruses, and retroviruses. Additionally, cGAS is essential in various other biological processes such as cellular senescence and recognition of ruptured micronuclei in the surveillance of potential cancer cells.
• cGAS pathway is important for host defense against invading pathogens, cellular stress and genetic factors may also cause accumulation of self-dsDNA in the cytosol, e.g. from nuclear or mitochondrial leakage. This can trigger autoinflammatory responses.
• Aicardi- Goutieres syndrome (AGS), a lupus-like severe autoinflammatory immune-mediated disorder, arises from loss-of-function mutation in TREX1, a primary DNA exonuclease responsible for degrading aberrant DNA in cytosol. Knockout of cGAS in TREX1 -deficient mice prevented otherwise lethal autoimmune responses, supporting cGAS as a drug target and driver of interferonopathies. Likewise, embryonic lethality caused by deficiency of DNase II, an endonuclease responsible for degradation of excessive DNA in lysosomes during endocytosis, is completely rescued by additional knockout of STING or cGAS.
• Inhibition of cGAS therefore, constitutes an important therapeutic strategy for preventing autoinflammatory diseases whose etiology involves anti-dsDNA antibodies.
• Systemic lupus erythematosus may be one such disease [Pisetsky, Nat Rev Rheumatol 12, 102-110 (2016)].
• Parkinson’s disease the loss of dopaminergic neurons from the substantia nigra pars compacta, the motor defect, and inflammation observed in aged Parkin knockout mutator mice, which accumulate mutations in mitochondrial DNA, are rescued by loss of STING, suggesting that inflammation facilitates this phenotype (Sliter D, 2018).
• cGAS and STING have attracted the interest of structural biologists and medicinal chemists for identification of inhibitors and/or activators.
• An in silico screening effort using murine cGAS- DNA crystal structure led to the identification of a well -characterized small- molecule anti- malarial drug, quinacrine, as a potential cGAS inhibitor [An et ah, Immunol.194, 4089-4093 (2015)].
• quinacrine a known DNA intercalator, was found to indirectly affect the cGAS activity through disruption of dsDNA conformation failing to activate the enzyme instead of directly binding and inhibiting the enzyme. Additionally, considerable off- target effect was observed through its interference with RIG-I pathway.
• Prodrugs are inactive derivatives of a drug and are designed to undergo activation under physiologic conditions after the prodrugs have accumulated in target organs. Some prodrugs can also undergo enzyme-mediated activation and can be designed to undergo both passive and receptor-mediated active cellular uptake. [0012] Small molecule inhibitors or prodrugs thereof that are specific for cGAS would be of great value in treating diseases that arise from inappropriate cGAS activity and the resulting undesired type I interferon activity.
• autoimmune diseases include Aicardi- Goutieres syndrome (AGS) and systemic lupus erythematosus (SLE), a complex chronic systemic autoimmune disease that afflicts over 1.5 million Americans.
• Aicardi- Goutieres syndrome Aicardi- Goutieres syndrome (AGS) and systemic lupus erythematosus (SLE), a complex chronic systemic autoimmune disease that afflicts over 1.5 million Americans.
• Current treatments for SLE involve immuno-suppressive regimens associated with debilitating adverse side effects.
• Other possible utilities related to the suppression of undesired type I interferon activity would include treating inflammatory bowel disease (IBD) and neurodegenerative diseases.
• IBD inflammatory bowel disease
• BBB blood-brain barrier
• R 1 is heteroaryl, halogen, aryl, cyclic amine, hydroxy, -OC(O)alkyl, -NH 2 , -N(H)CO- alkyl, or alkoxy
• R 2 is H, alkyl, -CHF 2 , -CF 3 , -CN, -OR c , halogen, or heterocyclyl
• R 3 and R 4 are independently H, halogen, -CHF 2 , -CF 3, -CN, -OR c , or -OCF 3
• R 5a and R 5b are independently H, alkyl, aryl, or cycloalkyl
• R 6 is N(H)R a , O-alkyl, OH, -CO 2 R d ; or R 5a and R 6 are taken together to form a 5-6 membered heterocyclyl
• the disclosure also relates to pharmaceutical compositions comprising a compound of formula (I), (II), or (III).
• This disclosure further provides a method of treating cGAS-related autoimmune diseases or disorders in a subject with a compound of the disclosure.
• This disclosure further provides a method of inhibiting an inflammatory response in a subject with a compound of the disclosure.
• This disclosure further provides a method of inhibiting dsDNA-triggered interferon expression in a subject with a compound of the disclosure.
• This disclosure further provides a method of treating neurodegenerative diseases or disorders in a subject with a compound of the disclosure.
• This disclosure further provides a method of treating epilepsy in a subject with a compound of the disclosure.
• This disclosure further provides a method of treating viral infection-associated dementia in a subject with a compound of the disclosure.
• This disclosure further provides a method of treating neurological disorders associated with COVID in a subject with a compound of the disclosure.
• This disclosure further relates to pharmaceutical compositions comprising a pharmaceutically acceptable carrier and a compound of the disclosure.
• Figure 1A is a volcano plot of RNA-seq data from bulk hippocampal tissue from 8-9-month-old P301S and non-transgenic mice. Red dots represent genes with
• Figure 1B is the gene set enrichment analysis showing hallmark pathways associated with top 500 DEGs upregulated in P301S compared to non-transgenic samples;
• Figure 1C is the gene set enrichment analysis showing top transcription factors associated with top 500 DEGs upregulated in P301S compared to non-transgenic samples;
• Figure 1D is the Ingenuity Pathway Analysis prediction of cGAS as an upstream regulator of upregulated DEGs, identified using Activation z-score > 1 and p-value of overlap ⁇ 0.05;
• Figure 1E is the Western blots for phosphorylated Tank binding kinase (pTBK1), total Tank binding kinase 1 (TBK1) and GAPDH.
• Figure 1J is the UMAP plots showing expression of microglial marker genes INPP5D and CSF1R as well as STAT1 and cGAS (MB21D1) in snRNA-Seq of human microglial population
• Figure 1K is the Gene set enrichment analysis showing hallmark pathways associated enriched in cGAS expressing microglia
• Figure 1L is the representative western blots for pTBK1 and GAPDH using human frontal cortex brain lysates.
• Lanes 1-3 non-AD (Braak stage 0); Lanes 4-6: AD (Braak stage 6); Figure 1M is the Ratio of pTBK1/GAPDH from (L) showing significantly higher phospho-TBK1 in human AD compared to non-AD brains. ** p ⁇ 0.01, Student’s two tailed t-test.
• Figures 2A-2J show interferon activation in tau-stimulated microglia is mediated by cGAS and mitochondrial DNA leakage;
• Figure 2A is the Quantification of IFNB by ELISA and CXCL10 and CCL5 proteins by MagPix multiplex ELISA in culture media supernatants from untreated (Ctrl) and tau-treated (Tau) primary mouse microglia.
• FIG. 2B is the epresentative western blots for phosphorylated Tank binding kinase (pTBK1), total Tank binding kinase 1 (TBK1) and GAPDH using mouse primary microglial cell lysates (Lane 1: untreated; Lane 2: treated with tau fibrils);
• Figure 2C is the Ratio of pTBK1/TBK1 from Figure 2A showing significantly higher phopho-TBK1 in tau fibril-treated primary microglia (Tau) compared to untreated (Ctrl).
• FIG. 1 Venn diagram showing overlap of genes upregulated by dsDNA and tau treatment in Cgas+/+ microglia.
• Figure 2H is the top 5 reactome pathways represented in upregulated DEGs common to dsDNA and tau treated Cgas+/+ microglia.
• Figure 2I is the heatmap summary of interferon stimulated genes that are lower in Cgas-/- compared to Cgas+/+ microglia stimulated with HT-DNA or Tau;
• Figure 2J is the string interaction plot of genes from (I) including interferon genes including Stat1, Sp100, and Ddx60.
• Figures 3A-3J show partial or complete loss of Cgas mitigates tauopathy-associated microglial interferon signature.
• Figure 3A is the Dot plot showing normalized cell type expression of Cgas (Mb21d1) and Sting (Tmem173) in single nuclei sequencing (snRNA-Seq) samples;
• Figure 3C is the UMAP plots colored according to microglial subclusters and split by genotype;
• Figure 3D is the violin plots showing expression level of homeostatic (P2ry12, Siglech), disease associated (Apoe, Itgax) and interferon (Parp14, Stat1, Trim30a, Rnf213) genes in microglia clusters;
• Figure 3E is the Dot plot showing interferon stimulated genes that are significantly lower in P301
• Figure 3H is the Heatmap showing association of gene modules with genotype
• Figure 3G is the Analysis of disease module 1 and 2 markers compared to disease associated, early response and late response microglia signatures.
• Figure 4A-4I show loss of Cgas rescues tauopathy-induced hippocampal synapse toxicity and memory deficits.
• Figure 4A is the cumulative search distance during hidden trials (Session 1- 12) in a Morris water maze (MVM) assessment of spatial learning and memory in 7–8-month-old P301S cGas +/+, P301S cGas +/-, and P301S cGas -/- and their non-transgenic littermates. Males and females were tested on separated days. Data presented here represents both sexes combined.
• Figure 4B is the percentage of time spent in the target or the average time spent in the nontarget (others) quadrants during the 24- hr probe in the MVM assessment.
• FIG. 4C is the percentage of time spent in the target or the average time spent in the nontarget (others) quadrants during the 72- hr probe in the MVM assessment. Paired two-tailed Student’s ttest; Figure 4D is the field excitatory postsynaptic potentials (fEPSPs) were recorded in the dentate gyrus molecular layer and a TBS protocol was applied (arrow) to the perforant pathway to induce LTP. Representative traces show fEPSPs before and after LTP induction (top). Scale bars, 0.4 mV and 5 ms.
• Figure 4F is the dot plot showing classification of excitatory neuron clusters by expression of granule, CA1 and CA2/3, CA2 markers;
• Figure 4G is the Pie chart summarizing the proportion of DEGs from clusters pertaining to dentate gyrus (DG), CA1 and CA2/3 clusters;
• Figure 4I is the mean intensity of PSD-95 puncta measured in CA1 striatum radiatum.
• Figure 5A is the Volcano plot showing representative differentially expressed genes that are upregulated in P301S Cgas-/- compared to P301S Cgas+/+ excitatory neurons. (log2FC>0.1, FDR ⁇ 0.05);
• Figure 5C is the Mean intensity of NRG1 measured in CA1 striatum radiatum. Each circle represents the average intensity measurement of 3 images per animal. Statistical comparisons performed using Two-way ANOVA.
• Figure 5G is the Venn diagram of the overlap between excitatory neuron DEGs, inhibitory neuron DEGs, and MEF2C target genes
• Figure 5H is the Heatmap showing the overlap between excitatory/inhibitory neuron DEGs and lists of transcription factor target genes (MEF2A, MEF2C, FOSL2, JUNB) and activity-induced differentially expressed genes (ARG and scARG).
• Figures 6A-6I show brain permeable cGAS inhibitor elevates MEF2C target genes and protects against synaptic loss and spatial learning and memory deficits.
• Figure 6A is the Venn diagram of the overlap between P301S TDI vs P301S Veh DEGs in excitatory neuron, inhibitory neuron, and MEF2C target genes;
• Figure 6B is the Heatmap showing the overlap between excitatory/inhibitory neuron DEGs and lists of transcription factor target genes (MEF2A, MEF2C, FOSL2, JUNB) and activity-induced differentially expressed genes (ARG and scARG).
• MEF2A, MEF2C, FOSL2, JUNB transcription factor target genes
• ARG and scARG activity-induced differentially expressed genes
• Figure 6E is the Novel object recognition test for Ntg and P301S mice fed with 150mg/kg TDI-6570 or control diet for three months.
• Figure 6G is the Mean intensity of PSD95 puncta measured in CA1 striatum radiatum. Each circle represents the average intensity measurement of one image. 3-5 images were taken per animal.
• FIG. 7 show Cgas deletion also modified transcriptomes of inhibitory neurons in tauopathy. Subclustering of pan-interneuron marker GAD1 and GAD2 positive neuron populations identified 9 inhibitory neuron subpopulations (Fig.6A) (Arneson et al., 2018; Cembrowski et al., 2016).
• FIG. 8A-8D shows a working model illustrating cGAS-IFN-MEF2c axis in tauopathy. Under disease/vulnerable condition, pathogenic tau activates cGAS-dependent interferon response via mtDNA leakage in microglia, and reduction of MEF2c transcriptional network in excitatory and inhibitory neurons, resulting in cognitive dysfunction.
• a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, to A only (optionally including elements other than B); or to B only (optionally including elements other than A); or yet, to both A and B (optionally including other elements); etc.
• “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items.
• the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
• This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified.
• “at least one of A and B” can refer, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); or to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); or yet, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
• the present disclosure contemplates all such compounds, including cis- and trans- isomers, R- and S-enantiomers, diastereomers, (d)-isomers, (l)-isomers, the racemic mixtures thereof, and other mixtures thereof, as falling within the scope of the disclosure. Additional asymmetric carbon atoms may be present in a substituent such as an alkyl group. All such isomers, as well as mixtures thereof, are intended to be included in this disclosure.
• a particular enantiomer of compound of the present disclosure may be prepared by asymmetric synthesis, or by derivation with a chiral auxiliary, where the resulting diastereomeric mixture is separated and the auxiliary group cleaved to provide the pure desired enantiomers.
• the molecule contains a basic functional group, such as amino, or an acidic functional group, such as carboxyl, diastereomeric salts are formed with an appropriate opticallyactive acid or base, followed by resolution of the diastereomers thus formed by fractional crystallization or chromatographic means well known in the art, and subsequent recovery of the pure enantiomers.
• prodrug as used herein encompasses compounds that, under physiological conditions, are converted into therapeutically active agents.
• a common method for making a prodrug is to include selected moieties that are hydrolyzed under physiological conditions to reveal the desired molecule. The prodrug can be converted by an enzymatic activity of the host animal.
• phrases “pharmaceutically acceptable excipient” or “pharmaceutically acceptable carrier” as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject chemical from one organ or portion of the body to another organ or portion of the body.
• Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation, not injurious to the patient, and substantially non-pyrogenic.
• materials which can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum
• compositions of the present disclosure are non-pyrogenic, i.e., do not induce significant temperature elevations when administered to a patient.
• pharmaceutically acceptable salts refers to the relatively non-toxic, inorganic and organic acid addition salts of the compound(s). These salts can be prepared in situ during the final isolation and purification of the compound(s), or by separately reacting a purified compound(s) in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed.
• Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts, and the like.
• sulfate bisulfate
• phosphate nitrate
• acetate valerate
• oleate palmitate
• stearate laurate
• benzoate lactate
• phosphate tosylate
• citrate maleate
• fumarate succinate
• tartrate naphthylate
• mesylate glucoheptonate
• lactobionate lactobionate
• laurylsulphonate salts and the like.
• the compounds useful in the methods of the present disclosure may contain one or more acidic functional groups and, thus, can form pharmaceutically acceptable salts with pharmaceutically acceptable bases.
• pharmaceutically acceptable salts refers to the relatively non-toxic inorganic and organic base addition salts of a compound(s). These salts can likewise be prepared in situ during the final isolation and purification of the compound(s), or by separately reacting the purified compound(s) in its free acid form with a suitable base, such as the hydroxide, carbonate, or bicarbonate of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary, or tertiary amine.
• Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts, and the like.
• Representative organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, and the like (see, for example, Berge et al., supra).
• a “therapeutically effective amount” (or “effective amount”) of a compound with respect to use in treatment refers to an amount of the compound in a preparation which, when administered as part of a desired dosage regimen (to a mammal, such as a human) alleviates a symptom, ameliorates a condition, or slows the onset of disease conditions according to clinically acceptable standards for the disorder or condition to be treated or the cosmetic purpose, e.g., at a reasonable benefit/risk ratio applicable to any medical treatment.
• the term “prophylactic or therapeutic” treatment is art-recognized and includes administration to the patient of one or more compound of the disclosure.
• the treatment is prophylactic, (i.e., it protects the host against developing the unwanted condition), whereas if it is administered after manifestation of the unwanted condition, the treatment is therapeutic, (i.e., it is intended to diminish, ameliorate, or stabilize the existing unwanted condition or side effects thereof).
• the term “patient” or “subject” refers to a mammal suffering of a disease, disorder, or condition.
• a patient or subject can be a primate, canine, feline, or equine.
• a patient can ne subject is a bird.
• the bird can be a domesticated bird, such as chicken.
• the bird can be a fowl.
• An aliphatic chain comprises the classes of alkyl, alkenyl and alkynyl defined below.
• a straight aliphatic chain is limited to unbranched carbon chain moieties.
• the term “aliphatic group” refers to a straight chain, branched chain, or cyclic aliphatic hydrocarbon group and includes saturated and unsaturated aliphatic groups, such as an alkyl group, an alkenyl group, or an alkynyl group.
• alkyl refers to a fully saturated cyclic or acyclic, branched or unbranched carbon chain moiety having the number of carbon atoms specified, or up to 30 carbon atoms if no specification is made.
• alkyl of 1 to 8 carbon atoms refers to moieties such as methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, and octyl, and those moieties which are positional isomers of these moieties.
• Alkyl of 10 to 30 carbon atoms includes decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl, octadecyl, nonadecyl, eicosyl, heneicosyl, docosyl, tricosyl, tetracosyl, pentacosyl, hexacosyl, heptacosyl, octacosyl, nonacosyl,trocontanyl, pentacosenyl, and hexacosenyl.
• a straight chain or branched chain alkyl can have 30 or fewer carbon atoms in its backbone (e.g., C1-C30 for straight chains, C3-C30 for branched chains), or 20 or fewer.
• Alkyl groups may be substituted or unsubstituted.
• alkylene refers to an alkyl group having the specified number of carbons, for example from 2 to 12 carbon atoms, that contains two points of attachment to the rest of the compound on its longest carbon chain.
• Non-limiting examples of alkylene groups include methylene -(CH2)-, ethylene -(CH2CH2)-, n-propylene -(CH2CH2CH2)-, isopropylene - (CH2CH(CH3))-, and the like.
• Alkylene groups can be cyclic or acyclic, branched or unbranched carbon chain moiety, and may be optionally substituted with one or more substituents.
• Cycloalkyl means mono- or bicyclic or bridged or spirocyclic, or polycyclic saturated carbocyclic rings, each having from 3 to 12 carbon atoms.
• cycloalkyls have from 3-10 carbon atoms in their ring structure, or 3-6 carbons in the ring structure. Cycloalkyl groups may be substituted or unsubstituted.
• “lower alkyl,” as used herein, means an alkyl group, as defined above, but having from one to ten carbons, or from one to six carbon atoms in its backbone structure such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and tert-butyl.
• alkenyl and “lower alkynyl” have similar chain lengths.
• a substituent designated herein as alkyl can be a lower alkyl.
• Alkenyl refers to any cyclic or acyclic, branched or unbranched unsaturated carbon chain moiety having the number of carbon atoms specified, or up to 26 carbon atoms if no limitation on the number of carbon atoms is specified; and having one or more double bonds in the moiety.
• Alkenyl of 6 to 26 carbon atoms is exemplified by hexenyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, dodenyl, tridecenyl, tetradecenyl, pentadecenyl, hexadecenyl, heptadecenyl, octadecenyl, nonadecenyl, eicosenyl, heneicosoenyl, docosenyl, tricosenyl, and tetracosenyl, in their various isomeric forms, where the unsaturated bond(s) can be located anywhere in the moiety and can have either the (Z) or the (E) configuration about the double bond(s).
• alkynyl refers to hydrocarbyl moieties of the scope of alkenyl but having one or more triple bonds in the moiety.
• alkylthio refers to an alkyl group, as defined above, having a sulfur moiety attached thereto.
• the “alkylthio” moiety can be represented by one of -(S)-alkyl, -(S)-alkenyl, -(S)- alkynyl, and -(S)-(CH2)m-R1, wherein m and R1 are defined below.
• Representative alkylthio groups include methylthio, ethylthio, and the like.
• alkoxyl refers to an alkyl group, as defined below, having an oxygen moiety attached thereto.
• Representative alkoxyl groups include methoxy, ethoxy, propoxy, tert-butoxy, and the like.
• An “ether” is two hydrocarbons covalently linked by an oxygen. Accordingly, the substituent of an alkyl that renders that alkyl an ether is or resembles an alkoxyl, such as can be represented by one of -O-alkyl, -O-alkenyl, -O- alkynyl, -O-(CH2)m-R10, where m and R10 are described below.
• amine and “amino” are art-recognized and refer to both unsubstituted and substituted amines, e.g., a moiety that can be represented by the formulae: [0064] wherein R11 and R12 each independently represent a hydrogen, an alkyl, an alkenyl, -(CH2)m-R10, or R11 and R12 taken together with the N atom to which they are attached complete a heterocycle having from 4 to 8 atoms in the ring structure; R10 represents an alkenyl, aryl, cycloalkyl, a cycloalkenyl, a heterocyclyl, or a polycyclyl; and m is zero or an integer in the range of 1 to 8.
• R11 or R12 can be a carbonyl, e.g., R11, R12, and the nitrogen together do not form an imide.
• R11 and R12 each independently can represent a hydrogen, an alkyl, an alkenyl, or -(CH2)m- R10.
• alkylamine as used herein means an amine group, as defined above, having a substituted or unsubstituted alkyl attached thereto, i.e., at least one of R11 and R12 is an alkyl group.
• amide refers to a group [0066] wherein each R13 independently represent a hydrogen or hydrocarbyl group, or two R13 are taken together with the N atom to which they are attached complete a heterocycle having from 4 to 8 atoms in the ring structure.
• aryl as used herein includes 3- to 12-membered substituted or unsubstituted single-ring aromatic groups in which each atom of the ring is carbon (i.e., carbocyclic aryl) or where one or more atoms are heteroatoms (i.e., heteroaryl).
• aryl groups include 5- to 12-membered rings, or 6- to 10-membered rings
• aryl also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings wherein at least one of the rings is aromatic, e.g., the other cyclic rings can be cycloalkyls, cycloalkenyls, cycloalkynyls, aryls, heteroaryls, and/or heterocyclyls.
• Carbocyclic aryl groups include benzene, naphthalene, phenanthrene, phenol, aniline, and the like.
• Heteroaryl groups include substituted or unsubstituted aromatic 3- to 12-membered ring structures, 5- to 12-membered rings, or 5- to 10-membered rings, whose ring structures include one to four heteroatoms.
• Heteroaryl groups include, for example, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine and pyrimidine, and the like.
• Aryl and heteroaryl can be monocyclic, bicyclic, or polycyclic.
• Each instance of an aryl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted aryl") or substituted (a "substituted aryl") with one or more substituents; e.g., for instance from 1 to 5 substituents, 1 to 4 substituents, 1 to 3 substituents, 1 to 2 substituents or just 1 substituent.
• the aromatic ring may be substituted at one or more ring positions with one or more substituents, such as halogen, azide, alkyl, aryl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido, ketone, aldehyde, ester, heterocyclyl, aromatic or heteroaromatic moieties, fluoroalkyl (such as trifluromethyl), cyano, or the like.
• substituents such as halogen, azide, alkyl, aryl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amid
• the aryl group can be an unsubstituted C5-C12 aryl or the aryl group can be a substituted C5-C10 aryl.
• halo means halogen and includes, for example, and without being limited thereto, fluoro, chloro, bromo, iodo and the like, in both radioactive and non-radioactive forms.
• Halo can be selected from the group consisting of fluoro, chloro and bromo.
• heterocyclyl or “heterocyclic group” refer to 3- to 12-membered ring structures, 5- to 12-membered rings, or 5- to 10-membered rings, whose ring structures include one to four heteroatoms.
• Heterocycles can be monocyclic, bicyclic, spirocyclic, or polycyclic. Heterocycles can be saturated or unsaturated.
• Heterocyclyl groups include, for example, thiophene, thianthrene, furan, pyran, isobenzofuran, chromene, xanthene, phenoxathiin, pyrrole, imidazole, pyrazole, isothiazole, isoxazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, pyrimidine, phenanthroline, phenazine, phenarsazine, phenothiazine, furazan, phenoxazine, pyrrolidine, o
• the heterocyclic ring can be substituted at one or more positions with such substituents as described above, as for example, halogen, alkyl, aryl, alkenyl, alkynyl, cycloalkyl, hydroxyl, amino, nitro, sulfhydryl, imino, amido, phosphate, phosphonate, phosphinate, carbonyl, carboxyl, silyl, sulfamoyl, sulfinyl, ether, alkylthio, sulfonyl, ketone, aldehyde, ester, a heterocyclyl, an aromatic or heteroaromatic moiety, -CF3, -CN, and the like.
• substituents as described above, as for example, halogen, alkyl, aryl, alkenyl, alkynyl, cycloalkyl, hydroxyl, amino, nitro, sulfhydryl, imino, amido, phosphat
• heteroaryl ring is an embodiment of a heterocyclyl group.
• the phrase “heterocyclyl group” includes fused ring species including those that include fused aromatic and non- aromatic groups.
• Representative heterocyclyl groups include, but are not limited to, piperidynyl, piperazinyl, morpholinyl, furanyl, pyrrolidinyl, pyridinyl, pyrazinyl, pyrimidinyl, triazinyl, thiophenyl, tetrahydrofuranyl, pyrrolyl, oxazolyl, imidazolyl, triazyolyl, tetrazolyl, benzoxazolinyl, and benzimidazolinyl groups.
• heterocyclyl groups include, without limitation:
• a nitrogen-containing heterocyclyl group is a heterocyclyl group containing a nitrogen atom as an atom in the ring.
• the heterocyclyl is other than thiophene or substituted thiophene.
• the heterocyclyl is other than furan or substituted furan.
• carbonyl is art-recognized and includes such moieties as can be represented by the formula: [0072] wherein X’ is a bond or represents an oxygen, a nitrogen, or a sulfur, and R14 represents a hydrogen, an alkyl, an alkenyl, -(CH2)m-R10 or a pharmaceutically acceptable salt, R15 represents a hydrogen, an alkyl, an alkenyl or -(CH2)m-R10, where m and R10 are as defined above.
• X’ is an oxygen and R14 or R15 is not hydrogen
• the formula represents an “ester.”
• X’ is an oxygen, and R14 is as defined above, the moiety is referred to herein as a carboxyl group, and particularly when R14 is a hydrogen, the formula represents a “carboxylic acid”.
• R15 is a hydrogen
• the formula represents a “formate.”
• the oxygen atom of the above formula is replaced by a sulfur
• the formula represents a “thiocarbonyl” group.
• X’ is a sulfur and R14 or R15 is not hydrogen
• the formula represents a “thioester” group.
• amido refers to a group having the formula C(O)NRR, wherein R is defined herein and can each independently be, e.g., hydrogen, alkyl, aryl or each R, together with the nitrogen atom to which they are attached, form a heterocyclyl group.
• nitro means -NO 2 ;
• halogen designates - F, -Cl, -Br, or -I;
• sulfhydryl means -SH;
• hydroxyl means -OH;
• sulfonyl means -SO 2 -;
• azido means –N3;
• cyano means –CN;
• isocyanato means –NCO;
• thiocyanato means –SCN;
• isothiocyanato means – NCS; and the term “cyanato” means –OCN.
• each expression e.g., alkyl, m, n, etc., when it occurs more than once in any structure, is intended to be independent of its definition elsewhere in the same structure.
• substituted refers to moieties having substituents replacing a hydrogen on one or more carbons of the backbone. It will be understood that “substitution” or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.
• the term “substituted” is contemplated to include all permissible substituents of organic compounds.
• the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds.
• the permissible substituents can be one or more and the same or different for appropriate organic compounds.
• the heteroatoms such as nitrogen may have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms.
• Substituents can include any substituents described herein, for example, a halogen, a hydroxyl, a carbonyl (such as a carboxyl, an alkoxycarbonyl, a formyl, or an acyl), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an alkoxy, a phosphoryl, a phosphate, a phosphonate, a phosphinate, an amino, an amido, an amidine, an imine, a cyano, a nitro, an azido, a sulfhydryl, an alkylthio, a sulfate, a sulfonate, a sulfamoyl, a sulfonamido, a sulfonyl, a heterocyclyl, an aryl, or an aromatic or heteroaromatic moiety.
• the substituents on substituted alkyls can be selected from C1-6 alkyl, C3-6 cycloalkyl, halogen, carbonyl, cyano, or hydroxyl.
• the substituents on substituted alkyls can be selected from fluoro, carbonyl, cyano, or hydroxyl. It will be understood by those skilled in the art that substituents can themselves be substituted, if appropriate.
• references to chemical moieties herein are understood to include substituted variants.
• reference to an “aryl” group or moiety implicitly includes both substituted and unsubstituted variants.
• substituted also refers to a group that is substituted with one or more groups including, but not limited to, the following groups: halogen (e.g., F, Cl, Br, and I), R, OR, ROH (e.g., CH 2 OH), OC(O)N(R) 2 , CN, NO, NO 2 , ONO 2 , azido, CF 3 , OCF 3 , methylenedioxy, ethylenedioxy, (C 3 -C 20 )heteroaryl, N(R) 2 , Si(R) 3 , SR, SOR, SO 2 R, SO 2 N(R) 2 , SO 3 R, P(O)(OR) 2 , OP(O)(OR) 2 , C(O)R, C(O)C(O)R, C(O)CH 2 C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)
• Substituted also includes a group that is substituted with one or more groups including, but not limited to, the following groups: fluoro, chloro, bromo, iodo, amino, amido, alkyl, hydroxy, alkoxy, alkylamido, alkenyl, alkynyl, alkoxycarbonyl, acyl, formyl, arylcarbonyl, aryloxycarbonyl, aryloxy, carboxy, haloalkyl, hydroxy, cyano, nitroso, nitro, azido, trifluoromethyl, trifluoromethoxy, thio, alkylthio, arylthiol, alkylsulfonyl, alkylsulfinyl, dialkylaminosulfonyl, sulfonic acid, carboxylic acid, dialkylamino and dialkylamido.
• groups including, but not limited to, the following groups: fluoro, chloro, bromo,
• the substituents can be linked to form a carbocyclic or heterocyclic ring.
• Such adjacent groups can have a vicinal or germinal relationship, or they can be adjacent on a ring in, e.g., an ortho-arrangement.
• Each instance of substituted is understood to be independent.
• a substituted aryl can be substituted with bromo and a substituted heterocycle on the same compound can be substituted with alkyl.
• a substituted group can be substituted with one or more non-fluoro groups.
• a substituted group can be substituted with one or more non-cyano groups.
• a substituted group can be substituted with one or more groups other than haloalkyl.
• a substituted group can be substituted with one or more groups other than tert-butyl.
• a substituted group can be substituted with one or more groups other than trifluoromethyl.
• a substituted group can be substituted with one or more groups other than nitro, other than methyl, other than methoxymethyl, other than dialkylaminosulfonyl, other than bromo, other than chloro, other than amido, other than halo, other than benzodioxepinyl, other than polycyclic heterocyclyl, other than polycyclic substituted aryl, other than methoxycarbonyl, other than alkoxycarbonyl, other than thiophenyl, or other than nitrophenyl, or groups meeting a combination of such descriptions.
• substituted is also understood to include fluoro, cyano, haloalkyl, tert-butyl, trifluoromethyl, nitro, methyl, methoxymethyl, dialkylaminosulfonyl, bromo, chloro, amido, halo, benzodioxepinyl, polycyclic heterocyclyl, polycyclic substituted aryl, methoxycarbonyl, alkoxycarbonyl, thiophenyl, and nitrophenyl groups.
• the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 67th Ed., 1986-87, inside cover.
• R 1 is heteroaryl, halogen, aryl, cyclic amine, hydroxy, -OC(O)alkyl, -NH 2 , -N(H)CO- alkyl, or alkoxy
• R 2 is H, alkyl, -CHF 2 , -CF 3 , -CN, -OR c , halogen, or heterocyclyl
• R 3 and R 4 are independently H, halogen, -CHF 2 , -CF 3, -CN, -OR c , or -OCF 3
• R 5a and R 5b are independently H, alkyl, aryl, or cycloalkyl
• R 6 is N(H)R a , O-alkyl, OH, -CO 2 R d ; or R 5a and R 6 are taken together to form a 5-6 membered heterocyclyl
• R 7 is independently H, alkyl, aryl, or cycloalkyl
• R 6 is
• R 1 can be substituted or unsubstituted heteroaryl.
• R 1 can be a N-containing heteroaryl.
• R 1 can be substituted or unsubstituted C-C or C-N linked monocyclic or bicyclic heteroaryl.
• R 1 can be substituted or unsubstituted aryl.
• R 1 can be ortho, meta or para aminophenyl, methoxyphenyl, or fluorophenyl.
• R 1 can be substituted or unsubstituted aryl.
• R 1 can be halogen.
• R 1 can be substituted or unsubstituted cyclic amine.
• R 1 can be functionalized and unfunctionalized azacyclobutane, azacyclobutanone, azacyclopentane, azacyclopemtanone.
• R 1 can be hydroxy.
• R 1 can be substituted or unsubstituted -OC(O)alkyl.
• R 1 can be -NH 2 .
• R 1 can be substituted or unsubstituted -N(H)COalkyl.
• R 1 can be alkoxy.
• R 1 can be C 1 -C 4 alkoxy.
• R 1 can be [0083]
• R 2 can be H.
• R 2 can be substituted or unsubstituted alkyl.
• R 2 can be C 1-4 -alkyl.
• R 2 can be -CHF 2 .
• R 2 can be -CF 3 .
• R 2 can be -CN.
• R 2 can be -OR c .
• R 2 can be -OH.
• R 2 can be OMe.
• R 2 can be halogen.
• R 2 can be Cl or F.
• R 2 can be substituted or unsubstituted heterocyclyl.
• R 2 can be substituted or unsubstituted 5- membered heterocyclyl.
• R 2 can be substituted or unsubstituted 6- membered heterocyclyl.
• R 3 can be H, R 3 can be halogen.
• R 3 can be Cl or F.
• R 3 can be -CHF 2 .
• R 3 can be -CF 3 .
• R 3 can be -CN.
• R 3 can be -OR c .
• R 3 can be -OCF 3 .
• R 4 can be H, R 4 can be halogen.
• R 4 can be Cl or F.
• R 4 can be -CHF 2 .
• R 4 can be -CF 3.
• R 4 can be -CN.
• R 4 can be -OR c .
• R 4 can be -OCF 3 .
• R 3 and R 4 can be the same, for example, R 3 and R 4 can both be halogen, such as Cl.
• R 3 and R 4 can be the different, for example, R 3 and R 4 can both be halogen, but R 3 is Cl and R 4 is F, or R 3 is H and R 4 is halogen.
• R 5a can be H.
• R 5a can be substituted or unsubstituted alkyl.
• R 5a can be methyl.
• R 5a can be substituted and unsubstituted aryl.
• R 5a can be substituted or unsubstituted cycloalkyl.
• R 5b can be H.
• R 5b can be substituted or unsubstituted alkyl.
• R 5b can be methyl.
• R 5b can be substituted or unsubstituted aryl.
• R 5b can be substituted or unsubstituted cycloalkyl.
• R 5a and R 5b can be the same, for example R 5a and R 5b can both be methyl.
• R 5a and R 5b can be the different, for example R 5a can be H, and R 5b can be methyl.
• R 6 can be N(H)R a .
• R 6 can be NH2.
• R 6 can be N(H)C(O)OtBu.
• R 6 can be O-alkyl.
• R 6 can be OH.
• R 6 can be -CO 2 R d .
• R 6 can be -OCH3, -OC2H5, -OC3H7, -OC4H9, -OC5H11, -OC6H13, - OC7H15, -OC8H17, -OC10H21, -OC12H25, -OC14H29 or -OC16H33.
• R 6 can be -NHCH3, -NHC2H5, - NHC 3 H 7 , -NHC 4 H 9 , -NHC 6 H 13 , -NHC 7 H 15 , -NHC 8 H 17 , -NHC 10 H 21 , -NHC 14 H 29 or -NHC 16 H 33 .
• R 5a and R 6 can be taken together to form a substituted or unsubstituted 5- membered heterocyclyl.
• R 5a and R 6 can be taken together to form a substituted or unsubstituted 6- membered heterocyclyl.
• R 7a can be H.
• R 7a can be alkyl.
• R 7b can be H.
• R 7b can be alkyl.
• R 7a and R 7b can be the same, for example R 7a and R 7b can both be methyl.
• R 7a and R 7b can be the different, for example R 7a can be H, and R 7b can be methyl.
• R 7a and R 7b can be taken together with the carbon to which they are attached to form a 3- membered aliphatic carbocyclic ring.
• R a can be H.
• R a can be substituted or unsubstituted alkyl.
• R a can be -COR b .
• R a can be - CON(H)R b .
• R a can be -CO 2 R e .
• R a can be -CO 2 tBu.
• R b can be substituted or unsubstituted alkyl.
• R b can be substituted or unsubstituted aryl.
• R c can be H.
• R c can be substituted or unsubstituted alkyl.
• R c can be substituted or unsubstituted -C(O)-alkyl
• R d can be H.
• R d can be substituted or unsubstituted alkyl.
• R e can be substituted or unsubstituted alkyl.
• R e can be substituted or unsubstituted aryl.
• X can be NH.
• X can be NMe.
• X can be NEt.
• X can be O.
• X can be S.
• [00103] can be a single bond . can be a double bond.
• a compound of formula (I) can be a compound selected from: [00105]
• a compound of formula (I) can be a compound selected from: [00106]
• a compound of formula (II) can be a compound selected from:
• a compound of formula (I), or (II) can be a compound from Table 1.
• All diastereomers of the compounds of the formulae (I)-(II) are contemplated herein.
• isotopomers which are compounds where one or more atoms in the compound has been replaced with an isotope of that atom.
• the disclosure relates to compounds wherein one or more hydrogen atoms is replaced with a deuterium or wherein a fluorine atom is replaced with an 19 F atom.
• Compounds of the disclosure can be synthesized by any method well known in the art.
• the disclosure relates to a method of treating cGAS-related diseases or disorders comprising the step of administering to a subject in need thereof a therapeutically effective amount of any one of the aforementioned compounds.
• the disclosure relates to a method of inhibiting an inflammatory response comprising the step of administering to a subject in need thereof a therapeutically effective amount of any one of the aforementioned compounds.
• the disclosure relates to a method of inhibiting dsDNA-triggered interferon expression comprising the step of administering to a subject in need thereof a therapeutically effective amount of any one of the aforementioned compounds.
• This disclosure further provides a method of treating a neurodegenerative disease or disorder comprising the step of administering to a subject in need thereof a therapeutically effective amount of any one of the aforementioned compounds.
• the neurodegenerative disease or disorder can be selected from the group consisting of AIDS dementia complex, Alzheimer's disease, amyotrophic lateral sclerosis, adrenoleukodystrophy, Alexander disease, Alper's disease, ataxia telangiectasia, Batten disease, bovine spongiform encephalopathy (BSE), Canavan disease, corticobasal degeneration, Creutzfeldt- Jakob disease, dementia with Lewy bodies, fatal familial insomnia, frontotemporal lobar degeneration, Huntington's disease, Kennedy's disease, Krabbe disease, Lyme disease, Machado-Joseph disease, multiple sclerosis, multiple system atrophy, neuroacanthocytosis, Niemann-Pick disease, Parkinson's disease, Pick's
• the neurodegenerative disease is selected from the group consisting of Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease, and Parkinson's disease.
• the neurodegenerative disease or disorder can be selected from the group consisting of Alzheimer’s Disease, Parkinson’s disease, Tauopathies, or Frontotemporal dementia.
• This disclosure further provides a method of treating epilepsy, including Dravet syndrome and other drug-resistant seizure.
• This disclosure further provides a method of treating viral infection-associated dementia, such as HIV dementia.
• This disclosure further provides a method of treating neurological disorders associated with COVID.
• compositions are directed to a pharmaceutical composition, comprising a compound of the disclosure and a pharmaceutically acceptable carrier.
• the pharmaceutical composition comprises a plurality of compounds of the disclosure and a pharmaceutically acceptable carrier.
• a pharmaceutical composition of the disclosure further comprises at least one additional pharmaceutically active agent other than a compound of the disclosure.
• the at least one additional pharmaceutically active agent can be an agent useful in the treatment of ischemia-reperfusion injury.
• Pharmaceutical compositions of the disclosure can be prepared by combining one or more compounds of the disclosure with a pharmaceutically acceptable carrier and, optionally, one or more additional pharmaceutically active agents.
• an “effective amount” refers to any amount that is sufficient to achieve a desired biological effect.
• an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial unwanted toxicity and yet is effective to treat the particular subject.
• the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular compound of the disclosure being administered, the size of the subject, or the severity of the disease or condition.
• a maximum dose may be used, that is, the highest safe dose according to some medical judgment. Multiple doses per day may be contemplated to achieve appropriate systemic levels of compounds. Appropriate systemic levels can be determined by, for example, measurement of the patient’s peak or sustained plasma level of the drug. “Dose” and “dosage” are used interchangeably herein. [00124] Generally, daily oral doses of a compound are, for human subjects, from about 0.01 milligrams/kg per day to 1000 milligrams/kg per day.
• Oral doses in the range of 0.5 to 50 milligrams/kg, in one or more administrations per day, can yield therapeutic results. Dosage may be adjusted appropriately to achieve desired drug levels, local or systemic, depending upon the mode of administration. For example, intravenous administration may vary from one order to several orders of magnitude lower dose per day. In the event that the response in a subject is insufficient at such doses, even higher doses (or effective higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Multiple doses per day are contemplated to achieve appropriate systemic levels of the compound. [00125] For any compound described herein the therapeutically effective amount can be initially determined from animal models.
• a therapeutically effective dose can also be determined from human data for compounds which have been tested in humans and for compounds which are known to exhibit similar pharmacological activities, such as other related active agents. Higher doses may be required for parenteral administration.
• the applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan.
• any compound of the disclosure can be administered in an amount equal or equivalent to 0.2-2000 milligram (mg) of compound per kilogram (kg) of body weight of the subject per day.
• the compounds of the disclosure can be administered in a dose equal or equivalent to 2-2000 mg of compound per kg body weight of the subject per day.
• the compounds of the disclosure can be administered in a dose equal or equivalent to 20-2000 mg of compound per kg body weight of the subject per day.
• the compounds of the disclosure can be administered in a dose equal or equivalent to 50-2000 mg of compound per kg body weight of the subject per day.
• the compounds of the disclosure can be administered in a dose equal or equivalent to 100-2000 mg of compound per kg body weight of the subject per day.
• the compounds of the disclosure can be administered in a dose equal or equivalent to 200-2000 mg of compound per kg body weight of the subject per day.
• a precursor or prodrug of the compounds of the disclosure is to be administered rather than the compound itself, it is administered in an amount that is equivalent to, i.e., sufficient to deliver, the above-stated amounts of the compounds of the invention.
• the formulations of the compounds of the disclosure can be administered to human subjects in therapeutically effective amounts. Typical dose ranges are from about 0.01 microgram/kg to about 2 mg/kg of body weight per day. The dosage of drug to be administered is likely to depend on such variables as the type and extent of the disorder, the overall health status of the particular subject, the specific compound being administered, the excipients used to formulate the compound, and its route of administration. Routine experiments may be used to optimize the dose and dosing frequency for any particular compound.
• the compounds of the disclosure can be administered at a concentration in the range from about 0.001 microgram/kg to greater than about 500 mg/kg.
• the concentration may be 0.001 microgram/kg, 0.01 microgram/kg, 0.05 microgram/kg, 0.1 microgram/kg, 0.5 microgram/kg, 1.0 microgram/kg, 10.0 microgram/kg, 50.0 microgram/kg, 100.0 microgram/kg, 500 microgram/kg, 1.0 mg/kg, 5.0 mg/kg, 10.0 mg/kg, 15.0 mg/kg, 20.0 mg/kg, 25.0 mg/kg, 30.0 mg/kg, 35.0 mg/kg, 40.0 mg/kg, 45.0 mg/kg, 50.0 mg/kg, 60.0 mg/kg, 70.0 mg/kg, 80.0 mg/kg, 90.0 mg/kg, 100.0 mg/kg, 150.0 mg/kg, 200.0 mg/kg, 250.0 mg/kg, 300.0 mg/kg, 350.0 mg/kg, 400.0 mg/kg, 450.0 mg/kg, to greater than
• the compounds of the disclosure can be administered at a dosage in the range from about 0.2 milligram/kg/day to greater than about 100 mg/kg/day.
• the dosage may be 0.2 mg/kg/day to 100 mg/kg/day, 0.2 mg/kg/day to 50 mg/kg/day, 0.2 mg/kg/day to 25 mg/kg/day, 0.2 mg/kg/day to 10 mg/kg/day, 0.2 mg/kg/day to 7.5 mg/kg/day, 0.2 mg/kg/day to 5 mg/kg/day, 0.25 mg/kg/day to 100 mg/kg/day, 0.25 mg/kg/day to 50 mg/kg/day, 0.25 mg/kg/day to 25 mg/kg/day, 0.25 mg/kg/day to 10 mg/kg/day, 0.25 mg/kg/day to 7.5 mg/kg/day, 0.25 mg/kg/day to 5 mg/kg/day, 0.5 mg/kg/day to 50 mg/kg/day, 0.5 mg/kg/day to 25 mg/kg/day, 0.5 mg/kg/day to 20 mg/kg/day, 0.5 mg/kg/day to 15 mg/kg/day, 0.5 mg/kg/kg/
• the compounds of the disclosure can be administered at a dosage in the range from about 0.25 milligram/kg/day to about 25 mg/kg/day.
• the dosage may be 0.25 mg/kg/day, 0.5 mg/kg/day, 0.75 mg/kg/day, 1.0 mg/kg/day, 1.25 mg/kg/day, 1.5 mg/kg/day, 1.75 mg/kg/day, 2.0 mg/kg/day, 2.25 mg/kg/day, 2.5 mg/kg/day, 2.75 mg/kg/day, 3.0 mg/kg/day, 3.25 mg/kg/day, 3.5 mg/kg/day, 3.75 mg/kg/day, 4.0 mg/kg/day, 4.25 mg/kg/day, 4.5 mg/kg/day, 4.75 mg/kg/day, 5 mg/kg/day, 5.5 mg/kg/day, 6.0 mg/kg/day, 6.5 mg/kg/day, 7.0 mg/kg/day, 7.5 mg/kg/day, 8.0 mg/kg/day, 8.5 mg/kg
• the compound or precursor thereof can be administered in concentrations that range from 0.01 micromolar to greater than or equal to 500 micromolar.
• the dose may be 0.01 micromolar, 0.02 micromolar, 0.05 micromolar, 0.1 micromolar, 0.15 micromolar, 0.2 micromolar, 0.5 micromolar, 0.7 micromolar, 1.0 micromolar, 3.0 micromolar, 5.0 micromolar, 7.0 micromolar, 10.0 micromolar, 15.0 micromolar, 20.0 micromolar, 25.0 micromolar, 30.0 micromolar, 35.0 micromolar, 40.0 micromolar, 45.0 micromolar, 50.0 micromolar, 60.0 micromolar, 70.0 micromolar, 80.0 micromolar, 90.0 micromolar, 100.0 micromolar, 150.0 micromolar, 200.0 micromolar, 250.0 micromolar, 300.0 micromolar, 350.0 micromolar, 400.0 micromolar, 450.0 micromolar, to greater than about 500.0 micromolar or any incremental value thereof.
• the compound or precursor thereof can be administered at concentrations that range from 0.10 microgram/mL to 500.0 microgram/mL.
• the concentration may be 0.10 microgram/mL, 0.50 microgram/mL, 1 microgram/mL, 2.0 microgram/mL, 5.0 microgram/mL, 10.0 microgram/mL, 20 microgram/mL, 25 microgram/mL.30 microgram/mL, 35 microgram/mL, 40 microgram/mL, 45 microgram/mL, 50 microgram/mL, 60.0 microgram/mL, 70.0 microgram/mL, 80.0 microgram/mL, 90.0 microgram/mL, 100.0 microgram/mL, 150.0 microgram/mL, 200.0 microgram/mL, 250.0 g/mL, 250.0 micro gram/mL, 300.0 microgram/mL, 350.0 microgram/mL, 40
• compositions of the disclosure can be administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
• an effective amount of the compound can be administered to a subject by any mode that delivers the compound to the desired surface.
• Administering a pharmaceutical composition may be accomplished by any means known to the skilled artisan.
• Routes of administration include but are not limited to intravenous, intramuscular, intraperitoneal, intravesical (urinary bladder), oral, subcutaneous, direct injection (for example, into a tumor or abscess), mucosal (e.g., topical to eye), inhalation, and topical.
• a compound of the disclosure can be formulated as a lyophilized preparation, as a lyophilized preparation of liposome-intercalated or -encapsulated active compound, as a lipid complex in aqueous suspension, or as a salt complex.
• Lyophilized formulations are generally reconstituted in suitable aqueous solution, e.g., in sterile water or saline, shortly prior to administration.
• the compounds can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art.
• Such carriers enable the compounds of the disclosure to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated.
• Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
• Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
• disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
• the oral formulations may also be formulated in saline or buffers, e.g., EDTA for neutralizing internal acid conditions or may be administered without any carriers.
• oral dosage forms of the compounds of the disclosure may be chemically modified so that oral delivery of the derivative is efficacious.
• the chemical modification contemplated is the attachment of at least one moiety to the compound itself, where said moiety permits (a) inhibition of acid hydrolysis; and (b) uptake into the blood stream from the stomach or intestine.
• moieties include: polyethylene glycol, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone and polyproline.
• Abuchowski and Davis “Soluble Polymer-Enzyme Adducts”, In: Enzymes as Drugs, Hocenberg and Roberts, eds., Wiley-Interscience, New York, N.Y., pp.367-383 (1981); Newmark et al., J Appl Biochem 4:185-9 (1982).
• Other polymers that could be used are poly-1,3-dioxolane and poly-1,3,6-tioxocane.
• polyethylene glycol moieties are suitable.
• the location of release of a compound of the disclosure may be the stomach, the small intestine (the duodenum, the jejunum, or the ileum), or the large intestine.
• One skilled in the art has available formulations which will not dissolve in the stomach, yet will release the material in the duodenum or elsewhere in the intestine. The release can avoid the deleterious effects of the stomach environment, either by protection of the compound of the disclosure or by release of the compound beyond the stomach environment, such as in the intestine.
• a coating impermeable to at least pH 5.0 is essential.
• cellulose acetate trimellitate hydroxypropylmethylcellulose phthalate
• HPMCP 50 HPMCP 55
• PVAP polyvinyl acetate phthalate
• CAP cellulose acetate phthalate
• a coating or mixture of coatings can also be used on tablets, which are not intended for protection against the stomach. This can include sugar coatings, or coatings which make the tablet easier to swallow.
• Capsules may consist of a hard shell (such as gelatin) for delivery of dry therapeutic (e.g., powder); for liquid forms, a soft gelatin shell may be used.
• the shell material of cachets could be thick starch or other edible paper.
• moist massing techniques can be used.
• the therapeutic can be included in the formulation as fine multi-particulates in the form of granules or pellets of particle size about 1 mm.
• the formulation of the material for capsule administration could also be as a powder, lightly compressed plugs or even as tablets.
• the therapeutic could be prepared by compression.
• Colorants and flavoring agents may all be included.
• the compound of the disclosure may be formulated (such as by liposome or microsphere encapsulation) and then further contained within an edible product, such as a refrigerated beverage containing colorants and flavoring agents.
• an edible product such as a refrigerated beverage containing colorants and flavoring agents.
• One may dilute or increase the volume of the therapeutic with an inert material.
• These diluents could include carbohydrates, especially mannitol, a-lactose, anhydrous lactose, cellulose, sucrose, modified dextrans and starch.
• Certain inorganic salts may be also be used as fillers including calcium triphosphate, magnesium carbonate and sodium chloride.
• Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and Avicell.
• Disintegrants may be included in the formulation of the therapeutic into a solid dosage form.
• Materials used as disintegrates include but are not limited to starch, including the commercial disintegrant based on starch, Explotab. Sodium starch glycolate, Amberlite, sodium carboxymethylcellulose, ultramylopectin, sodium alginate, gelatin, orange peel, acid carboxymethyl cellulose, natural sponge and bentonite may all be used.
• Another form of the disintegrants are the insoluble cationic exchange resins.
• Powdered gums may be used as disintegrants and as binders and these can include powdered gums such as agar, Karaya or tragacanth. Alginic acid and its sodium salt are also useful as disintegrants.
• Binders may be used to hold the therapeutic agent together to form a hard tablet and include materials from natural products such as acacia, tragacanth, starch and gelatin. Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl cellulose (CMC). Polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose (HPMC) could both be used in alcoholic solutions to granulate the therapeutic.
• An anti-frictional agent may be included in the formulation of the therapeutic to prevent sticking during the formulation process.
• Lubricants may be used as a layer between the therapeutic and the die wall, and these can include but are not limited to; stearic acid including its magnesium and calcium salts, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and waxes. Soluble lubricants may also be used such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol of various molecular weights, Carbowax 4000 and 6000. [00146] Glidants that might improve the flow properties of the drug during formulation and to aid rearrangement during compression might be added. The glidants may include starch, talc, pyrogenic silica and hydrated silicoaluminate.
• surfactant might be added as a wetting agent.
• Surfactants may include anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate.
• anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate.
• Cationic detergents which can be used and can include benzalkonium chloride and benzethonium chloride.
• Non-ionic detergents that could be included in the formulation as surfactants include lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 40, 60, 65 and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose. These surfactants could be present in the formulation of the compound of the disclosure or derivative either alone or as a mixture in different ratios.
• Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
• the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
• the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
• suitable liquids such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
• stabilizers may be added.
• Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration. [00149]
• the compositions may take the form of tablets or lozenges formulated in conventional manner.
• the compound may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art.
• Systemic formulations include those designed for administration by injection, e.g., subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal oral or pulmonary administration.
• compounds for use according to the present disclosure may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
• a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
• the dosage unit may be determined by providing a valve to deliver a metered amount.
• Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
• pulmonary delivery of the compounds disclosed herein (or salts thereof) is delivered to the lungs of a mammal while inhaling and traverses across the lung epithelial lining to the blood stream.
• Pat. No.5,284,656 granulocyte colony stimulating factor; incorporated by reference.
• a method and composition for pulmonary delivery of drugs for systemic effect is described in U.S. Pat. No.5,451,569 (incorporated by reference), issued Sep.19, 1995 to Wong et al.
• Contemplated for use in the practice of this disclosure are a wide range of mechanical devices designed for pulmonary delivery of therapeutic products, including but not limited to nebulizers, metered dose inhalers, and powder inhalers, all of which are familiar to those skilled in the art.
• Some specific examples of commercially available devices suitable for the practice of this disclosure are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St.
• each formulation is specific to the type of device employed and may involve the use of an appropriate propellant material, in addition to the usual diluents, adjuvants and/or carriers useful in therapy. Also, the use of liposomes, microcapsules or microspheres, inclusion complexes, or other types of carriers is contemplated.
• Chemically modified compound of the disclosure may also be prepared in different formulations depending on the type of chemical modification or the type of device employed.
• Formulations suitable for use with a nebulizer will typically comprise a compound of the disclosure dissolved in water at a concentration of about 0.1 to 25 mg of biologically active compound of the disclosure per mL of solution.
• the formulation may also include a buffer and a simple sugar (e.g., for inhibitor stabilization and regulation of osmotic pressure).
• the nebulizer formulation may also contain a surfactant, to reduce or prevent surface induced aggregation of the compound of the disclosure caused by atomization of the solution in forming the aerosol.
• Formulations for use with a metered-dose inhaler device will generally comprise a finely divided powder containing the compound of the disclosure suspended in a propellant with the aid of a surfactant.
• the propellant may be any conventional material employed for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof.
• Suitable surfactants include sorbitan trioleate and soya lecithin. Oleic acid may also be useful as a surfactant.
• Formulations for dispensing from a powder inhaler device will comprise a finely divided dry powder containing compound of the disclosure and may also include a bulking agent, such as lactose, sorbitol, sucrose, or mannitol in amounts which facilitate dispersal of the powder from the device, e.g., 50 to 90% by weight of the formulation.
• the compound of the disclosure can be be prepared in particulate form with an average particle size of less than 10 micrometers (mm), or 0.5 to 5 mm, for delivery to the deep lung.
• Nasal delivery of a pharmaceutical composition of the present disclosure is also contemplated.
• Nasal delivery allows the passage of a pharmaceutical composition of the present disclosure to the blood stream directly after administering the therapeutic product to the nose, without the necessity for deposition of the product in the lung.
• Formulations for nasal delivery include those with dextran or cyclodextran.
• a useful device is a small, hard bottle to which a metered dose sprayer is attached.
• the metered dose is delivered by drawing the pharmaceutical composition of the present disclosure solution into a chamber of defined volume, which chamber has an aperture dimensioned to aerosolize and aerosol formulation by forming a spray when a liquid in the chamber is compressed.
• the chamber is compressed to administer the pharmaceutical composition of the present disclosure.
• the chamber is a piston arrangement.
• Such devices are commercially available.
• a plastic squeeze bottle with an aperture or opening dimensioned to aerosolize an aerosol formulation by forming a spray when squeezed is used.
• the opening is usually found in the top of the bottle, and the top is generally tapered to partially fit in the nasal passages for efficient administration of the aerosol formulation.
• the nasal inhaler can provide a metered amount of the aerosol formulation, for administration of a measured dose of the drug.
• the compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
• compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
• Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
• Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran.
• the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
• the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
• the compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
• a compound may also be formulated as a depot preparation.
• Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
• suitable polymeric or hydrophobic materials for example as an emulsion in an acceptable oil
• ion exchange resins for example, as an emulsion in an acceptable oil
• sparingly soluble derivatives for example, as a sparingly soluble salt.
• the pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
• Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin.
• the pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
• the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see Langer R, Science 249:1527-33 (1990).
• the compound of the disclosure and optionally other therapeutics may be administered per se (neat) or in the form of a pharmaceutically acceptable salt.
• the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof.
• Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic.
• Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8- 2% w/v).
• Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
• compositions of the disclosure contain an effective amount of a compound as described herein and optionally therapeutic agents included in a pharmaceutically acceptable carrier.
• pharmaceutically acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal.
• carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
• the components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present disclosure, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
• the therapeutic agent(s), including specifically but not limited to a compound of the disclosure, may be provided in particles.
• Particles as used herein means nanoparticles or microparticles (or in some instances larger particles) which can consist in whole or in part of the compound of the disclosure or the other therapeutic agent(s) as described herein.
• the particles may contain the therapeutic agent(s) in a core surrounded by a coating, including, but not limited to, an enteric coating.
• the therapeutic agent(s) also may be dispersed throughout the particles.
• the therapeutic agent(s) also may be adsorbed into the particles.
• the particles may be of any order release kinetics, including zero-order release, first-order release, second-order release, delayed release, sustained release, immediate release, and any combination thereof, etc.
• the particle may include, in addition to the therapeutic agent(s), any of those materials routinely used in the art of pharmacy and medicine, including, but not limited to, erodible, nonerodible, biodegradable, or nonbiodegradable material or combinations thereof.
• the particles may be microcapsules which contain the compound of the disclosure in a solution or in a semi-solid state.
• the particles may be of virtually any shape.
• Both non-biodegradable and biodegradable polymeric materials can be used in the manufacture of particles for delivering the therapeutic agent(s). Such polymers may be natural or synthetic polymers. The polymer is selected based on the period of time over which release is desired.
• Bioadhesive polymers of particular interest include bioerodible hydrogels described in Sawhney H S et al. (1993) Macromolecules 26:581-7, the teachings of which are incorporated herein. These include polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate).
• the therapeutic agent(s) may be contained in controlled release systems.
• controlled release is intended to refer to any drug-containing formulation in which the manner and profile of drug release from the formulation are controlled. This refers to immediate as well as non-immediate release formulations, with non-immediate release formulations including but not limited to sustained release and delayed release formulations.
• sustained release also referred to as “extended release” is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that can results in substantially constant blood levels of a drug over an extended time period.
• delayed release is used in its conventional sense to refer to a drug formulation in which there is a time delay between administration of the formulation and the release of the drug there from. “Delayed release” may or may not involve gradual release of drug over an extended period of time, and thus may or may not be “sustained release.” [00175] Use of a long-term sustained release implant may be particularly suitable for treatment of chronic conditions. “Long-term” release, as used herein, means that the implant is constructed and arranged to deliver therapeutic levels of the active ingredient for at least 7 days, and up to 30-60 days. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above.
• mice (https://www.jax.org/strain/008169) were crossed with cGas knockout mice (https://www.jax.org/strain/026554) to generate littermate P301S cGas+/+ mice, P301S cGas+/- and littermate P301S cGas-/- mice, as well as non-transgenic littermates.
• Mice of both sexes were used behavioral, histological and biochemical analyses. Mice underwent behavioral testing at 7 to 8 months of age and had not been used for any other experiments. At 9 to 10 months of age, the same mice were used for pathology and RNA-seq studies.
• RNA isolation Brains recovered from freshly perfused mice, were dissected to isolate hippocampi and cortices. Hippocampi were split in two and frozen at -80°C, until experimentation. To isolate RNA, hippocampi were thawed on ice for 30 mins and then homogenized.
• hippocampi were passed through using a 21G needle in solution of RLT buffer containing 1% ⁇ -mercaptoethanol. Following homogenization, samples were spun down briefly and then frozen at -80°C overnight. The next day, samples were thawed on ice and then spun down at 4°C for 6 min at 14000 rpm.
• RNA isolation was performed on hippocampal lysates according to manufacturer’s protocol (RNeasy mini-kit, Qiagen). Isolated RNA was submitted to Weill Cornell Medicine Genomics Core for analysis of RNA quality and integrity. All samples passed QC and RNA sequencing libraries were prepared for sequencing using NovaSeq.
• cDNA was prepared using iScript Reverse Transcription supermix (BioRad). Rt-qPCR was performed on an ABI7900HT sequence detector (Applied biosystems) using SYBR green PCR master mix (Applied Biosystems) in triplicate. The change in Ct values between the transcript of interest and mouse GAPDH was calculated. The relative gene expression was then determined using 2 ⁇ Ct then expressed as a relative fold change.
• Western blot [00180] For mouse brain samples, half hippocampi were mechanically homogenized on ice in RIPA buffer containing protease and phosphatase inhibitors (Millipore Sigma).50ug of hippocampal lysates were used to analyze protein expression in the brain.
• Membranes were washed again to minimize non-specific binding and then treated with ECL (BioRad) for 60 seconds and developed in a dark room. Blots were scanned at 300 DPI and quantified using ImageJ.
• frontal cortex lysates were prepared as described previously (Min et al., 2010). Briefly, human or mouse brain tissues were lysed in RIPA buffer containing protease inhibitor cocktail (Sigma), 1 mM phenylmethyl sulfonyl fluoride (Sigma), phosphatase inhibitor cocktail (Roche), and HDAC inhibitors, including 5 mM nicotinamide (Sigma) and 1 mM trichostatin A (Sigma).
• lysates were centrifuged at 170,000 g at 4°C for 15 min. Supernatants were collected and analyzed by Western blot. Protein concentration was measured by BCA assay (Thermo Scientific).
• BCA assay For cultured primary microglia, 1-2 million cells were lysed in M-PERTM Mammalian Protein Extraction Reagent (Thermo Scientific) supplemented with HALT protease and phosphatase inhibitor cocktail (Thermo Scientific) and 150mM NaCl. Samples were rotated at 4°C for 10 min. Lysates were cleared by centrifugation at 16000xg for 15 min at 4°C. Protein concentration was measured by BCA assay.
• the homogenized tissue was filtered through a 35- ⁇ m cell strainer, then centrifuged at 600 g for 5 min at 4°C and washed three times with 1 ml of PBS containing 1% BSA, 20 mM DTT and 0.2 U ⁇ l ⁇ 1 recombinant RNase inhibitor. Then the nuclei were centrifuged at 600 g for 5 min at 4°C and re-suspended in 800 ⁇ l of PBS containing 0.04% BSA and 1x DAPI, followed by FACS sorting to remove cell debris. The FACS-sorted suspension of DAPI-stained nuclei were counted and diluted to a concentration of 1000 nuclei per microliter in PBS containing 0.04% BSA.
• Droplet-based single nuclei RNA sequencing [00184] For droplet-based snRNA-seq, libraries were prepared with Chromium Single Cell 3’ Reagent Kits v3 (10x Genomics, PN-1000075) according to the manufacturer’s protocol. The snRNA-seq libraries were sequenced on the NovaSeq 6000 sequencer (Illumina) with 100 cycles. Analysis of Droplet-Based Single-nuclei RNA-seq Data from Human Brain Tissue [00185] Gene counts were obtained by aligning reads to the mm10 genome with Cell Ranger software (v.3.1.0) (10x Genomics). To account for unspliced nuclear transcripts, reads mapping to pre-mRNA were counted.
• Seurat objects were converted to cds objects and analysed using Monocle 3 (Cao et al., 2019; Qiu et al., 2017; Trapnell et al., 2014).
• Moran I spatial autocorrelation analysis was performed to identify gene modules significantly associated with microglial trajectory.
• Enrichment analysis of target genes was performed with GeneOverlap package in R. Briefly, the MEF2C, MEF2A, JunB and FOSL2 target gene list, and human cognitive resilience gene lists (kindly shared by Dr. Li Huei Tsai) and P301S Cgas-/- vs P301S EN/IN DEG lists were used as the input for the comparison.
• Antibodies used in immunofluorescence analysis were as follows: Secondary antibodies used were Alexa fluor donkey anti-rabbit/goat 488 and anti-mouse 555, and Jackson donkey anti-goat 555 at 1:500 (Invitrogen).
• Antibodies used in western blot were as follows: STING (as above), TBK1 (D1B4, Cell Signaling Technology, 1:1000), pTBK1 (D52C2, Cell Signaling Technology, 1:500), Caspase-3 (9661, Cell Signaling Technology, 1:1000), GAPDH (MAB374, Millipore, 1:10000 and GTX100118, GeneTex, 1:10000). Secondaries used were anti-rabbit HRP (401393, Calbiochem, 1:2000) or anti-mouse HRP (401253, Calbiochem, 1:2000), anti-NeuN (ABN78, Millipore, 1:500).
• Sections were then placed in antigen unmasking solution (citrate buffer, pH 6.0, h-3300) and placed in a 90°C incubator for 30 min, when applicable. Sections were washed and then blocked in 10% normal donkey serum (NDS, Vector BMK-2202) in PBST for 2 hours at room temperature. Primary antibodies were diluted in 5% NDS PBST and incubated overnight at 4°C. The following day, sections were washed thoroughly and incubated in appropriate secondary antibodies (1:500, Invitrogen) for 1 hour. Sections were washed, mounted on slides and imaged using a Keyence BZ-X700 microscope.
• CA1 region of the mouse brain sections was imaged with Zeiss Apotome 20X objective (Carl Zeiss). Images were taken with Z stacks of 7 um interval at 1 um step size.
• MEF2C Images of the mouse brain CA1 pyramidal region were acquired using 25X objective of the Zeiss LSM880 confocal microscope (Carl Zeiss). A 4 by 1 tile scan and Z stack of 12um at a step size of 3 ⁇ m were used to generate maximum intensity projection, stitched images for each section.
• PSD-95, vGAT and NRG1 slides were imaged using a Zeiss LSM 880 Confocal microscope. Quantification was done using ImageJ software (NIH) using percentage area based on thresholding determined using negative and positive controls.
• Hidden platform training (days 1–7) consisted of 14 sessions (two per day, 2 hrs apart), each with two trials. The mouse was placed into the pool at alternating quadrants for each trial. A trial ended when the mouse located the platform or after 60 sec had elapsed. At 24 and 72 hrs after training, the mice were tested in probe trials, in which the hidden platform was removed, and mice were allowed to swim for 60 sec. Mice received 7 days of hidden platform training before the 24-hr and 72-hr probe trials. Visible platform testing was done 24 hrs after the last probe trial. Performance was measured with an EthoVision video tracking system (Noldus Information Technology).
• Elevated Plus Maze The maze consists of two 15 x 2-inch open arms without walls and two closed arms with walls 6.5 inches tall and is 30.5 inches above the ground. Mice were moved to the testing room 1 hr before testing to acclimate to the dim lighting. Mice were individually placed in the maze at the intersection of the open and closed arms and allowed to explore the maze for 10 min. Open Field [00195] Mice were individually placed into brightly lit automated activity chambers equipped with rows of infrared photocells connected to a computer (San Diego Instruments). Open field activity was recorded for 5 min. Recorded beam breaks were used to calculate total time of activity.
• Novel Object Recognition Test Mice were habituated to opaque open field arenas (40 x 40 cm) for two 10-minute trials spaced on the two days leading up to object recognition. Twenty-four hours after the second arena habituation trial, two identical objects (glass jars) were placed with the center of each arena. Mice were allowed to explore these objects for a single 15-minute trial. The subsequent day after object habituation, one of the identical objects were replaced with a novel object (DUPLO® block structure) for a 15-minute test period. Video recording and tracking (Ethovision v15, Noldus, Wageningen, the Netherlands) was used to determine total distance moved. An experimenter blind to the groups manually scored the time mice spent exploring each object.
• Electrophysiology The brain was quickly dissected from anesthetized mice and placed into ice-cold dissection solution containing (in mM): 210 sucrose, 2.5 KCl, 1.25 NaH2PO4, 25 NaHCO3, 7 glucose, 2 MgSO4, and 0.5 CaCl2 (gassed with 95% O2–5% CO2, pH ⁇ 7.4).
• Horizontal slices (400 ⁇ m thickness) were made on a vibratome and then the slices were incubated for 30 minutes in artificial cerebral spinal fluid (ACSF) warmed to 35°C containing (in mM): 119 NaCl, 2.5 KCl, 26.2 NaHCO3, 1 NaH2PO4, 11 glucose, 1.3 MgSO4, and 2.5 CaCl2 (gassed with 95% O2– 5% CO2, pH ⁇ 7.4).
• Slices were then kept at room temperature in oxygenated ACSF until recordings were performed.
• Field recordings were performed in the dentate gyrus molecular layer of the acute horizontal brain slices placed in a recording chamber. Slices were submerged in oxygenated ACSF that was continuously perfused at 30°C.
• the glass recording electrode ( ⁇ 3 M ⁇ pipette resistance) was filled with ACSF and lowered ⁇ 50 ⁇ m into the molecular layer of the dorsal blade of the dentate gyrus.
• a bipolar tungsten electrode (FHC, Bowdoin, ME), located ⁇ 150 ⁇ m from the recording electrode, was used to stimulate the perforant pathway inputs to the dentate gyrus.
• Stimulus pulses were generated by a Model 2100 Isolated Pulse Stimulator (A-M Systems). Responses were evoked every 30 s with stimulus intensities ranging from 5–40 ⁇ A with a 0.5-ms stimulus duration.
• the stimulus intensity was adjusted to evoke 30% of the maximal fEPSP slope to set the baseline for LTP recordings.
• LTP recordings were performed in the presence of picrotoxin (100 ⁇ M, Sigma).
• TBS ta burst stimulation
• the stimulus intensity was raised to a level that was 60% of the maximal fEPSP slope only during TBS and then returned to the stimulus intensity used during the baseline recording following TBS.
• the fEPSP slope was normalized to the baseline responses before LTP induction. Recordings were performed using a Multiclamp 700B amplifier (Molecular Devices), digitized at 10 kHz, and acquired with WinLTP software (version 1.11b, University of Bristol) and analyzed using WinLTP software. Recordings and analyses were done blind to mouse genotype. Microglia culture and isolation [00199] BV2 microglia culture.
• the BV2 microglia cell line was maintained in growth media – DMEM (Thermo Fisher) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (Life Technologies) in HERAcell 150i incubators (Caisson Labs) at 37C with 5% CO2. BV2 microglia were serially passaged once plates reached 80-90% confluency.
• DMEM heat-inactivated fetal bovine serum
• penicillin/streptomycin Life Technologies
• Tissues were dissociated in 0.25% Trypsin-EDTA for 10 min at 37°C and agitated every 5 min. Trypsin was neutralized with complete medium (DMEM (Thermo Fisher) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Hyclone), and were filtered through 70 ⁇ m cell strainers (BD Falcon) and pelleted by centrifugation at 1500 rpm. Mixed glial cultures were maintained in growth medium at 37°C and 5% CO2 for 7–10 d in vitro. Once bright round cells began to appear in the mixed glial cultures, recombinant mouse granulocyte macrophage colony stimulating factor (1ng/ml, Life Technologies) was added to promote microglia proliferation.
• DMEM Thermo Fisher
• FBS heat-inactivated fetal bovine serum
• BV2 microglia were transiently transfected with interferon beta reporter plasmid, pNiFty3-I-Lucia (Invivogen), using Lipofectamine 2000 (ThermoFisher). Transfection media was removed 6 hours post transfection and replaced with complete growth media. Selection with Zeocin was conducted for 3 weeks. Resistant cells were plated as single clones in 96-well plate (Corning).
• BV2 IfnB reporter microglia were stimulated with 0 to 10ug HT-DNA (Sigma) or cyclic GAMP (Invivogen). DNA was delivered to cells using Lipofectamine 2000 (ThermoFisher). Luciferase levels secreted in media was measured using Quanti-Luc (Invivogen). Luminescence was measured on a BioTek Synergy hybrid reader. cGas agonist assays [00203] Cell viability.
• BV2 microglia were treated with 0 to 100uM TDI 6570 solubilized in DMSO.24 hours post treatment, cell viability was measured using Cell Titer Glo assay (Promega). Briefly, cells in 96-well plate were equilibrated at room temperature for 30 minutes and then lysed. Luminescence was measure on a BioTek Synergy hybrid reader. [00204] Functional assays. Primary postnatal microglia or BV2 IfnB reporter microglia were treated with 0-50uM TDI6570, with or without HT-DNA transfection.
• BV2 IfnB reporter microglia were treated with 50-100ng/ml Ethidium Bromide (EtBr, Sigma Aldrich) or 40-80 ⁇ g/ml Dideoxycytidine (ddC, Sigma Aldrich) in DMEM supplemented with 10% FBS (GIBCO), 100 units/mL penicillin, 100 ⁇ g/mL streptomycin for seven days. On day 7, cells were detached from the plate by scraping. A portion of the cells was saved for mtDNA quantification PCR assay.
• EtBr Ethidium Bromide
• ddC Dideoxycytidine
• Nd2 The ratio of mtDNA (Nd2) versus genomic DNA (Tert) was measured by SybrGreen real-time PCR (Bio-rad Labratories) using the following primer pairs: Nd2 Forward: CCATCAACTCAATCTCACTTCTATG Nd2 Reverse: GAATCCTGTTAGTGGTGGAAGG Tert Forward: CTAGCTCATGTGTCAAGACCCTCTT Tert Reverse: GCCAGCACGTTTCTCTCGTT Enzyme-Linked Immunosorbent Assay (ELISA) and Multiplex bead-based immunoassay [00207] Cell culture media from cultured primary mouse microglia were collected 24h after stimulation and cleared by centrifugation at 2000rpm for 5min.
• the sections were collected on 200 mesh nickel grids. Briefly, sections were rehydrated in PBS. Unreacted aldehydes were quenched by 50 mM glycine in PBS followed by blocking for host of secondary AB (Aurion, EMS) for 15min at RT. Primary AB incubation was done overnight at 4°C in PBS-c (PBS+0.2% BSA-c [Aurion,EMS]). The next day, sections were washed 6x in PBS-c and incubated with secondary antibody (Aurion gold conjugate 1:100 in BB) for 1-2h at RT. Washes were done with PBS-c and then water.
• secondary AB Aurion gold conjugate 1:100 in BB
• Sections were then fixed in 2.5% glutaraldehye in 0.1 M buffer, PBS washed, contrasted with uranyl acetate and let air dry after final wash with water. Samples were viewed on a JEM 1400 electron microscope (JEOL, USA, Inc., Peabody, MA) operated at 120 kV. Digital images were captured on a Veleta 2K x 2K CCD camera (Olympus-SIS, Germany).
• TDI-6570 Pharmacokinetic evaluation of TDI-6570
• IP intraperitoneally
• EDTA-K2 both plasma
• brain tissues were collected at various time points (0.5, 2, 4, 8 and 24 hours post drug administration).
• Transcardial perfusion were performed with saline prior to brain collection.
• Bioanalysis of brain tissue and plasma extracts were performed by LC-MS/MS.
• Statistical analysis was performed using GraphPad Prism 8. All data are expressed as the mean ⁇ SEM.
• Figure 1A is a volcano plot of RNA-seq data from bulk hippocampal tissue from 8-9-month-old P301S and non-transgenic mice. Red dots represent genes with
• Figure 1B is the gene set enrichment analysis showing hallmark pathways associated with top 500 DEGs upregulated in P301S compared to non-transgenic samples;
• Figure 1C is the gene set enrichment analysis showing top transcription factors associated with top 500 DEGs upregulated in P301S compared to non-transgenic samples;
• Figure 1D is the Ingenuity Pathway Analysis prediction of cGAS as an upstream regulator of upregulated DEGs, identified using Activation z-score > 1 and p-value of overlap ⁇ 0.05;
• Figure 1E is the Western blots for phosphorylated Tank binding kinase (pTBK1), total Tank binding kinase 1 (TBK1) and GAPDH.
• Figure 1J is the UMAP plots showing expression of microglial marker genes INPP5D and CSF1R as well as STAT1 and cGAS (MB21D1) in snRNA- Seq of human microglial population
• Figure 1K is the Gene set enrichment analysis showing hallmark pathways associated enriched in cGAS expressing microglia
• Figure 1L is the representative western blots for pTBK1 and GAPDH using human frontal cortex brain lysates.
• Figure 2A is the Quantification of IFNB by ELISA and CXCL10 and CCL5 proteins by MagPix multiplex ELISA in culture media supernatants from untreated (Ctrl) and tau-treated (Tau) primary mouse microglia.
• FIG. 2B is the epresentative western blots for phosphorylated Tank binding kinase (pTBK1), total Tank binding kinase 1 (TBK1) and GAPDH using mouse primary microglial cell lysates (Lane 1: untreated; Lane 2: treated with tau fibrils);
• Figure 2C is the Ratio of pTBK1/TBK1 from Figure 2A showing significantly higher phopho-TBK1 in tau fibril-treated primary microglia (Tau) compared to untreated (Ctrl).
• FIG. 1 Venn diagram showing overlap of genes upregulated by dsDNA and tau treatment in Cgas+/+ microglia.
• Figure 2H is the top 5 reactome pathways represented in upregulated DEGs common to dsDNA and tau treated Cgas+/+ microglia.
• Figure 2I is the heatmap summary of interferon stimulated genes that are lower in Cgas-/- compared to Cgas+/+ microglia stimulated with HT- DNA or Tau;
• Figure 2J is the string interaction plot of genes from (I) including interferon genes including Stat1, Sp100, and Ddx60.
• Figure 3A is the Dot plot showing normalized cell type expression of Cgas (Mb21d1) and Sting (Tmem173) in single nuclei sequencing (snRNA-Seq) samples
• Figure 3C is the UMAP plots colored according to microglial subclusters and split by genotype
• Figure 3D is the violin plots showing expression level of homeostatic (P2ry12, Siglech), disease associated (Apoe, Itgax) and interferon (Parp14, Stat1, Trim30a, Rnf213) genes in microglia clusters
• Figure 3E is the Dot plot showing interferon stimulated genes that are significantly lower in P301S C
• Figure 3H is the Heatmap showing association of gene modules with genotype
• Figure 3G is the Analysis of disease module 1 and 2 markers compared to disease associated, early response and late response microglia signatures.
• Figures 4A is the cumulative search distance during hidden trials (Session 1-12) in a Morris water maze (MVM) assessment of spatial learning and memory in 7–8-month-old P301S cGas +/+, P301S cGas +/-, and P301S cGas -/- and their non-transgenic littermates. Males and females were tested on separated days. Data presented here represents both sexes combined.
• Figure 4B is the percentage of time spent in the target or the average time spent in the nontarget (others) quadrants during the 24-hr probe in the MVM assessment.
• FIG. 4C is the percentage of time spent in the target or the average time spent in the nontarget (others) quadrants during the 72-hr probe in the MVM assessment. Paired two-tailed Student’s ttest; Figure 4D is the field excitatory postsynaptic potentials (fEPSPs) were recorded in the dentate gyrus molecular layer and a TBS protocol was applied (arrow) to the perforant pathway to induce LTP. Representative traces show fEPSPs before and after LTP induction (top). Scale bars, 0.4 mV and 5 ms.
• Figure 4F is the dot plot showing classification of excitatory neuron clusters by expression of granule, CA1 and CA2/3, CA2 markers;
• Figure 4G is the Pie chart summarizing the proportion of DEGs from clusters pertaining to dentate gyrus (DG), CA1 and CA2/3 clusters;
• Figure 4I is the mean intensity of PSD-95 puncta measured in CA1 striatum radiatum.
• Figure 5A is the Volcano plot showing representative differentially expressed genes that are upregulated in P301S Cgas-/- compared to P301S Cgas+/+ excitatory neurons. (log2FC>0.1, FDR ⁇ 0.05);
• Figure 5C is the Mean intensity of NRG1 measured in CA1 striatum radiatum. Each circle represents the average intensity measurement of 3 images per animal. Statistical comparisons performed using Two-way ANOVA.
• Figure 5G is the Venn diagram of the overlap between excitatory neuron DEGs, inhibitory neuron DEGs, and MEF2C target genes
• Figure 5H is the Heatmap showing the overlap between excitatory/inhibitory neuron DEGs and lists of transcription factor target genes (MEF2A, MEF2C, FOSL2, JUNB) and activity-induced differentially expressed genes (ARG and scARG).
• FIG. 6 Brain permeable cGAS inhibitor elevates MEF2C target genes and protects against synaptic loss and spatial learning and memory deficits.
• Figure 6A is the Venn diagram of the overlap between P301S TDI vs P301S Veh DEGs in excitatory neuron, inhibitory neuron, and MEF2C target genes
• Figure 6B is the Heatmap showing the overlap between excitatory/inhibitory neuron DEGs and lists of transcription factor target genes (MEF2A, MEF2C, FOSL2, JUNB) and activity-induced differentially expressed genes (ARG and scARG).
• Figure 6E is the Novel object recognition test for Ntg and P301S mice fed with 150mg/kg TDI-6570 or control diet for three months.
• Figure 6G is the Mean intensity of PSD95 puncta measured in CA1 striatum radiatum. Each circle represents the average intensity measurement of one image. 3-5 images were taken per animal.
• small molecule cGas inhibitors were developed. The initial focus was on a known cGAS inhibitor, TDI-6570 1 .
• TDI-6570 inhibits both mouse and human cGAS with a sub-micromolar activity (IC50: 0.0128 ⁇ M and 0.138 ⁇ M, respectively).
• TDI-6570 was prepared in multigram scale using a 4-step process, earlier described by Lama, et al. 1
• Working model illustrating cGAS-IFN-MEF2c axis in tauopathy (Figure 7). Under disease/vulnerable condition, pathogenic tau activates cGAS-dependent interferon response via mtDNA leakage in microglia, and reduction of MEF2c transcriptional network in excitatory and inhibitory neurons, resulting in cognitive dysfunction. Loss of cGAS reduces interferon response in microglia and enhances Mef2c transcriptional network, resulting in cognitive resilience.
• Cgas deletion modified transcriptomes of inhibitory neurons in tauopathy ( Figure 8).
• cGAS-STING pathway is activated in tau transgenic mice and in human AD brains [00226]
• DEG Differential gene expression
• IRF interferon response factor
• ISRE interferon sensitive response elements
• cGAS-STING pathway activation was tested by immunoblotting for TBK1 phosphorylation and observed increased TBK1 phosphorylation in P301S hippocampal lysates (Fig.1E-F). Additionally, immunofluorescent labeling were performed and significantly increased microglial STING expression in P301S was observed compared to non-transgenic hippocampi (Fig.1G-H).
• cGAS- STING signaling contribute to interferon activation in human AD.
• Tau fibrils activate microglial interferon signaling through cGAS activation and mitochondrial DNA leakage
• Fig.2A levels of IFNB, CXCL10 and CCL5 proteins in culture media from primary microglia treated with tau fibrils using multiplex ELISA were measured and confirmed their induction in response to tau (Fig.2A).
• Tau treatment also led to robust TBK1 phosphorylation indicating that tau directly induces activation of cGAS-STING signaling in microglia (Fig.2B-C).
• mtDNA-depleted cells by treating the IfnB BV2 cells with low dose Ethidium Bromide (EtBr) or Dideoxycytidine (ddC) (Hashiguchi and Zhang-Akiyama, 2009; Kaguni, 2004) were then generated.
• EtBr Ethidium Bromide
• ddC Dideoxycytidine
• IfnB luciferase BV2 cells with Bcl2 inhibitor ABT-737 and caspase inhibitor Q-VD-OPH (QVD) to trigger mtDNA leakage without apoptosis induction (Rongvaux et al., 2014; White et al., 2014).
• ABT-737+QVD treatment activated IfnB-dependent luciferase expression, which were markedly dampened with ddC- or EtBr-induced mtDNA depletion.
• microglial cGAS promotes tau-induced interferon and inflammatory responses, overlapping with those induced by cytosolic DNA and at least partly mediated by mitochondrial DNA leakage.
• cGAS loss mitigates tauopathy-associated microglial interferon signature in vivo
• Cluster 1 expressed high levels of homeostatic genes, P2ry12 and Siglech, clusters 2, 3, and 4 showed reduced expression of these homeostatic genes and simultaneous upregulation of disease associated (Apoe, Itgax) and interferon stimulated genes (Stat1, Parp14, Trim30a and Rnf213) (Fig.3D).
• Cluster 3 was enriched with interferon genes specifically, which is distinct from cluster 4 enriched with the well-established disease- associated microglial phenotype (DAM) reported in mouse amyloid model (Keren-Shaul et al., 2017) (Fig.3D).
• DAM disease-associated microglial phenotype
• D1 Disease module 1
• D2 disease module 2
• D1 genes included DAM genes such as Apoe, Lyz2, and Itgax, while D2 was characterized by expression of interferon genes.
• D2 Compared to P301S Cgas +/+ P301S Cgas +/- and P301S Cgas -/- microglia exhibited no change in D1 module, but diminished D2 (Fig.3I). Moreover, D2 correlated most strongly with late response microglia (LRM) signature which was associated with synapse and neuron loss, and cognitive impairment in p25 induction model of neurodegeneration (Fig.3J) (Mathys et al., 2017). Loss of cGAS rescues tauopathy-induced memory deficits and hippocampal synapse loss and plasticity [00235] Our data showed that loss of cGAS fine-tunes microglial responses to suppress a subset of disease response modules.
• LRM late response microglia
• Cgas deletion affected tauopathy-induced spatial learning and memory was evaluated using the Morris Water Maze (MWM) behavioral test.
• MLM Morris Water Maze
• Fig.4A Cgas +/– and Cgas –/– mice phenocopied Cgas +/+ mice, while P301S Cgas +/+ mice exhibited impaired learning compared to non-transgenic mice, denoted by significantly higher search distance on the last hidden platform trial (Session 12).
• P301S Cgas +/- and P301S Cgas -/- mice performed similarly to Cgas +/+ mice in the hidden platform trial, showing strong protection induced by cGAS loss (Fig.4A).
• TBS induced long-term potentiation (LTP) to similar levels in P301S Cgas +/+ and P301S Cgas -/- slices at the early phase of LTP.
• LTP magnitude was significantly reduced in P301S Cgas +/+ compared to P301S Cgas -/- slices by 60 minutes post induction, indicating that the late phase LTP impairment in P301S Cgas +/+ hippocampus was rescued by Cgas deletion (Fig.4D–E).
• cGAS loss protects against tau-mediated plasticity deficits in hippocampal circuit.
• Top DEGs in the excitatory neurons included genes implicated in transcription regulation and chromatin remodeling (Mef2c, Satb1, Satb2), genes regulating excitability (a potassium channel regulator, Dpp10), and genes involved in synapse maintenance (Nrg1 Pcdh7, Pcdh5) (Jaitner et al., 2016; Li et al., 2008; Li et al., 2017; Wang et al., 2020) (Fig.5A).
• Fig.5B-C immunofluorescent labelling for NRG1 in the CA1
• Cgas deletion also modified transcriptomes of inhibitory neurons in tauopathy.
• Subclustering of pan-interneuron marker GAD1 and GAD2 positive neuron populations identified 9 inhibitory neuron subpopulations (Arneson et al., 2018; Cembrowski et al., 2016).
• Genes upregulated by Cgas deletion in interneurons included genes involved in GABAergic signaling, a GABA transporter (Slc6a1), a GABA receptor (Gabbr2), ion channels regulating neuronal excitability and firing, such as shaw- type potassium channels (Kcnc1, Kcnc2).
• Genes downregulated by Cgas deletion also included calcium channels (Cacnb2, Cacna1e), and Ryanodine Receptor-Calcium Release Channel (Ryr3) (Fig.5D).
• Cgas loss induced specific enhancement of MEF2C transcriptional network in P301S mice both as a transcription activator and a repressor in excitatory and inhibitory neurons (Fig.5I, J).
• MEF2C target genes rescued by Cgas deletion in P301S mice included genes involved in axonal guidance, dendritic growth and synaptic maintenance (Tenm3, Unc5d, Nrxn1, Lzts1 Ptprd, Fhod3, Hs6st2), and those in regulating calcium signaling/homeostasis (Cacng3, Ncald, Slc24a3) (Fig.5I).
• Cgas deletion in inhibitory neurons also rescued MEF2C target genes involved in axonal guidance, growth and synaptic maintenance (Tenm3, Unc5d, Lzts1, Ctnnd2, Cdh8, Sipa1l1), and those regulating calcium signaling/homeostasis (Ncald, Camk4) (Fig.5J).
• Mef2C target genes upregulated in Cgas –/– ENs and INs revealed multiple overlaps with genes involved in cognitive resilience in AD brains, including Ncald, Rasgef1b, Igsf3, and R3hdm2 (Fig.5K-L).
• the enhanced MEF2C transcription network could drive the protective mechanism underlying Cgas –/– neurons in the presence of tau pathology.
• Cgas deletion resulted in a striking upregulation of anti-seizure genes that were diminished in the interneurons of P301S mice (Fig.6A-D), including Scn1a. Deficiency of Scn1a leads to Dravet syndrome, an intractable childhood epilepsy with generalized tonic-clonic seizures.
• tau-induced cGAS hyperactivation promotes microglial type I interferon response, reduces neuronal MEF2C transactivation, and renders neurons vulnerable to tau toxicity (Fig.8).
• cGAS ablation diminishes microglial type I interferon response, enhances neuronal MEF2C transcription network, leading to cognitive resilience against tau pathology (Fig.8).
• Pharmacological inhibition of cGAS with TDI-6570 also enhanced MEF2C target genes and restored synaptic integrity and memory, supporting the therapeutic potential of targeting cGAS- MEF2C axis to improve resilience to treat AD.
• cGAS could be activated by leakage of DNA from mitochondria or nucleus (Rongvaux et al., 2014; White et al., 2014).
• phagocytosis tau is found in mitochondria as well as lysosomes. It is possible that entry of tau into mitochondria could cause leakage of mitochondrial DNA into the cytosol which triggers cGAS-STING activation.
• tau-induced interferon responses were reduced in a dose-dependent manner in mtDNA depleted microglia.
• TDP-43 may enter the mitochondrial matrix via the mitochondrial import inner membrane translocase TIM22, which leads to destabilization of mitochondria and mtDNA leakage (Yu et al., 2020). Whether TIM22 or other mitochondrial translocases are involved in the entry of tau into mitochondria is unknown. It is conceivable that mitochondrial stress induced by tau’s entry into mitochondria directly or indirectly leads to the leakage of mtDNA.
• MEF2C is dramatically downregulated in neurons of HIV-associated dementia patients suggesting an interplay of antiviral signaling and MEF2C transcription network could exist in the brain (Yelamanchili et al., 2010). It remains to be determined if microglial interferon can downregulate neuronal Mef2c. Mouse models with cell type-specific deletion of Cgas are needed to further dissect the link between cGAS and regulators of cognitive resilience and neuronal excitability.
• reaction mixture was filtered and purified by prep-HPLC (column: Phenomenex Luna 80*30mm*3um; mobile phase: [water(TFA)-ACN];B%: 45%- 85%,8min) to yield A-16 (6 mg, 11.9 umol, 39.9% yield, 100.0% purity) as a white solid.
• B-16 and B-17 underwent coupling with N-Boc-4-tetrahydropyridone and the resulting benzofurans B-18 and B- 19 were reacted with BBr3 to afford key intermediates B-20 and B-21.
• the latter compounds reacted with 2-acetoxyacetyl chloride in the presence of Na 2 CO 3 and the products, B-22 and B- 23, were converted to triflates B-24 and B-25 by reacting with triflic anhydride.
• B-24 and B-25 underwent Suzuki coupling with appropriate heterocyclic boronic acid derivatives to afford compounds B-(26-32) and acetate deprotection to afford the title products 22-26 and 28-29.
• Triflate B-25 was converted to a boronic acid derivative B-33, reacted with bromo-heterocycles to afford compounds B-(34-36), and subsequently deprotected to give compounds 27 and 30-31.
• Scheme 2C Synthesis of the benzofuran derivatives 27 and 30-31. [00314] Compound B-33.
• Synthesis of compounds 53-56 started with reaction of intermediate C-16 with N-Boc-protected glycine and 2-methyl alanine to afford compounds C-28 and C-29. The latter compounds reacted with triflic anhydride to afford compounds C-30 and C-31, which underwent Pd-catalyzed Suzuki coupling with the heterocycle-boronic acid derivatives to afford compounds C-(32-35), and subsequently Boc deprotection to give compounds 53-56.
• reaction mixture was filtered and purified by prep-HPLC (TFA condition; column: Phenomenex Luna 80*30mm*3um;mobile phase: [water(TFA)-ACN];B%: 40%- 75%,8min) to yield C-67 (8 mg, 17.8 umol, 48.7% yield, 100.0% purity) as a white solid.
• 1 H NMR (400MHz, DMSO-d6) ⁇ 10.70 (s, 1H), 6.96 - 6.75 (m, 2H), 4.83 - 4.67 (m, 2H), 3.98 - 3.83 (m, 2H), 3.80 - 3.65 (m, 2H), 3.15 - 2.97 (m, 2H), 1.39 (s, 9H).
• reaction was concentrated, diluted with sat.aq.Na 2 CO 3 (5 mL) and extracted with EtOAc (5 mL*5), dried over Na2SO4, filtered, concentrated and purified by prep-HPLC (column: Waters Xbridge BEH C18 100*30mm*10um; mobile phase: [water( NH4HCO3)-ACN]; B%: 15%-45%,10min) to yield 100 and 101 (2 mg, 4.3 umol, 10.3% yield, 100.0% purity) as a pale yellow solid.

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Medicinal Chemistry (AREA)
• Public Health (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Neurology (AREA)
• Neurosurgery (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Epidemiology (AREA)
• Hospice & Palliative Care (AREA)
• Psychiatry (AREA)
• Pain & Pain Management (AREA)
• Virology (AREA)
• Communicable Diseases (AREA)
• Oncology (AREA)
• Psychology (AREA)
• Rheumatology (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Publications (1)

Family

ID=85556604

Family Applications (1)

Country Status (5)

Cited By (2)

Citations (5)

• 2023
  • 2023-02-14 CA CA3252179A patent/CA3252179A1/en active Pending
  • 2023-02-14 WO PCT/US2023/062593 patent/WO2023154962A1/en not_active Ceased
  • 2023-02-14 JP JP2024547761A patent/JP2025507382A/ja active Pending
  • 2023-02-14 EP EP23710172.0A patent/EP4479134A1/en active Pending
  • 2023-02-14 US US18/838,578 patent/US20250163052A1/en active Pending

Patent Citations (5)

Non-Patent Citations (24)

Also Published As

Similar Documents

Legal Events