KR102320221B1 - Composition for Preventing, Improving or Treating of muscular disease containing Valeriana fauriei Briq. extract - Google Patents

Abstract

The present invention relates to a composition for preventing, improving or treating muscle diseases comprising a valerian extract as an active ingredient, and more particularly, to a muscle strengthening composition comprising a valerian extract as an active ingredient or a food composition for improving exercise ability. it's about The method of the present invention, since the valerian extract increases the size of muscle cells and has the effect of improving exercise performance, it can be usefully used to prevent, improve or treat muscle diseases without side effects. .

Description

A composition for preventing, improving or treating muscular diseases comprising a valerian extract as an active ingredient TECHNICAL FIELD [0002] Composition for Preventing, Improving or Treating of muscular disease containing Valeriana fauriei Briq. extract}

The present invention relates to a composition for preventing, improving or treating muscle diseases comprising a valerian extract as an active ingredient, and more particularly, to a muscle strengthening composition comprising a valerian extract as an active ingredient or a food composition for improving exercise ability. it's about

The muscle is the tissue with the most composition in the human body, and in order to maintain the functional capacity of the human body and to prevent metabolic diseases, it is essential to secure an appropriate muscle mass. Muscle size is regulated by intracellular signaling pathways that induce anabolism or catabolism within the muscle. When a signal transduction reaction that induces synthesis rather than degradation of muscle protein occurs, muscle protein synthesis is increased, and as a result, muscle hypertrophy (hypertrophy) or increase in the number of muscle fibers (hyperplasia) occurs (The Korea) Journal of Sports Science, 20(3): 1551-1561, 2011).

Muscles also promote calcium influx and increase bone density. However, as the body ages, the redistribution of body fat and body proteins occurs due to changes in the composition of the body. At the age of 50, the rate of protein synthesis in muscle cells becomes slower than the rate of decomposition, leading to rapid muscle degeneration and exposure to muscle loss disease. can be

Sarcopenia, one of muscle loss diseases, refers to a state in which about 13 to 24% of one's body mass is decreased, and indicates a decrease in protein content, fiber diameter, muscle strength production, and fatigue resistance. Sarcopenia is caused by a variety of causes, including sepsis, cancer, renal failure, excess glucocorticoids, denervation, muscle non-use, and the aging process. Mainly, the gradual decrease in the quantity and quality of skeletal muscle that occurs with aging and weight loss including fat and body fat components due to inadequate dietary energy intake can be cited as the causes. .

Sarcopenia results from an imbalance between protein synthesis and degradation. If there is sarcopenia, the amount of action is significantly reduced, which not only harms mental health, but also reduces life satisfaction, and even in easy daily life, it is easy to get injured and serious serious injuries.

In addition, excessive exercise causes muscle fatigue and damage, and reduces exercise capacity. Muscle injuries include bruises, lacerations, ischemia, strains, and severe damage to skeletal muscles. In addition to causing great pain, the injured person can become incapacitated by preventing him from continuing to exercise and work, or even performing normal daily activities. When there is severe damage to the skeletal muscle, sprains are most common, which are characterized by destruction of the muscle-tendon unit. Destruction of these muscle-tendon units can occur anywhere in the muscle. Constraints account for more than 30% of all injuries treated professionally or by sports medicine professionals.

Treatments that reduce muscle damage or speed up recovery of muscle tissue have the potential to speed up recovery of muscle development after exercise. It may also help muscle recovery after illness.

However, as interest in appearance and diet has increased recently, sarcopenia may be induced by rapid weight loss regardless of age, and muscle may be damaged by vigorous exercise.

Accordingly, studies and efforts to treat muscle loss caused by general muscle loss diseases or to increase muscles are being concentrated, and studies on treatment of muscle loss diseases and muscle strengthening are still required.

Accordingly, the present inventors have searched for a natural substance that has muscle function strengthening and muscle reduction inhibitory activity and can be safely applied, confirming that the valerian extract has the effect of preventing and treating sarcopenia, increasing muscle mass, inhibiting muscle loss, or increasing muscle endurance Thus, the present invention was completed.

Therefore, it is an object of the present invention to provide a composition for preventing, improving or treating muscle diseases, comprising an extract of Valeriana fauriei Briq.

Another object of the present invention is to provide a composition for strengthening muscles comprising a valerian extract as an active ingredient.

Another object of the present invention is to provide a food composition for improving exercise ability comprising a valerian extract as an active ingredient.

In order to achieve the above object, the present invention provides a composition for preventing, improving or treating muscle diseases, comprising an extract of Valeriana fauriei Briq.

In order to achieve another object of the present invention, the present invention provides a composition for strengthening muscles comprising a valerian extract as an active ingredient.

In order to achieve another object of the present invention, the present invention provides a food composition for improving exercise ability comprising a valerian extract as an active ingredient.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for preventing, improving or treating muscle diseases, comprising an extract of Valeriana fauriei Briq.

In the present invention, the valerian grass ( Valeriana fauriei Briq. ) has been known as silver leaf, sagebrush, and herbal medicine name gilcho. It is a perennial plant that belongs to the family Honeysuckle and Matariaceae, and is a perennial herb with a strong scent. It inhabits humid places in the mountains and is distributed throughout Korea, theory, Taiwan, Manchuria, and Sakhalin. Known ingredients include borneolisovaleric acid, isovalerate, and valerosidatum. Spice - (root) Used as a flavoring for tobacco. Edible - Young leaves and sterling silver are also eaten as greens. Medicinal - (Root root) It is known to be effective for neurasthenia and neuropathy.

The extract of the present invention may be extracted by a known natural extracting method. It has a meaning commonly used as a crude extract in the art, but broadly includes a fraction obtained by additionally fractionating the extract. . That is, the valerian extract includes not only those obtained using an extraction solvent, but also those obtained by additionally applying a purification process here. For example, a fraction obtained by passing the extract through an ultrafiltration membrane having a constant molecular weight cut-off value, separation by various chromatography (prepared for separation according to size, charge, hydrophobicity or affinity), etc. The fraction obtained through the purification method may also be included in the extract of the present invention. Preferably, it is characterized in that the extract is obtained by at least one solvent selected from the group consisting of water, an organic solvent having 1 to 6 carbon atoms, a subcritical fluid, a supercritical fluid, and a mixture thereof.

In the present invention, the muscle disease is a progressive disease characterized by a loss of walking ability due to a gradual decrease in muscle strength, weakness in respiratory muscle, weakness in heart function, etc. It is a chronic disease that causes In addition, muscle diseases can be divided into congenital diseases and acquired diseases, but are not limited thereto, but atony, muscular atrophy, muscular dystrophy, muscle degeneration, muscle stiffness, muscular dystrophy, muscular atrophy It may be axonal sclerosis, myasthenia gravis, cachexia or sarcopenia.

The present invention provides a composition for strengthening muscles comprising a valerian extract as an active ingredient.

In the present invention, muscle strengthening refers to an effect of increasing muscle strength and/or size of a muscle, and the type of muscle is not limited. Preferably, it exhibits an effect of increasing muscle mass, and is characterized in that it exhibits an effect of inhibiting muscle loss.

The increase in muscle mass is to improve muscle performance, and it is possible to increase muscle mass through physical exercise and improvement of endurance, and to increase muscle mass by administering a substance having a muscle increasing effect into the body. In addition, the muscle reduction is characterized by a gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal or voluntary muscles and cardiac muscles, genetic factors, and acquired factors. Aging may be the cause.

The composition of the present invention is characterized in that it is a pharmaceutical composition or a food composition comprising a valerian extract as an active ingredient.

The pharmaceutical composition according to the present invention may contain the valerian extract alone or may be formulated in a suitable form together with a pharmaceutically acceptable carrier, and may further contain an excipient or diluent. As used herein, the term 'pharmaceutically acceptable' refers to a non-toxic composition that is physiologically acceptable and does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans.

The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, various drug delivery materials used for oral administration of the peptide formulation may be included. In addition, the carrier for parenteral administration may include water, a suitable oil, saline, aqueous glucose and glycol, and the like, and may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, etc. in addition to the above components. For other pharmaceutically acceptable carriers and agents, reference may be made to those described in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The composition of the present invention can be administered to mammals including humans by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal administration. can be

The pharmaceutical composition of the present invention may be formulated as a formulation for oral administration or parenteral administration according to the administration route as described above.

In the case of a formulation for oral administration, the composition of the present invention may be formulated as a powder, granule, tablet, pill, dragee, capsule, liquid, gel, syrup, slurry, suspension, etc. using methods known in the art. can For example, oral preparations can be obtained by blending the active ingredient with a solid excipient, pulverizing it, adding a suitable adjuvant, and processing it into a granule mixture to obtain tablets or dragees. Examples of suitable excipients include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches, including corn starch, wheat starch, rice starch and potato starch, cellulose, Cellulose, including methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, and the like, fillers such as gelatin, polyvinylpyrrolidone, and the like may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant if necessary. Furthermore, the pharmaceutical composition of the present invention may further include an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, and a preservative.

Formulations for parenteral administration can be formulated in the form of injections, creams, lotions, external ointments, oils, moisturizers, gels, aerosols and nasal inhalants by methods known in the art. These formulations are described in Remington's Pharmaceutical Science, 19th ed., Mack Publishing Company, Easton, PA, 1995, which is a commonly known recipe for all pharmaceutical chemistry.

The total effective amount of the composition of the present invention may be administered to a patient as a single dose, or may be administered by a fractionated treatment protocol in which multiple doses are administered for a long period of time. The pharmaceutical composition of the present invention may vary the content of the active ingredient depending on the severity of the disease. Preferably, the preferred total dose of the pharmaceutical composition of the present invention may be about 0.01 μg to 10,000 mg, most preferably 0.1 μg to 500 mg per kg of body weight of the patient per day. However, the dosage of the pharmaceutical composition is determined by considering various factors such as the formulation method, administration route and number of treatments, as well as the patient's age, weight, health status, sex, severity of disease, diet and excretion rate, etc., the effective dosage for the patient is determined. Therefore, in consideration of this point, those of ordinary skill in the art will be able to determine an appropriate effective dosage of the composition of the present invention. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route and administration method as long as the effect of the present invention is exhibited.

The present invention provides a food composition for improving exercise ability comprising a valerian extract as an active ingredient.

In the present invention, the exercise ability can be performed quickly, strongly, accurately, for a long time, and skillfully when physical motions seen in daily life or sports are externally divided into running, jumping, throwing, swimming, etc. It indicates the degree of presence, and exercise performance is defined by factors such as muscle strength, agility, and endurance.

The term 'improving athletic performance' refers to improving or improving athletic performance. Preferably, the food composition exhibits an effect of increasing muscle strength and is characterized in that it exhibits an effect of increasing muscle endurance. In addition, although not limited thereto, it may be to prevent or improve symptoms such as degenerative diseases, mitochondrial abnormalities, hypostamina, hypoactivity, lethargy, muscle wasting or depression.

The composition for food using the valerian extract according to the present invention includes all types of functional food, nutritional supplement, health food, and food additives. The above types can be prepared in various forms according to conventional methods known in the art.

For example, as a health food, the composition for food of the present invention may be prepared in the form of tea, juice, and drink for drinking, or may be ingested by granulation, encapsulation and powdering. In addition, the composition for food of the present invention can be prepared in the form of a composition by mixing with known substances or active ingredients known to have effects of promoting hair growth and anti-inflammatory.

In addition, functional foods include beverages (including alcoholic beverages), fruits and their processed foods (eg, canned fruit, canned fruit, jam, marmalade, etc.), fish, meat and their processed foods (eg, ham and sausage cornbread). if), breads and noodles (eg udon noodles, soba noodles, ramen, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (eg butter, cheese, etc.), edible vegetable oils and fats, margarine , vegetable protein, retort food, frozen food, various seasonings (eg, soybean paste, soy sauce, sauce, etc.) can be prepared by adding the composition for food of the present invention.

The preferred content of the composition for food according to the present invention is not limited thereto, but is preferably 0.01 to 50% by weight based on the total weight of the finally prepared food. In order to use the composition for food of the present invention in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate.

In one embodiment of the present invention, when the valerian extract was treated with PPAR delta, ERR3 over cells to measure the luciferase activity, the two transcription activities were increased to increase the utilization rate in the muscle cells. It was confirmed that it was effective for formation and differentiation.

In one embodiment of the present invention, the valerian extract was treated with a diet to C. elegans, and as a result of analyzing the life span, it was confirmed that there was no significant effect in the worm lifespan and healthspan compared to the control group N2. Could.

In one embodiment of the present invention, after treating the valerian extract on muscle cells, RNA is extracted, and atrogin-1, MurF-1, which induces atrophy by destroying muscle proteins, Myostatin that inhibits muscle differentiation, and muscle As a result of measuring the expression levels of MyoG and MyoD mRNA that regulate differentiation, the treatment with valerian extract significantly regulated the above gene expression compared to the group treated with dexamethasone, which was effective for the formation and differentiation of muscle cells. could confirm that

In one embodiment of the present invention, the protein expression of T-MHC, MHCI, MHCIIa, and MHCIIb was measured after treatment with the valerian extract on muscle cells, and as a result of the treatment with dexamethasone, the muscle cell constituent protein decreased. Expression was significantly increased when the valerian extract was treated, and it was confirmed that it was effective in the formation of muscle cells.

In one embodiment of the present invention, cellular respiration rate, that is, oxygen consumption rate (OCR) was measured after treatment with the valerian extract on muscle cells, and the decreased cellular respiration rate when treated with dexamethasone was significantly reduced when the valerian extract was treated. recovery could be confirmed.

In another embodiment of the present invention, it was found that when the valerian extract was administered to the mouse, the movement distance and the muscle mass in the mouse body were increased to recover.

Accordingly, the present invention provides a composition for preventing, improving or treating muscle diseases, comprising the valerian extract as an active ingredient. The method of the present invention confirms the effect of the valerian extract on muscle cells, and since the valerian extract showed an effect of improving muscle mass, muscular endurance or athletic performance when ingested, a composition for preventing, improving or treating muscle diseases, exercise ability It can be usefully used as a food composition for enhancement, a composition for strengthening muscles.

Figure 1 shows the results of measuring Luciferase activity after treatment with a valerian extract on PPAR delta, ERR3 over cells using U-2 OS (HTB-96 ^{TM) human-derived bone cells.}
2 is a result of analyzing the life span of a Valerian extract by treating C. elegans as a diet.
3 shows the results of confirming the expression change of myocyte differentiation and muscle contraction-related mRNA according to the treatment of the valerian extract after treating the differentiated myoblasts with dexamethasone.
4 is a result of confirming the expression change of muscle type protein according to the treatment of valerian extract after treating the differentiated myoblasts with dexamethasone.
5 is a result of confirming the change in cellular respiration rate according to the treatment of valerian extract after treating myoblasts with dexamethasone.
6 is a result of measuring the change in the movement distance and muscle mass in the muscles of the gastrocnemius, Soleus, Quadriceps, and Triceps regions after feeding dexamethasone to the mouse.

Hereinafter, the present invention will be described in detail.

However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

<Experiment method>

One-way ANOVA was performed for all study results using GraphPad Prism 7 (GraphPad Software Inc., SanDiego, CA, USA), and statistical significance was verified by Boneferroni multiple comparison post test, *p<0.05, **p It was expressed as <0.01, ***p<0.001.

1. Preparation of Valerian Extract Sample

Dry valerian was purchased and ground into a powder. Hot water extraction was performed for 2 hours using a 50% ethanol solvent in a volume 10 times the weight of the powder. After the extract was concentrated under reduced pressure, the final product obtained by freeze-drying after freezing at -80°C was finely pulverized and used in the experiment.

2. Measurement of the regulation of luciferase activity of PPAR delta and ERR3 transcription of murine urine extract

U-2 OS (HTB-96 ^TM ) human-derived bone cells used in the experiment were purchased from American type Cell Collection (ATCC, USA) and cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS.

The plasmid DNA of pBABE-puro (addgene, Plasmide #1764), pBABE puro PPAR delta (addgene, Plasmide #8891), and pSG5-HA-ERR3 (addgene, Plasmide #37850) was converted to X-tremeGENE 9 DNA Transfection Reagent (06 365 787). 001, Roche, Switzerland) was used to construct a target over cell.

After processing valerian extract on the prepared PPAR delta and ERR3 over cells, PPRE X3-TK-lus (addgene, Plasmide #1015), pRL-SV40P (addgene, Plasmide #27163) plasmid DNA and Dual-Luciferase® Reporter Assay System ( Promega, E1910) was used to measure luciferase activity. The results are shown in FIG. 1 .

3. Lifespan Analysis of C. elegans from Valerian Extract

The life span of the valerian extract was analyzed using C. elegans. After making a culture plate by adding 100 mg/mL of valerian extract to Nematode Growth Medium (NGM), 200 μl of OP50 culture was dispensed to create basic culture conditions. Here, two N2 L4 stage worms were separated from one plate and incubated in an incubator at 15°C for a week. After a week, young adults from synchronized L4 were collected in 200μl M9 buffer and incubated at 20°C overnight. After overnight incubation, dispense in the NGM prepared for the L1 stage and incubate for two days. After two days of incubation, when the L1 stage grows to L4, transfer one worm per plate to a new NGM (n=30). After raising the worms in an incubator at 20 °C, the date of death was recorded for each worm, and when all the worms died, the life span was measured by analyzing the death records. The results are shown in FIG. 2 .

4. Confirmation of changes in mRNA expression of muscle contraction and differentiation regulators when valerian extracts differentiated muscle cells

Mouse-derived myoblasts, C2C12 (CRL1772 ATCC, USA) cells were cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS, and treated with DMEM differentiation medium containing 2% HS for 4 days. After differentiation induction, valerian extract 1, 2.5 μg/mL and dexamethasone 5 μM were treated.

After 24 hours, the cells were washed with PBS, the cells were obtained, and total RNA was extracted using the NucleoSpin RNA kit (Nacherey-Nagel, Duren, Germany) according to the manufacturer's instructions. Then, cDNA was synthesized using Synthesize cDNA for real-time PCR kit (ReverTra Ace qPCR RT Master Mix, FSQ-201, TOYOBO), and PCR was performed with SYBR Green MasterMix (TOYOBO Co. Ltd., Osaka, Japan). to measure the mRNA expression levels of atrogin-1, MurF-1, Myostatin, MyoG, and MyoD. The results are shown in FIG. 3 .

primer sequence base sequence SEQ ID NO: Atrogin Sense GACTGGACTTCTCGACTGCC One Anti-sense TCAGGGATGTGAGCTGTGAC 2 MurF-1 Sense GCTGGTGGAAAACATCATTGACAT 3 Anti-sense CATCGGGTGGCTGCCTTT 4 Myostatin Sense ACGCTACCACGGAAACAATC 5 Anti-sense GGAGTCTTGACGGGTCTGAG 6 MyoG Sense GCAGGCTCAAGAAAGTGAATGA 7 Anti-sense TAGGCGCTCAATGTACTGGAT 8 MyoD Sense CGGGACATAGACTTGACAGGC 9 Anti-sense TCGAAACACGGGTCATCATAGA 10 18s RNA Sense GTAACCCGTTGAACCCCATT 11 Anti-sense CCATCCAATCGGTAGTAGCG 12

5. Effect of valerian extract on muscle type protein expression

Mouse-derived myoblasts, C2C12 (CRL1772 ATCC, USA) cells were cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS, and treated with DMEM differentiation medium containing 2% HS for 4 days. After differentiation induction, valerian extract 1, 2.5 μg/mL and Dexamethasone 5 μM were treated.

After 24 hours, the cells were washed using PBS, the cells were obtained, and the protein was extracted by dissolving in RIPA buffer (Thermo Scientific, Waltham, MA, USA), and then electrophoresed using an SDS-PAGE gel. was carried out. After that, the membrane to which the protein was transferred was blocked with 5 (v/v)% skim milk for 1 hour, the primary antibody was heated at 4° C. overnight, and the secondary antibody was incubated at room temperature. After attaching for 2 hours in a , protein expression was measured using an enhanced chemiluminescence (ECL) solution.

The primary antibody used for western blotting performed in the present invention is β-actin (β-actin, Santa Cruz Biotechnology, Santa Cruz, CA, USA), MHC (myosin heavy chain), MHC1 (oxidative, slow type), MHC2A (oxidative, fast type) and MHC2B (glycolytic, fast type) (Developmental Studies Hybridoma Bank, Iowa City, Iowa, USA). The results are shown in FIG. 4 .

6. Confirmation of the effect of valerian extract on respiration rate

The respiration rate, that is, oxygen consumption rate (OCR) of the valerian extract was measured using an XF analyzer (Seahorse Bioscience, USA).

C2C12 (CRL1772 ATCC, USA) cells, which are mouse-derived myoblasts, were cultured in DMEM (Dulbecco's Modified Eagle Medium) medium containing 10% FBS. Cells were prepared by seeding according to the instructions of XF-24 FluxPak (Seahorse, Agilent, USA). After 24 hours of treatment with dexamethasone and valerian extract 1, 2.5 μg/mL, it was replaced with a bicarbonate-free medium and cultured in a cell incubator without _{CO 2 for 1 hour.} 1.5 µM oligomycin, 2 µM carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (carbonyl cyanide-4-(trifluoromethoxy)) using Seahorse XF Cell Mito Stress Test Kit (Agilent, USA) phenylhydrazone (FCCP)) and 1 μM rotenone, a respiratory chain inhibitor, were sequentially treated to measure the change in OCR. The results are shown in FIG. 5 .

7. Confirmation of effect of valerian extract by mouse administration

A feed prepared by adding 0.1% (w/w) of valerian extract freeze-dried powder to the AIN-93G growing Rodent Diet (Research diet, D10012G) base was fed to 8-week-old C57BL/6 male mice for 8 weeks.

During feeding, dexamethasone (dexamethasone, Handong Pharmaceuticals) was administered intraperitoneally at 5 mg/kg 19 days before sacrificing. On the 18th day of intraperitoneal administration, the movement distance of the mouse was measured using a treadmill (ugo basile). At this time, the movement distance of the mouse was measured by increasing the inclination of 10 degrees and 10 m/min from 0 min to 20 min, and increasing by 2 m/min every 2 min after 20 min. After the 18-day intraperitoneal administration was completed, the mice were sacrificed the next day, and the muscle mass (muscle weight, expressed in mg per mouse body weight (g BW)) of the four muscles of gastrocnemius, Soleus, Quadriceps, and Triceps was measured.

<Example 1> Measurement of luciferase activity regulation of PPAR delta and ERR3 transcription of Valerian extract

As can be seen in Figure 1, it was confirmed that the valerian extract significantly increased the activity of ERR3 and PPAR delta. It was found that the valerian extract effectively regulates ERR3 and PPAR delta activities, which play an important transcriptional role in muscle cells.

<Example 2> Lifespan analysis of C. elegans of Valerian extract

As can be seen in Figure 2, compared to the N2 worm control group, the overall lifespan measurement in the group treated with 100 μg/mL valerian extract showed no effect. In the individual worm lifespan observation results, there was no significant difference compared to the control group, so the valerian extract did not appear to have a significant effect on the worm lifespan and healthspan.

<Example 3> Confirmation of changes in mRNA expression of muscle contraction and differentiation regulators when valerian extract is differentiated into muscle cells

As can be seen in Figure 3, the results of confirming the gene expression of Atrogin-1, MurF-1 (Muscle RING-finger protein-1), which causes atrophy by destroying muscle protein, dexamethasone It was confirmed that the treated group significantly increased compared to the control group, DMSO group.

On the other hand, it was confirmed that the increase in gene expression caused by dexamethasone was significantly reduced in the group treated with the valerian extract at 1, 2.5 μg/mL. It was possible to confirm the efficacy of valerian extract to regulate muscle atrophy-regulating genes.

As a result of analyzing the gene expression of MyoD and MyoG (myogenin), which are known to regulate muscle differentiation, and myostatin, a muscle differentiation inhibitor, the expression of MyoD and MyoG was significantly higher in the dexamethasone-treated group compared to the control group DMSO. decreased and myostatin significantly increased.

It was confirmed that the gene expression of MyoD, MyoG, and myostatin, which are genes regulating muscle differentiation during treatment with dexamethasone, was significantly regulated when treated with valerian extract 1, 2.5 μg/mL. As a result, it was confirmed that the valerian extract has the effect of regulating muscle differentiation.

<Example 4> Effect of valerian extract on muscle type protein expression

As can be seen in FIG. 4, protein expression of myofibrils T-MHC, MHCI, MHCIIa, and MHCIIb was inhibited by treatment with dexamethasone, but the protein expression concentration was increased according to treatment with valerian extract 1 and 2.5 μg/mL. was significantly recovered in a dependent manner.

As a result, it was confirmed that the atrophy of the muscle fibers induced by dexamethasone was protected by the valerian extract.

<Example 5> Confirmation of the effect of valerian extract on respiration rate

As can be seen in FIG. 5, it was confirmed that the cellular respiration rate decreased by dexamethasone treatment was significantly restored when the valerian extract was treated.

<Example 6> Measurement of exercise capacity and muscle mass of mice administered with valerian extract

As can be seen in Figure 6, mice fed dexamethasone had a reduced movement distance compared to the control group (AIN-93G growing Rodent Diet fed and dexamethasone untreated), whereas mice fed valerian extract had a movement distance at the control level. was found to be recovering.

In addition, in terms of muscle mass in the mouse body, it was found that the mice fed dexamethasone decreased overall muscle mass, but the mice fed the valerian extract increased muscle mass and recovered.

As described above, the method of the present invention is useful for preventing, improving or treating muscle diseases without side effects using the valerian extract because it increases the size of muscle cells and has the effect of improving exercise performance. can be used

<110> KOREA FOOD RESEARCH INSTITUTE <120> Composition for Preventing, Improving or Treating of muscular disease containing Valeriana fauriei Briq. extract <130> NP19-0134 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Atrogin_sense <400> 1 gactggactt ctcgactgcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Atrogin_anti sense <400> 2 tcagggatgt gagctgtgac 20 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MurF-1_sense <400> 3 gctggtggaa aacatcattg acat 24 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> MurF-1_anti sense <400> 4 catcgggtgg ctgccttt 18 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myostatin_sense <400> 5 acgctaccac ggaaacaatc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myostatin_anti sense <400> 6 ggagtcttga cgggtctgag 20 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MyoG_sense <400> 7 gcaggctcaa gaaagtgaat ga 22 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MyoG_anti sense <400> 8 taggcgctca atgtactgga t 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MyoD_sense <400> 9 cgggacatag acttgacagg c 21 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MyoD_anti sense <400> 10 tcgaaacacg ggtcatcata ga 22 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s RNA_sense <400> 11 gtaacccgtt gaaccccatt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 18s RNA_anti sense <400> 12 ccacccaatc ggtagtagcg 20

Claims (11)

Valeriana fauriei Briq. extract containing as an active ingredient atony, muscular atrophy, muscular dystrophy, muscle degeneration, muscular dystrophy, amyotrophic axonal sclerosis, myasthenia gravis, cachexia ) and a pharmaceutical composition for preventing or treating at least one muscle disease selected from the group consisting of sarcopenia.
The composition of claim 1, wherein the extract is an extract using one or more solvents selected from the group consisting of water, an organic solvent having 1 to 6 carbon atoms, a subcritical fluid, a supercritical fluid, and a mixture thereof.
Valeriana fauriei Briq. extract containing as an active ingredient atony, muscular atrophy, muscular dystrophy, muscle degeneration, muscular dystrophy, amyotrophic axonal sclerosis, myasthenia gravis, cachexia ) and a food composition for preventing or improving at least one muscle disease selected from the group consisting of sarcopenia.
A composition for strengthening muscles comprising a valerian extract as an active ingredient.
The composition according to claim 4, wherein the composition exhibits an effect of increasing muscle mass.
The composition according to claim 4, wherein the composition exhibits an effect of inhibiting muscle loss.
delete A food composition for improving athletic performance comprising a valerian extract as an active ingredient.
The food composition according to claim 8, wherein the food composition exhibits an effect of increasing muscle strength.
The food composition according to claim 8, wherein the food composition exhibits an effect of increasing muscular endurance.
The food composition according to claim 8, wherein the exercise ability enhancement is to prevent or improve one or more symptoms selected from the group consisting of degenerative diseases, mitochondrial abnormalities, hypostamina, hypoactivity, lethargy, muscle wasting, and depression. .

Images