WO2023149593A1 - Composition containing phlorofucofuroeckol a as active ingredient for ameliorating, preventing, or treating viral infections - Google Patents

Abstract

The present invention relates to a composition and the like containing Ecklonia cava extract or phlorofucofuroeckol A as an active ingredient for ameliorating, preventing, or treating viral infections. The composition of the present invention is expected to be an effective naturally-derived anti-viral agent as the composition is derived from a natural substance long proven to be highly safe, has the benefit of having little or no adverse effects when used, and has activity that effectively inhibits proliferation of SARS-CoV-2 and variants thereof.

Description

Composition for improving, preventing or treating viral infection diseases comprising florofucopuroechol A as an active ingredient

The present invention was completed by confirming the proliferation inhibitory effect of 2019 new coronavirus (SARS-CoV-2) in florofucopuroechol A derived from Ecklonia cava, and using Ecklonia cava extract or florofucopuroechol A as an active ingredient It is to provide a composition for improving, preventing or treating a viral infection disease comprising.

Coronavirus infection (COVID-19), which first occurred in Wuhan, China in December 2019, is a 2019 novel coronavirus (SARS-CoV-2) infectious disease that spreads to more than 200 countries around the world in 3 months, creating a strong pandemic. As the virus shown, as of December 2021, more than 800,000 deaths have been reported in the United States alone, which has the world's largest medical facilities and pharmaceutical companies, and direct infections, opportunistic infections, and reinfections are occurring consecutively. In particular, rapid spread and continuous mutations are incapacitating vaccines, and drug repurposing strategies using previously developed RNA virus treatments have not been successful, so the development of new treatments is urgently needed. In the case of antibody therapeutics and protein therapeutics that block SARS-CoV-2 infection, the therapeutic effect may be reduced when mutations occur, and in the case of gene therapeutics, side effects are highly likely to occur, requiring a long period of time to verify safety. On the other hand, in the case of natural product-based treatments, they are substances that are easily used in daily life and require a short period of safety verification and are easy to mass-produce. The present invention aims to present the possibility of developing a therapeutic agent through toxicity evaluation and antiviral efficacy evaluation at the cellular level by developing a therapeutic agent based on natural products.

The technical problem to be achieved by the present invention is to provide Ecklonia cava extract, in particular, florofucopuroechol A contained in the extract for use in preventing or treating viral infections.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

In order to solve the above problems, the present invention provides a pharmaceutical composition for preventing or treating viral infectious diseases, comprising Phlorofucofuroeckol A as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating a viral infection disease comprising an Ecklonia cava extract as an active ingredient.

In addition, the present invention provides a food composition for preventing or improving viral infectious diseases, comprising florofucopuroekcol A as an active ingredient.

In addition, the present invention is a food composition for preventing or improving viral infectious diseases, comprising Ecklonia cava extract as an active ingredient.

As an embodiment of the present invention, the viral infectious disease may be coronavirus infection (COVID-19).

As another embodiment of the present invention, the florofucopuroekcol A may be derived from brown algae, and more specifically, may be derived from Ecklonia stolonifera .

As another embodiment of the present invention, the Ecklonia cava extract may contain florofucopuroechol A.

As another embodiment of the present invention, the composition may proliferate SARS-CoV-2.

As another embodiment of the present invention, the composition may inhibit the proliferation of alpha, beta, gamma, and delta variants of SARS-CoV-2.

As another embodiment of the present invention, the Ecklonia cava extract is water, alcohol having 1 to 4 carbon atoms, n-hexane, ethyl acetate, acetone, butyl acetate, 1,3-butylene glycol, methylene chloride, and mixed solvents thereof It may be extracted using one or more solvents selected from the group consisting of, preferably extracted using 70% ethanol as a solvent.

As another embodiment of the present invention, the Ecklonia cava extract may be obtained through a supercritical extraction method using dry Ecklonia cava powder with 0.5 wt% of alcohol as a co-solvent.

In addition, the present invention provides a method for treating a viral infection disease comprising the step of administering florofucopuroechol A to a subject.

In addition, the present invention provides a method for treating a viral infection disease comprising administering an Ecklonia cava extract to a subject.

As an embodiment of the present invention, the treatment method may further include determining whether the subject is infected with a virus, and the virus may be SARS-CoV-2.

As another embodiment of the present invention, the confirmation of viral infection may be performed by a method of detecting a viral protein or gene.

As another embodiment of the present invention, the viral protein may be N protein, S protein, and/or RNA dependent RNA polymerase (RdRP).

As another embodiment of the present invention, the viral gene may be N gene, S gene, and/or RdRp gene.

In addition, the present invention provides the use of Ecklonia cava extract for preparing an antiviral agent.

In addition, the present invention provides the use of phlorofucopuroecol A for the preparation of an antiviral agent.

The antiviral agent according to the present invention contains florofucopuroechol A, which can be obtained from seaweed, as an active ingredient to effectively inhibit the proliferation of SARS-CoV-2, thereby preventing and treating COVID-19. In addition, the present invention is derived from a natural product whose safety has been verified for a long time, and has the advantage of having very few or no side effects due to use. In addition, the antiviral agent of the present invention is expected to be used as an effective antiviral agent derived from natural products because it can also act on SARS-CoV-2 mutants and inhibit their proliferation.

1a and 1b are prediction results of binding between a COVID-19 protein and a ligand.

Figure 2 is the structure of Dieckol and Phlorofucofuroeckol A.

3 is a schematic diagram of a supercritical extraction device.

4 shows the results of HPLC analysis of Dieckol and Phlorofucofuroeckol A.

Figure 5a is the cytotoxicity and antiviral efficacy analysis results of Phlorofucofuroeckol A, Figure 5b is the cytotoxicity and antiviral efficacy analysis results of Dieckol.

6 is a Plaque assay result for confirming the antiviral efficacy of Phlorofucofuroeckol A.

7 is a TCID ₅₀ assay result for confirming the antiviral efficacy of Phlorofucofuroeckol A.

Figure 8 shows the results of immunofluorescence staining of DAPI and S protein after treating cells infected with SARS-CoV-2 with Remdesivir, Dieckol, or Phlorofucofuroeckol A.

FIG. 9 is a graph showing the ratio of total cells and cells infected with SARS-CoV-2 in FIG. 8 .

FIG. 10 compares the expression levels of N protein and S protein of SARS-CoV-2 after treatment with Remdesivir, Dieckol, or Phlorofucofuroeckol A in cells infected with SARS-CoV-2.

11 is a comparison of the expression levels of the RdRp gene and the N gene of SARS-CoV-2 after treatment with Remdesivir, Dieckol, or Phlorofucofuroeckol A in cells infected with SARS-CoV-2.

Figure 12 compares and confirms the degree of virus infection by treating cells treated with Remdesivir, Dieckol, or Phlorofucofuroeckol A with a pseudovirus having only the Spike gene of SARS-CoV-2.

13 shows the results of immunofluorescence staining of DAPI and S protein after treating cells infected with SARS-CoV-2 alpha, beta, gamma, or delta mutants with Phlorofucofuroeckol A.

FIG. 14 is a graph showing the ratio of total cells and cells infected with SARS-CoV-2 mutants in FIG. 13 .

Figure 15 compares the expression levels of N protein and S protein after treating cells infected with SARS-CoV-2 mutants with Phlorofucofuroeckol A.

16 shows comparison of expression levels of RdRp gene and N gene after treatment with Phlorofucofuroeckol A in cells infected with SARS-CoV-2 mutants.

As a result of intensive research to develop a natural product-based antiviral drug, the present inventors identified Phlorofucofuroeckol A, which can effectively inhibit the growth of SARS-CoV-2 and its variants in Ecklonia cava, a seaweed. completed the present invention.

More specifically, the present inventors secured Autodock4 by securing the tertiary structure of seaweed metabolites from the seaweed metabolome database and pubchem, and securing the structures of Spike protein, NSP9, NSP15, RdRp, PLpro, and 3CLpro of SARS-CoV-2. Through this, protein-ligand binding was predicted, and Dieckol and phlorofucofuroeckol A derived from Ecklonia cava were screened as candidates (Example 1).

Next, the present inventors dried and pulverized Ecklonia cava powder to prepare Ecklonia cava powder, prepared Ecklonia cava supercritical fluid extract using 0.5 wt% alcohol as a co-solvent, and centrifuged the extract to obtain a concentrate of the supernatant. Dieckol and Phlorofucofuroeckol A were purified to high purity by preparative HPLC after fractionation and concentration of the concentrate with hexane, chloroform, and ethyl acetate, dissolving in acetonitrile (Example 2).

In addition, the present inventors confirmed the cytotoxicity and virus sensitivity of purified Dieckol and Phlorofucofuroeckol A. As a result, it was confirmed that Dieckol has high toxicity compared to its antiviral effect, and its application as a therapeutic agent is limited. Phlorofucofuroeckol A has low cytotoxicity and high sensitivity to viruses, confirming its potential as a relatively safe antiviral agent.

Accordingly, the present inventors tried to confirm the antiviral efficacy of Phlorofucofuroeckol A against SARS-CoV-2 through specific experiments, and compared the antiviral efficacy of Phlorofucofuroeckol A with Diekol and Remdesivir, a known antiviral agent. As a result, it was confirmed that Phlorofucofuroeckol A was able to inhibit the proliferation of the virus to a remarkably high level compared to Diekol, although it was less than Remdesivir (Example 4).

On the other hand, the present inventors confirmed through specific experiments that Phlorofucofuroeckol A did not block the intracellular penetration of SARS-CoV-2 (Example 5).

In addition, the present inventors conducted specific experiments to confirm that Phlorofucofuroeckol A can also act on SARS-CoV-2 mutants and be used as a general-purpose antiviral agent. The effect of Phlorofucofuroeckol A on CoV-2 proliferation was confirmed. As a result, it was found that Phlorofucofuroeckol A could effectively inhibit the proliferation of all SARS-CoV-2 variants (Example 6).

From the above, the present inventors can provide Ecklonia cava extract containing Phlorofucofuroeckol A as an active ingredient and Phlorofucofuroeckol A itself for use in preventing or treating viral infections.

Accordingly, the present invention provides a pharmaceutical composition for the prevention or treatment of viral infections comprising Ecklonia cava extract or Phlorofucofuroeckol A as an active ingredient.

In addition, the present invention provides a method for treating a viral infection disease comprising administering Ecklonia cava extract or Phlorofucofuroeckol A to a subject.

The treatment method of the present invention may further include a step of confirming whether or not the subject is infected with the virus before and/or after the administration.

In the present invention, " Eckloina cava " is a seaweed plant of the brown algae plant Laminariales seaweed family (Alariaceae), and mainly inhabits the southern coast of Korea, Jeju coast, and Japan. Ecklonia cava mainly feeds on abalone and conch, and is used as a major raw material for making alginic acid or potassium iodine.

On the other hand, Ecklonia stolonifera is a brown algae of the same species as Ecklonia stolonifera and contains a large amount of Phlorofucofuroeckol A. may not be limited.

In the present invention, “viral infectious disease” specifically refers to an RNA viral infectious disease, and may in particular be COVID-19, an infectious disease of SARS-CoV-2 and its variants.

In the present invention, "individual" refers to all mammals, including humans, exposed to an environment with a high possibility of viral infection or infected with a virus. The animal may be not only humans but also mammals such as cattle, horses, sheep, pigs, goats, camels, antelopes, dogs, and cats that require treatment for similar symptoms, but are not limited thereto.

In the present invention, "prevention" means any action that delays the onset of a viral infectious disease by inhibiting the proliferation of viruses by administration of the pharmaceutical composition according to the present invention, and "treatment" means the use of the pharmaceutical composition according to the present invention It refers to all activities that improve or beneficially change the symptoms of the viral infectious disease by administration.

In the present invention, "administration" means introducing the pharmaceutical composition of the present invention to a patient by any appropriate method, and the route of administration of the composition of the present invention is through various oral or parenteral routes as long as it can reach the target tissue. can be administered.

In the present invention, cultivated or commercially available Ecklonia cava for preparing the Ecklonia cava extract may be used without limitation.

The Ecklonia cava extract of the present invention can be extracted according to a conventional method known in the art for extracting an extract from a natural product, that is, using a conventional solvent under normal temperature and pressure conditions. For example, in the present invention, the Ecklonia cava extract is selected from the group consisting of water, alcohol having 1 to 4 carbon atoms, n-hexane, ethyl acetate, acetone, butyl acetate, 1,3-butylene glycol, methylene chloride, and mixed solvents thereof. It can be extracted using one or more solvents, and the method for extracting Ecklonia cava extract can be extracted through various methods such as hot water extraction, cold extraction, reflux extraction, ultrasonic extraction, and supercritical extraction. No, preferably, a supercritical extraction method may be used.

The prepared extract may then be filtered, concentrated, or dried to remove the solvent, and all of the filtration, concentration, and drying may be performed, and the filtration, concentration, or drying may be performed several times. For example, filtration may be performed using filter paper or a vacuum filter, concentration may be performed using a vacuum concentrator, and drying may be performed by a spray drying method, a freeze drying method, and the like, but is not limited thereto.

The pharmaceutical composition of the present invention may further include suitable carriers, excipients or diluents commonly used in the preparation of pharmaceutical compositions. A composition containing a pharmaceutically acceptable carrier may be in various oral or parenteral formulations. When formulated, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration may include tablet pills, powders, granules, capsules, etc., and such solid preparations may contain at least one excipient such as starch, calcium carbonate, sucrose or lactose in one or more compounds. It can be prepared by mixing lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. there is. Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

In addition, the pharmaceutical composition of the present invention is not limited thereto, but tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations And it may have any one formulation selected from the group consisting of suppositories.

The pharmaceutical composition of the present invention may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically applied) depending on the desired method, and the dosage depends on the condition of the patient (or individual) and It varies depending on body weight, severity of disease, drug type, administration route and time, but can be appropriately selected by those skilled in the art.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, activity of the drug, It may be determined according to factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, body weight, absorption rate, inactivation rate and excretion rate of the active ingredient in the body, type of disease, and concomitant drugs, generally 0.001 to 150 mg, preferably 0.01 to 100 mg per 1 kg of body weight may be administered daily or every other day, or divided into 1 to 3 times a day. However, since it may increase or decrease depending on the route of administration, severity of obesity, gender, weight, age, etc., the dosage is not limited to the scope of the present invention in any way.

The present invention may be pet food, animal feed, etc. processed as pet food, and pharmaceuticals for animals.

The composition of the present invention can be used alone or in combination with known antiviral agents for the prevention and treatment of viral infections.

In addition, the Ecklonia cava extract or Phlorofucofuroeckol A of the present invention can be used in food for preventing or improving viral infection diseases, and can be included as an additive in food for preventing or improving the disease.

In the present invention, 'food' means a functional food for preventing and improving viral infectious diseases, and is added to food materials such as beverages, teas, spices, chewing gum, confectionery, etc., or manufactured into encapsulated, powdered, suspension, etc. This means that when ingested, it brings about a specific effect on health, but unlike general medicines, it has the advantage of not having side effects that may occur when taking medicines for a long period of time using food as a raw material. The health functional food of the present invention obtained in this way is very useful because it can be consumed on a daily basis.

The food composition according to the present invention includes all foods such as beverages, meat, chocolate, food, confectionery, pizza, ramen, other noodles, gum, ice cream, alcoholic beverages, and vitamin complexes. Although it cannot be uniformly defined depending on the type of food, it can be added within a range that does not impair the original taste of the food, and is usually in the range of 0.01 to 50% by weight, preferably 0.1 to 20% by weight relative to the target food. In addition, in the case of food in the form of granules, tablets or capsules, it is usually added in the range of 0.1 to 100% by weight, preferably 5 to 100% by weight.

In the present invention, it may be characterized in that the food composition further comprises a food additive acceptable food additives.

The functional food of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients. The aforementioned natural carbohydrates include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as thaumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used.

The ratio of the natural carbohydrate is preferably selected in the range of 0.01 to 0.04 parts by weight, preferably about 0.02 to 0.03 parts by weight, per 100 parts by weight of the health food of the present invention.

In addition to the above, the functional food of the present invention includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, It may contain alcohol, a carbonating agent used in carbonated beverages, and the like. In addition, the functional food of the present invention may contain fruit flesh for the production of natural fruit juice, fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health food of the present invention.

Hereinafter, embodiments will be described in detail with reference to the accompanying drawings. However, since various changes can be made to the embodiments, the scope of the patent application is not limited or limited by these embodiments. It should be understood that all changes, equivalents or substitutes to the embodiments are included within the scope of rights.

Terms used in the examples are used only for descriptive purposes and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as "include" or "have" are intended to designate that there is a feature, number, step, operation, component, part, or combination thereof described in the specification, but one or more other features It should be understood that the presence or addition of numbers, steps, operations, components, parts, or combinations thereof is not precluded.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiment belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in the present application, they should not be interpreted in an ideal or excessively formal meaning. don't

In addition, in the description with reference to the accompanying drawings, the same reference numerals are given to the same components regardless of reference numerals, and overlapping descriptions thereof will be omitted. In describing the embodiment, if it is determined that a detailed description of a related known technology may unnecessarily obscure the gist of the embodiment, the detailed description will be omitted.

[Experiment method]

1.Virus infection

Vero E6 cells were treated with test substances (Remdesivir-4 uM, Dieckol-4 uM, Phlorofucofuroeckol A-4 uM) and cultured in an incubator at 37°C for 1 hour. Then, SARS-CoV-2 at 0.1 MOI was administered to Vero E6 cells. After 1 hour of infection, viruses in the culture medium were removed by washing three times with PBS, and the medium was replaced with DMEM containing the same concentration of the test substance and 2% FBS as before infection.

2. RNA extraction and qRT PCR

TriZol (Invirtrogen, USA, Cat no. 15596026) was treated with 500ul of the cells from which the supernatant was removed to lyse the cells, and the recovered cells were treated with 100ul of Chloroform (Sigma, USA, C2432). After the sample was centrifuged at 13000 rpm for 10 minutes, the collected supernatant was treated with 250ul 2-propanol (Merk, USA, 109634) and stored at 4°C for 10 minutes. Subsequently, RNA was precipitated by centrifugation at 13000 rpm for 15 minutes, and the supernatant was removed, followed by treatment with 500 ul of 75% Ethanol (Merk, USA, 100983). After centrifugation at 7000 rpm for 5 minutes, Ethanol is removed, dried for 10 minutes, and RNA is eluted with RNase-free distilled water. RNA was treated at 55 ° C. for 10 minutes and then quantified at 100 ng / ul to synthesize cDNA. For cDNA synthesis, polymerase chain reaction (PCR) was performed using All-in-One cDNA Master Mix (Cellsafe, Korea, Cat no. CDS-200) at 25°C for 5 minutes, 42°C for 1 hour, and 85°C for 5 seconds. proceed Using the synthesized cDNA as a template, quantitative real-time polymerization chain reaction (qRT-PCR) was performed with iQ SYBR Green (Bio-Rad, USA, Cat no. BR1708882) at 95°C for 10 seconds, 55°C for 30 seconds, and repeated 40 times. do. Information on the primers used is summarized in Table 1 below.

gene	primer	Base sequence (5' → 3')	sequence number
Actin	Forward	TGACAGCAGTCGGTTGGAGCG	One
	Reverse
GACTTCCTGTAACAACGCATCTCATA	2
Nucleocapsid	Forward		TAATCAGACAAGGAACTGATTA	3
	Reverse		CGAAGGTGTGACTTCCATG	4
RdRp	Forward		AGAATAGAGCTCGCACCGTAG	5
	Reverse		CTCCTCTAGTGGCGGCTATT	6

3. Immunofluorescence staining (IFA)

After removing the supernatant, the cells were washed with PBS, fixed with methanol:aceton (1:1) fixative for 10 minutes, and then washed three times with PBS. Thereafter, the cells were treated with 500ul of 5% bovine serum albumin (Bovogen, Austrailia, Cat no. BSAS0.1) diluted in PBS and reacted for 1 hour. After removing 5% bovine serum albumin, dilute SARS-CoV-2 NP antibody (Sinobio, China, Cat no. 40143-T62) capable of detecting SARS-CoV-2 Nuclocapside protein in 5% BSA at a ratio of 1:5000. and react for 1 hour 30 minutes. After washing three times with PBS, Mouse IgG (H + L), F (ab') 2 Fragment (Alexa Fluor 488) antibody (Cell signaling, USA, Cat no. 4408S) was diluted in PBS at a ratio of 1:2000 and 1 reacted over time. After washing with PBS, DAPI (Thermo, USA, Cat no. D1306) was diluted in PBS at a ratio of 1:2000 and reacted for 30 minutes. After washing three times with PBS, the degree of virus proliferation was evaluated under a fluorescence microscope.

4. Western blot

Western blot was performed through the following steps:

1. After 24 hours of viral infection, the supernatant was removed, the cells were washed with PBS, and RIPA lysis buffer containing protease inhibitor (Thermofisher, USA, Cat no. 78425) and phosphatase inhibitor (Thermofisher, USA, Cat no. 78420) was used. (Biosesang, catalog. RC2002-050-00) is processed and dissolved.

2. After centrifugation at 15000g, 4℃, 15 minutes, transfer the supernatant to a new tube.

3. The supernatant, Protein sample buffer (Bio-Rad, catalog. 1610747), and 2-Mercaptoethanol (Bio-Rad, catalog. 1610710) were mixed at a ratio of 3: 0.9: 0.1 and heated at 100 ° C for 10 minutes. Then, prepare protein samples by cooling in ice water.

4. Electrophoresis of the protein sample on SDS-PAGE gel and transfer to PVDF membrane.

5. Add blocking buffer (5% BSA diluted with PBS) to Membrane and incubate for 1 hour at room temperature.

6. Add 1 ug of antibody (Sino Biological, SP-catalog. 40589-T62/ NP-catalog. 40143-T62) to each membrane to SARS-CoV-2 Spike, N protein, shake and incubate at 4℃ for 16 hours .

7. After washing with TBS-T 6 times at 5-minute intervals, treat 1 ug of rabbit antibody (Cell Signaling, catalog. 7074) as a secondary antibody and incubate for 1 hour at room temperature.

8. After washing 6 times with TBS-T at 5-minute intervals, treat the membrane with ECL (ELPIS-BIOTECH, catalog. EBP-1073).

9. Expose the membrane to X-ray film in a darkroom for 5 minutes, and detect protein bands by processing the developer (Duksan General Science, catalog. 0514_00004) and the fixer (Duksan General Science, catalog. 0514_00003).

5. Pseudovirus production

Pseudovirus was created through the following steps:

1. After mixing 2ug each of the three plasmids of pLV-Luc, psPAX2, and pAGCN-SARS-CoV-2 S gene and 12ul lipofectamine 2000 (Thermo Fisher Scinetific, catalog. 11668500), treat HEK293T cells and incubate for 3 days.

2. Put the cells and supernatant in a cornical tube, centrifuge at 1000 rpm, 4℃ for 5 minutes, and transfer the supernatant to a new tube.

3. After mixing the Lenti-X concentrator (takarabio, catalog. 631231) with the supernatant at a ratio of 1: 3, set aside in a refrigerator at 4℃ for 16 hours.

4. Centrifuge at 1500g, 4℃, 45 minutes and remove the supernatant.

5. Suspend the precipitated pellet in serum-free DMEM and store at -80℃ until use.

6. Pseudovirus efficiency test

1. HEK293T cells are infected with the pesudovirus, and after 24 hours, the cells are lysed by treating the cells with reporter lysis buffer (promega, catalog. E1531).

2. Dispense the lysate into a 96-well white plate, mix the same amount of Bright-Glo reagent (promega. catalog. E2610), and measure the luminescence with a luminometer (promega, catalog. GM3000) to confirm the infection efficacy of the pseudovirus. .

7. Luminescence measurement

1. Treat HEK293T cells with each test substance (Dieckol-4 uM, Phlorofucofuroeckol A-20 uM, Siphonaxanthin-10 uM) and incubate in a 37°C incubator for 1 hour.

2. Infect with 130 ul pseudovirus (about 10,000 luminescence).

3. 4 hours after infection, replace the medium with DMEM containing 5% FBS.

4. After 24 hours, the cells are lysed with reporter lysis buffer.

3. Dispense the lysate into a 96-well white plate and measure the luminescence by mixing the same amount of Bright-Glo reagent.

[Experiment result]

Example 1. In silico screening of antiviral active materials against seaweed-derived SARS-CoV-2

Information on 1110 compounds was obtained from the Seaweed Metabolite Database (https://www.swmd.co.in/) and pubchem (https://pubchem.ncbi.nlm.nih.gov/ ) to obtain the tertiary structure of each seaweed metabolite, and known to be involved in the infection, replication and proliferation of SARS-CoV-2 from the Protein Data Bank (https://www.rcsb.org/) The tertiary structures of Spike protein (6VW1), NSP9 (6W4B), NSP15 (6VWW), RdRp (6M71), PLpro (6W9C), and 3CLpro (6LU7) were obtained from Autodock4 (https://autodock.scripps.edu /) was used to predict protein-ligand binding (Molecular docking) (Figs. 1a and 1b).

As a result, Dieckol and phlorofucofuroeckol A derived from seaweeds that have high bonding strength and are native to Korea were selected as candidates.

Example 2. Ecklonia ( Ecklonia cava ) Purification of Dieckol and Phlorofucofuroeckol A from

1 kg of Ecklonia cava from Wando was washed, dried in hot air at 60 ° C, then pulverized to 500 mesh or less, placed in a 200mL stainless steel extraction container of the supercritical extraction device shown in FIG. An Ecklonia cava supercritical fluid extract was prepared according to the extraction time (5 hours) and temperature (60 ° C) using % alcohol as a co-solvent.

The Ecklonia cava supercritical extract was centrifuged to remove the pellet, the supernatant was concentrated with a rotary concentrator, and then fractionated with hexane, chloroform, and ethyl acetate, concentrated, and then aceto Dieckol and Phlorofucofuroeckol A were purified to high purity by adding and dissolving nitrile (Acetonitrile) and injecting 5 ml each into preparative HPLC (Preparative HPLC, LC-6AD HPLC system, Shimadzu, Japan).

water as mobile phase A and acetonitrile as mobile phase B at a flow rate of 5.0 ml/min, 0-40 minutes, 10-40% B; 40-50 min, 40-50% B; Gradient elution with 50-10% B for 50-60 minutes was performed at 25°C using a reversed-phase column (Cosmosile packed column, 5C18-AR-II, 10ID × 250 mm, Nacalai tesque, Japan) protected by a guard column as the stationary phase. and each peak at 290 nm was recovered.

The HPLC analysis conditions for Dieckol and Phlorofucofuroeckol A were performed according to the method of Goo et al. (2010), and all HPLC analyzes were performed using an LC-20AD HPLC system (Shimadzu, Japan) equipped with a tunable absorbance detector (Shimadzu, PDA). It was performed using Phlorofucofuroeckol A is water and 0.2% formic acid as mobile phase A, and acetonitrile and 0.2% formic acid as mobile phase B at a flow rate of 1 mL/min for 0-17 minutes, 13-15% B; 17-30 min, 15-27% B; 30-40 min, 27% B; 40-45 min, 27-60% B; 45-48 min, 60% B; 48-50 min, 60-13% B; Gradient elution with 13% B for 50-60 minutes was confirmed by HPLC at 254 nm. All reverse-phase HPLC analyzes were performed at 25° C. using a reverse-phase column (Sunfire C18, 5.0 μm particle size, 4.8 × 250 mm, Waters, USA) protected by a guard column having the same stationary phase.

Separated and purified Dieckol and Phlorofucofuroeckol A were diluted, filtered out using a 0.22 μm membrane filter, and injected 20 μl each, respectively, and analyzed.

As a result, as shown in FIG. 4, it was confirmed through HPLC analysis that the purity of Dieckol and phlorofucofuroeckol A purified from Ecklonia cava was 90% or more.

Example 3. Confirmation of cytotoxicity and antiviral efficacy of Dieckol and phlorofucofuroeckol A

Two types of phlorotannins (Phlorofucofuroeckol A and Diekol) were treated with Vero E6 cells at different concentrations, and after selecting a concentration that exhibited 50% cytotoxicity and 50% antiviral efficacy, the sensitivity of the two substances to viruses (SI , sensitivity index) was calculated.

As a result, as shown in FIG. 5, Phlorofucofuroeckol A was identified as a very safe drug with an SI value of 18.75 and effectively blocks viral growth, whereas Diekol was identified as a dangerous drug due to its high toxicity compared to its antiviral efficacy.

Example 4. Verification of antiviral efficacy of Phlorofucofuroeckol A against SARS-CoV-2

4-1. Confirmation of antiviral efficacy through plaque assay

Vero E6 cells were cultured in a 12 well plate at 3 × 10 ⁵ /well, treated with two types of phlorotannins at each concentration, and then infected with SARS-CoV-2.

As a result, as shown in FIG. 6 , it was not confirmed that there was a significant difference in the number of plaques in the Diekol-treated group depending on whether or not the treatment was performed and the treatment concentration. However, it was confirmed that the proliferation of SARS-CoV-2 was significantly reduced in cells treated with 4 μM of Phlorofucofuroeckol A compared to cells in the drug-untreated group (PC, positive control).

4-2. Confirmation of antiviral efficacy through TCID ₅₀ assay

Based on the antiviral efficacy test and toxicity test results of Examples 3 and 4 described above, the concentrations of Phlorofucofuroeckol A and Diekol were selected at 4 μM, and Remdesivir, the only SARS-CoV-2 drug approved by the US FDA, was used as a positive control. . SARS-CoV-2 was infected through decimal serial dilution, each drug was treated, and the virus titer was confirmed.

As a result, as shown in FIG. 7, the Diekol-treated group showed a slight difference in viral titer compared to the drug-untreated group (N.T.), but the Phlorofucofuroeckol A-treated group showed a decrease of about 97% in viral titer compared to the N.T. group. I was able to confirm.

4-3. Confirmation of antiviral efficacy through immunofluorescence staining

Immunofluorescence staining was used to observe changes in the proliferative ability of living SARS-CoV-2. In the drug-untreated group (N.T.), the virus proliferated explosively, whereas in the cells treated with Phlorofucofuroeckol A, the virus proliferation rate was significantly reduced [FIG. 8]. Cells in which the virus proliferated (SARS-CoV-2 infected cells) compared to total cells were counted and tabulated (FIG. 9).

4-4. Confirmation of virus proliferation inhibitory effect

To confirm whether Phlorofucofuroeckol A can inhibit viral growth, Vero E6 cells were treated with 4 µM Phlorofucofuroeckol A, and 24 hours later, the expression levels of S and N proteins, and the levels of N and RdRp genes were examined. The comparative experimental group was treated with the same amount of Diekol, and the positive control group was treated with Remdesivir.

As a result, as shown in FIG. 10, the expression of S protein and N protein could not be confirmed in the cells treated with Remdesivir, and N.T. Compared to the group, significantly lower levels of S protein and N protein expression were confirmed. In particular, the S protein could hardly be identified, and the N protein was found in N.T. Compared to the group, it was confirmed that the level was reduced by about 80%.

In addition, as shown in FIG. 11, it was confirmed that the expression levels of N gene and RdRp gene were significantly reduced in the Phlorofucofuroeckol A-treated group compared to the N.T. group in terms of gene duplication level.

Example 5. Verification of whether Phlorofucofuroeckol A blocks SARS-CoV-2 infection

In Example 4, it was confirmed that Phlorofucofuroeckol A inhibits RNA replication, protein expression, and virus proliferation of SARS-CoV-2. Next, we tried to determine whether Phlorofucofuroeckol A is also involved in SARS-CoV-2 infection. Therefore, a pseudovirus without viral genes was produced with only the S protein of SARS-CoV-2 required for viral infection. The produced pseudovirus contained the luciferase gene to easily check whether cells were infected with the virus. Cells pretreated with Phlorofucofuroeckol A were infected with the pseudovirus having the S protein and luciferase gene, and luminescence was measured to confirm the degree of decrease in infectivity of the pseudovirus by Phlorofucofuroeckol A.

As a result, as shown in FIG. 12, it was found that the luciferase activity was highly increased in the cells of the drug-untreated group, indicating that the manufactured pseudovirus infects the cells well, and the luciferase activity does not decrease in the cells treated with Phlorofucofuroeckol A. From this, it was found that Phlorofucofuroeckol A was not involved in the viral infection step.

Example 6. Confirmation of antiviral efficacy of Phlorofucofuroeckol A against SARS-CoV-2 variants

6-1. Confirmation of antiviral efficacy through immunofluorescence staining

We tried to confirm whether Phlorofucofuroeckol A, which can inhibit the proliferation of SARS-CoV-2, can act equally on SARS-CoV-2 mutants. Cells were infected with SARS-CoV-2 alpha, beta, gamma, and delta viruses, treated with 4 µM Phlorofucofuroeckol A, and immunofluorescence staining was performed.

As a result, as can be seen in FIG. 13 , it was confirmed that the proliferative ability was significantly reduced in the cells treated with Phlorofucofuroeckol A compared to the drug-untreated group.

In addition, as can be seen in FIG. 14, the treatment of Phlorofucofuroeckol A induces a decrease in the proliferation ability of all variants in terms of the number of cells (SARS-CoV-2 infected cells) in which the virus proliferates compared to total cells (total cells). Could know.

6-2. Confirmation of virus proliferation inhibitory effect

Expression levels of viral proteins and genomes were confirmed according to Phlorofucofuroeckol A in the same manner as in Example 4-4.

As a result, as shown in FIGS. 15 and 16, the expression of S protein and N protein was reduced according to Phlorofucofuroeckol A treatment in cells infected with SARS-CoV-2 mutants of alpha, beta, gamma, and delta, and similarly, N It was confirmed that the expression levels of gene and RdRp gene were also reduced.

As described above, although the embodiments have been described with limited drawings, those skilled in the art can apply various technical modifications and variations based on the above. For example, the described techniques may be performed in an order different from the method described, and/or components of the described system, structure, device, circuit, etc. may be combined or combined in a different form than the method described, or other components may be used. Or even if it is replaced or substituted by equivalents, appropriate results can be achieved.

Therefore, other implementations, other embodiments, and equivalents of the claims are within the scope of the following claims.

Claims (13)

1. A pharmaceutical composition for preventing or treating viral infections, comprising Phlorofucofuroeckol A as an active ingredient.
2. According to claim 1,

   The viral infection disease is a coronavirus infection (COVID-19), the pharmaceutical composition.
3. According to claim 1,

   The florofucopuroekkol A is derived from Ecklonia cava , a pharmaceutical composition.
4. According to claim 1,

   Wherein the composition inhibits the proliferation of SARS-CoV-2, the pharmaceutical composition.
5. According to claim 1,

   The composition inhibits the proliferation of alpha, beta, gamma, and delta variants of SARS-CoV-2, a pharmaceutical composition.
6. A pharmaceutical composition for preventing or treating viral infections, comprising an extract of Ecklonia cava as an active ingredient.
7. According to claim 6,

   The Ecklonia cava extract is a pharmaceutical composition comprising Florofucofuroeckol A (Phlorofucofuroeckol A).
8. According to claim 6,

   Wherein the composition inhibits the proliferation of SARS-CoV-2, the pharmaceutical composition.
9. According to claim 6,

   The composition inhibits the proliferation of alpha, beta, gamma, and delta variants of SARS-CoV-2, a pharmaceutical composition.
10. According to claim 6,

    The Ecklonia cava extract is a pharmaceutical composition obtained through a supercritical extraction method using 0.5 wt% of alcohol as a co-solvent in dried Ecklonia cava powder.
11. A food composition for preventing or improving viral infectious diseases, comprising Phlorofucofuroeckol A as an active ingredient.
12. Ecklonia cava ) Containing an extract as an active ingredient, a food composition for preventing or improving viral infections.
13. A method for preventing or treating a viral infection, comprising administering an extract of Phlorofucofuroeckol A or Ecklonia cava to a subject.

Images