WO2022149901A1 - Composition for preventing, alleviating, or treating muscle diseases, containing extract of gardenia jasminoides as active ingredient - Google Patents

Composition for preventing, alleviating, or treating muscle diseases, containing extract of gardenia jasminoides as active ingredient Download PDF

Info

Publication number
WO2022149901A1
WO2022149901A1 PCT/KR2022/000286 KR2022000286W WO2022149901A1 WO 2022149901 A1 WO2022149901 A1 WO 2022149901A1 KR 2022000286 W KR2022000286 W KR 2022000286W WO 2022149901 A1 WO2022149901 A1 WO 2022149901A1
Authority
WO
WIPO (PCT)
Prior art keywords
muscle
composition
gardenia extract
extract
gardenia
Prior art date
Application number
PCT/KR2022/000286
Other languages
French (fr)
Korean (ko)
Inventor
안지윤
정창화
하태열
서효덕
김영인
Original Assignee
한국식품연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국식품연구원 filed Critical 한국식품연구원
Publication of WO2022149901A1 publication Critical patent/WO2022149901A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/74—Rubiaceae (Madder family)
    • A61K36/744—Gardenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/316—Foods, ingredients or supplements having a functional effect on health having an effect on regeneration or building of ligaments or muscles

Definitions

  • the present invention provides a composition for preventing, improving or treating muscle disease comprising a gardenia extract as an active ingredient; composition for strengthening muscles; composition for promoting muscle differentiation; Or it relates to a food composition for enhancing athletic ability.
  • the muscle is the tissue with the most composition in the human body, and in order to maintain the functional capacity of the human body and to prevent metabolic diseases, it is essential to secure an appropriate muscle mass.
  • Muscle size is regulated by intracellular signaling pathways that induce anabolism or catabolism within the muscle.
  • a signal transduction reaction that induces synthesis rather than degradation of muscle protein occurs, muscle protein synthesis is increased, and as a result, muscle hypertrophy (hypertrophy) or an increase in the number of muscle fibers (hyperplasia) occurs (The Korea) Journal of Sports Science, 20(3): 1551-1561, 2011).
  • Sarcopenia which is one of the muscle loss diseases, refers to a state in which about 13 to 24% of one's body mass is decreased, and indicates a decrease in protein content, fiber diameter, muscle strength production, and fatigue resistance. Sarcopenia is caused by a variety of causes, including sepsis, cancer, renal failure, excess glucocorticoids, denervation, muscle non-use, and the aging process. Mainly, the gradual decrease in the quantity and quality of skeletal muscle that occurs with aging and weight loss including fat and body fat components due to inadequate dietary energy intake can be cited as the causes. .
  • Sarcopenia results from an imbalance between protein synthesis and degradation. If there is sarcopenia, the amount of action is significantly reduced, which not only harms mental health, but also reduces life satisfaction.
  • Muscle injuries include bruises, lacerations, ischemia, strains, and severe damage to skeletal muscles.
  • the injured person can become incapacitated by preventing him from continuing to exercise and work or even performing normal daily activities.
  • sprains are most common, which are characterized by destruction of the muscle-tendon unit. Destruction of these muscle-tendon units can occur anywhere in the muscle. Constraints account for more than 30% of all injuries treated professionally or by sports medicine professionals.
  • Treatments that reduce muscle damage or speed up recovery of muscle tissue have the potential to speed up recovery of muscle development after exercise. It may also help muscle recovery after illness.
  • Another object of the present invention is to provide a composition for strengthening muscles comprising a gardenia extract as an active ingredient.
  • Another object of the present invention is to provide a composition for promoting muscle differentiation comprising a gardenia extract as an active ingredient.
  • Another object of the present invention is to provide a composition for enhancing athletic performance comprising a gardenia extract as an active ingredient.
  • Another object of the present invention is to provide a method for preventing, ameliorating or treating a muscle disease, comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • Another object of the present invention is to provide a method for strengthening muscles comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • Another object of the present invention is to provide a method for promoting muscle differentiation comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • Another object of the present invention is to provide a method for enhancing athletic performance comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • the present invention provides a composition for preventing, improving or treating muscle diseases comprising a gardenia extract as an active ingredient.
  • the present invention provides a composition for strengthening muscles comprising a gardenia extract as an active ingredient.
  • the present invention provides a composition for promoting muscle differentiation comprising a gardenia extract as an active ingredient.
  • the present invention provides a food composition for enhancing exercise ability comprising a gardenia extract as an active ingredient.
  • the present invention provides a method for preventing, ameliorating or treating a muscle disease, comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • the present invention provides a muscle strengthening method comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • the present invention provides a method for promoting muscle differentiation comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • the present invention provides a method for enhancing athletic performance comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • composition according to the present invention has the effect of promoting muscle differentiation, inhibiting muscle atrophy factors and inhibitory factors of muscle differentiation, increasing muscle differentiation regulators, and enhancing or improving exercise performance, preventing and improving muscle diseases Or it can be usefully used for treatment.
  • FIG 2 shows the results of observation through myosin heavy chain (MHC) immunostaining of the degree of differentiation into myotube cells after treatment of mouse-derived myoblasts with a gardenia extract (1 or 2.5 ⁇ g/mL) for 24 hours and root canals. These are the results of the formation and fusion degree expressed as a fusion index (%) (C: control; and GJ: gardenia extract).
  • MHC myosin heavy chain
  • Figure 3 shows the mRNA of MyoG and MyoD, myoG and MyoD, myogenic regulators through reverse transcription polymerase chain reaction (RT-PCR) after treatment with gardenia extract (1 or 2.5 ⁇ g/mL) in the myotubular cell differentiation process of mouse-derived myoblasts. It is the result of measuring the expression level (C: control; and GJ: gardenia extract).
  • RT-PCR reverse transcription polymerase chain reaction
  • FIG. 4 shows muscle atrophy by treatment with 5 ⁇ M dexamethasone after differentiation from mouse-derived myoblasts into myotube cells, and after simultaneous treatment with gardenia extract (1 or 2.5 ⁇ g/mL) with 5 ⁇ M dexamethasone, differentiation into myotube cells
  • myosin heavy chain myosin heavy chain, MHC
  • N control group
  • DEX dexamethasone treated group
  • DEX+GJ 1 1 ⁇ g/mL gardenia extract treated group
  • DEX+GJ 2.5 2.5 ⁇ g/mL gardenia extract treated group
  • FIG. 5 shows muscle atrophy by treatment with 5 ⁇ M dexamethasone after differentiation from mouse-derived myoblasts into myotube cells, and after simultaneous treatment with gardenia extract (1 or 2.5 ⁇ g/mL) with 5 ⁇ M dexamethasone, reverse transcription polymerase chain mRNA expression levels of Atrogin-1, MurF-1, and Myostatin, which are muscle atrophy regulators through reaction (RT-PCR); And the results of measuring the mRNA expression levels of MyoG and MyoD, which are muscle differentiation regulators (DEX: dexamethasone-treated group; GJ: Gardenia extract-treated group; and NC: control group).
  • FIG. 6 is a result of measuring the bone density and body composition of a mouse animal model after feeding a gardenia extract to the mouse (red: body fat); and the results of measuring the fat in tissue (%) and lean body mass (%, real body weight) (CTL: control; DEX: mice administered with dexamethasone; GJL: 0.05%) of Mice fed with gardenia extract; and GJH: mice fed with 0.1% gardenia extract).
  • mice 7 is a result of measuring the grip strength, hanging test, running time and running distance after feeding a gardenia extract to mice (CTL: control; DEX: Mice administered dexamethasone; GJL: mice fed 0.05% gardenia extract; and GJH: mice fed 0.1% gardenia extract).
  • CTL control
  • DEX Mice administered dexamethasone
  • GJL mice fed 0.05% gardenia extract
  • GJH mice fed 0.1% gardenia extract
  • Figure 8 is after feeding the gardenia extract to the mouse, quadriceps (Quadriceps), gastrocnemius (gastrocnemius), triceps (Triceps), tibialis anterior (Tibialis anterior), extensor longus (Extensor digitorum longus) and the muscle mass of the spleen (Soleus)
  • CTL control
  • DEX mice administered dexamethasone
  • GJL mice fed 0.05% gardenia extract
  • GJH mice fed 0.1% gardenia extract
  • FIG. 9 is a graph showing the results of measuring the cross-sectional area (CSA) of muscle fibers and distribution according to the size of the muscle fibers after feeding a gardenia extract to mice (CTL: control group; DEX: mice administered with dexamethasone; GJL: mice fed 0.05% gardenia extract; and GJH: mice fed 0.1% gardenia extract).
  • CTL control group
  • DEX mice administered with dexamethasone
  • GJL mice fed 0.05% gardenia extract
  • GJH mice fed 0.1% gardenia extract
  • composition ratio (%) of MHC isoform after feeding a gardenia extract to the mouse (CTL: control; DEX: dexamethasone administered mouse; GJL: 0.05% gardenia extract is fed mice; and GJH: mice fed 0.1% gardenia extract).
  • the present invention provides a composition for preventing, improving or treating muscle diseases, comprising an extract of Gardenia jasminoides as an active ingredient.
  • the extract according to the present invention may be obtained by extraction and separation from nature using extraction and separation methods known in the art, and "extract" as defined in the present invention is extracted from gardenia using an appropriate solvent.
  • extract for example, include both a crude extract of gardenia, a polar solvent soluble extract, or a non-polar solvent soluble extract.
  • any pharmaceutically acceptable organic solvent may be used, and water or an organic solvent may be used, but is not limited thereto, for example, purified water, methanol ( methanol), ethanol, propanol, isopropanol, alcohol having 1 to 4 carbon atoms, including butanol, acetone, ether, benzene, chloroform ( Various solvents such as chloroform), ethyl acetate, methylene chloride, hexane and cyclohexane may be used alone or in combination.
  • any one of methods such as hot water extraction, cold extraction, reflux cooling extraction, solvent extraction, steam distillation, ultrasonic extraction, elution, and compression may be selected and used.
  • the desired extract may be further subjected to a conventional fractionation process, and may be purified using a conventional purification method.
  • the method for preparing the gardenia extract of the present invention and any known method may be used.
  • the gardenia extract included in the composition of the present invention may be prepared in a powder state by an additional process such as distillation under reduced pressure and freeze-drying or spray-drying the primary extract extracted by the hot water extraction or solvent extraction method.
  • fractions further purified by using various chromatography methods such as silica gel column chromatography, thin layer chromatography, and high performance liquid chromatography for the primary extract can also get
  • the gardenia extract is a concept including all extracts, fractions and purified products obtained in each step of extraction, fractionation or purification, and dilutions, concentrates or dried products thereof.
  • the composition may inhibit the expression of Atrogin-1 and MuRF-1 (Muscle RING-finger protein-1) causing muscle atrophy, and the expression of Myostatin that inhibits muscle differentiation may be inhibited, and may increase the expression of MyoG (myogenin) and MyoD (myoblast determination protein 1) that promote muscle differentiation.
  • Atrogin-1 and MuRF-1 Muscle RING-finger protein-1
  • Myostatin that inhibits muscle differentiation
  • MyoG myogenin
  • MyoD myoblast determination protein 1
  • the muscle disease is a progressive disease characterized by loss of walking ability due to gradual muscle strength reduction, weakening of respiratory muscle, weakening of heart function, etc. is a disease
  • muscle diseases can be divided into congenital diseases and acquired diseases, but are not limited thereto, but atony, muscular atrophy, muscular dystrophy, muscular dystrophy, muscle stiffness, amyotrophic axonal sclerosis , myasthenia gravis, cachexia or sarcopenia.
  • the present invention provides a food composition for preventing or improving muscle disease comprising a gardenia extract as an active ingredient.
  • the food composition using the gardenia extract according to the present invention includes all types of functional food, nutritional supplement, health food and food additives.
  • the above types can be prepared in various forms according to conventional methods known in the art.
  • the composition for food of the present invention may be prepared in the form of tea, juice, and drink for drinking, or may be ingested by granulation, encapsulation and powdering.
  • the composition for food of the present invention can be prepared in the form of a composition by mixing with known substances or active ingredients known to have effects of promoting hair growth and anti-inflammatory.
  • functional foods include beverages (including alcoholic beverages), fruits and processed foods thereof (eg, canned fruit, bottled, jam, marmalade, etc.), fish, meat, and processed foods (eg, ham, sausage) corn beef, etc.), breads and noodles (eg udon noodles, soba noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (eg butter, cheese, etc.), edible vegetable oils and fats, It can be prepared by adding the composition for food of the present invention to margarine, vegetable protein, retort food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.).
  • beverages including alcoholic beverages
  • fruits and processed foods thereof eg, canned fruit, bottled, jam, marmalade, etc.
  • fish, meat, and processed foods eg, ham, sausage) corn beef, etc.
  • breads and noodles eg udon noodles, soba noodles, ramen, spaghetti, macaroni, etc
  • composition for food according to the present invention is not limited thereto, but is preferably 0.01 to 50% by weight based on the total weight of the finally prepared food.
  • composition for food of the present invention in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate.
  • the present invention provides a pharmaceutical composition for preventing or treating muscle diseases comprising a gardenia extract as an active ingredient.
  • the pharmaceutical composition according to the present invention may contain the gardenia extract alone or may be formulated in a suitable form together with a pharmaceutically acceptable carrier, and may further contain an excipient or diluent.
  • a pharmaceutically acceptable carrier may further contain an excipient or diluent.
  • the term 'pharmaceutically acceptable' refers to a non-toxic composition that is physiologically acceptable and does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans.
  • the pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration.
  • Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.
  • various drug delivery materials used for oral administration of the peptide formulation may be included.
  • the carrier for parenteral administration may include water, a suitable oil, saline, aqueous glucose and glycol, and the like, and may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid.
  • Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, and the like, in addition to the above components.
  • a lubricant for other pharmaceutically acceptable carriers and agents, reference may be made to those described in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
  • composition of the present invention can be administered to mammals including humans by any method.
  • it may be administered orally or parenterally.
  • Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration.
  • the pharmaceutical composition of the present invention may be formulated as a formulation for oral administration or parenteral administration according to the administration route as described above.
  • the composition of the present invention may be formulated as a powder, granule, tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, etc. using methods known in the art.
  • oral preparations can be obtained by mixing the active ingredient with a solid excipient, pulverizing it, adding a suitable adjuvant, and processing it into a granule mixture to obtain tablets or dragees.
  • excipients include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches, including corn starch, wheat starch, rice starch and potato starch, cellulose, Cellulose, including methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, and the like, fillers such as gelatin, polyvinylpyrrolidone, and the like may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant if necessary. Furthermore, the pharmaceutical composition of the present invention may further include an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, and an antiseptic agent.
  • sugars including lactose, dextrose, sucrose, sorbitol, manni
  • Formulations for parenteral administration may be formulated in the form of injections, creams, lotions, external ointments, oils, moisturizers, gels, aerosols and nasal inhalants by methods known in the art. These formulations are described in Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA, 1995, which is a commonly known recipe for all pharmaceutical chemistry.
  • the total effective amount of the composition of the present invention may be administered to a patient as a single dose, or may be administered by a fractionated treatment protocol in which multiple doses are administered for a long period of time.
  • the pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease.
  • the preferred total dose of the pharmaceutical composition of the present invention may be about 0.01 ⁇ g to 10,000 mg, most preferably 0.1 ⁇ g to 500 mg per kg of patient body weight per day.
  • the dosage of the pharmaceutical composition is determined by considering various factors such as the formulation method, administration route and number of treatments, as well as the patient's age, weight, health status, sex, severity of disease, diet and excretion rate, etc., the effective dosage for the patient is determined.
  • the pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route and administration method as long as the effect of the present invention is exhibited.
  • the present invention provides a composition for strengthening muscles comprising a gardenia extract as an active ingredient.
  • muscle strengthening refers to an effect of increasing muscle strength and/or size of a muscle, and does not limit the type of muscle. Preferably, it exhibits an effect of increasing muscle mass, and is characterized in that it exhibits an effect of inhibiting muscle loss.
  • the increase in muscle mass is to improve muscle performance, and it is possible to increase muscle mass through physical exercise and improvement of endurance, and to increase muscle mass by administering a substance having a muscle increasing effect into the body.
  • the muscle reduction is characterized by a gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal or voluntary muscles and cardiac muscles, genetic factors, and acquired factors. Aging may be the cause.
  • the present invention provides a composition for promoting muscle differentiation comprising a gardenia extract as an active ingredient.
  • myogenesis refers to the formation of muscle tissue, and the muscle fibers constituting the muscle are differentiated and formed into myotubes through the fusion of myoblasts.
  • the present invention provides a composition for enhancing athletic performance comprising a gardenia extract as an active ingredient.
  • exercise ability refers to when physical motions seen in daily life or sports are visually divided into running, jumping, throwing, swimming, etc., quickly, strongly, accurately, long, and skillfully. As an indication of the degree to which one can do it, exercise performance is defined by factors such as strength, agility, and endurance.
  • the term "improving exercise capacity” refers to improving or improving exercise capacity.
  • the food composition exhibits an effect of increasing muscle strength and is characterized in that it exhibits an effect of increasing muscle endurance.
  • it may be to prevent or improve the symptoms of degenerative diseases, mitochondrial abnormalities, hypostamina, hypoactivity, lethargy, muscle waste, or depression.
  • the degenerative disease may be a degenerative disease causing a decrease in muscle function
  • the mitochondrial abnormal disease may be a mitochondrial abnormal disease causing a decrease in muscle function
  • the depression is a depression causing a decrease in muscle function may be
  • the present invention provides a method for preventing, ameliorating or treating a muscle disease, comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • the present invention provides a muscle strengthening method comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • the present invention provides a method for promoting muscle differentiation comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • the present invention provides a method for enhancing athletic performance comprising administering to a subject a therapeutically effective amount of a gardenia extract.
  • the therapeutically effective amount is the type and extent of the response to be achieved, the specific composition including whether other agents are used if necessary, the individual's age, weight, general health status, sex and diet, administration time, administration route, and composition It is preferable to apply differently depending on various factors including the secretion rate, treatment period, and drugs used or concurrently with a specific composition and similar factors well known in the pharmaceutical field. Therefore, the effective amount of the composition suitable for the purpose of the present invention is preferably determined in consideration of the foregoing.
  • the subject is applicable to any mammal, and the mammal includes not only humans and primates, but also domestic animals such as cattle, pigs, sheep, horses, dogs and cats.
  • the dried gardenia was pulverized and made into powder. Hot water extraction was performed for 3 hours using a 50% ethanol solvent in a volume 10 times the weight of the powder. After the extract was concentrated under reduced pressure, the final product obtained by freeze-drying after freezing at -80°C was finely pulverized and used in the experiment.
  • the present inventors performed an experiment to determine whether or not cytotoxicity after treating the gardenia extract to mouse-derived myoblasts. Briefly, the mouse-derived myoblast C2C12 cell line (CRL1772 ATCC, USA) was cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS). Gardenia extracts were treated at the given concentrations (0.5, 1, 2.5, 10, 25 and 50 ⁇ g/mL), and the cell growth rate was analyzed after 24 hours.
  • DMEM Dynabecco's Modified Eagle Medium
  • FBS fetal bovine serum
  • PS penicillin-streptomycin
  • the present inventors performed an experiment to determine whether the effect of enhancing muscle differentiation after treating the gardenia extract to mouse-derived myoblasts.
  • the mouse-derived myoblast C2C12 cell line (CRL1772 ATCC, USA) was cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS).
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS fetal bovine serum
  • PS penicillin-streptomycin
  • fusion index (nucleus in myotube cells / nucleus present in all cells) ⁇ 100 (%).
  • the present inventors performed an experiment to determine whether the gardenia extract affects the expression levels of MyoG (myogenin) and MyoD (myoblast determination protein 1), which are muscle differentiation regulators. Briefly, mouse-derived myoblasts, C2C12 cell line (CRL1772 ATCC, USA), were treated with 1 and 2.5 ⁇ g/mL gardenia extract for 24 hours. Thereafter, cells were washed with PBS to obtain cells, and total RNA was extracted using NucleoSpin RNA Kit (Nacherey-Nagel, Duren, Germany) according to the manufacturer's instructions.
  • MyoG myogenin
  • MyoD myoblast determination protein 1
  • cDNA was synthesized using Synthesize cDNA for real-time PCR Kit (ReverTra Ace qPCR RT Master Mix, FSQ-201, TOYOBO), and PCR was performed with SYBR Green MasterMix (TOYOBO Co. Ltd., Osaka, Japan).
  • SYBR Green MasterMix TOYOBO Co. Ltd., Osaka, Japan.
  • the mRNA expression levels of MyoG (myogenin) and MyoD (myoblast determination protein 1) were measured. Primer sequences specific for each gene are shown in Table 1 below.
  • the present inventors confirmed that the gardenia extract has the effect of enhancing muscle differentiation by increasing the expression levels of MyoG and MyoD.
  • the present inventors performed an experiment to determine whether the gardenia extract has the effect of promoting muscle differentiation and inhibiting muscle canal atrophy.
  • the mouse-derived myoblast C2C12 cell line (CRL1772 ATCC, USA) was cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS (fetal bovine serum), and DMEM containing 2% HS (horse serum).
  • DMEM Dulbecco's Modified Eagle Medium
  • FBS fetal bovine serum
  • DMEM containing 2% HS horse serum
  • Differentiation induction medium was treated for 4 days.
  • 1 and 2.5 ⁇ g/mL of gardenia extract and 5 ⁇ M of dexamethasone (DEX) were treated for 24 hours.
  • the degree of differentiation into myotube cells was observed by performing myosin heavy chain (MHC) immunostaining, and the myosin formation and fusion degree were calculated as a fusion index (%).
  • the mRNA expression levels of Atrogin-1, MurF-1 and Myostatin increased in the group treated with dexamethasone compared to the control group (DMSO), whereas the group treated with the gardenia extract showed Atrogin-1, MurF compared to the group treated with dexamethasone. It was confirmed that the mRNA expression levels of -1 and Myostatin were significantly reduced (FIG. 5). In addition, it was confirmed that the mRNA expression levels of MyoG and MyoD in the group treated with dexamethasone decreased compared to the control group, whereas the mRNA expression levels of MyoG and MyoD were significantly increased in the group treated with the gardenia extract compared to the group treated with dexamethasone ( 5).
  • Atrogin-1 and MurF-1 are genes known to cause muscle atrophy by destroying muscle proteins, and Myostatin is known as a muscle differentiation inhibitory factor. In addition, MyoG and MyoD are known to promote muscle differentiation.
  • gardenia extract inhibits the expression levels of Atrogin-1 and MurF-1 that cause muscle atrophy, suppresses the expression level of Myostatin that inhibits muscle differentiation, and MyoG and MyoD that promote muscle differentiation It was confirmed that there is an effect of increasing the expression level of
  • Example 5 Effect of enhancing exercise performance and increasing muscle mass in a mouse animal model
  • the present inventors performed an experiment to determine whether the effect of gardenia extract in reducing body fat in a mouse animal model.
  • a feed prepared by adding 0.05 or 0.1% (w/v) gardenia extract to the AIN-93M Adult maintenance Rodent Diet (Research diet, D10012M) base was used for 8 weeks. paid The tested mice started the experiment before the experiment and their weight was measured until the mice were sacrificed.
  • mice were intraperitoneally administered with dexamethasone (dexamethasone, Handong Pharmaceuticals) at 5 mg/kg 19 days before sacrifice.
  • dexamethasone distaloid, amethasone, Handong Pharmaceuticals
  • a bone densitometer InAlyzer, Medicors
  • the percentage of fat in the tissue %, fat in tissue
  • the percentage of body weight without fat %, lean body mass, real body weight
  • the present inventors performed an experiment to determine whether the effect of gardenia extract to enhance exercise performance in a mouse animal model.
  • the mouse In the grip strength and hanging test, on the 18th day of intraperitoneal administration, the mouse repeatedly performed grip strength and hanging with the forelimb 5 times, and then the average value was calculated, and the skeletal muscle strength was expressed in g.
  • the running time and running distance of the mouse were measured using a treadmill (Ugo Basile). At this time, the movement distance of the mouse was measured by increasing the inclination of 10 degrees and 10 m/min from 0 min to 20 min, and increasing by 2 m/min every 2 min after 20 min.
  • mice fed dexamethasone showed significantly reduced exercise performance in the grip strength and hanging test compared to the control group, whereas in mice fed with gardenia extract (GJL, GJH) It was confirmed that there was an effect of recovering or improving exercise performance in the grip strength and hanging experiments compared to mice fed with dexamethasone (FIG. 7).
  • mice (DEX) fed with dexmethasone the running time and running distance were decreased compared to the control group, whereas in mice fed with gardenia extract (GJL, GJH), the level was similar to that of the control group. It was confirmed that there is an effect of recovering the exercise time and exercise distance (FIG. 7). Accordingly, it was confirmed that the gardenia extract has the effect of restoring or improving the exercise performance decreased by dexamethasone.
  • the present inventors sacrificed the mouse the next day after the end of the intraperitoneal administration of 18 days, quadriceps, gastrocnemius, triceps (Triceps), tibialis anterior, extensor digitorum longus (Extensor digitorum longus) And muscle mass (muscle weight, expressed in mg per mouse body weight, mg/g body weight) was measured in the 6 muscles of the soleus.
  • mice fed dexamethasone had a decrease in body muscle mass such as quadriceps and gastrocnemius compared to the control group
  • mice fed with gardenia extract GJL, GJH
  • the body muscle mass of the quadriceps and gastrocnemius was significantly recovered in a concentration-dependent manner ( FIG. 8 ). Accordingly, it was confirmed that the gardenia extract has the effect of restoring the muscle mass decreased by dexamethasone.
  • Laminin is a protein present in the extracellular matrix, and is known to be an essential protein for the formation of a cell structure.
  • the present inventors observed the cross sectional area of the muscle fiber through laminin staining to confirm whether the gardenia extract affects the size of the muscle fiber.
  • the gastrocnemius of the mouse was fixed at -20°C with OCT compound, and then sliced to a thickness of 7 ⁇ m and attached to the slide. Thereafter, the sliced muscle tissue was fixed with 20% acetone, blocked with 10% FBS, and stained with alexa fluor 488-conjugated laminin at 4° C. for 16 hours. The stained tissue was washed with PBS, covered with a cover slide, and observed through a confocal microscope. In immunohistochemical staining, laminin is green.
  • mice fed dexamethasone about 45% of muscle fibers of 1,000 ⁇ m 2 or less, and about 50% of muscle fibers of 1,500 ⁇ m 2 or less, were confirmed, whereas in mice fed with gardenia extract, It was confirmed that muscle fibers of 1,000 ⁇ m 2 or less decreased, and muscle fibers of 2,000 ⁇ m 2 or less increased in a concentration-dependent manner compared to mice fed dexamethasone ( FIG. 9 ). Thus, it was confirmed that the gardenia extract has the effect of restoring the size of the muscle fibers decreased by dexamethasone.
  • MHC myosin heavy chain
  • MHC1 is a slow type muscle
  • MHC2B is a fast type muscle
  • fast-to-slow type transformation appears.
  • the present inventors performed MHC-type immunohistochemical staining in muscle and performed an experiment to analyze the composition ratio of MHC subtypes.
  • the gastrocnemius of the mouse was fixed at -20°C with OCT compound, and then sliced to a thickness of 7 ⁇ m and attached to the slide. Then, the sliced muscle tissue was fixed with 20% acetone, blocked with 10% FBS, and stained with MHC1, MHC2A and MHC2B primary antibodies at 4°C for 16 hours. Then, it was washed with PBS and stained with a secondary antibody at room temperature for 30 minutes. The stained tissue was washed with PBS, covered with a cover slide, and observed through a confocal microscope. In immunohistochemical staining, MHC1 is blue, MHC2A is green, and MHC2B is red.
  • mice fed with dexamethasone MHC1 of the slow type increased and MHC2B of the fast type decreased compared to the control group
  • MHC1 was significant at a level similar to that of the control group compared to mice fed with dexamethasone. decreased, and it was confirmed that MHC2B was significantly increased (FIG. 10). Accordingly, it was confirmed that the gardenia extract had the effect of reducing the slow type MHC1 increased by dexamethasone and increasing the fast type MHC2B decreased by dexamethasone.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Neurology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Psychiatry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Biomedical Technology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Pain & Pain Management (AREA)
  • Neurosurgery (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

The present invention relates to a composition for preventing, alleviating or treating muscle diseases, a composition for strengthening muscles, a composition for promoting muscle differentiation, or a composition for improving exercise capacity, all of the compositions containing an extract of Gardenia jasminoides as an active ingredient, wherein the compositions promote muscle differentiation, inhibit muscle atrophy factors and myodifferentiation inhibitory factors and increases myodifferentiation regulatory factors, and thus can be effectively used in the prevention, alleviation or treatment of muscle diseases.

Description

치자 추출물을 유효성분으로 포함하는 근육 질환 예방, 개선 또는 치료용 조성물Composition for preventing, improving or treating muscle disease comprising gardenia extract as an active ingredient
본 발명은 치자 추출물을 유효성분으로 포함하는 근육 질환 예방, 개선 또는 치료용 조성물; 근육강화용 조성물; 근육분화 촉진용 조성물; 또는 운동능력 증진용 식품 조성물에 관한 것이다.The present invention provides a composition for preventing, improving or treating muscle disease comprising a gardenia extract as an active ingredient; composition for strengthening muscles; composition for promoting muscle differentiation; Or it relates to a food composition for enhancing athletic ability.
근육(muscle)은 인체에서 가장 구성량이 많은 조직으로서 인체의 기능적 능력(functional capacity)을 유지하고, 대사성 질환을 예방하기 위해서는 적정 근육량의 확보가 필수적으로 요구된다. 근육 크기(muscle size)는 근육 내에서 일어나는 동화작용(anabolism)이나 이화작용(catabolism)을 유도하는 세포 내 신호전달 과정(signalling pathways)에 의해 조절된다. 근육 단백질의 분해보다 합성을 유도하는 신호전달 반응이 많이 일어날 경우 근육 단백질 합성이 증가되며, 결과적으로 근육의 크기가 증가하는 근 비대(hypertrophy)나 근섬유 수의 증가(hyperplasia)가 발생한다(The Korea Journal of Sports Science, 20(3): 1551-1561, 2011).The muscle is the tissue with the most composition in the human body, and in order to maintain the functional capacity of the human body and to prevent metabolic diseases, it is essential to secure an appropriate muscle mass. Muscle size is regulated by intracellular signaling pathways that induce anabolism or catabolism within the muscle. When a signal transduction reaction that induces synthesis rather than degradation of muscle protein occurs, muscle protein synthesis is increased, and as a result, muscle hypertrophy (hypertrophy) or an increase in the number of muscle fibers (hyperplasia) occurs (The Korea) Journal of Sports Science, 20(3): 1551-1561, 2011).
신체는 노화하면서 구성성분의 변화로써 체지방과 체단백질의 재분포가 일어나며, 약 50세가 되면 근세포 내 단백질의 합성속도가 분해속도보다 느려져 근육이 급격하게 퇴화를 시작하게 되며, 근육 감소 질환에 노출될 수 있다.As the body ages, the redistribution of body fat and body proteins occurs due to changes in the composition of the body. At the age of about 50, the rate of protein synthesis in muscle cells becomes slower than the rate of decomposition, leading to rapid muscle degeneration and exposure to muscle loss disease. can
근육 감소 질환의 하나인 근육 감소증은 평소 자기 체질량의 약 13~24%가 감소한 상태를 말하는 것으로, 단백질 함량, 섬유 직경, 근력 생산 및 피로 저항(fatigue resistance)의 감소를 나타낸다. 근육 감소증은 패혈증, 암, 신부전증, 글루코코르티코이드의 과다, 신경제거, 근육의 미사용 그리고 노화과정 등 다양한 원인에 의해 발생한다. 주로, 노화가 진행됨에 따라 일어나는 골격근의 양과 질의 점진적 감소 및 부적절한 식이에너지 섭취에 따른 지방과 체지방성분을 포함하는 체중감소 등을 원인으로 꼽을 수 있으며, 흔히 노화에 따른 것으로 연령과의 상관관계가 깊다.Sarcopenia, which is one of the muscle loss diseases, refers to a state in which about 13 to 24% of one's body mass is decreased, and indicates a decrease in protein content, fiber diameter, muscle strength production, and fatigue resistance. Sarcopenia is caused by a variety of causes, including sepsis, cancer, renal failure, excess glucocorticoids, denervation, muscle non-use, and the aging process. Mainly, the gradual decrease in the quantity and quality of skeletal muscle that occurs with aging and weight loss including fat and body fat components due to inadequate dietary energy intake can be cited as the causes. .
근육 감소증은 단백질 합성 및 분해 사이의 불평형으로부터 발생한다. 근육 감소증이 있으면 행동량이 현격하게 줄어 정신건강을 해칠뿐만 아니라 생활의 만족도도 떨어지며, 용이한 일상생활에서도 쉽게 부상을 입고 심각한 중상에 이러기도 한다.Sarcopenia results from an imbalance between protein synthesis and degradation. If there is sarcopenia, the amount of action is significantly reduced, which not only harms mental health, but also reduces life satisfaction.
또한, 과도한 운동은 근육의 피로와 손상을 가져오고 운동 능력을 떨어뜨린다. 근육 손상에는 타박상(멍), 열상, 국소 빈혈, 좌상(strain) 및 골격근에 대한 심각한 손상이 포함된다. 이러한 손상은 굉장한 통증을 유발할 뿐 아니라, 손상을 입은 사람은 운동 및 작업을 지속할 수 없으며 정상적인 일상 활동조차 할 수 없도록 하여, 그를 무능력하게 만들 수 있다. 골격근에 심각한 손상이 있는 경우, 좌상이 가장 흔한데, 근육 좌상 손상은 근육-건 유닛의 파괴를 특징으로 한다. 이러한 근육-건 유닛의 파괴는 근육 어느 부위에서나 발생할 수 있다. 좌상은 직업적으로 또는 스포츠 의학 전문가에 의해 처치되는 모든 손상의 30% 이상을 차지한다.In addition, excessive exercise causes muscle fatigue and damage and reduces exercise capacity. Muscle injuries include bruises, lacerations, ischemia, strains, and severe damage to skeletal muscles. In addition to causing great pain, the injured person can become incapacitated by preventing him from continuing to exercise and work or even performing normal daily activities. When there is severe damage to the skeletal muscle, sprains are most common, which are characterized by destruction of the muscle-tendon unit. Destruction of these muscle-tendon units can occur anywhere in the muscle. Constraints account for more than 30% of all injuries treated professionally or by sports medicine professionals.
근육 손상을 감소시키거나 또는 근육 조직 회복을 빠르게 할 수 있는 처치는 운동 후 근력 발생 회복을 빠르게 할 가능성이 있다. 이는 또한 질병 후 근육 회복을 도울 수도 있다.Treatments that reduce muscle damage or speed up recovery of muscle tissue have the potential to speed up recovery of muscle development after exercise. It may also help muscle recovery after illness.
그러나, 최근 외모와 다이어트에 관한 관심이 높아지면서 연령에 상관없이 급격한 체중감소로 근육 감소증이 유발될 수도 있고, 격한 운동으로 근육이 손상될 수 있다. 이에 일반적인 근육 감소 질환으로 인한 근육 감소를 치료하거나 근육을 증가시키기 위한 연구와 노력이 집중되고 있으며, 여전히 근육 감소 질환의 치료와 근육강화에 대한 연구가 요구되고 있는 실정이다.However, as interest in appearance and diet has recently increased, sarcopenia may be induced by rapid weight loss regardless of age, and muscle may be damaged by vigorous exercise. Accordingly, research and efforts to treat muscle loss caused by general muscle loss disease or to increase muscle have been focused, and research on treatment of muscle loss disease and muscle strengthening is still required.
본 발명의 목적은 치자 추출물을 유효성분으로 포함하는 근육 질환의 예방, 개선 또는 치료용 조성물을 제공하는 것이다.It is an object of the present invention to provide a composition for preventing, improving or treating muscle diseases comprising a gardenia extract as an active ingredient.
본 발명의 다른 목적은 치자 추출물을 유효성분으로 포함하는 근육강화용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for strengthening muscles comprising a gardenia extract as an active ingredient.
본 발명의 또 다른 목적은 치자 추출물을 유효성분으로 포함하는 근육분화 촉진용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for promoting muscle differentiation comprising a gardenia extract as an active ingredient.
본 발명의 또 다른 목적은 치자 추출물을 유효성분으로 포함하는 운동능력 증진용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for enhancing athletic performance comprising a gardenia extract as an active ingredient.
본 발명의 또 다른 목적은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육 질환의 예방, 개선 또는 치료 방법을 제공하는 것이다. Another object of the present invention is to provide a method for preventing, ameliorating or treating a muscle disease, comprising administering to a subject a therapeutically effective amount of a gardenia extract.
본 발명의 또 다른 목적은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육강화 방법을 제공하는 것이다.Another object of the present invention is to provide a method for strengthening muscles comprising administering to a subject a therapeutically effective amount of a gardenia extract.
본 발명의 또 다른 목적은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육분화 촉진 방법을 제공하는 것이다. Another object of the present invention is to provide a method for promoting muscle differentiation comprising administering to a subject a therapeutically effective amount of a gardenia extract.
본 발명의 또 다른 목적은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 운동능력 증진 방법을 제공하는 것이다. Another object of the present invention is to provide a method for enhancing athletic performance comprising administering to a subject a therapeutically effective amount of a gardenia extract.
상기 목적을 달성하기 위하여, 본 발명은 치자 추출물을 유효성분으로 포함하는 근육 질환의 예방, 개선 또는 치료용 조성물을 제공한다. In order to achieve the above object, the present invention provides a composition for preventing, improving or treating muscle diseases comprising a gardenia extract as an active ingredient.
또한, 본 발명은 치자 추출물을 유효성분으로 포함하는 근육강화용 조성물을 제공한다.In addition, the present invention provides a composition for strengthening muscles comprising a gardenia extract as an active ingredient.
또한, 본 발명은 치자 추출물을 유효성분으로 포함하는 근육분화 촉진용 조성물을 제공한다. In addition, the present invention provides a composition for promoting muscle differentiation comprising a gardenia extract as an active ingredient.
또한, 본 발명은 치자 추출물을 유효성분으로 포함하는 운동능력 증진용 식품 조성물을 제공한다. In addition, the present invention provides a food composition for enhancing exercise ability comprising a gardenia extract as an active ingredient.
또한, 본 발명은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육 질환의 예방, 개선 또는 치료 방법을 제공한다. In addition, the present invention provides a method for preventing, ameliorating or treating a muscle disease, comprising administering to a subject a therapeutically effective amount of a gardenia extract.
또한, 본 발명은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육강화 방법을 제공한다. In addition, the present invention provides a muscle strengthening method comprising administering to a subject a therapeutically effective amount of a gardenia extract.
또한, 본 발명은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육분화 촉진 방법을 제공한다. In addition, the present invention provides a method for promoting muscle differentiation comprising administering to a subject a therapeutically effective amount of a gardenia extract.
또한, 본 발명은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 운동능력 증진 방법을 제공한다. In addition, the present invention provides a method for enhancing athletic performance comprising administering to a subject a therapeutically effective amount of a gardenia extract.
본 발명에 따른 조성물은 근육분화를 촉진하고, 근위축 인자 및 근육분화 억제인자를 억제하며, 근육분화 조절인자를 증가시키고, 운동수행능력을 증진 또는 개선시키는 효과가 있어, 근육 질환의 예방, 개선 또는 치료에 유용하게 사용할 수 있다.The composition according to the present invention has the effect of promoting muscle differentiation, inhibiting muscle atrophy factors and inhibitory factors of muscle differentiation, increasing muscle differentiation regulators, and enhancing or improving exercise performance, preventing and improving muscle diseases Or it can be usefully used for treatment.
도 1은 마우스 유래 근아세포에 치자 추출물을 주어진 농도(0.5, 1, 2.5, 10, 25 및 50 μg/mL)로 처리한 후, 세포생존율을 측정한 결과이다 (C: 대조군; 및 GJ: 치자 추출물).1 is a result of measuring the cell viability after treating mouse-derived myoblasts with a gardenia extract at a given concentration (0.5, 1, 2.5, 10, 25 and 50 μg/mL) (C: control; and GJ: gardenia) extract).
도 2는 마우스 유래 근아세포에 치자 추출물(1 또는 2.5 μg/mL)을 24시간 처리한 후, 근관세포로 분화되는 정도를 미오신 중쇄(myosin heavy chain, MHC) 면역염색을 통해 관찰한 결과 및 근관형성과 융합정도를 융합지수(fusion index, %)로 나타낸 결과이다 (C: 대조군; 및 GJ: 치자 추출물). Figure 2 shows the results of observation through myosin heavy chain (MHC) immunostaining of the degree of differentiation into myotube cells after treatment of mouse-derived myoblasts with a gardenia extract (1 or 2.5 μg/mL) for 24 hours and root canals. These are the results of the formation and fusion degree expressed as a fusion index (%) (C: control; and GJ: gardenia extract).
도 3은 마우스 유래 근아세포의 근관세포 분화 과정에서 치자 추출물(1 또는 2.5 μg/mL)을 처리한 후, 역전사 중합효소 연쇄반응(RT-PCR)을 통해 근육분화 조절인자인 MyoG 및 MyoD의 mRNA 발현량을 측정한 결과이다 (C: 대조군; 및 GJ: 치자 추출물).Figure 3 shows the mRNA of MyoG and MyoD, myoG and MyoD, myogenic regulators through reverse transcription polymerase chain reaction (RT-PCR) after treatment with gardenia extract (1 or 2.5 μg/mL) in the myotubular cell differentiation process of mouse-derived myoblasts. It is the result of measuring the expression level (C: control; and GJ: gardenia extract).
도 4는 마우스 유래 근아세포에서 근관세포로 분화 후 5 μM의 덱사메타손을 처리하여 근위축을 유도하고, 치자 추출물(1 또는 2.5 μg/mL)을 5 μM 덱사메타손과 동시에 처리한 후, 근관세포로 분화되는 정도를 미오신 중쇄(myosin heavy chain, MHC) 면역염색을 통해 관찰한 결과; 및 근관형성과 융합정도를 융합지수(fusion index, %)로 나타낸 결과이다 (NC: 대조군; DEX: 덱사메타손 처리군; DEX+GJ 1: 1 μg/mL의 치자 추출물 처리군; 및 DEX+GJ 2.5: 2.5 μg/mL의 치자 추출물 처리군). FIG. 4 shows muscle atrophy by treatment with 5 μM dexamethasone after differentiation from mouse-derived myoblasts into myotube cells, and after simultaneous treatment with gardenia extract (1 or 2.5 μg/mL) with 5 μM dexamethasone, differentiation into myotube cells As a result of observing the degree of myosin heavy chain (myosin heavy chain, MHC) through immunostaining; and root canal formation and fusion degree as a fusion index (%) (NC: control group; DEX: dexamethasone treated group; DEX+GJ 1: 1 μg/mL gardenia extract treated group; and DEX+GJ 2.5 : 2.5 μg/mL gardenia extract treated group).
도 5는 마우스 유래 근아세포에서 근관세포로 분화 후 5 μM의 덱사메타손을 처리하여 근위축을 유도하고, 치자 추출물(1 또는 2.5 μg/mL)을 5 μM 덱사메타손과 동시에 처리한 후, 역전사 중합효소 연쇄반응(RT-PCR)을 통해 근위축 조절 인자인 Atrogin-1, MurF-1, Myostatin의 mRNA 발현량; 및 근육분화 조절인자인 MyoG, MyoD의 mRNA 발현량을 측정한 결과이다 (DEX: 덱사메타손 처리군; GJ: 치자 추출물 처리군; 및 NC: 대조군).FIG. 5 shows muscle atrophy by treatment with 5 μM dexamethasone after differentiation from mouse-derived myoblasts into myotube cells, and after simultaneous treatment with gardenia extract (1 or 2.5 μg/mL) with 5 μM dexamethasone, reverse transcription polymerase chain mRNA expression levels of Atrogin-1, MurF-1, and Myostatin, which are muscle atrophy regulators through reaction (RT-PCR); And the results of measuring the mRNA expression levels of MyoG and MyoD, which are muscle differentiation regulators (DEX: dexamethasone-treated group; GJ: Gardenia extract-treated group; and NC: control group).
도 6은 마우스에 치자 추출물을 급여한 후, 마우스 동물모델의 골밀도와 체성분을 측정한 결과 (빨간색: 체지방); 및 조직 내 지방비율(fat in tissue, %) 및 지방제외체중비율(lean body mass, %, 실질체중)을 측정한 결과이다다 (CTL: 대조군; DEX: 덱사메타손이 투여된 마우스; GJL: 0.05%의 치자 추출물이 급여된 마우스; 및 GJH: 0.1%의 치자 추출물이 급여된 마우스).6 is a result of measuring the bone density and body composition of a mouse animal model after feeding a gardenia extract to the mouse (red: body fat); and the results of measuring the fat in tissue (%) and lean body mass (%, real body weight) (CTL: control; DEX: mice administered with dexamethasone; GJL: 0.05%) of Mice fed with gardenia extract; and GJH: mice fed with 0.1% gardenia extract).
도 7은 마우스에 치자 추출물을 급여한 후, 악력(Grip Strength), 매달리기 실험(Hanging test), 운동시간(running time) 및 운동거리(running distance)를 측정한 결과이다 (CTL: 대조군; DEX: 덱사메타손이 투여된 마우스; GJL: 0.05%의 치자 추출물이 급여된 마우스; 및 GJH: 0.1%의 치자 추출물이 급여된 마우스).7 is a result of measuring the grip strength, hanging test, running time and running distance after feeding a gardenia extract to mice (CTL: control; DEX: Mice administered dexamethasone; GJL: mice fed 0.05% gardenia extract; and GJH: mice fed 0.1% gardenia extract).
도 8은 마우스에 치자 추출물을 급여한 후, 대퇴사두근(Quadriceps), 비복근(gastrocnemius), 삼두근(Triceps), 전경골근(Tibialis anterior), 장지신근(Extensor digitorum longus) 및 비장근(Soleus)의 근육량을 측정한 결과이다 (CTL: 대조군; DEX: 덱사메타손이 투여된 마우스; GJL: 0.05%의 치자 추출물이 급여된 마우스; 및 GJH: 0.1%의 치자 추출물이 급여된 마우스).Figure 8 is after feeding the gardenia extract to the mouse, quadriceps (Quadriceps), gastrocnemius (gastrocnemius), triceps (Triceps), tibialis anterior (Tibialis anterior), extensor longus (Extensor digitorum longus) and the muscle mass of the spleen (Soleus) These are the measured results (CTL: control; DEX: mice administered dexamethasone; GJL: mice fed 0.05% gardenia extract; and GJH: mice fed 0.1% gardenia extract).
도 9는 마우스에 치자 추출물을 급여한 후, 근섬유의 단면적(cross-sectional area, CSA)을 측정한 결과 및 근섬유 크기에 따른 분포를 나타낸 결과이다 (CTL: 대조군; DEX: 덱사메타손이 투여된 마우스; GJL: 0.05%의 치자 추출물이 급여된 마우스; 및 GJH: 0.1%의 치자 추출물이 급여된 마우스).9 is a graph showing the results of measuring the cross-sectional area (CSA) of muscle fibers and distribution according to the size of the muscle fibers after feeding a gardenia extract to mice (CTL: control group; DEX: mice administered with dexamethasone; GJL: mice fed 0.05% gardenia extract; and GJH: mice fed 0.1% gardenia extract).
도 10은 마우스에 치자 추출물을 급여한 후, MHC 아형(isoform)의 구성 비율(%)을 분석할 결과이다 (CTL: 대조군; DEX: 덱사메타손이 투여된 마우스; GJL: 0.05%의 치자 추출물이 급여된 마우스; 및 GJH: 0.1%의 치자 추출물이 급여된 마우스).10 is a result of analyzing the composition ratio (%) of MHC isoform after feeding a gardenia extract to the mouse (CTL: control; DEX: dexamethasone administered mouse; GJL: 0.05% gardenia extract is fed mice; and GJH: mice fed 0.1% gardenia extract).
이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 치자(Gardenia jasminoides) 추출물을 유효성분으로 포함하는 근육 질환의 예방, 개선 또는 치료용 조성물을 제공한다.The present invention provides a composition for preventing, improving or treating muscle diseases, comprising an extract of Gardenia jasminoides as an active ingredient.
본 발명에 따른 추출물은 당업계에 공지된 추출 및 분리하는 방법을 사용하여 천연으로부터 추출 및 분리하여 수득한 것을 사용할 수 있으며, 본 발명에서 정의된 "추출물"은 적절한 용매를 이용하여 치자로부터 추출한 것이며, 예를 들어, 치자의 조추출물, 극성용매 가용 추출물 또는 비극성용매 가용 추출물을 모두 포함한다.The extract according to the present invention may be obtained by extraction and separation from nature using extraction and separation methods known in the art, and "extract" as defined in the present invention is extracted from gardenia using an appropriate solvent. , for example, include both a crude extract of gardenia, a polar solvent soluble extract, or a non-polar solvent soluble extract.
상기 치자로부터 추출물을 추출하기 위한 적절한 용매로는 약학적으로 허용되는 유기용매라면 어느 것을 사용해도 무방하며, 물 또는 유기용매를 사용할 수 있으며, 이에 제한되지는 않으나, 예를 들어, 정제수, 메탄올(methanol), 에탄올(ethanol), 프로판올(propanol), 이소프로판올(isopropanol), 부탄올(butanol) 등을 포함하는 탄소수 1 내지 4의 알코올, 아세톤(acetone), 에테르(ether), 벤젠(benzene), 클로로포름(chloroform), 에틸아세테이트(ethyl acetate), 메틸렌클로라이드(methylene chloride), 헥산(hexane) 및 시클로헥산(cyclohexane) 등의 각종 용매를 단독으로 또는 혼합하여 사용할 수 있다. As a suitable solvent for extracting the extract from the gardenia, any pharmaceutically acceptable organic solvent may be used, and water or an organic solvent may be used, but is not limited thereto, for example, purified water, methanol ( methanol), ethanol, propanol, isopropanol, alcohol having 1 to 4 carbon atoms, including butanol, acetone, ether, benzene, chloroform ( Various solvents such as chloroform), ethyl acetate, methylene chloride, hexane and cyclohexane may be used alone or in combination.
추출 방법으로는 열수추출법, 냉침추출법, 환류냉각추출법, 용매추출법, 수증기증류법, 초음파추출법, 용출법, 압착법 등의 방법 중 어느 하나를 선택하여 사용할 수 있다. 또한, 목적하는 추출물은 추가로 통상의 분획 공정을 수행할 수도 있으며, 통상의 정제 방법을 이용하여 정제될 수도 있다. 본 발명의 치자 추출물의 제조 방법에는 제한이 없으며, 공지되어 있는 어떠한 방법도 이용될 수 있다.As the extraction method, any one of methods such as hot water extraction, cold extraction, reflux cooling extraction, solvent extraction, steam distillation, ultrasonic extraction, elution, and compression may be selected and used. In addition, the desired extract may be further subjected to a conventional fractionation process, and may be purified using a conventional purification method. There is no limitation on the method for preparing the gardenia extract of the present invention, and any known method may be used.
예를 들면, 본 발명의 조성물에 포함되는 치자 추출물은 상기 열수 추출 또는 용매 추출법으로 추출된 1차 추출물을 감압 증류 및 동결 건조 또는 분무 건조 등과 같은 추가적인 과정에 의해 분말 상태로 제조할 수 있다. 또한, 상기 1차 추출물을 실리카겔 컬럼 크로마토그래피(silica gel column chromatography), 박층 크로마토그래피(thin layer chromatography), 고성능 액체 크로마토그래피(high performance liquid chromatography) 등과 같은 다양한 크로마토그래피를 이용하여 추가로 정제된 분획을 얻을 수도 있다.For example, the gardenia extract included in the composition of the present invention may be prepared in a powder state by an additional process such as distillation under reduced pressure and freeze-drying or spray-drying the primary extract extracted by the hot water extraction or solvent extraction method. In addition, fractions further purified by using various chromatography methods such as silica gel column chromatography, thin layer chromatography, and high performance liquid chromatography for the primary extract can also get
따라서, 본 발명에 있어서, 치자 추출물은 추출, 분획 또는 정제의 각 단계에서 얻어지는 모든 추출액, 분획물 및 정제물, 그들의 희석액, 농축액 또는 건조물을 모두 포함하는 개념이다.Therefore, in the present invention, the gardenia extract is a concept including all extracts, fractions and purified products obtained in each step of extraction, fractionation or purification, and dilutions, concentrates or dried products thereof.
본 발명의 일 실시예에 있어서, 상기 조성물은 근위축을 야기하는 Atrogin-1 및 MuRF-1(Muscle RING-finger protein-1)의 발현을 억제하는 것일 수 있고, 근육분화를 억제하는 Myostatin의 발현을 억제하는 것일 수 있으며, 근육분화를 촉진하는 MyoG (myogenin) 및 MyoD (myoblast determination protein 1)의 발현을 증가시키는 것일 수 있다. In one embodiment of the present invention, the composition may inhibit the expression of Atrogin-1 and MuRF-1 (Muscle RING-finger protein-1) causing muscle atrophy, and the expression of Myostatin that inhibits muscle differentiation may be inhibited, and may increase the expression of MyoG (myogenin) and MyoD (myoblast determination protein 1) that promote muscle differentiation.
상기 근육 질환은 점진적인 근력감소로 인한 보행능력의 상실과 호흡 근력의 약화, 심장 기능의 약화 등을 특징으로 하는 진행성 질환으로서, 결국에는 신체의 장애를 가져와서 모든 일상생활을 남에게 의지하게 되는 만성적인 질환이다. 또한 근육 질환은 선천성 질환과 후천성 질환으로 나눌 수 있고, 이에 제한되지는 않으나, 긴장감퇴증(atony), 근위축증(muscular atrophy), 근이영양증(muscular dystrophy), 근육퇴화증, 근경직증, 근위축성 축삭경화증, 근무력증, 악액질(cachexia) 또는 근육감소증(sarcopenia)일 수 있다.The muscle disease is a progressive disease characterized by loss of walking ability due to gradual muscle strength reduction, weakening of respiratory muscle, weakening of heart function, etc. is a disease In addition, muscle diseases can be divided into congenital diseases and acquired diseases, but are not limited thereto, but atony, muscular atrophy, muscular dystrophy, muscular dystrophy, muscle stiffness, amyotrophic axonal sclerosis , myasthenia gravis, cachexia or sarcopenia.
또한, 본 발명은 치자 추출물을 유효성분으로 포함하는 근육 질환의 예방 또는 개선용 식품 조성물을 제공한다.In addition, the present invention provides a food composition for preventing or improving muscle disease comprising a gardenia extract as an active ingredient.
본 발명에 따른 치자 추출물을 이용한 식품 조성물은 기능성 식품(functional food), 영양보조제(nutritional supplement), 건강식품(health food) 및 식품첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형들은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.The food composition using the gardenia extract according to the present invention includes all types of functional food, nutritional supplement, health food and food additives. The above types can be prepared in various forms according to conventional methods known in the art.
예를 들면, 건강식품으로는 본 발명의 식품용 조성물 자체를 차, 쥬스 및 드링크의 형태로 제조하여 음용하도록 하거나, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다. 또한 본 발명의 식품용 조성물은 모발 성장 촉진 및 항염증의 효과가 있다고 알려진 공지의 물질 또는 활성 성분과 함께 혼합하여 조성물의 형태로 제조할 수 있다.For example, as a health food, the composition for food of the present invention may be prepared in the form of tea, juice, and drink for drinking, or may be ingested by granulation, encapsulation and powdering. In addition, the composition for food of the present invention can be prepared in the form of a composition by mixing with known substances or active ingredients known to have effects of promoting hair growth and anti-inflammatory.
또한, 기능성 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예를 들어 과일 통조림, 병조림, 잼, 마아말레이드 등), 어류, 육류 및 그 가공식품(예를 들어 햄, 소시지콘비이프 등), 빵류 및 면류(예를 들어 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예를 들어 버터, 치이즈 등), 식용식물유지, 마아가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예를 들어 된장, 간장, 소스 등) 등에 본 발명의 식품용 조성물을 첨가하여 제조할 수 있다.In addition, functional foods include beverages (including alcoholic beverages), fruits and processed foods thereof (eg, canned fruit, bottled, jam, marmalade, etc.), fish, meat, and processed foods (eg, ham, sausage) corn beef, etc.), breads and noodles (eg udon noodles, soba noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (eg butter, cheese, etc.), edible vegetable oils and fats, It can be prepared by adding the composition for food of the present invention to margarine, vegetable protein, retort food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.).
본 발명에 따른 식품용 조성물의 바람직한 함유량으로는 이에 한정되지 않지만, 바람직하게는 최종적으로 제조된 식품 총 중량 중 0.01 내지 50 중량% 이다. 본 발명의 식품용 조성물을 식품첨가제의 형태로 사용하기 위해서는 분말 또는 농축액 형태로 제조하여 사용할 수 있다.The preferred content of the composition for food according to the present invention is not limited thereto, but is preferably 0.01 to 50% by weight based on the total weight of the finally prepared food. In order to use the composition for food of the present invention in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate.
또한, 본 발명은 치자 추출물을 유효성분으로 포함하는 근육 질환의 예방 또는 치료용 약학적 조성물을 제공한다.In addition, the present invention provides a pharmaceutical composition for preventing or treating muscle diseases comprising a gardenia extract as an active ingredient.
본 발명에 따른 약학적 조성물은 치자 추출물을 단독으로 함유하거나 약학적으로 허용되는 담체와 함께 적합한 형태로 제형화 될 수 있으며, 부형제 또는 희석제를 추가로 함유할 수 있다. 상기에서 '약학적으로 허용되는'이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증 등과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 비독성의 조성물을 말한다. The pharmaceutical composition according to the present invention may contain the gardenia extract alone or may be formulated in a suitable form together with a pharmaceutically acceptable carrier, and may further contain an excipient or diluent. As used herein, the term 'pharmaceutically acceptable' refers to a non-toxic composition that is physiologically acceptable and does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans.
약학적으로 허용되는 담체로는 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체를 추가로 포함할 수 있다. 경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다. 아울러, 펩티드 제제에 대한 경구투여용으로 사용되는 다양한 약물전달물질을 포함할 수 있다. 또한, 비경구 투여용 담체는 물, 적합한 오일, 식염수, 수성 글루코오스 및 글리콜 등을 포함할 수 있으며, 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸-또는 프로필-파라벤 및 클로로부탄올이 있다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현택제 등을 추가로 포함할 수 있다. 그 밖의 약학적으로 허용되는 담체 및 제제는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다(Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, various drug delivery materials used for oral administration of the peptide formulation may be included. In addition, the carrier for parenteral administration may include water, a suitable oil, saline, aqueous glucose and glycol, and the like, and may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, and the like, in addition to the above components. For other pharmaceutically acceptable carriers and agents, reference may be made to those described in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
본 발명의 조성물은 인간을 비롯한 포유동물에 어떠한 방법으로도 투여할 수 있다. 예를 들면, 경구 또는 비경구적으로 투여할 수 있다. 비경구적인 투여방법으로는 이에 한정되지는 않으나, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장내 투여일 수 있다.The composition of the present invention can be administered to mammals including humans by any method. For example, it may be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration. can be
본 발명의 약학적 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화 할 수 있다.The pharmaceutical composition of the present invention may be formulated as a formulation for oral administration or parenteral administration according to the administration route as described above.
경구 투여용 제제의 경우에 본 발명의 조성물은 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 등으로 당업계에 공지된 방법을 이용하여 제형화될 수 있다. 예를 들어, 경구용 제제는 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제 또는 당의정제를 수득할 수 있다. 적합한 부형제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있다. 나아가, 본 발명의 약학적 조성물은 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.In the case of a formulation for oral administration, the composition of the present invention may be formulated as a powder, granule, tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, etc. using methods known in the art. can For example, oral preparations can be obtained by mixing the active ingredient with a solid excipient, pulverizing it, adding a suitable adjuvant, and processing it into a granule mixture to obtain tablets or dragees. Examples of suitable excipients include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches, including corn starch, wheat starch, rice starch and potato starch, cellulose, Cellulose, including methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, and the like, fillers such as gelatin, polyvinylpyrrolidone, and the like may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant if necessary. Furthermore, the pharmaceutical composition of the present invention may further include an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, and an antiseptic agent.
비경구 투여용 제제의 경우에는 주사제, 크림제, 로션제, 외용연고제, 오일제, 보습제, 겔제, 에어로졸 및 비강 흡입제의 형태로 당업계에 공지된 방법으로 제형화할 수 있다. 이들 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌(Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA,1995)에 기재되어 있다.Formulations for parenteral administration may be formulated in the form of injections, creams, lotions, external ointments, oils, moisturizers, gels, aerosols and nasal inhalants by methods known in the art. These formulations are described in Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA, 1995, which is a commonly known recipe for all pharmaceutical chemistry.
본 발명의 조성물의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학적 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있다. 바람직하게 본 발명의 약학적 조성물의 바람직한 전체 용량은 1일당 환자 체중 1㎏ 당 약 0.01㎍ 내지 10,000mg, 가장 바람직하게는 0.1㎍ 내지 500mg일 수 있다. 그러나 상기 약학적 조성물의 용량은 제제화 방법, 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이 및 배설율 등 다양한 요인들을 고려하여 환자에 대한 유효 투여량이 결정되는 것이므로, 이러한 점을 고려할 때 당 분야의 통상적인 지식을 가진 자라면 본 발명의 조성물의 적절한 유효 투여량을 결정할 수 있을 것이다. 본 발명에 따른 약학적 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여 경로 및 투여 방법에 특별히 제한되지 아니한다.The total effective amount of the composition of the present invention may be administered to a patient as a single dose, or may be administered by a fractionated treatment protocol in which multiple doses are administered for a long period of time. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease. Preferably, the preferred total dose of the pharmaceutical composition of the present invention may be about 0.01 μg to 10,000 mg, most preferably 0.1 μg to 500 mg per kg of patient body weight per day. However, the dosage of the pharmaceutical composition is determined by considering various factors such as the formulation method, administration route and number of treatments, as well as the patient's age, weight, health status, sex, severity of disease, diet and excretion rate, etc., the effective dosage for the patient is determined. Therefore, considering this point, those of ordinary skill in the art will be able to determine an appropriate effective dosage of the composition of the present invention. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route and administration method as long as the effect of the present invention is exhibited.
또한, 본 발명은 치자 추출물을 유효성분으로 포함하는 근육강화용 조성물을 제공한다. In addition, the present invention provides a composition for strengthening muscles comprising a gardenia extract as an active ingredient.
본 발명의 용어, "근육강화"는 근육의 근력 및/또는 크기를 증가시키는 효과를 의미하며, 근육의 종류를 제한하지 않는다. 바람직하게는 근육량을 증가시키는 효과를 나타내고, 근육 감소를 억제시키는 효과를 나타내는 것을 특징으로 한다.As used herein, the term "muscle strengthening" refers to an effect of increasing muscle strength and/or size of a muscle, and does not limit the type of muscle. Preferably, it exhibits an effect of increasing muscle mass, and is characterized in that it exhibits an effect of inhibiting muscle loss.
상기 근육량의 증가는 근육의 성능을 향상시키는 것으로, 육체적 운동 및 지구력 향상을 통해 근육량을 증가시킬 수 있고, 근육 증가 효과를 가지는 물질을 체내에 투여하는 방식으로 근육량을 증가시킬 수 있다. 또한 상기 근육 감소는 근육량의 점진적 손실, 근육, 특히 골격근 또는 수의근 및 심장근육의 약화 및 퇴행을 특징으로 하며, 유전적 요인, 후천적 요인. 노화 등이 원인일 수 있다.The increase in muscle mass is to improve muscle performance, and it is possible to increase muscle mass through physical exercise and improvement of endurance, and to increase muscle mass by administering a substance having a muscle increasing effect into the body. In addition, the muscle reduction is characterized by a gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal or voluntary muscles and cardiac muscles, genetic factors, and acquired factors. Aging may be the cause.
또한, 본 발명은 치자 추출물을 유효성분으로 포함하는 근육분화 촉진용 조성물을 제공한다. In addition, the present invention provides a composition for promoting muscle differentiation comprising a gardenia extract as an active ingredient.
본 발명의 용어, "근육분화(myogenesis)"는 근육조직의 형성을 의미하며, 근육을 구성하는 근섬유는 근아세포(myoblast)의 융합을 통해 근관세포(myotube)로 분화되어 형성된다. As used herein, the term "myogenesis" refers to the formation of muscle tissue, and the muscle fibers constituting the muscle are differentiated and formed into myotubes through the fusion of myoblasts.
또한, 본 발명은 치자 추출물을 유효성분으로 포함하는 운동능력 증진용 조성물을 제공한다.In addition, the present invention provides a composition for enhancing athletic performance comprising a gardenia extract as an active ingredient.
본 발명의 용어, "운동능력"은 일상생활이나 스포츠에서 볼 수 있는 신체동작을 외형적으로 달리기, 뛰기, 던지기, 헤엄치기 등으로 구분할 때, 상기 동작을 빠르게, 강하게, 정확하게, 오래, 능숙하게 할 수 있는 정도를 나타내는 것으로서, 운동수행능력은 근력, 민첩성 및 지구력 등의 인자로 규정된다. As used herein, the term "exercise ability" refers to when physical motions seen in daily life or sports are visually divided into running, jumping, throwing, swimming, etc., quickly, strongly, accurately, long, and skillfully. As an indication of the degree to which one can do it, exercise performance is defined by factors such as strength, agility, and endurance.
본 발명의 용어, "운동능력 증진"은 운동능력을 개선하거나 향상시키는 것을 말한다. 바람직하게는 상기 식품 조성물은 근력을 증가시키는 효과를 나타내고, 근 지구력을 증가시키는 효과를 나타내는 것을 특징으로 한다. 또한, 이에 제한되지는 않으나, 퇴행성 질환, 미토콘드리아 이상 질환, 지구력 저하증, 순발력 저하증, 무기력증, 근육 폐기 또는 우울증의 증상을 예방 또는 개선시키는 것일 수 있다. 바람직하게는, 상기 퇴행성 질환은 근육 기능 저하를 야기하는 퇴행성 질환인 것일 수 있고, 상기 미토콘드리아 이상 질환은 근육 기능 저하를 야기하는 미토콘드리아 이상 질환인 것일 수 있고, 상기 우울증은 근육 기능 저하를 야기하는 우울증인 것일 수 있다. As used herein, the term "improving exercise capacity" refers to improving or improving exercise capacity. Preferably, the food composition exhibits an effect of increasing muscle strength and is characterized in that it exhibits an effect of increasing muscle endurance. In addition, although not limited thereto, it may be to prevent or improve the symptoms of degenerative diseases, mitochondrial abnormalities, hypostamina, hypoactivity, lethargy, muscle waste, or depression. Preferably, the degenerative disease may be a degenerative disease causing a decrease in muscle function, the mitochondrial abnormal disease may be a mitochondrial abnormal disease causing a decrease in muscle function, and the depression is a depression causing a decrease in muscle function may be
또한, 본 발명은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육 질환의 예방, 개선 또는 치료 방법을 제공한다. In addition, the present invention provides a method for preventing, ameliorating or treating a muscle disease, comprising administering to a subject a therapeutically effective amount of a gardenia extract.
또한, 본 발명은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육강화 방법을 제공한다. In addition, the present invention provides a muscle strengthening method comprising administering to a subject a therapeutically effective amount of a gardenia extract.
또한, 본 발명은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 근육분화 촉진 방법을 제공한다. In addition, the present invention provides a method for promoting muscle differentiation comprising administering to a subject a therapeutically effective amount of a gardenia extract.
또한, 본 발명은 치자 추출물의 치료적 유효량을 개체에 투여하는 단계를 포함하는 운동능력 증진 방법을 제공한다. In addition, the present invention provides a method for enhancing athletic performance comprising administering to a subject a therapeutically effective amount of a gardenia extract.
상기 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 개체의 연령, 체중, 일반건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 따라서, 본 발명의 목적에 적합한 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다.The therapeutically effective amount is the type and extent of the response to be achieved, the specific composition including whether other agents are used if necessary, the individual's age, weight, general health status, sex and diet, administration time, administration route, and composition It is preferable to apply differently depending on various factors including the secretion rate, treatment period, and drugs used or concurrently with a specific composition and similar factors well known in the pharmaceutical field. Therefore, the effective amount of the composition suitable for the purpose of the present invention is preferably determined in consideration of the foregoing.
상기 개체는 임의의 포유동물에 적용가능하며, 상기 포유동물은 인간 및 영장류뿐만 아니라, 소, 돼지, 양, 말, 개 및 고양이 등의 가축을 포함한다.The subject is applicable to any mammal, and the mammal includes not only humans and primates, but also domestic animals such as cattle, pigs, sheep, horses, dogs and cats.
이하, 본 발명을 실시예를 통하여 더욱 상세히 설명하기로 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through examples. These examples are for explaining the present invention in more detail, and the scope of the present invention is not limited to these examples.
실시예 1. 실험방법Example 1. Experimental method
1.1. 통계적 분석1.1. statistical analysis
모든 연구결과는 GraphPad Prism 7 (GraphPad Software Inc., SanDiego, CA, USA)을 이용하여 one-way ANOVA를 실시하였고, 통계적 유의성은 Boneferroni multiple comparison post test로 검증하였으며, *p<0.05, **p<0.01, ***p<0.001 및 ****p<0.0001 로 표기하였다.All study results were one-way ANOVA using GraphPad Prism 7 (GraphPad Software Inc., SanDiego, CA, USA), and statistical significance was verified by Boneferroni multiple comparison post test, *p<0.05, **p It was expressed as <0.01, ***p<0.001 and ****p<0.0001.
1.2. 치자 추출물의 제조1.2. Preparation of Gardenia Extract
건조된 치자를 분쇄하여 파우더로 만들었다. 파우더 중량의 10배 볼륨의 50% 에탄올 용매를 이용하여 3시간 열수 추출하였다. 추출물을 감압농축 후 -80℃에서 동결 후 동결 건조하여 얻은 최종 산물을 곱게 분쇄하여 실험에 사용하였다. The dried gardenia was pulverized and made into powder. Hot water extraction was performed for 3 hours using a 50% ethanol solvent in a volume 10 times the weight of the powder. After the extract was concentrated under reduced pressure, the final product obtained by freeze-drying after freezing at -80°C was finely pulverized and used in the experiment.
실시예 2. 치자 추출물의 세포독성 실험Example 2. Cytotoxicity test of gardenia extract
본 발명자들은 치자 추출물을 마우스 유래 근아세포에 처리한 후 세포독성 여부를 확인하는 실험을 수행하였다. 간단히, 마우스 유래 근아세포인 C2C12 세포주 (CRL1772 ATCC, USA)는 10% FBS (fetal bovine serum) 및 1% PS (penicillin-streptomycin)가 포함된 DMEM (Dulbecco's Modified Eagle Medium) 배지에서 배양하였다. 치자 추출물은 주어진 농도(0.5, 1, 2.5, 10, 25 및 50 μg/mL)로 처리하였고, 24시간 후 세포생장율을 분석하였다. The present inventors performed an experiment to determine whether or not cytotoxicity after treating the gardenia extract to mouse-derived myoblasts. Briefly, the mouse-derived myoblast C2C12 cell line (CRL1772 ATCC, USA) was cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS). Gardenia extracts were treated at the given concentrations (0.5, 1, 2.5, 10, 25 and 50 μg/mL), and the cell growth rate was analyzed after 24 hours.
그 결과, 치자 추출물은 50 μg/mL 농도까지 세포독성이 나타나지 않았음을 확인하였다 (도 1). As a result, it was confirmed that the gardenia extract did not show cytotoxicity up to a concentration of 50 μg/mL ( FIG. 1 ).
실시예 3. 치자 추출물의 근육 분화(myogenesis) 증진 효과Example 3. Effect of Gardenia extract to promote muscle differentiation (myogenesis)
3.1. 근관 형성의 증가 효과3.1. Increased effect of root canal formation
본 발명자들은 치자 추출물을 마우스 유래 근아세포에 처리한 후 근육 분화를 증진시키는 효과가 있는지 확인하는 실험을 수행하였다. 간단히, 마우스 유래 근아세포인 C2C12 세포주 (CRL1772 ATCC, USA)는 10% FBS (fetal bovine serum) 및 1% PS (penicillin-streptomycin)가 포함된 DMEM (Dulbecco's Modified Eagle Medium) 배지에서 배양하였다. 세포가 배양용기에 100% confluence로 자라면, 2% HS (horse serum) 및 1% PS (penicillin-streptomycin)가 포함된 DMEM (Dulbecco's Modified Eagle Medium) 배지로 바꾸고, 근관세포 형성을 위해 총 4일 동안 분화를 진행하였다. The present inventors performed an experiment to determine whether the effect of enhancing muscle differentiation after treating the gardenia extract to mouse-derived myoblasts. Briefly, the mouse-derived myoblast C2C12 cell line (CRL1772 ATCC, USA) was cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS). When the cells are grown to 100% confluence in a culture vessel, change to DMEM (Dulbecco's Modified Eagle Medium) medium containing 2% HS (horse serum) and 1% PS (penicillin-streptomycin), and a total of 4 days for myotube cell formation. differentiation was carried out during the
분화 4일 째에는 1 및 2.5 μg/mL의 치자 추출물을 24시간 동안 처리한 후, 근관세포로 분화되는 정도를 미오신 중쇄(myosin heavy chain, MHC) 면역염색을 수행하였다. 분화된 근관세포는 4% 포름알데히드로 고정하였고, 0.05% 사포닌(saponin)으로 투과(permeabilization)시키고, 1% BSA(bovine serum albumin)로 블러킹(blocking)하였다. 이후, 미오신 중쇄(myosin heavy chain, MHC)에 대한 1차 항체 및 2차 항체를 붙여 염색하였고, DAPI로 핵을 염색하였다. 융합지수(fusion index, %)는 다음의 수식으로 계산하였다: 융합지수(fusion index) = (근관세포 안의 핵 / 전체 세포에 존재 하는 핵) × 100 (%).On the fourth day of differentiation, 1 and 2.5 μg/mL of gardenia extract were treated for 24 hours, and then, myosin heavy chain (MHC) immunostaining was performed to determine the degree of differentiation into myotube cells. Differentiated myotube cells were fixed with 4% formaldehyde, permeabilized with 0.05% saponin, and blocked with 1% bovine serum albumin (BSA). Thereafter, a primary antibody and a secondary antibody for myosin heavy chain (MHC) were attached and stained, and the nucleus was stained with DAPI. The fusion index (%) was calculated by the following formula: fusion index = (nucleus in myotube cells / nucleus present in all cells) × 100 (%).
그 결과, 치자 추출물이 처리된 경우, 시간에 따라 근관세포로의 분화가 증진되었음을 확인하였다 (도 2). 또한, 치자 추출물(1 및 2.5 μg/mL)을 처리한 군에서는 대조군에 비해 근관형성 및 융합정도를 나타내는 융합지수(fusion index)가 유의하게 증가하였음을 확인하였다 (도 2). 이로써, 치자 추출물은 근관 형성을 증가시키는 근육 분화 증진 효과가 있음을 확인하였다. As a result, when the gardenia extract was treated, it was confirmed that the differentiation into myotube cells was enhanced over time ( FIG. 2 ). In addition, it was confirmed that the group treated with the gardenia extract (1 and 2.5 μg/mL) significantly increased the fusion index indicating the degree of root canal formation and fusion compared to the control group (FIG. 2). Accordingly, it was confirmed that the gardenia extract has the effect of enhancing muscle differentiation by increasing the formation of the root canal.
3.2. 근육분화(myogenesis) 조절인자의 증가 효과3.2. Increasing effect of myogenesis regulators
본 발명자들은 치자 추출물이 근육분화 조절인자인 MyoG (myogenin) 및 MyoD (myoblast determination protein 1)의 발현량에 영향을 주는지 확인하는 실험을 수행하였다. 간단히, 마우스 유래 근아세포인 C2C12 세포주 (CRL1772 ATCC, USA)에 1 및 2.5 μg/mL의 치자 추출물을 24시간 동안 처리하였다. 이후, PBS를 이용하여 세포를 세척하고 세포를 수득하였고, 제조사의 지침에 따라 NucleoSpin RNA Kit (Nacherey-Nagel,Duren, Germany)를 이용하여 total RNA를 추출하였다. 이후, Synthesize cDNA for real-time PCR Kit (ReverTra Ace qPCR RT Master Mix, FSQ-201, TOYOBO)을 이용하여 cDNA를 합성한 후, SYBR Green MasterMix (TOYOBO Co. Ltd., Osaka, Japan)로 PCR을 실시하여 MyoG (myogenin) 및 MyoD (myoblast determination protein 1)의 mRNA 발현량을 측정하였다. 각 유전자에 특이적인 프라이머 서열은 하기 표 1과 같다. The present inventors performed an experiment to determine whether the gardenia extract affects the expression levels of MyoG (myogenin) and MyoD (myoblast determination protein 1), which are muscle differentiation regulators. Briefly, mouse-derived myoblasts, C2C12 cell line (CRL1772 ATCC, USA), were treated with 1 and 2.5 μg/mL gardenia extract for 24 hours. Thereafter, cells were washed with PBS to obtain cells, and total RNA was extracted using NucleoSpin RNA Kit (Nacherey-Nagel, Duren, Germany) according to the manufacturer's instructions. Then, cDNA was synthesized using Synthesize cDNA for real-time PCR Kit (ReverTra Ace qPCR RT Master Mix, FSQ-201, TOYOBO), and PCR was performed with SYBR Green MasterMix (TOYOBO Co. Ltd., Osaka, Japan). The mRNA expression levels of MyoG (myogenin) and MyoD (myoblast determination protein 1) were measured. Primer sequences specific for each gene are shown in Table 1 below.
염기서열 (5' -> 3')base sequence (5' -> 3') 서열번호SEQ ID NO:
AtroginAtrogin SenseSense GACTGGACTTCTCGACTGCCGACTGGACTTCTCGACTGCC 1One
Anti-senseAnti-sense TCAGGGATGTGAGCTGTGACTCAGGGATGTGAGCTGTGAC 22
MurF-1MurF-1 SenseSense GCTGGTGGAAAACATCATTGACATGCTGGTGGAAAACATCATTGACAT 33
Anti-senseAnti-sense CATCGGGTGGCTGCCTTTCATCGGGTGGCTGCCTTT 44
Myostatin Myostatin SenseSense ACGCTACCACGGAAACAATCACGCTACCACGGAAACAATC 55
Anti-senseAnti-sense GGAGTCTTGACGGGTCTGAGGGAGTCTTGACGGGTCTGAG 66
MyoGMyoG SenseSense GCAGGCTCAAGAAAGTGAATGAGCAGGCTCAAGAAAGTGAATGA 77
Anti-senseAnti-sense TAGGCGCTCAATGTACTGGATTAGGCGCTCAATGTACTGGAT 88
MyoDMyoD SenseSense CGGGACATAGACTTGACAGGCCGGGACATAGACTTGACAGGC 99
Anti-sense Anti-sense TCGAAACACGGGTCATCATAGATCGAAACACGGGTCATCATAGA 1010
18s RNA18s RNA SenseSense GTAACCCGTTGAACCCCATTGTAACCCGTTGAACCCCATT 1111
Anti-senseAnti-sense CCATCCAATCGGTAGTAGCGCCATCCAATCGGTAGTAGCG 1212
그 결과, 치자 추출물을 처리한 군에서는 대조군에 비해 MyoG의 mRNA 발현량이 유의하게 증가하였고, MyoD의 mRNA 발현량이 증가하는 경향이 있음을 확인하였다 (도 3). 이로써, 본 발명자들은 치자 추출물이 MyoG 및 MyoD 발현량을 증가시켜 근육 분화를 증진시키는 효과가 있음을 확인하였다. As a result, it was confirmed that in the group treated with the gardenia extract, the mRNA expression level of MyoG was significantly increased compared to the control group, and the mRNA expression level of MyoD tended to increase ( FIG. 3 ). Accordingly, the present inventors confirmed that the gardenia extract has the effect of enhancing muscle differentiation by increasing the expression levels of MyoG and MyoD.
실시예 4. 치자 추출물의 근육 분화 증진 및 근위축(myotube atrophy) 억제 효과Example 4. Enhancement of muscle differentiation and inhibitory effect on myotube atrophy of gardenia extract
4.1. 근관 형성의 증가 효과4.1. Increased effect of root canal formation
본 발명자들은 치자 추출물이 근육 분화 증진 및 근관 위축 억제 효과가 있는지 확인하는 실험을 수행하였다. 간단히, 마우스 유래 근아세포인 C2C12 세포주 (CRL1772 ATCC, USA)는 10% FBS (fetal bovine serum)가 포함된 DMEM (Dulbecco's Modified Eagle Medium) 배지에서 배양하였고, 2% HS (horse serum)가 포함된 DMEM 분화 유도 배지를 4 일 동안 처리하였다. 분화 유도가 끝난 후, 1 및 2.5 μg/mL의 치자 추출물과 5 μM의 덱사메타손(dexamethasone, DEX)을 24 시간 동안 처리하였다. 이후, 근관세포로 분화되는 정도를 미오신 중쇄(myosin heavy chain, MHC) 면역염색을 수행하여 관찰하였고, 근관형성과 융합정도를 융합지수(fusion index, %)로 계산하였다. The present inventors performed an experiment to determine whether the gardenia extract has the effect of promoting muscle differentiation and inhibiting muscle canal atrophy. Briefly, the mouse-derived myoblast C2C12 cell line (CRL1772 ATCC, USA) was cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS (fetal bovine serum), and DMEM containing 2% HS (horse serum). Differentiation induction medium was treated for 4 days. After differentiation induction, 1 and 2.5 μg/mL of gardenia extract and 5 μM of dexamethasone (DEX) were treated for 24 hours. Thereafter, the degree of differentiation into myotube cells was observed by performing myosin heavy chain (MHC) immunostaining, and the myosin formation and fusion degree were calculated as a fusion index (%).
그 결과, 덱사메타손이 처리된 군에서는 대조군에 비해 근관 형성이 감소하고, 근관세포의 융합이 감소한 반면, 치자 추출물이 처리된 군에서는 덱사메타손이 처리된 군에 비해 근관 형성이 증가하고, 근관형성 및 융합정도를 나타내는 융합지수(fusion index)가 유의하게 증가하였음을 확인하였다 (도 4). 이로써, 치자 추출물은 덱사메타손에 의해 유도된 근위축을 억제하고, 근육 분화를 증진시키는 효과가 있음을 확인하였다. As a result, in the group treated with dexamethasone, myotube formation was reduced compared to the control group, and fusion of myotube cells was reduced, whereas in the group treated with the gardenia extract, the formation of the root canal increased compared to the group treated with dexamethasone, and myotube formation and fusion It was confirmed that the fusion index indicating the degree was significantly increased (FIG. 4). Accordingly, it was confirmed that the gardenia extract has the effect of suppressing the muscle atrophy induced by dexamethasone and promoting muscle differentiation.
4.2. 근위축 조절인자의 억제 및 근육분화 조절인자의 증가 효과4.2. Inhibition of muscle atrophy regulators and increasing effects of muscle differentiation regulators
이후, PBS를 이용하여 세포를 세척한 후 세포를 수득하였고, 제조사의 지침에 따라 NucleoSpin RNA Kit (Nacherey-Nagel,Duren, Germany)를 이용하여 total RNA를 추출하였다. 이후, Synthesize cDNA for real-time PCR Kit (ReverTra Ace qPCR RT Master Mix, FSQ-201, TOYOBO)을 이용하여 cDNA를 합성한 후, SYBR Green MasterMix (TOYOBO Co. Ltd., Osaka, Japan)로 PCR을 실시하여 Atrogin-1, MurF-1 (Muscle RING-finger protein-1) 및 Myostatin의 mRNA 발현량을 측정하였다. 각 유전자에 특이적인 프라이머 서열은 상기 표 1과 같다. After washing the cells with PBS, the cells were obtained, and total RNA was extracted using the NucleoSpin RNA Kit (Nacherey-Nagel, Duren, Germany) according to the manufacturer's instructions. Then, cDNA was synthesized using Synthesize cDNA for real-time PCR Kit (ReverTra Ace qPCR RT Master Mix, FSQ-201, TOYOBO), and PCR was performed with SYBR Green MasterMix (TOYOBO Co. Ltd., Osaka, Japan). The mRNA expression levels of Atrogin-1, MurF-1 (Muscle RING-finger protein-1) and Myostatin were measured. Primer sequences specific for each gene are shown in Table 1 above.
그 결과, 덱사메타손을 처리한 군에서는 대조군(DMSO)에 비해 Atrogin-1, MurF-1 및 Myostatin의 mRNA 발현량이 증가한 반면, 치자 추출물을 처리한 군에서는 덱사메타손을 처리한 군에 비해 Atrogin-1, MurF-1 및 Myostatin의 mRNA 발현량이 유의하게 감소하였음을 확인하였다 (도 5). 또한, 덱사메타손을 처리한 군에서는 대조군에 비해 MyoG 및 MyoD의 mRNA 발현량이 감소한 반면, 치자 추출물을 처리한 군에서는 덱사메타손을 처리한 군에 비해 MyoG 및 MyoD의 mRNA 발현량이 유의하게 증가하였음을 확인하였다 (도 5). As a result, the mRNA expression levels of Atrogin-1, MurF-1 and Myostatin increased in the group treated with dexamethasone compared to the control group (DMSO), whereas the group treated with the gardenia extract showed Atrogin-1, MurF compared to the group treated with dexamethasone. It was confirmed that the mRNA expression levels of -1 and Myostatin were significantly reduced (FIG. 5). In addition, it was confirmed that the mRNA expression levels of MyoG and MyoD in the group treated with dexamethasone decreased compared to the control group, whereas the mRNA expression levels of MyoG and MyoD were significantly increased in the group treated with the gardenia extract compared to the group treated with dexamethasone ( 5).
Atrogin-1 및 MurF-1은 근육 단백질을 파괴하여 근위축(atrophy)을 야기하는 것으로 알려진 유전자이며, Myostatin은 근육분화 억제인자로 알려져 있다. 또한, MyoG 및 MyoD는 근육 분화를 촉진하는 인자로 알려져 있다. Atrogin-1 and MurF-1 are genes known to cause muscle atrophy by destroying muscle proteins, and Myostatin is known as a muscle differentiation inhibitory factor. In addition, MyoG and MyoD are known to promote muscle differentiation.
상기 결과로부터, 본 발명자들은 치자 추출물이 근위축을 야기하는 Atrogin-1 및 MurF-1의 발현량을 억제하고, 근육분화를 억제하는 Myostatin의 발현량을 억제하며, 근육 분화를 촉진하는 MyoG 및 MyoD의 발현량을 증가시키는 효과가 있음을 확인하였다. From the above results, the present inventors found that gardenia extract inhibits the expression levels of Atrogin-1 and MurF-1 that cause muscle atrophy, suppresses the expression level of Myostatin that inhibits muscle differentiation, and MyoG and MyoD that promote muscle differentiation It was confirmed that there is an effect of increasing the expression level of
실시예 5. 마우스 동물모델에서 운동수행능력 증진 및 근육량 증가 효과 Example 5. Effect of enhancing exercise performance and increasing muscle mass in a mouse animal model
5.1. 체지방의 감소 효과5.1. body fat reduction effect
본 발명자들은 마우스 동물모델에서 치자 추출물이 체지방을 감소시키는 효과가 있는지 확인하는 실험을 수행하였다. 마우스는 8주령의 C57BL/6 수컷 마우스가 사용되었고, AIN-93M Adult maintenance Rodent Diet (Research diet, D10012M) 베이스에 0.05 또는 0.1%(w/v)의 치자 추출물을 첨가하여 조제한 사료를 8주 동안 급여하였다. 실험된 마우스는 실험을 실시하기 전부터 실험을 시작하여 마우스가 희생되기 전까지 몸무게를 측정하였다. The present inventors performed an experiment to determine whether the effect of gardenia extract in reducing body fat in a mouse animal model. For the mouse, 8-week-old C57BL/6 male mice were used, and a feed prepared by adding 0.05 or 0.1% (w/v) gardenia extract to the AIN-93M Adult maintenance Rodent Diet (Research diet, D10012M) base was used for 8 weeks. paid The tested mice started the experiment before the experiment and their weight was measured until the mice were sacrificed.
마우스에는 희생(sacrifice)시키기 19일 전부터 덱사메타손(dexamethasone, 한동제약 덱사손)을 5 mg/kg로 복강 내로 투여하였다. 복강투여 15일차에 골밀도측정기(InAlyzer, 메디코어스)를 이용하여 마우스의 조직 내 지방비율(%, fat in tissue) 및 지방제외체중비율(%, lean body mass, 실질체중)을 측정하였다. Mice were intraperitoneally administered with dexamethasone (dexamethasone, Handong Pharmaceuticals) at 5 mg/kg 19 days before sacrifice. On the 15th day of intraperitoneal administration, using a bone densitometer (InAlyzer, Medicors), the percentage of fat in the tissue (%, fat in tissue) and the percentage of body weight without fat (%, lean body mass, real body weight) were measured.
골밀도측정기(Inalyzer)를 이용한 마우스의 체성분 측정 결과, 덱사메타손이 투여된 마우스(DEX)에서는 대조군에 비해 빨간색으로 나타낸 체지방의 비율이 높은 반면, 치자 추출물을 급여한 마우스(GJL, GJH)에서는 체지방 비율이 정상 대조군과 유사한 수준으로 감소하였음을 확인하였다 (도 6). As a result of measuring the body composition of mice using a bone densitometer (Inalyzer), the proportion of body fat indicated in red was higher in mice administered with dexamethasone (DEX) compared to the control group, whereas the proportion of body fat was higher in mice fed with gardenia extract (GJL, GJH) compared to the control group. It was confirmed that it was reduced to a level similar to that of the normal control ( FIG. 6 ).
특히, 덱사메타손이 급여된 마우스(DEX)에서는 대조군에 비해 조직 내 지방비율(%)이 증가한 반면, 치자 추출물이 급여된 마우스(GJL, GJH)에서는 덱사메타손이 급여된 마우스에 비해 조직 내 지방비율(%)이 농도-의존적으로 유의하게 감소되었음을 확인하였다 (도 6). 또한, 덱사메타손이 급여된 마우스(DEX)에서는 대조군에 비해 지방제외체중비율(%)이 감소한 반면, 치자 추출물이 급여된 마우스(GJL, GJH)에서는 지방제외체중비율(%)이 대조군과 유사하게 회복되는 효과가 있음을 확인하였다 (도 6). 이로써, 치자 추출물은 덱사메타손에 의해 증가된 체지방량을 감소시키는 효과가 있음을 확인하였다. In particular, in mice fed dexamethasone (DEX), the tissue fat ratio (%) was increased compared to the control group, whereas in mice fed with gardenia extract (GJL, GJH), the tissue fat ratio (%) compared to mice fed dexamethasone (%) ) was significantly decreased in a concentration-dependent manner ( FIG. 6 ). In addition, in mice fed dexamethasone (DEX), the proportion of body weight without fat (%) decreased compared to the control group, whereas in mice fed with gardenia extract (GJL, GJH), the ratio of body weight without fat (%) was recovered similar to that of the control group. It was confirmed that there is an effect (FIG. 6). Accordingly, it was confirmed that the gardenia extract has the effect of reducing the amount of body fat increased by dexamethasone.
5.2. 운동수행능력의 증진 효과5.2. Enhancement of exercise performance
이후, 본 발명자들은 마우스 동물모델에서 치자 추출물이 운동수행능력을 증진시키는 효과가 있는지 확인하는 실험을 수행하였다. 우선, 악력(Grip Strength) 및 매달리기 실험(Hanging test)은 복강투여 18일차에 마우스가 앞다리로 악력 및 매달리기를 5회 반복 실시하게 한 후 평균값을 계산하였고, 골격근 강도는 g로 나타내었다. 또한, 트레드밀(treadmill, Ugo Basile)을 이용하여 마우스의 운동시간(running time) 및 운동거리(running distance)를 측정하였다. 이때, 0분-20분까지는 경사 10도, 10m/min으로, 20분 이후는 2분마다 2m/min씩 증가하여 마우스의 운동거리를 측정하였다. Thereafter, the present inventors performed an experiment to determine whether the effect of gardenia extract to enhance exercise performance in a mouse animal model. First, in the grip strength and hanging test, on the 18th day of intraperitoneal administration, the mouse repeatedly performed grip strength and hanging with the forelimb 5 times, and then the average value was calculated, and the skeletal muscle strength was expressed in g. In addition, the running time and running distance of the mouse were measured using a treadmill (Ugo Basile). At this time, the movement distance of the mouse was measured by increasing the inclination of 10 degrees and 10 m/min from 0 min to 20 min, and increasing by 2 m/min every 2 min after 20 min.
그 결과, 덱사메타손이 급여된 마우스(DEX)에서는 대조군에 비해 악력(Grip Strength) 및 매달리기 실험(Hanging test)에서 현저히 감소된 운동수행능력을 보이는 반면, 치자 추출물이 급여된 마우스(GJL, GJH)에서는 덱사메타손이 급여된 마우스에 비해 악력 및 매달리기 실험에서 운동수행능력이 회복 또는 개선되는 효과가 있음을 확인하였다 (도 7). 또한, 덱메타손이 급여된 마우스(DEX)에서는 대조군에 비해 운동시간(running time) 및 운동거리(running distance)가 감소한 반면, 치자 추출물이 급여된 마우스(GJL, GJH)에서는 대조군과 유사한 수준으로 운동시간 및 운동거리가 회복되는 효과가 있음을 확인하였다 (도 7). 이로써, 치자 추출물은 덱사메타손에 의해 감소된 운동수행능력을 회복 또는 개선시키는 효과가 있음을 확인하였다. As a result, mice fed dexamethasone (DEX) showed significantly reduced exercise performance in the grip strength and hanging test compared to the control group, whereas in mice fed with gardenia extract (GJL, GJH) It was confirmed that there was an effect of recovering or improving exercise performance in the grip strength and hanging experiments compared to mice fed with dexamethasone (FIG. 7). In addition, in mice (DEX) fed with dexmethasone, the running time and running distance were decreased compared to the control group, whereas in mice fed with gardenia extract (GJL, GJH), the level was similar to that of the control group. It was confirmed that there is an effect of recovering the exercise time and exercise distance (FIG. 7). Accordingly, it was confirmed that the gardenia extract has the effect of restoring or improving the exercise performance decreased by dexamethasone.
5.3. 근육량의 증가 효과5.3. increase in muscle mass
이후, 본 발명자들은 18일의 복강투여가 끝난 후의 다음날에 마우스를 희생시키고, 대퇴사두근(Quadriceps), 비복근(gastrocnemius), 삼두근(Triceps), 전경골근(Tibialis anterior), 장지신근(Extensor digitorum longus) 및 비장근(Soleus)의 6부위 근육에서 근육량(근육 무게, 마우스 체중 당 mg으로 표시, mg/g body weight)을 계측하였다. Then, the present inventors sacrificed the mouse the next day after the end of the intraperitoneal administration of 18 days, quadriceps, gastrocnemius, triceps (Triceps), tibialis anterior, extensor digitorum longus (Extensor digitorum longus) And muscle mass (muscle weight, expressed in mg per mouse body weight, mg/g body weight) was measured in the 6 muscles of the soleus.
그 결과, 덱사메타손이 급여된 마우스(DEX)는 대조군에 비해 대퇴사두근(Quadriceps), 비복근(gastrocnemius) 등의 체내 근육량이 감소한 반면, 치자 추출물이 급여된 마우스(GJL, GJH)에서는 덱사메타손이 급여된 마우스에 비해 대퇴사두근(Quadriceps), 비복근(gastrocnemius)의 체내 근육량이 농도-의존적으로 유의하게 회복되었음을 확인하였다 (도 8). 이로써, 치자 추출물은 덱사메타손에 의해 감소된 근육량을 회복시키는 효과가 있음을 확인하였다. As a result, the mice fed dexamethasone (DEX) had a decrease in body muscle mass such as quadriceps and gastrocnemius compared to the control group, whereas mice fed with gardenia extract (GJL, GJH) were mice fed dexamethasone. In comparison, it was confirmed that the body muscle mass of the quadriceps and gastrocnemius was significantly recovered in a concentration-dependent manner ( FIG. 8 ). Accordingly, it was confirmed that the gardenia extract has the effect of restoring the muscle mass decreased by dexamethasone.
5.4. 근섬유 크기의 증가 효과5.4. Effect of increasing muscle fiber size
라미닌(Laminin)은 세포외기질(extracellular matrix)에 존재하는 단백질로서, 세포의 구조 형성에 필수적인 단백질인 것으로 알려져 있다. 본 발명자들은 치자 추출물이 근섬유의 크기에 영향을 주는지 확인하기 위하여, 라미닌 염색(laminin staining)을 통해 근섬유의 단면적(cross sectional area)을 관찰하였다. 간단히, 마우스의 비복근(gastrocnemius)을 OCT compound로 -20℃에서 고정한 후, 7 μm 두께로 박절하여 슬라이드에 붙였다. 이후, 박절된 근육조직을 20% 아세톤으로 고정하고, 10% FBS로 블러킹한 후, alexa fluor 488-conjugated laminin으로 4℃에서 16시간 동안 염색하였다. 염색된 조직은 PBS로 세척하였고, 커버 슬라이드를 덮은 후, 공초점 현미경(confocal microscope)을 통해 관찰하였다. 면역조직화학염색에서 라미닌은 녹색을 나타낸다. Laminin is a protein present in the extracellular matrix, and is known to be an essential protein for the formation of a cell structure. The present inventors observed the cross sectional area of the muscle fiber through laminin staining to confirm whether the gardenia extract affects the size of the muscle fiber. Briefly, the gastrocnemius of the mouse was fixed at -20°C with OCT compound, and then sliced to a thickness of 7 μm and attached to the slide. Thereafter, the sliced muscle tissue was fixed with 20% acetone, blocked with 10% FBS, and stained with alexa fluor 488-conjugated laminin at 4° C. for 16 hours. The stained tissue was washed with PBS, covered with a cover slide, and observed through a confocal microscope. In immunohistochemical staining, laminin is green.
그 결과, 덱사메타손이 급여된 마우스에서는 대조군에 비해 근섬유의 단면적이 작게 나타반 반면, 치자 추출물이 급여된 마우스에서는 농도 의존적으로 근섬유의 단면적이 유의하게 증가하였음을 확인하였다 (도 9). 또한, 근섬유 크기에 따른 분포 결과로부터, 덱사메타손이 급여된 마우스에서는 1,000 μm2 이하의 근섬유가 약 45%이고, 1,500 μm2 이하의 근섬유가 약 50%로 확인된 반면, 치자 추출물이 급여된 마우스에서는 덱사메타손이 급여된 마우스에 비해 1,000 μm2 이하의 근섬유가 감소하고, 2,000 μm2 이하의 근섬유가 농도-의존적으로 증가하였음을 확인하였다 (도 9). 이로써, 치자 추출물은 덱사메타손에 의해 감소된 근섬유의 크기를 회복시키는 효과가 있음을 확인하였다. As a result, it was confirmed that, in mice fed dexamethasone, the cross-sectional area of muscle fibers was smaller than that of the control group, whereas in mice fed with gardenia extract, the cross-sectional area of muscle fibers was significantly increased in a concentration-dependent manner (FIG. 9). In addition, from the distribution results according to the muscle fiber size, in mice fed dexamethasone, about 45% of muscle fibers of 1,000 μm 2 or less, and about 50% of muscle fibers of 1,500 μm 2 or less, were confirmed, whereas in mice fed with gardenia extract, It was confirmed that muscle fibers of 1,000 μm 2 or less decreased, and muscle fibers of 2,000 μm 2 or less increased in a concentration-dependent manner compared to mice fed dexamethasone ( FIG. 9 ). Thus, it was confirmed that the gardenia extract has the effect of restoring the size of the muscle fibers decreased by dexamethasone.
5.5. MHC (myosin heavy chain) 아형(isoform)의 구성 비율 회복 효과5.5. Composition ratio recovery effect of MHC (myosin heavy chain) isoform
골격근에 존재하는 MHC (myosin heavy chain)는 MHC1, MHC2A, MHC2B 같은 아형(isoform)을 가지고 있으며, 각 아형은 서로 다른 특징을 가지고 있는 것으로 알려져 있다. 특히, MHC1은 slow type, MHC2B는 fast type의 근육으로서, 노화가 진행될수록 fast-to-slow type 변환이 나타난다. 본 발명자들은 치자 추출물이 MHC 아형의 구성 비율에 영향을 주는지 확인하기 위하여, 근육에서 MHC 타입의 면역조직화학 염색을 수행하고 MHC 아형의 구성 비율을 분석하는 실험을 수행하였다. MHC (myosin heavy chain) present in skeletal muscle has isoforms such as MHC1, MHC2A, and MHC2B, and each subtype is known to have different characteristics. In particular, MHC1 is a slow type muscle and MHC2B is a fast type muscle, and as aging progresses, fast-to-slow type transformation appears. In order to determine whether the gardenia extract affects the composition ratio of MHC subtypes, the present inventors performed MHC-type immunohistochemical staining in muscle and performed an experiment to analyze the composition ratio of MHC subtypes.
간단히, 마우스의 비복근(gastrocnemius)을 OCT compound로 -20℃에서 고정한 후, 7 μm 두께로 박절하여 슬라이드에 붙였다. 이후, 박절된 근육조직을 20% 아세톤으로 고정하고, 10% FBS로 블러킹한 후, MHC1, MHC2A 및 MHC2B 1차 항체로 4℃에서 16시간 동안 염색하였다. 이후, PBS로 세척하였고, 2차 항체로 상온에서 30분 동안 염색하였다. 염색된 조직은 PBS로 세척하였고, 커버 슬라이드를 덮은 후, 공초점 현미경(confocal microscope)을 통해 관찰하였다. 면역조직화학염색에서 MHC1은 파란색, MHC2A는 녹색, MHC2B는 적색으로 나타난다. Briefly, the gastrocnemius of the mouse was fixed at -20°C with OCT compound, and then sliced to a thickness of 7 μm and attached to the slide. Then, the sliced muscle tissue was fixed with 20% acetone, blocked with 10% FBS, and stained with MHC1, MHC2A and MHC2B primary antibodies at 4°C for 16 hours. Then, it was washed with PBS and stained with a secondary antibody at room temperature for 30 minutes. The stained tissue was washed with PBS, covered with a cover slide, and observed through a confocal microscope. In immunohistochemical staining, MHC1 is blue, MHC2A is green, and MHC2B is red.
그 결과, 덱사메타손이 급여된 마우스에서는 대조군에 비해 slow type의 MHC1이 증가하고, fast type의 MHC2B가 감소한 반면, 치자 추출물이 급여된 마우스에서는 덱사메타손에 급여된 마우스에 비해 MHC1이 대조군과 유사한 수준으로 유의하게 감소하고, MHC2B가 현저하게 증가하였음을 확인하였다 (도 10). 이로써, 치자 추출물은 덱사메타손에 의해 증가된 slow type의 MHC1를 감소시키고, 덱사메타손에 의해 감소된 fast type의 MHC2B를 증가시키는 효과가 있음을 확인하였다. As a result, in mice fed with dexamethasone, MHC1 of the slow type increased and MHC2B of the fast type decreased compared to the control group, whereas in mice fed with gardenia extract, MHC1 was significant at a level similar to that of the control group compared to mice fed with dexamethasone. decreased, and it was confirmed that MHC2B was significantly increased (FIG. 10). Accordingly, it was confirmed that the gardenia extract had the effect of reducing the slow type MHC1 increased by dexamethasone and increasing the fast type MHC2B decreased by dexamethasone.

Claims (12)

  1. 치자(Gardenia jasminoides) 추출물을 유효성분으로 포함하는 근육 질환의 예방 또는 개선용 식품 조성물.Gardenia ( Gardenia jasminoides ) Food composition for the prevention or improvement of muscle diseases comprising an extract as an active ingredient.
  2. 제 1 항에 있어서,The method of claim 1,
    상기 추출물은 물, 유기용매 또는 이들의 혼합물에 의하여 추출된 것인, 조성물.Wherein the extract is extracted by water, an organic solvent, or a mixture thereof, the composition.
  3. 제 2 항에 있어서, 3. The method of claim 2,
    상기 유기 용매는 메탄올, 에탄올, 프로판올, 이소프로판올, 부탄올, 아세톤, 에테르, 벤젠, 클로로포름, 에틸아세테이트, 메틸렌클로라이드, 헥산 및 시클로헥산으로 이루어진 그룹에서 선택되는 것인, 조성물. Wherein the organic solvent is selected from the group consisting of methanol, ethanol, propanol, isopropanol, butanol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane and cyclohexane.
  4. 제 1 항에 있어서, The method of claim 1,
    상기 조성물은 근위축을 야기하는 Atrogin-1 및 MuRF-1(Muscle RING-finger protein-1)의 발현을 억제하는 것인, 조성물. The composition is to inhibit the expression of Atrogin-1 and MuRF-1 (Muscle RING-finger protein-1) causing muscle atrophy, the composition.
  5. 제 1 항에 있어서, The method of claim 1,
    상기 조성물은 근육분화를 억제하는 Myostatin의 발현을 억제하는 것인, 조성물. The composition is to inhibit the expression of Myostatin, which inhibits muscle differentiation.
  6. 제 1 항에 있어서, The method of claim 1,
    상기 조성물은 근육분화를 촉진하는 MyoG (myogenin) 및 MyoD (myoblast determination protein 1)의 발현을 증가시키는 것인, 조성물. The composition is to increase the expression of MyoG (myogenin) and MyoD (myoblast determination protein 1) that promotes muscle differentiation, the composition.
  7. 제 1 항에 있어서, The method of claim 1,
    상기 근육 질환은 긴장감퇴증(atony), 근위축증(muscular atrophy), 근이영양증(muscular dystrophy), 근육 퇴화, 근경직증, 근위축성 축삭경화증, 근무력증, 악액질(cachexia), 근육감소증(sarcopenia) 및 이의 조합으로 이루어진 군에서 선택되는 것인, 조성물.The muscle disease is dystonia (atony), muscular atrophy (muscular atrophy), muscular dystrophy (muscular dystrophy), muscle degeneration, muscle stiffness, amyotrophic axonal sclerosis, myasthenia gravis, cachexia (cachexia), sarcopenia and combinations thereof. Which is selected from the group consisting of, the composition.
  8. 치자 추출물을 유효성분으로 포함하는 근육 질환의 예방 또는 치료용 약학적 조성물. A pharmaceutical composition for the prevention or treatment of muscle diseases comprising a gardenia extract as an active ingredient.
  9. 치자 추출물을 유효성분으로 포함하는 근육강화용 조성물.A composition for strengthening muscles comprising a gardenia extract as an active ingredient.
  10. 치자 추출물을 유효성분으로 포함하는 근육분화 촉진용 조성물. A composition for promoting muscle differentiation comprising a gardenia extract as an active ingredient.
  11. 치자 추출물을 유효성분으로 포함하는 운동능력 증진용 조성물.A composition for enhancing athletic performance comprising a gardenia extract as an active ingredient.
  12. 제 11 항에 있어서, 12. The method of claim 11,
    상기 운동능력 증진은 근육 기능 저하를 야기하는 퇴행성 질환, 미토콘드리아 이상 질환, 지구력 저하증, 순발력 저하증, 무기력증, 근육 폐기 및 우울증으로 이루어진 군에서 선택되는 하나 이상의 증상을 예방 또는 개선시키는 것인, 조성물.The exercise capacity enhancement is to prevent or improve one or more symptoms selected from the group consisting of degenerative diseases, mitochondrial abnormalities, hypostamina, hypotonia, lethargy, muscle wasting, and depression that cause a decrease in muscle function, composition.
PCT/KR2022/000286 2021-01-07 2022-01-07 Composition for preventing, alleviating, or treating muscle diseases, containing extract of gardenia jasminoides as active ingredient WO2022149901A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20210002232 2021-01-07
KR10-2021-0002232 2021-01-07

Publications (1)

Publication Number Publication Date
WO2022149901A1 true WO2022149901A1 (en) 2022-07-14

Family

ID=82358236

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/000286 WO2022149901A1 (en) 2021-01-07 2022-01-07 Composition for preventing, alleviating, or treating muscle diseases, containing extract of gardenia jasminoides as active ingredient

Country Status (2)

Country Link
KR (1) KR20220099917A (en)
WO (1) WO2022149901A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150064287A1 (en) * 2013-08-27 2015-03-05 National Taiwan Normal University Method for treating abnormal polyglutamine-mediated diseases
CN107213360A (en) * 2017-08-03 2017-09-29 洛阳士雄聚元医疗集团股份有限公司 A kind of Chinese medicine composition for treating heavy myasthenia
WO2020037895A1 (en) * 2018-08-22 2020-02-27 江南大学 Application of geniposide in promoting formation of skeletal muscle fast muscle

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150064287A1 (en) * 2013-08-27 2015-03-05 National Taiwan Normal University Method for treating abnormal polyglutamine-mediated diseases
CN107213360A (en) * 2017-08-03 2017-09-29 洛阳士雄聚元医疗集团股份有限公司 A kind of Chinese medicine composition for treating heavy myasthenia
WO2020037895A1 (en) * 2018-08-22 2020-02-27 江南大学 Application of geniposide in promoting formation of skeletal muscle fast muscle

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HAIOU PAN, YAN LI, HAIFENG QIAN, XIGUANG QI, GANGCHENG WU, HUI ZHANG, MEIJUAN XU, ZHIMING RAO, JIN-LONG LI, LI WANG, HAO YING: "Effects of Geniposide from Gardenia Fruit Pomace on Skeletal-Muscle Fibrosis", JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY, vol. 66, no. 23, 13 June 2018 (2018-06-13), US , pages 5802 - 5811, XP055687486, ISSN: 0021-8561, DOI: 10.1021/acs.jafc.8b00739 *
HUANG SHANG-MING, LIN SHUAN-YING, CHEN MING-KAI, PENG CHIUNG-CHI, HSIEH CHIU-LAN: "Effects of Geniposide and Geniposidic Acid on Fluoxetine-Induced Muscle Atrophy in C2C12 Cells", PROCESSES, vol. 9, no. 9, 1 January 2021 (2021-01-01), pages 1 - 12, XP055949758, DOI: 10.3390/pr9091649 *

Also Published As

Publication number Publication date
KR20220099917A (en) 2022-07-14

Similar Documents

Publication Publication Date Title
WO2022050516A1 (en) Coronavirus therapeutic agent comprising elaeocarpus sylvestris extract as active ingredient
WO2020218720A1 (en) Composition for preventing or treating muscular disorders or improving muscular functions, containing leonurus japonicus extract or leonurine
WO2020231127A1 (en) Strain showing liver function improving activity, and use thereof
WO2019231150A1 (en) Composition comprising aster sphathulifolius maxim extract for preventing, improving, or treating muscular diseases or for improving muscular functions
KR102050099B1 (en) Composition for Preventing, Improving or Treating of muscular disease containing Davallia mariesii extract
WO2017003086A1 (en) Composition for inhibiting and preventing myopathy, containing bean leaf extract as active ingredient
WO2013141581A1 (en) Pharmaceutical composition or health food comprising lonicera coerulea var. edulis fruit extracts as active ingredients for preventing or improving ischemic cerebrovascular diseases
WO2021080129A1 (en) Composition for strengthening skin barrier and alleviating atopic dermatitis, having hydrangenol or phyllodulcin as active ingredient
WO2022149901A1 (en) Composition for preventing, alleviating, or treating muscle diseases, containing extract of gardenia jasminoides as active ingredient
WO2018070705A1 (en) Composition for preventing or treating muscle diseases, containing, as active ingredient, diosmin or pharmaceutically acceptable salt thereof
KR102500412B1 (en) Composition for Preventing, Improving or Treating of muscular disease containing Ricinus communis L. extract
WO2016093613A2 (en) Composition for preventing or treating abnormal weight loss, containing citrus unshiu peel extract
WO2015167240A1 (en) Composition containing scutellaria alpina extract
WO2016190481A1 (en) Anticancer adjuvant containing panaxadiol ginsenocide compound
KR102320221B1 (en) Composition for Preventing, Improving or Treating of muscular disease containing Valeriana fauriei Briq. extract
WO2021002642A1 (en) Composition for preventing or treating rheumatoid arthritis, comprising snake venom
WO2015152653A1 (en) Composition comprising extract of alpine wormwood
KR102050100B1 (en) Composition for Preventing, Improving or Treating of muscular disease containing Phytolacca esculenta extract
KR102034313B1 (en) Composition for Preventing, Improving or Treating of muscular disease containing Isatis indigotica Fortune extract
KR102463328B1 (en) Composition for preventing, improving or treating of muscular disease containing Rosa aff rubiginosa.L. extract
WO2020004989A1 (en) Composition for preventing, improving or treating cachexia comprising kimchi
KR102487438B1 (en) Composition for preventing, improving or treating of muscular disease comprising Chrysanthemum zawadskii extract
WO2019078381A1 (en) Pharmaceutical composition, food composition and food additive for preventing, alleviating or treating muscle loss, weakness and atrophy, containing, as active ingredient, enterococcus faecalis, culture liquid thereof or dead cells thereof
WO2022035220A1 (en) Composition for preventing, ameliorating or treating muscle weakness-related muscle diseases comprising chestnut flower extract
KR102303624B1 (en) Composition for Preventing, Improving or Treating of muscular disease containing Petasites japonicus extract

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22736878

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22736878

Country of ref document: EP

Kind code of ref document: A1