WO2023140505A1 - 할로푸지논을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물 - Google Patents
할로푸지논을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물 Download PDFInfo
- Publication number
- WO2023140505A1 WO2023140505A1 PCT/KR2022/020102 KR2022020102W WO2023140505A1 WO 2023140505 A1 WO2023140505 A1 WO 2023140505A1 KR 2022020102 W KR2022020102 W KR 2022020102W WO 2023140505 A1 WO2023140505 A1 WO 2023140505A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- halofuginone
- motor neuron
- preventing
- tgf
- neurodegenerative
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2200/00—Function of food ingredients
- A23V2200/30—Foods, ingredients or supplements having a functional effect on health
- A23V2200/322—Foods, ingredients or supplements having a functional effect on health having an effect on the health of the nervous system or on mental function
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2250/00—Food ingredients
- A23V2250/30—Other Organic compounds
Definitions
- the present invention relates to a composition for preventing or treating neurodegenerative or motor neuron diseases containing halofuginone as an active ingredient.
- ALS Amyotrophic lateral sclerosis
- Alzheimer's disease Parkinson's disease
- Huntington's disease multiple sclerosis, etc. are representative neurodegenerative or motor neuron diseases, and currently clinically used treatments are extremely limited.
- ALS reduces quality of life and quality of death due to progression of muscle atrophy, joint contracture and pain.
- the clinical course and prognosis are heterogeneous due to various pathophysiological mechanisms including genetic mutations, protein homeostasis disorders, mitochondrial dysfunction, neuronal dysfunction and neuroinflammation.
- TGF- ⁇ Transforming growth factor- ⁇
- a multifunctional cytokine involved in cell regulation such as cell growth, differentiation, and apoptosis.
- TGF- ⁇ plays a role in repairing damaged muscle and generally regulates myogenesis, growth and differentiation.
- TGF- ⁇ continues to increase, muscle formation decreases and muscle fibrosis and atrophy are promoted.
- ECM extracellular matrix
- TGF- ⁇ signaling pathway has been reported to be associated with Alzheimer's disease, Parkinson's disease, Huntington's disease, and multiple sclerosis as well as ALS.
- Halofuginone suppresses fibrosis caused by TGF- ⁇ elevation in ALS cell models and animal models, improves joint contracture by improving skeletal muscle generation, and exhibits dual effects of inhibiting inflammatory response and neuronal cell death in the central nervous system, thereby delaying the symptom progression of ALS and improving performance and survival time.
- the halofuginone can be usefully used as an active ingredient in a composition for preventing or treating neurodegenerative or motor neuron diseases including ALS, leading to the present application.
- An object of the present invention is to provide a composition for preventing or treating neurodegenerative or motor neuron diseases, containing Halofuginone or a pharmaceutically acceptable salt thereof as an active ingredient.
- the present invention provides a pharmaceutical composition for preventing or treating neurodegenerative or motor neuron disease, containing Halofuginone or a pharmaceutically acceptable salt thereof as an active ingredient.
- the present invention provides a health functional food composition for preventing or improving neurodegenerative or motor neuron diseases, containing halofuginone or a pharmaceutically acceptable salt thereof as an active ingredient.
- the present invention provides a method for preventing or treating neurodegenerative or motor neuron disease, comprising administering halofuginone or a pharmaceutically acceptable salt thereof to a subject.
- the present invention provides a pharmaceutical composition containing halofuginone or a pharmaceutically acceptable salt thereof for use in preventing or treating neurodegenerative or motor neuron diseases.
- the present invention provides a health functional food composition containing halofuginone or a pharmaceutically acceptable salt thereof for use in preventing or improving neurodegenerative or motor neuron diseases.
- the present invention provides a use of halofuginone or a pharmaceutically acceptable salt thereof for the preparation of a drug for preventing or treating neurodegenerative or motor neuron disease.
- the present invention provides the use of halofuginone or a pharmaceutically acceptable salt thereof for preparing a health functional food composition for preventing or improving neurodegenerative or motor neuron disease.
- halofuginone can inhibit fibrosis, improve skeletal muscle production, improve joint contracture, and suppress inflammatory response and neuronal cell death in the amyotrophic lateral sclerosis (ALS) cell model and animal model, thereby delaying the symptomatic progression of ALS and improving performance and survival. It can be usefully used as an active ingredient of a composition for preventing or treating sexual or motor neuron diseases.
- ALS amyotrophic lateral sclerosis
- FIG. 1 is a diagram schematically illustrating a method of administering Halofuginone to an animal model of amyotrophic lateral sclerosis (ALS) according to an embodiment of the present invention.
- ALS amyotrophic lateral sclerosis
- FIGS. 2a and 2b are diagrams confirming TGF- ⁇ 1, TGF- ⁇ 2, TGF- ⁇ 3, ⁇ -SMA, and MyoD mRNA expression (Fig. 2a) and TGF- ⁇ 1, ⁇ -SMA, and MyoD protein expression (Fig. 2b) after stimulation with TGF- ⁇ 1 (Transforming growth factor- ⁇ 1) in myoblasts.
- FIGS. 3A to 3C are diagrams showing myoblasts treated with halofuginone at various concentrations (Fig. 3a) or TGF- ⁇ 1 and halofuginone at various concentrations (Fig. 3b) to confirm cell viability, p-Smad2/Samd2 ratio, TGF- ⁇ 1, ⁇ -SMA, MyoD, and collagen I protein expression (Fig. 3c).
- FIGS. 4A to 4C are diagrams showing TGF- ⁇ 1, ⁇ -SMA, MyoD, and collagen I mRNA expression (Fig. 4a) and TGF- ⁇ 1, ⁇ -SMA, MyoD, and collagen I protein expression (Fig. 4b) after TGF- ⁇ 1 and halofuginone treatment in myoblasts, and ⁇ -SMA and MyoD expression (Fig. 4c) confirmed by immunocytochemical analysis.
- FIGS. 5A and 5B are diagrams confirming TGF- ⁇ 1, ⁇ -SMA, and collagen I mRNA expression (Fig. 5A), p-Smad2/Samd2 ratio, TGF- ⁇ 1, ⁇ -SMA, and collagen I protein expression (Fig. 5B) after treatment with halofuginone in fibroblasts isolated from an ALS animal model.
- FIG. 6a to 6c are views confirming changes in motor function and body weight (FIG. 6a) and symptom onset (FIGS. 6b and 6c) after administration of halofuginone to an ALS animal model.
- FIGS. 7A to 7D are diagrams confirming the expression of TGF- ⁇ 1, ⁇ -SMA, MyoD, and collagen I in 90-day-old females (FIG. 7A) and males (FIG. 7B), 120-day-old females (FIG. 7C) and males (FIG. 7D) after administration of halofuginone to an ALS animal model by immunohistochemical analysis.
- FIGS. 8A and 8B are diagrams confirming the range of motion (ROM) in the synovial cavity of the knee joint at 120 days after birth after administration of halofuginone to an ALS animal model (FIG. 8A), p-Smad2/Samd2 ratio, TGF- ⁇ 1, ⁇ -SMA, MyoD, and collagen I protein expression (FIG. 8B).
- FIG. 9a to 9f are diagrams confirming microglia activity (FIG. 9a), astrocyte activity (FIG. 9b), IL-1 ⁇ expression (FIG. 9c), the number of ChAT-positive motor neurons (FIG. 9d), ChAT mRNA expression (FIG. 9e), and ChAT protein expression (FIG. 9f) in the lumbar spinal cord at 120 days after birth after administration of halofuginone to an ALS animal model.
- FIG. 10a and 10b are diagrams confirming the microglia activity (FIG. 10a) and the number of ChAT-positive motor neurons (FIG. 10b) in the lumbar spinal cord at 90 days after birth after administration of halofuginone to an ALS animal model.
- FIG. 11a and 11b show the expression of TGF- ⁇ , iNOS, CD86, arginase 1, IFN- ⁇ , IL-6, IL-1 ⁇ , TNF- ⁇ , caspase-3, bcl2, bax mRNA (Fig. 11a) and cleaved caspase-3, b in the lumbar spinal cord at 120 days after administration of halofuginone to an ALS animal model. It is a diagram confirming the expression of cl2 and bax proteins (FIG. 11b).
- prevention refers to any action that inhibits or delays the onset and acceleration of a disease, the spread and recurrence of symptoms by administration of the composition of the present invention
- treatment means any action that improves or beneficially changes the symptoms of the disease by administration of the composition of the present invention.
- the term "administration" means providing a predetermined substance to a patient by any suitable method, and the administration route of the composition of the present invention is oral or parenteral administration through all general routes as long as it can reach the target tissue. It can be administered.
- the composition may be administered by any device capable of transporting an active substance to a target cell.
- the present invention provides a pharmaceutical composition for preventing or treating neurodegenerative or motor neuron diseases, containing Halofuginone or a pharmaceutically acceptable salt thereof as an active ingredient.
- the present invention provides a method for preventing or treating neurodegenerative or motor neuron disease, comprising administering halofuginone or a pharmaceutically acceptable salt thereof to a subject.
- the present invention provides a pharmaceutical composition containing halofuginone or a pharmaceutically acceptable salt thereof for use in preventing or treating neurodegenerative or motor neuron diseases.
- the present invention provides a use of halofuginone or a pharmaceutically acceptable salt thereof for the preparation of a drug for preventing or treating neurodegenerative or motor neuron disease.
- the halofuginone or a pharmaceutically acceptable salt thereof is a TGF- ⁇ inhibitor and has a chemical structure represented by the following [Formula 1]:
- the neurodegenerative or motor neuron disease may be amyotrophic lateral sclerosis, Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis, dystonia, spinal muscular atrophy or inflammatory neuropathy, but is not limited thereto.
- halofuginone relieves fibrosis of the joint synovial cavity caused by TGF- ⁇ stimulation and improves skeletal muscle generation, thereby preventing or treating the disease.
- halofuginone can prevent or treat the disease by suppressing the inflammatory response and neuronal cell death of the central nervous system induced by TGF- ⁇ stimulation. More specifically, the halofuginone increases the expression of anti-inflammatory factors such as arginase 1 in the central nervous system and reduces the expression of pro-inflammatory factors such as iNOS, CD86, IFN- ⁇ , TNF- ⁇ , IL-1 ⁇ or IL-6, thereby preventing or treating diseases.
- anti-inflammatory factors such as arginase 1 in the central nervous system and reduces the expression of pro-inflammatory factors such as iNOS, CD86, IFN- ⁇ , TNF- ⁇ , IL-1 ⁇ or IL-6, thereby preventing or treating diseases.
- halofuginone increases the expression of anti-neuronal apoptosis factors, such as bcl-2, and reduces the expression of neuronal apoptosis factors, such as caspase-3 and bax, in the central nervous system, thereby preventing or treating diseases.
- halofuginone can delay the deterioration of symptoms and improve performance and survival time.
- the present inventors confirmed that fibrosis was induced and muscle formation was reduced by TGF- ⁇ 1 stimulation in myoblasts, whereas fibrosis induction and muscle formation by TGF- ⁇ 1 stimulation were suppressed when treated with halofuginone.
- the present inventors confirmed that, after isolating fibroblasts from an amyotrophic lateral sclerosis (ALS) animal model and treating them with halofuginone, fibrosis and reduction of muscle transcription factors in fibroblasts were inhibited.
- ALS amyotrophic lateral sclerosis
- the present inventors confirmed that as a result of administering halofuginone to an ALS animal model, the onset of ALS was delayed and performance and survival were improved.
- the ALS animal model administered with halofuginone it was confirmed that joint contracture was improved by reducing fibrosis of the joint synovial cavity and improving skeletal muscle generation.
- anti-inflammatory and neuronal cell death inhibitory effects appeared in the central nervous system (CNS) of the ALS animal model administered with halofuginone.
- halofuginone can inhibit fibrosis, improve skeletal muscle production, improve joint contracture, and inhibit inflammatory response and neuronal cell death in ALS cell models and animal models, thereby delaying the symptomatic progression of ALS and improving performance and survival time. Therefore, halofuginone can be usefully used as an active ingredient in a pharmaceutical composition for preventing or treating neurodegenerative or motor neuron diseases including ALS.
- Halofuzinone of the present invention includes all pharmaceutically acceptable salts, possible solvates, hydrates, racemates, or stereoisomers that can be prepared therefrom.
- the halofuginone of the present invention can be used in the form of a pharmaceutically acceptable salt, and an acid addition salt formed by a pharmaceutically acceptable free acid is useful as the salt.
- Acid addition salts are obtained from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid and non-toxic organic acids such as aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanedioates, aromatic acids, aliphatic and aromatic sulfonic acids.
- Such pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulphate, sulphite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, iodide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptane.
- Acid addition salts according to the present invention can be prepared by conventional methods, for example, by dissolving a compound of the present invention in an excess aqueous acid solution and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile. In addition, it may be prepared by evaporating the solvent or excess acid from the mixture and drying it, or by suction filtering the precipitated salt.
- a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile.
- a pharmaceutically acceptable metal salt may be prepared using a base.
- An alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to prepare a sodium, potassium or calcium salt as the metal salt.
- the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg, silver nitrate).
- Halofuzinone or a pharmaceutically acceptable salt thereof of the present invention may contain a therapeutically effective amount and a pharmaceutically acceptable carrier.
- an effective amount or effective amount means slowing or minimizing neurodegenerative and/or motor neuron disease; or an amount of a compound of the invention sufficient to provide a therapeutic benefit in the treatment or management of neurodegenerative and/or motor neuron disease.
- a carrier for oral administration or a carrier for parenteral administration may be used.
- Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like.
- the carrier for parenteral administration may include water, suitable oil, saline, aqueous glucose, glycol, and the like, and may further include a stabilizer and a preservative.
- Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid.
- Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
- the pharmaceutical composition of the present invention can be administered to mammals including humans by any route of administration. It can be administered orally or parenterally.
- Parenteral administration methods include, for example, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual or rectal administration, but are not limited thereto.
- the pharmaceutical composition of the present invention may be prepared as an injectable formulation and administered by lightly pricking the skin with a 30 gauge thin injection needle or by directly applying or attaching to the skin.
- composition of the present invention may be formulated into a formulation for oral administration or parenteral administration according to the administration route as described above.
- composition of the present invention may be formulated into powders, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like using methods known in the art.
- preparations for oral use may be obtained by combining the active ingredient with a solid excipient, grinding it, and processing it into a mixture of granules after adding suitable auxiliaries.
- excipients examples include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, starches including corn starch, wheat starch, rice starch and potato starch, celluloses including cellulose, methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethyl-cellulose, gelatin, polyvinyl Fillers such as pyrrolidone and the like may be included.
- cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant, if desired.
- the pharmaceutical composition of the present invention may further include an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifier, and a preservative.
- preparations for parenteral administration they may be formulated in the form of injections, creams, lotions, external ointments, oils, moisturizers, gels, patches, aerosols and nasal inhalations by methods known in the art. These formulations are described in Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a generally known formula for all pharmaceutical chemistry.
- the total dose of the pharmaceutical composition of the present invention may be administered to the patient as a single dose, more specifically, a single dose may be administered multiple times over a long period of time, or multiple doses may be administered for a long period of time. It may be administered by a fractionated treatment protocol.
- the pharmaceutical composition of the present invention may vary the content of the active ingredient according to the symptoms of the disease. Specifically, the total dose of the composition of the present invention may be about 0.01 ⁇ g to 1,000 mg, more specifically 0.1 ⁇ g to 100 mg per 1 kg of patient body weight per day.
- the dosage of the pharmaceutical composition of the present invention takes into account various factors such as the patient's age, weight, health condition, gender, severity of disease, diet, excretion rate, as well as the route of administration and number of treatments, and those skilled in the art will be able to determine an appropriate effective dosage.
- the pharmaceutical composition according to the present invention is not particularly limited in its formulation, administration route and administration method as long as it exhibits the effects of the present invention.
- the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents.
- the composition of the present invention and the other therapeutic agent may be administered simultaneously, separately or sequentially.
- the other therapeutic agent may be a substance that is already known to have an effect of treating or improving neurodegenerative and/or motor neuron diseases.
- the pharmaceutical composition of the present invention is administered in combination with another therapeutic agent, the composition of the present invention and the other therapeutic agent may be separately formulated in separate containers or co-formulated together in the same dosage form.
- the present invention provides a health functional food composition for preventing or improving neurodegenerative or motor neuron diseases, containing halofuginone or a pharmaceutically acceptable salt thereof as an active ingredient.
- the present invention provides a use of halofuginone or a pharmaceutically acceptable salt thereof for use as a health functional food composition for preventing or improving neurodegenerative or motor neuron diseases.
- the present invention provides the use of halofuginone or a pharmaceutically acceptable salt thereof for preparing a health functional food composition for preventing or improving neurodegenerative or motor neuron disease.
- halofuginone can inhibit fibrosis, improve skeletal muscle generation, improve joint contracture, and inhibit inflammatory response and neuronal cell death in ALS cell models and animal models, thereby delaying the symptomatic progression of ALS and improving performance and survival. Therefore, halofuginone can be usefully used as an active ingredient in a health functional food composition for preventing or improving neurodegenerative or motor neuron diseases including ALS.
- the health functional food composition of the present invention may be prepared in any one formulation selected from powder, granule, pill, tablet, capsule, candy, syrup and beverage, but is not limited thereto.
- the health functional food composition is not particularly limited as long as it can be ingested to prevent or improve neurodegenerative or motor neuron diseases.
- the health functional food composition of the present invention may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to conventional methods. Active ingredients can be appropriately used depending on their purpose of use (prevention or improvement). In general, it is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the health functional food composition of the present invention when preparing food or beverage.
- the amount may be below the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.
- the type of food There is no particular limitation on the type of food. Examples of foods to which the functional food composition may be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea drinks, alcoholic beverages and vitamin complexes, and all health foods in the conventional sense are included.
- the health functional food composition of the present invention can be made into food, particularly functional food.
- the functional food of the present invention includes components commonly added during food preparation, and includes, for example, proteins, carbohydrates, fats, nutrients, and seasonings.
- natural carbohydrates or flavoring agents may be included as additional ingredients in addition to active ingredients.
- the natural carbohydrate is preferably a monosaccharide (eg, glucose, fructose, etc.), a disaccharide (eg, maltose, sucrose, etc.), an oligosaccharide, a polysaccharide (eg, dextrin, cyclodextrin, etc.) or a sugar alcohol (eg, xylitol, sorbitol, erythritol, etc.).
- natural flavoring agents eg, thaumatin, stevia extract, etc.
- synthetic flavoring agents eg, saccharin, aspartame, etc.
- various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. may be further contained.
- Example 1 Myoblast culture, and TGF- ⁇ 1 (Transforming growth factor- ⁇ 1) and halofuginone treatment
- TGF- ⁇ transforming growth factor- ⁇
- C2C12 cells as mouse myoblasts were purchased from ATCC (American Type Culture Collection) and maintained under 37°C and 5% CO 2 conditions in DMEM medium (Welgene) containing 10% (v/v) fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin (P/S; Gibco).
- C2C12 cells were transferred to a 6-well-plate (3 ⁇ 10 5 cells/well) and seeded for 24 hours, and after 24 hours, the medium was replaced with serum-free medium and stimulated with 5 ng/ml of rhTGF- ⁇ 1 (recombinant human TGF- ⁇ 1; R&D Systems). After stimulation, the cells were treated with halofuginone (Sigma) at various concentrations (0 [control] or 1, 2.5, 5 (low concentration), 10 (high concentration), 20, 50, 100 ng/ml) in serum-free medium for 24 hours.
- Cell viability was measured after rhTGF- ⁇ 1 or halofuginone treatment in serum-free conditions for C2C12 cells using the Cell Counting Kit-8 (CCK-8 kit) assay (Enzo Life Sciences, ALX-850-039).
- the C2C12 cells of ⁇ Example 1> were cultured in a 96-well plate (10 4 cells/well) for 24 hours and stimulated with 5 ng/ml of rhTGF- ⁇ 1 for 24 hours.
- halofuginone was treated with various concentrations (0 [control] or 1, 2.5, 5, 10, 20, 50, 100 ng/ml) for 24 hours.
- 10 ⁇ l of CCK-8 solution was added to each well and incubated at 37° C. for 1 hour. Then, absorbance was measured at 450 nm using a VersaMax microplate reader (Molecular Devices). Cell viability was expressed as the viability of control (untreated) cells. For each concentration of halofuginone, the average value of the average absorbance obtained from 6 wells was calculated.
- Example 2 C2C12 cells were treated with rhTGF- ⁇ 1 or halofuginone in serum-free conditions, and then immunocytochemical analysis was performed.
- C2C12 cells were plated in 6-well-plates with coverslips and stimulated with rhTGF- ⁇ 1 in serum-free medium. After 24 hours of stimulation, cells were treated with low or high concentrations of halofuginone in serum-free medium for 24 hours. Cells were washed three times with PBS and fixed with 4% paraformaldehyde for 15 minutes at room temperature. The fixed cells were then washed three times in PBS, treated with 0.5% Triton X-100 for 5 minutes, and then blocked with 5% bovine serum albumin in 0.3% PBS-T for 1 hour at room temperature.
- ALS Amyotrophic lateral sclerosis
- ALS amyotrophic lateral sclerosis
- mice expressing the human G93A mutant SOD1 gene (B6SJL-Tg(SOD1-G93A) 1 Gur/J) as an ALS animal model were purchased from Jackson Laboratories (Bar Harbor, ME, USA).
- Male transgenic ALS mice of the mtSOD1(G93A) H1 high expressor strain (Jackson Laboratories, Bar Harbor, ME, USA) were mated with female mice (B6/SJLF1).
- mice were housed under standard conditions of constant temperature (22 ⁇ 1° C.), relative humidity (40%) and 12-hour light/dark cycle, and were allowed free access to food and water.
- the genotype was confirmed by polymerase chain reaction (PCR) using the primers shown in Table 1 below, and the copy number of the transgene was confirmed.
- PCR polymerase chain reaction
- the G93A mutant SOD1 transgenic mice were divided into three stages according to the time point: 60 days of age (asymptomatic), 90 days of age (early symptoms) and 120 days of age (late symptoms). A total of 96 mice were used in the experiment. As a comparison group, non-transgenic mice were used.
- Example 5 Culture of ALS animal model-derived fibroblasts and treatment with halofuginone
- fibroblasts were isolated from the ALS animal model in which the G93A mutant SOD1 gene was confirmed in ⁇ Example 4>, and the cells were treated with halofujinone.
- fibroblasts were isolated from skeletal muscle of 120-day-old non-transformed or G93A mutant SOD1 transgenic mice of ⁇ Example 4>.
- the excised tissue was placed in a 100 mm culture dish containing calcium- and magnesium-free HBSS (Hanks' Balanced Salt Solution; Gibco, cat# 14175095) and penicillin-streptomycin (Cat# 15070-063, Thermo Fisher Scientific). Muscle tissue was cut on an ice block. Then, the tissue was cut into 1 mm pieces and enzymatically reacted with 0.2% collagenase type IV (Sigma) for 1 hour at 37°C. The enzymatic reaction was stopped by adding 10 ml of FBS (Gibco).
- tissue mixture was centrifuged at 1,800 rpm at 4° C. for 5 minutes and resuspended in DMEM medium (Welgene) containing 10% FBS.
- Cells were filtered through a 70 ⁇ m cell strainer (BD Biosciences, San Jose, CA) and cultured on plates coated with 0.2% gelatin (Sigma) in DMEM medium containing 10% FBS and 1% penicillin-streptomycin. Then, halofuginone was treated in the same manner as described in ⁇ Example 1> above.
- halofujinone was administered to an ALS animal model in which the G93A mutant SOD1 gene was confirmed in ⁇ Example 4>.
- mice of the same sex and age of ⁇ Example 4> were randomly divided into three groups, and as shown in Table 2 below, the DMSO TG group and the Hal TG group were administered to G93A mutant SOD1 transgenic mice with vehicle (DMSO, Duchefa Biochemie, D1370) and halofuginone (Sigma, S8144) respectively at 10 weeks of age (initial symptom stage) for 10 weeks or longer 3 times per intraperitoneal (i.p.) injection.
- vehicle DMSO, Duchefa Biochemie, D1370
- halofuginone Sigma, S8144
- mice of the same sex and age of ⁇ Example 4> were randomly divided into three groups, and as shown in Table 2 below, the DMSO TG group and the Hal TG group were administered to G93A mutant SOD1 transgenic mice with vehicle (DMSO, Duchefa Biochemie, D1370) and halofuginone (Sigma, S8144) respectively at 10 weeks of
- G93A mutant SOD1 transgenic mice or non-transgenic mice used for biochemical analysis were sacrificed at 90 and 120 days after birth, and all experiments were performed in triplicate.
- Termination age was determined as the animal's inability to correct itself within 30 seconds of being laid on its side on a flat surface. At this point the mouse was considered dead [C. Zheng, I. Nennesmo, B. Fadeel, J.I. Henter Vascular endothelial growth factor prolongs survival in a transgenic mouse model of ALS Ann Neurol, 56 (2004), pp. 564-567].
- the motor function of the mouse was verified using a rotarod device (JD-A-07M, Jeongdo B&P Co., Ltd.). Mice were trained for one week before recording began.
- the mouse was placed on a rod that started at a speed of 4 rpm and accelerated to 40 rpm over 300 seconds with increments of 1 rpm approximately every 8.3 seconds.
- the rotarod test was measured three times a week on average from 83 days after birth to the point where they could not stay on the rotarod for more than 10 seconds three times in a row.
- mice of ⁇ Example 6> were perfused with 4% paraformaldehyde (PFA) at 90 and 120 days after birth, and the lumbar spinal cord and knee joints were separated. After fixation in 4% PFA for 24 hours, the knee joint was rinsed in running tap water for 24 hours and incubated with decalcifying solution (Calci-Clear, HS-104, National Diagnostics) at 4°C while shaking continuously. The decalcification solution was replaced with a fresh solution every day until the decalcification process, in which the bone was easily penetrated with a needle, was completed.
- PFA paraformaldehyde
- the demineralized knee joint was rinsed in running tap water for 24 hours, and the spinal cord and knee joint were treated with 30% sucrose until the sample subsided, then cryoprotected and subsequently cut (14 ⁇ m).
- Lumbar spinal cord and knee joint tissue sections were washed three times with PBS, permeabilized with 0.5% Triton X-100 for 5 minutes, and then blocked with 5% bovine serum albumin in 0.3% PBS-T for 1 hour at room temperature.
- Knee joint tissue sections were prepared with anti-TGF- ⁇ 1 antibody (1:200; Santa Cruz, cat# sc130348), anti- ⁇ -SMA antibody (1:200; abcam cat# ab7817), anti-MyoD antibody (1:200; Santa Cruz, cat# sc377460), anti-collagen I antibody (1:200; abcam cat# ab21286), respectively, and lumbar spine Spinal cord sections were anti-GFAP antibody (1:200; Dako cat# Z0334), anti-Iba1 antibody (1:200; Wako cat# 016)-20001), anti-TGF- ⁇ 1 antibody (1:200; Santa Cruz, cat# sc130348), anti-TGF- ⁇ 1 antibody (1:200; abcam, cat# ab92486), anti-IL-1 ⁇
- Each antibody (1:200; R&D Systems cat# AF-401-NA) was further incubated for 24 hours at 4°C.
- mice were sacrificed at various time points (90 days and 120 days) according to the clinical condition of the mice in ⁇ Example 6>.
- Each mouse was transcardially perfused with cold PBS followed by cold 4% paraformaldehyde (PFA) and the lumbar spinal cord was isolated.
- Samples were post-fixed in 4% paraformaldehyde, treated in cold 30% sucrose solution and cryoprotected, and then 14 ⁇ m thick cross-sectional sections were subsequently obtained.
- the tissue sections were washed with PBS and immersed in PBS containing 0.3% hydrogen peroxide (H 2 O 2 ) for 15 minutes to remove endogenous peroxidase activity.
- H 2 O 2 hydrogen peroxide
- Sections were washed in PBS, permeabilized with 0.5% Triton X-100 for 5 minutes and blocked with 5% bovine serum albumin in 0.3% PBS-T for 1 hour at room temperature. Tissue sections from each set were incubated for 24 hours with primary anti-ChAT antibody (1:400; Millipore, cat# AB144P).
- Sections were dehydrated and air dried and mounted in toluene soluble Permount mounting medium (Fisher Scientific, cat# SP15-500). Motor neurons were counted on ChAT-stained sections using a computer-assisted microscope (Olympus BX53) and software (cellSens software) at 4 ⁇ magnification. Counting was performed per ventral horn in a total of 3 mice per group. The fields analyzed were all ChAT+ profiles located in the dorsal half of the immunostained sections clearly marked in the gray matter of each hemisphere.
- an anatomical index was used to determine the knee extension angle.
- passive knee joint ROM was measured using a 2D angle analysis system, Random Two-line.
- the mouse of ⁇ Example 6> was anesthetized by inhalation of 1% isoflurane, placed on an acrylic plate, and the hindlimb skin was shaved.
- the femur was fixed to the plate and an extension moment of constant force was applied to the knee joint per mouse. Thereafter, markers were attached to the greater trochanter, the lateral epicondyle of the knee, and the lateral malleolus to obtain markers for photographed images.
- the angle between the axis of the femur (the greater trochanter to the lateral joint space of the knee) and the fibula (from the lateral joint space of the knee to the lateral malleolus) was measured with knee extension ROM.
- Sixteen mice in each group were analyzed, and as a control, the knee of a non-transgenic mouse injected with DMSO in the group on day 120 was used.
- Real-time qRT-PCR analysis was performed using myoblasts treated with halofujinon after stimulation with TGF- ⁇ 1 in ⁇ Example 1>, fibroblasts isolated from the ALS animal model and treated with halofujinon in ⁇ Example 5>, or lumbar spinal cord isolated after administration of halofujinon to the ALS animal model as in ⁇ Example 6>.
- RNA was isolated from C2C12 cells of ⁇ Example 1>, fibroblasts of ⁇ Example 5>, and lumbar spinal cords of mice of ⁇ Example 6> using FavorPrepTM Tri-RNA Reagent (Favorgen).
- the lumbar spinal cord was isolated from the mouse of ⁇ Example 6> and stored frozen at -80°C until the experiment.
- the concentration of total RNA was measured with a spectrophotometer (NanoDrop Spectrophotometer ND-2000, Thermo Scientific) at 260 nm absorbance.
- cDNA was synthesized using 1 ⁇ g of total RNA using ReverTra Ace- ⁇ -TM (Toyobo) according to the manufacturer's protocol.
- Quantitative RT-PCR was performed using SYBR green ExcelTaqTM 2X Fast Q-PCR Master Mix (TQ1200, Smobio) using the primers shown in Table 3 below in a Thermocycler CFX Connect Real-Time PCR Detection System (BIO-RAD). Fluorescence data were analyzed with Bio-Rad CFX Manager 3.1 software, and relative mRNA expression versus control was calculated with the 2 (- ⁇ CT) method. Four experiments were performed on all samples. All primers were designed using Primer3 online software, and GAPDH was used as a control.
- the lumbar spinal cord or knee joint of the mouse of ⁇ Example 6> was isolated and immediately frozen at -80°C. Then, each lumbar spinal cord or knee joint was homogenized and chemically treated to obtain cells.
- the chemically treated cells, the C2C12 cells of ⁇ Example 1> or the fibroblasts of ⁇ Example 5> were lysed in RIPA buffer (Thermo, MA, USA) with protease inhibitors and phosphatase inhibitors (Roche, IN, USA) and incubated on ice for 30 minutes. The lysate was centrifuged at 4° C. at 13,000 rpm for 20 minutes to remove insoluble matter. Protein concentration was measured by BCA assay (Pierce Biotechnology).
- Equal amounts of cell lysates were loaded onto SDS-PAGE gels for electrophoresis and transferred to nitrocellulose membranes (Amersham Protran 0.2um NC, Amersham Pharmacia Biotech, Piscataway, NJ, USA). Then, the membrane was blocked with 5% (w/v) skim milk in 1X TBST for 1 hour at room temperature. After blocking, anti- ⁇ -actin antibody (1:5000; Santa Cruz, cat# sc47778), anti-Smad2 antibody (1:1000; Cell Signaling, cat# 5339), anti-p-Smad2 antibody (1:1000; Cell Signaling, cat# 3108), and anti-TGF- ⁇ 1 antibody (1:1000; Santa Cruz, cat# sc13034) were applied to the membrane as primary antibodies.
- anti- ⁇ -SMA antibody (1:10000; abcam cat# ab7817), anti-MyoD antibody (1:1000; Santa Cruz, cat# sc377460), anti-collagen I antibody (1:1000; abcam cat# ab21286), anti-cleaved caspase-3 antibody (1:1000; Cell Signaling, cat# 9661), anti -bax antibody (1:500; Santa Cruz, cat# sc493), anti-bcl2 antibody (1:1000; Novus Biologicals, cat# NB100-56098), and anti-ChAT antibody (1:1000; Millipore, cat# AB144P) were treated and incubated overnight at 4°C.
- the membrane was incubated with horseradish peroxidase-conjugated secondary antibody (anti-mouse, rabbit or goat, 1:5000; GE Healthcare) in blocking buffer for 1 hour at room temperature (RT). Then, the membrane was washed and briefly incubated with SuperSignal West Pico Plus Chemiluminescent Substrate (Pierce Biotechnology) according to the manufacturer's procedure and quantified with an image analyzer (Amersham Pharmacia Biotech, Piscataway, NJ, USA). ⁇ -actin was used as an internal control. Densitometry of protein intensity was quantified using Image J (National Institutes of Health).
- Example 1> C2C12 cells were treated with TGF- ⁇ 1 for 24 hours, and real-time qRT-PCR was performed in the same manner as described in ⁇ Example 11> to confirm the expression of TGF- ⁇ 1, 2 and 3, ⁇ -SMA and MyoD mRNA (Fig. 2a). Autocrine expression of MyoD protein and ⁇ -SMA was confirmed (FIG. 2b).
- the optimal concentration of halofuginone in C2C12 cells was 5 ng/ml at a low concentration and 10 ng/ml at a high concentration.
- the C2C12 mouse myoblast cell line was treated with halofuginone after stimulation with TGF- ⁇ 1, and real-time qRT-PCR analysis, Western blot analysis and immunocytochemical analysis were performed.
- C2C12 cells were stimulated with TGF- ⁇ 1 for 24 hours, then treated with halofuginone for 24 hours, and real-time qRT-PCR was performed in the same manner as described in ⁇ Example 11> to confirm the expression of TGF- ⁇ 1, ⁇ -SMA, MyoD, and collagen I (Col-I) mRNA (Fig. 4a).
- Western blot analysis was performed in the same manner as described in ⁇ Example 12> to confirm the expression of TGF- ⁇ 1, ⁇ -SMA, MyoD, and collagen I proteins (FIG. 4b).
- immunocytochemical analysis was performed in the same manner as described in ⁇ Example 3> to confirm the expression of ⁇ -SMA and MyoD (FIG. 4c).
- fibrosis is enhanced in fibroblasts of the ALS mouse model, and fibrosis can be inhibited by treatment with halofuginone.
- halofujinon was administered to an ALS animal model, and disease progression, survival, and motor function were analyzed.
- halofuginone was administered to an ALS animal model in the same manner as described in ⁇ Example 6>, and disease progression, survival and motor function analysis were performed in the same manner as in ⁇ Example 7>.
- each TG group in the symptomatic stage showed a significantly reduced time on the rotarod compared to the non-TG group.
- the TG group administered with halofujinon showed a significantly longer time on the rotarod.
- Body weight was significantly decreased in the TG group compared to the non-TG group, and there was no significant difference between the DMSO TG group and the Hal TG group (FIG. 6a).
- halofujinon was administered to an ALS animal model, and changes in the synovial cavity of the knee joint were confirmed by immunohistochemical analysis (IHC) in the early and late stages of the disease.
- IHC immunohistochemical analysis
- halofuginone was administered to G93A mutant SOD1 mice from the early stage of ALS onset (73 days), and immunohistochemical analysis was performed in the same manner as described in ⁇ Example 8> using knee joints of females and males at an early stage of the disease (90 days old, Figs. 7A and 7B) and later females and males (120 days old, Figs. 7C and 7D).
- the DMSO TG group confirmed a significant increase in TGF- ⁇ 1 in the synovial cavity of the knee joint in the early stage of the disease regardless of gender.
- ⁇ -SMA and Col-I increased, and MyoD decreased along with TGF- ⁇ 1 increase in the synovial cavity of the DMSO TG group compared to the DMSO Non-TG group.
- the Hal TG group the increase of TGF- ⁇ was suppressed in the early stage of the disease, and accordingly, the expression of ⁇ -SMA and Col-I was significantly lower than that of the DMSO TG group (FIGS. 7a and 7b).
- halofujinon was administered to an ALS animal model, and then the range of motion (ROM) of the knee joint was measured and Western blot analysis was performed.
- halofuginone was administered to G93A mutant SOD1 mice in the same manner as described in ⁇ Example 6>, and ROM of the knee joint was measured in the same manner as in ⁇ Example 10> (FIG. 8a).
- Western blot analysis was performed using knee joint tissues in the same manner as described in ⁇ Example 12> to confirm the expression of p-Smad2, Smad2, TGF- ⁇ 1, ⁇ -SMA, MyoD, and collagen I proteins (FIG. 8B).
- ROM was significantly reduced in the DMSO TG group compared to the 120-day-old DMSO Non-TG group, and it was confirmed that ROM did not change in the Hal TG group (FIG. 8a).
- halofuginone was administered to G93A mutant SOD1 mice in the same manner as described in ⁇ Example 6>, and the mice were sacrificed at 120 days after birth. Immunohistochemical analysis was performed in the same manner as in ⁇ Example 8> to confirm TGF- ⁇ 1 and glial cells in the lumbar spinal cord. Considering that it has been reported that astrocyte-derived TGF- ⁇ accelerates the disease in ALS mice, the spinal cords of each group were co-stained with TGF- ⁇ and GFAP for immunohistochemical analysis. In addition, Iba1 staining was performed to confirm the activity of microglia (FIGS. 9a and 9b).
- IL-1 ⁇ a representative pro-inflammatory cytokine
- halofuginone was administered to G93A mutant SOD1 mice in the same manner as described in ⁇ Example 6>, the mice were sacrificed at 90 days old, and Iba1 staining was performed to confirm the activity of microglia in the same manner as above (Fig. 10a), and motor neurons were observed and counted (Fig. 10b).
- FIGS. 9A and 9B GFAP intensity was significantly increased in the DMSO TG group of 120-day-old mice compared to the DMSO Non-TG group, and TGF- ⁇ 1 was also increased in the same region. It was confirmed that these increases in astrocyte activity and TGF- ⁇ 1 were significantly decreased in the Hal TG group (FIG. 9b). On the other hand, microglia showed a significant increase in the DMSO TG group, and it was confirmed that microglia continuously increased in the Hal TG group (FIG. 9a).
- halofuginone was administered to G93A mutant SOD1 mice in the same manner as described in ⁇ Example 6>, and mice were sacrificed at 120 days after birth, and then the lumbar spinal cord was isolated.
- mRNA expression of inflammation-related factors and neuronal cell death-related factors in the CNS was confirmed by performing real-time qRT-PCT analysis in the same manner as described in ⁇ Example 11> (FIG. 11A), and protein expression of neuronal cell death-related factors was confirmed by Western blot analysis in the same manner as described in ⁇ Example 12> (FIG. 11B).
- M1 markers iNOS, CD86
- M2 markers arginase 1
- pro-inflammatory factors IFN-a, TNF-a, IL-1b, IL-6
- caspase-3, bax, and bcl-2 as factors related to neuronal cell death was confirmed.
- FIG. 11a it was confirmed that the mRNA levels of the M1 marker and the pro-inflammatory factor were significantly increased according to the mRNA level of TGF- ⁇ in the DMSO TG group, which was inhibited by halofuginone.
- the mRNA level of bcl-2, an anti-neuronal apoptosis factor was decreased in the DMSO TG group compared to the DMSO Non-TG group, and it was confirmed that it was preserved in the Hal TG group (FIG. 11a).
- halofuginone can block the continuously increased TGF- ⁇ in ALS mice, thereby exhibiting anti-inflammatory effects in the CNS and inhibiting neuronal cell death.
- halofuginone exhibits a dual therapeutic effect of improving joint contracture due to an increase in TGF- ⁇ and inhibiting chronic inflammation and neuronal cell death in ALS. Accordingly, the halofuginone can be used to prevent or treat neurodegenerative or motor neuron diseases caused by increased TGF- ⁇ , including ALS.
- halofuginone inhibits fibrosis, improves skeletal muscle generation, improves joint contracture, and exhibits dual effects of suppressing inflammatory response and neuronal cell death in the central nervous system, thereby delaying the symptomatic progression of ALS and improving performance and survival. Therefore, the halofuginone or a pharmaceutically acceptable salt thereof It can be usefully used as an active ingredient of a composition for preventing or treating neurodegenerative or motor neuron diseases including ALS.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Psychiatry (AREA)
- Hospice & Palliative Care (AREA)
- Epidemiology (AREA)
- Psychology (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Food Science & Technology (AREA)
- Polymers & Plastics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 할로푸지논(Halofuginone)을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물에 관한 것으로, 구체적으로 근위축성 측삭경화증(Amyotrophic lateral sclerosis, ALS) 세포모델 및 동물모델에서 할로푸지논이 섬유증을 억제하고 골격근 생성을 향상하여 관절 구축을 개선하고 중추신경계의 염증 반응 및 신경세포사멸을 억제하는 이중 효과를 나타내어, ALS의 증상 진행을 지연시키고 수행 능력 및 생존기간을 향상시킬 수 있음을 확인하였으므로, 상기 할로푸지논은 ALS을 포함한 신경퇴행성 또는 운동신경 질환의 예방 또는 치료용 조성물의 유효성분으로 유용하게 이용될 수 있다.
Description
본 발명은 할로푸지논(Halofuginone)을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물에 관한 것이다.
근위축성 측삭경화증(Amyotrophic lateral sclerosis, ALS), 알츠하이머병(Alzheimer's disease), 파킨슨병(Parkinson's disease), 헌팅턴병(Huntington's disease), 다발성경화증(Multiple sclerosis) 등은 대표되는 퇴행성 신경질환 또는 운동신경 질환으로, 현재 임상적으로 사용되는 치료제가 극히 제한적이다.
ALS은 근위축, 관절 구축 및 통증의 진행으로 인해 삶의 질과 죽음의 질을 저하시킨다. 또한, 유전적 돌연변이, 단백질 항상성 장애, 미토콘드리아 기능 장애, 신경 기능 장애 및 신경 염증을 포함한 다양한 병태생리학적 기전으로 인해 임상 경과 및 예후가 이질적이다.
TGF-β(Transforming growth factor-β)는 세포 성장, 분화 및 세포사멸과 같은 세포 조절에 관여하는 다기능 사이토카인으로, TGF-β와 ALS 사이의 연관성이 나타난 후 ALS 진행에서 TGF-β의 역할이 밝혀지기 시작했다. 골격근에서 TGF-β는 손상된 근육을 복구하는 역할을 하며 일반적으로 근형성, 성장 및 분화를 조절한다. 그러나 TGF-β가 지속적으로 증가하면 근형성이 감소하고 근육 섬유화 및 위축이 촉진된다. ALS의 뮤린 모델을 사용한 이전 연구는 증상 단계에서 향상된 TGF-β 신호 전달 경로를 보여주었고 섬유/지방 생성 전구체의 증가로 인해 풍부한 세포외 기질(extracellular matrix, ECM) 생성이 나타났다. 마찬가지로, 정상 신경계에서는 흥분독성(excitotoxic) 및 산화적 손상으로부터 뉴런을 보호하고 신경 발생에 중요한 역할을 하는 것으로 알려져 있다. 그러나 지속적으로 상승한 TGF-β는 ALS 질환 진행 촉진과 관련이 있는 것으로 보고되었다.
또한, TGF-β 신호 전달 경로는 ALS 뿐만 아니라 알츠하이머병, 파킨슨병, 헌팅턴병, 다발성 경화증과도 연관성이 있는 것으로 보고되었다.
이에, 지속적인 TGF-β에 의한 ALS을 포함한 신경퇴행성 또는 운동신경 질환의 가속화를 막고 치료 효과를 나타낼 수 있는 치료제를 개발하기 위해 노력한 결과, ALS 세포모델 및 동물모델에서 할로푸지논(Halofuginone)이 TGF-β 상승에 의한 섬유증을 억제하고 골격근 생성을 향상하여 관절 구축을 개선하고, 중추신경계의 염증 반응 및 신경세포사멸을 억제하는 이중 효과를 나타내어, ALS의 증상 진행을 지연시키고, 수행 능력 및 생존기간을 향상시킬 수 있음을 확인하여, 상기 할로푸지논을 ALS을 포함한 신경퇴행성 또는 운동신경 질환의 예방 또는 치료용 조성물의 유효성분으로 유용하게 이용할 수 있음을 밝힘으로써, 본 출원에 이르게 되었다.
[선행기술문헌]
[비특허문헌]
Katsuno, M. et al. Transforming growth factor-βsignaling in motor neuron diseases. Current molecular medicine 11, 48-56, 2011.
Kashima, R. & Hata, A. The role of TGF-βsuperfamily signaling in neurological disorders. Acta biochimica et biophysica Sinica 50, 106-120, 2018.
Peters, S. et al. The TGF-βSystem As a Potential Pathogenic Player in Disease Modulation of Amyotrophic Lateral Sclerosis. Frontiers in neurology 8, 669, 2017.
본 발명의 목적은 할로푸지논(Halofuginone) 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물을 제공하는 것이다.
본 발명의 목적을 달성하기 위하여, 본 발명은 할로푸지논(Halofuginone) 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 할로푸지논 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는, 신경퇴행성 또는 운동신경 질환 예방 또는 개선용 건강기능식품 조성물을 제공한다.
또한, 본 발명은 할로푸지논 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 신경퇴행성 또는 운동신경 질환 예방 또는 치료방법을 제공한다.
또한, 본 발명은 신경퇴행성 또는 운동신경 질환 예방 또는 치료에 사용하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염을 함유하는 약학 조성물을 제공한다.
또한, 본 발명은 신경퇴행성 또는 운동신경 질환 예방 또는 개선에 사용하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염을 함유하는 건강기능식품 조성물을 제공한다.
또한, 본 발명은 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약제로 제조하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염의 용도를 제공한다.
아울러, 본 발명은 신경퇴행성 또는 운동신경 질환 예방 또는 개선용 건강기능식품 조성물로 제조하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염의 용도를 제공한다.
본 발명자들은 근위축성 측삭경화증(Amyotrophic lateral sclerosis, ALS) 세포모델 및 동물모델에서 할로푸지논(Halofuginone)이 섬유증을 억제하고 골격근 생성을 향상하여 관절 구축을 개선하고 중추신경계의 염증 반응 및 신경세포사멸을 억제하는 이중 효과를 나타내어, ALS의 증상 진행을 지연시키고 수행 능력 및 생존기간을 향상시킬 수 있음을 확인하였으므로, 상기 할로푸지논은 ALS을 포함한 신경퇴행성 또는 운동신경 질환의 예방 또는 치료용 조성물의 유효성분으로 유용하게 이용될 수 있다.
도 1은 본 발명의 일 실시예에 따라 근위축성 측삭경화증(Amyotrophic lateral sclerosis, ALS) 동물모델에 할로푸지논(Halofuginone)을 투여하는 방법을 모식화한 도이다.
도 2a 및 도 2b는 근아세포(myoblast)에 TGF-β1(Transforming growth factor-β1) 자극 후 TGF-β1, TGF-β2, TGF-β3, α-SMA, MyoD mRNA 발현(도 2a) 및 TGF-β1, α-SMA, MyoD 단백질 발현(도 2b)을 확인한 도이다.
도 3a 내지 도 3c는 근아세포에 다양한 농도의 할로푸지논 처리(도 3a), 또는 TGF-β1 및 다양한 농도의 할로푸지논 처리(도 3b) 후 세포 생존율을 확인하고, p-Smad2/Samd2 비율, TGF-β1, α-SMA, MyoD, 콜라겐 I 단백질 발현(도 3c)을 확인한 도이다.
도 4a 내지 도 4c는 근아세포에 TGF-β1 및 할로푸지논 처리 후 TGF-β1, α-SMA, MyoD, 콜라겐 I(collagen I) mRNA 발현(도 4a) 및 TGF-β1, α-SMA, MyoD, 콜라겐 I 단백질 발현(도 4b)를 확인하고, 면역세포화학 분석으로 α-SMA, MyoD 발현(도 4c)을 확인한 도이다.
도 5a 및 도 5b는 ALS 동물모델에서 분리한 섬유아세포에 할로푸지논 처리 후 TGF-β1, α-SMA, 콜라겐 I mRNA 발현(도 5a) 및 p-Smad2/Samd2 비율, TGF-β1, α-SMA, 콜라겐 I 단백질 발현(도 5b)을 확인한 도이다.
도 6a 내지 도 6c는 ALS 동물모델에 할로푸지논 투여 후 운동 기능 및 체중 변화(도 6a) 및 증상 발병 변화(도 6b 및 도 6c)를 확인한 도이다.
도 7a 내지 도 7d는 ALS 동물모델에 할로푸지논을 투여하고 90일령 암컷(도 7a) 및 수컷(도 7b), 120일령 암컷(도 7c) 및 수컷(도 7d)에 TGF-β1, α-SMA, MyoD, 콜라겐 I 발현을 면역조직화학 분석으로 확인한 도이다.
도 8a 및 도 8b는 ALS 동물모델에 할로푸지논을 투여하고 생후 120일에 무릎 관절 활막강에서 관절가동범위(ROM)을 확인하고(도 8a), p-Smad2/Samd2 비율, TGF-β1, α-SMA, MyoD, 콜라겐 I 단백질 발현(도 8b)을 확인한 도이다.
도 9a 내지 도 9f는 ALS 동물모델에 할로푸지논을 투여하고 생후 120일에 요추 척수에서 미세아교세포 활성(도 9a), 성상교세포 활성(도 9b), IL-1β 발현(도 9c), ChAT 양성 운동 뉴런 수(도 9d), ChAT mRNA 발현(도 9e), ChAT 단백질 발현(도 9f)을 확인한 도이다.
도 10a 및 도 10b는 ALS 동물모델에 할로푸지논을 투여하고 생후 90일에 요추 척수에서 미세아교세포 활성(도 10a) 및 ChAT 양성 운동 뉴런 수(도 10b)를 확인한 도이다.
도 11a 및 도 11b는 ALS 동물모델에 할로푸지논을 투여하고 생후 120일에 요추 척수에서 TGF-β, iNOS, CD86, 아르기나아제 1(arginase 1), IFN-α, IL-6, IL-1β, TNF-α, 카스파제-3(caspase-3), bcl2, bax mRNA 발현(도 11a) 및 절단된 카스파제-3, bcl2, bax 단백질 발현(도 11b)을 확인한 도이다.
이하, 본 발명을 보다 상세히 설명한다.
본 발명에 있어서 용어 "예방"이란 본 발명의 조성물 투여로 질환의 발생 및 가속화, 증세의 확산 및 재발을 억제시키거나 지연시키는 모든 행위를 의미하고, 용어 "치료"란 본 발명의 조성물 투여로 상기 질환의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에 있어서 용어 "투여"는 임의의 적절한 방법으로 환자에게 소정의 물질을 제공하는 것을 의미하며, 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 일반적인 모든 경로를 통하여 경구 또는 비경구 투여될 수 있다. 또한, 조성물은 활성물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
본 발명은 할로푸지논(Halofuginone) 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약학 조성물을 제공한다.
또한, 본 발명은 할로푸지논 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 신경퇴행성 또는 운동신경 질환 예방 또는 치료방법을 제공한다.
또한, 본 발명은 신경퇴행성 또는 운동신경 질환 예방 또는 치료에 사용하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염을 함유하는 약학 조성물을 제공한다.
또한, 본 발명은 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약제로 제조하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염의 용도를 제공한다.
본 발명에서, 상기 할로푸지논 또는 이의 약학적으로 허용가능한 염은 TGF-β 억제제로, 하기 [화학식 1]로 기재되는 화학 구조를 갖는다:
[화학식 1]
또한, 상기 할로푸지논은 시판되는 것, 합성한 것 모두 무방하게 사용할 수 있다.
본 발명에서, 상기 신경퇴행성 또는 운동신경 질환은 근위축성 측삭경화증, 알츠하이머병, 파킨슨병, 헌팅턴병, 다발성 경화증, 근육긴장이상증, 척수성 근위축증 또는 염증성 신경병증일 수 있으나, 이에 제한되는 것은 아니다.
구체적으로, 상기 신경퇴행성 또는 운동신경 질환에 있어서 할로푸지논은 TGF-β 자극에 의한 관절 활막강의 섬유증을 완화하고, 골격근 생성을 향상시켜, 질환을 예방 또는 치료할 수 있다.
또한, 상기 신경퇴행성 또는 운동신경 질환에 있어서 할로푸지논은 TGF-β 자극에 의한 중추신경계의 염증 반응 및 신경세포사멸을 억제하여, 질환을 예방 또는 치료할 수 있다. 보다 구체적으로, 상기 할로푸지논은 중추신경계에서 항염증 인자, 예컨대 아르기나아제 1(arginase 1)의 발현을 증가시키고, 전염증 인자, 예컨대 iNOS, CD86, IFN-α, TNF-α, IL-1β 또는 IL-6의 발현을 감소시켜 질환을 예방 또는 치료할 수 있다. 또한, 상기 할로푸지논은 중추신경계에서 항신경세포사멸 인자, 예컨대 bcl-2의 발현을 증가시키고, 신경세포사멸 인자, 예컨대 카스파제-3(caspase-3) 및 bax의 발현을 감소시켜 질환을 예방 또는 치료할 수 있다.
또한, 상기 신경퇴행성 또는 운동신경 질환에 있어서 할로푸지논은 증상 악화를 지연시키고, 수행 능력 및 생존기간을 향상시킬 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 근아세포(myoblast)에서 TGF-β1 자극으로 섬유증이 유도되고 근형성이 저하되는 반면, 할로푸지논을 처리할 경우 TGF-β1 자극에 의한 섬유증 유도 및 근형성 저하가 억제되는 것을 확인하였다.
또한, 본 발명자들은 근위축성 측삭경화증(ALS) 동물모델로부터 섬유아세포를 분리한 후 할로푸지논을 처리한 결과 섬유아세포에서 섬유증 및 근육전사인자의 저하가 억제되는 것을 확인하였다.
또한, 본 발명자들은 ALS 동물모델에 할로푸지논을 투여한 결과 ALS 발병이 지연되고 수행 능력 및 생존기간이 향상되는 것을 확인하였다. 또한, 할로푸지논을 투여한 ALS 동물모델에서 관절 활막강의 섬유증이 감소하고 골격근 생성이 향상되어 관절 구축이 개선되는 것을 확인하였다. 아울러, 할로푸지논을 투여한 ALS 동물모델의 중추신경계(CNS)에서 항염증 및 신경세포사멸 억제 효과가 나타나는 것을 확인하였다.
따라서, 본 발명자들은 ALS 세포모델 및 동물모델에서 할로푸지논이 섬유증을 억제하고 골격근 생성을 향상하여 관절 구축을 개선하고 중추신경계의 염증 반응 및 신경세포사멸을 억제하는 이중 효과를 나타내어, ALS의 증상 진행을 지연시키고 수행 능력 및 생존기간을 향상시킬 수 있음을 확인하였으므로, 상기 할로푸지논은 ALS을 포함한 신경퇴행성 또는 운동신경 질환의 예방 또는 치료용 약학 조성물의 유효성분으로 유용하게 이용될 수 있다.
본 발명의 할로푸지논은 약학적으로 허용가능한 염, 이로부터 제조될 수 있는 가능한 용매화물, 수화물, 라세미체, 또는 입체이성질체를 모두 포함한다.
본 발명의 할로푸지논은 약학적으로 허용가능한 염의 형태로 사용할 수 있으며, 염으로는 약학적으로 허용가능한 유리산(free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, 하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함한다.
본 발명에 따른 산 부가염은 통상의 방법, 예를 들면, 본 발명의 화합물을 과량의 산 수용액 중에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들면 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다. 또한, 이 혼합물에서 용매나 과량의 산을 증발시켜서 건조하거나 또는 석출된 염을 흡입 여과시켜 제조할 수도 있다.
또한, 염기를 사용하여 약학적으로 허용가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은, 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로는 소듐, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은염(예, 질산은)과 반응시켜 얻는다.
본 발명의 할로푸지논 또는 이의 약학적으로 허용가능한 염은 치료적으로 유효한 양으로, 및 약학적으로 허용가능한 담체를 포함할 수 있다.
본 명세서에서 사용된 "유효한 양 또는 유효량"은 신경퇴행성 및/또는 운동신경 질환을 늦추거나 또는 최소화하거나; 또는 신경퇴행성 및/또는 운동신경 질환의 치료 또는 관리에서 치료상 이점을 제공하기에 충분한 본 발명의 화합물의 양을 말한다.
상기 약학적으로 허용가능한 담체로는 예컨대, 경구 투여용 담체 또는 비경구 투여용 담체가 사용될 수 있다. 경구 투여용 담체는 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등을 포함할 수 있다. 또한, 비경구 투여용 담체는 물, 적합한 오일, 식염수, 수성 글루코스 및 글리콜 등을 포함할 수 있으며, 안정화제 및 보존제를 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 그 밖의 약학적으로 허용되는 담체로는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다(Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
본 발명의 약학 조성물은 인간을 비롯한 포유동물에 어떠한 투여 경로로도 투여할 수 있다. 경구 또는 비경구적으로 투여할 수 있다.
비경구적인 투여방법으로는 예를 들어, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장내 투여일 수 있으나, 이에 한정되는 것은 아니다. 예컨대, 본 발명의 약학 조성물을 주사형 제형으로 제조하여 이를 30 게이지의 가는 주사 바늘로 피부를 가볍게 단자 (prick)하는 방법, 또는 피부에 직접적으로 도포 또는 부착하는 방법으로 투여될 수도 있다.
본 발명의 약학 조성물은 상술한 바와 같은 투여 경로에 따라 경구 투여용 또는 비경구 투여용 제제로 제형화 할 수 있다.
경구 투여용 제제의 경우에 본 발명의 조성물은 분말, 과립, 정제, 환제, 당의정제, 캡슐제, 액제, 겔제, 시럽제, 슬러리제, 현탁액 등으로 당업계에 공지된 방법을 이용하여 제형화될 수 있다. 예를 들어, 경구용 제제는 활성성분을 고체 부형제와 배합한 다음 이를 분쇄하고 적합한 보조제를 첨가한 후 과립 혼합물로 가공함으로써 정제를 수득할 수 있다. 적합한 부형제의 예로는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨 및 말티톨 등을 포함하는 당류와 옥수수 전분, 밀 전분, 쌀 전분 및 감자 전분 등을 포함하는 전분류, 셀룰로즈, 메틸 셀룰로즈, 나트륨 카르복시메틸셀룰로오즈 및 하이드록시프로필메틸-셀룰로즈 등을 포함하는 셀룰로즈류, 젤라틴, 폴리비닐피롤리돈 등과 같은 충전제가 포함될 수 있다. 또한, 경우에 따라 가교결합 폴리비닐피롤리돈, 한천, 알긴산 또는 나트륨 알기네이트 등을 붕해제로 첨가할 수 있다. 나아가, 본 발명의 약학 조성물은 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다.
비경구 투여용 제제의 경우에는 주사제, 크림제, 로션제, 외용연고제, 오일제, 보습제, 겔제, 패치제, 에어로졸 및 비강흡입제의 형태로 당업계에 공지된 방법으로 제형화할 수 있다. 이들 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌 (Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour)에 기재되어 있다.
본 발명의 약학 조성물의 총 투여량은 단일 투여량(single dose)으로 환자에게 투여될 수 있고, 보다 구체적으로 단일 투여량으로 장기간 다중 투여될 수 있으며, 또는 다중 투여량(multiple dose)으로 장기간 투여되는 분할 치료 방법 (fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학 조성물은 질환의 증상에 따라 유효성분의 함량을 달리할 수 있다. 구체적으로 본 발명의 조성물의 전체 용량은 1일당 환자 체중 1 ㎏ 당 약 0.01 ㎍ 내지 1,000 mg, 보다 구체적으로 0.1 ㎍ 내지 100 mg일 수 있다. 그러나 상기 본 발명의 약학 조성물의 용량은 투여 경로 및 치료 횟수뿐만 아니라 환자의 연령, 체중, 건강 상태, 성별, 질환의 중증도, 식이, 배설율 등 다양한 요인들을 고려하여, 당 분야의 통상적인 지식을 가진 자가 적절한 유효 투여량을 결정할 수 있을 것이다. 본 발명에 따른 약학 조성물은 본 발명의 효과를 보이는 한 그 제형, 투여 경로 및 투여 방법에 특별히 제한되지 아니한다.
또한, 본 발명의 약학 조성물은 개별 치료제로 투여되거나 다른 치료제와 병용하여 투여될 수 있다. 다른 치료제와 병용하여 투여되는 경우, 본 발명의 조성물과 다른 치료제는 동시에, 개별적으로 또는 순차적으로 투여될 수 있다. 이때 다른 치료제라 함은 신경퇴행성 및/또는 운동신경 질환의 치료 또는 개선 효과를 갖는 것으로 이미 알려져 있는 물질일 수 있다. 본 발명의 약학 조성물이 다른 치료제와 병용하여 투여될 경우, 본 발명의 조성물과 다른 치료제는 각각 별도의 용기로 분리시켜 제형화 되거나, 같은 제형에서 함께 복합 제형화 될 수 있다.
또한, 본 발명은 할로푸지논 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는, 신경퇴행성 또는 운동신경 질환 예방 또는 개선용 건강기능식품 조성물을 제공한다.
또한, 본 발명은 신경퇴행성 또는 운동신경 질환 예방 또는 개선용 건강기능식품 조성물로 사용하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염의 용도를 제공한다.
아울러, 본 발명은 신경퇴행성 또는 운동신경 질환 예방 또는 개선용 건강기능식품 조성물로 제조하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염의 용도를 제공한다.
본 발명에서, 상기 할로푸지논 또는 이의 약학적으로 허용가능한 염, 신경퇴행성 또는 운동신경 질환에 대한 내용은 전술한 바와 동일하므로, 구체적인 설명은 상기 내용을 원용하고, 이하에서는 건강기능식품 조성물의 특유한 구성에 대해서만 설명하도록 한다.
한편, 본 발명자들은 ALS 세포모델 및 동물모델에서 할로푸지논이 섬유증을 억제하고 골격근 생성을 향상하여 관절 구축을 개선하고 중추신경계의 염증 반응 및 신경세포사멸을 억제하는 이중 효과를 나타내어, ALS의 증상 진행을 지연시키고 수행 능력 및 생존기간을 향상시킬 수 있음을 확인하였으므로, 상기 할로푸지논은 ALS을 포함한 신경퇴행성 또는 운동신경 질환의 예방 또는 개선용 건강기능식품 조성물의 유효성분으로 유용하게 이용될 수 있다.
본 발명의 건강기능식품 조성물은 분말, 과립, 환, 정제, 캡슐, 캔디, 시럽 및 음료 중에서 선택된 어느 하나의 제형으로 제조될 수 있으나, 이에 제한되지 않는다.
상기 건강기능식품 조성물은 신경퇴행성 또는 운동신경 질환을 예방하거나 개선하기 위해 섭취할 수 있는 것이면 특별히 제한되지 않는다. 본 발명의 건강기능식품 조성물을 식품첨가물로 사용하는 경우, 상기 건강기능식품 조성물을 그대로 첨가하거나 다른 식품 또는 식품성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분은 그의 사용 목적(예방 또는 개선)에 따라 적절하게 사용될 수 있다. 일반적으로, 식품 또는 음료의 제조시 본 발명의 건강기능식품 조성물에 대하여 15 중량부 이하, 바람직하게는 10 중량부 이하의 양으로 첨가된다. 그러나 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로 사용될 수 있다. 상기 식품의 종류에는 특별한 제한은 없다. 상기 건강기능식품 조성물을 첨가할 수 있는 식품의 예로는 육류, 소시지, 빵, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 수프, 음료수, 차 드링크제, 알코올 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강식품을 모두 포함한다. 또한, 본 발명의 건강기능식품 조성물은 식품, 특히 기능성 식품으로 제조될 수 있다.
본 발명의 기능성 식품은 식품 제조 시에 통상적으로 첨가되는 성분을 포함하며, 예를 들어, 단백질, 탄수화물, 지방, 영양소 및 조미제를 포함한다. 예컨대, 드링크제로 제조되는 경우에는 유효성분 이외에 천연 탄수화물 또는 향미제를 추가 성분으로서 포함할 수 있다. 상기 천연 탄수화물은 모노사카라이드(예컨대, 글루코오스, 프럭토오스 등), 디사카라이드(예컨대, 말토스, 수크로오스 등), 올리고당, 폴리사카라이드(예컨대, 덱스트린, 시클로덱스트린 등) 또는 당알코올(예컨대, 자일리톨, 소르비톨, 에리쓰리톨 등)인 것이 바람직하다. 상기 향미제는 천연 향미제(예컨대, 타우마틴, 스테비아 추출물 등)와 합성 향미제(예컨대, 사카린, 아스파르탐 등)를 이용할 수 있다. 상기 건강기능식품 조성물 외에 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 더 함유할 수 있다.
이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.
단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<실시예 1> 근아세포(myoblast) 배양, 및 TGF-β1(Transforming growth factor-β1) 및 할로푸지논(halofuginone) 처리
TGF-β(Transforming growth factor-β)가 근아세포(myoblast)에 미치는 영향 및 할로푸지논(halofuginone)에 의한 효과를 알아보기 위하여, 마우스 근아세포를 배양하고, 상기 세포에 TGF-β1 및 할로푸지논을 처리하였다.
구체적으로, 마우스 근아세포로 C2C12 세포(CRL-1772)를 ATCC(American Type Culture Collection)에서 구입하여 10%(v/v) 소태아혈청(FBS; Gibco), 1% 페니실린-스트렙토마이신(P/S; Gibco)이 포함된 DMEM 배지(Welgene)에서 37℃, 5% CO2 조건 하에 유지하였다. C2C12 세포를 6웰-플레이트(3×105 세포/웰)에 옮기고 24시간 분주한 다음, 24시간 후 무혈청 배지로 교체하고 5 ng/ml의 rhTGF-β1(재조합 인간 TGF-β1; R&D Systems)로 자극하였다. 자극 후, 세포를 24시간 동안 무혈청 배지에서 다양한 농도(0[control] 또는 1, 2.5, 5(저농도), 10(고농도), 20, 50, 100 ng/ml)의 할로푸지논(halofuginone; Sigma)을 처리하였다.
<실시예 2> 세포 생존력 분석
세포 계수 키트-8(CCK-8 키트) 분석(Enzo Life Sciences, ALX-850-039)을 사용하여 C2C12 세포에 대해 무혈청 조건에서 rhTGF-β1 또는 할로푸지논 처리 후 세포 생존력을 측정하였다.
구체적으로, 상기 <실시예 1>의 C2C12 세포를 96웰-플레이트(104 세포/웰)에 24시간 배양하고, 24시간 동안 5 ng/ml의 rhTGF-β1로 자극하였다. 자극 후 할로푸지논을 다양한 농도(0[control] 또는 1, 2.5, 5, 10, 20, 50, 100 ng/ml)로 24시간 동안 처리하였다. 24시간 후 각 웰에 10 μl의 CCK-8 용액을 첨가하고 37℃에서 1시간 동안 배양하였다. 그 다음, VersaMax 마이크로플레이트 판독기(Molecular Devices)를 이용하여 450 nm에서 흡광도를 측정하였다. 세포 생존율은 대조군(미처리) 세포의 생존율로 표현하였다. 할로푸지논의 각 농도에 대해 6개의 웰에서 얻은 평균 흡광도의 평균값을 계산하였다.
<실시예 3> 면역세포화학 분석
상기 <실시예 1>과 같이 C2C12 세포에 대해 무혈청 조건에서 rhTGF-β1 또는 할로푸지논 처리 후 면역세포화학 분석을 수행하였다.
구체적으로, C2C12 세포를 커버슬립이 있는 6웰-플레이트에 플레이팅하고 무혈청 배지에서 rhTGF-β1로 자극하였다. 자극 24시간 후, 세포를 24시간 동안 무혈청 배지에서 저농도 또는 고농도의 할로푸지논을 처리하였다. 세포를 PBS로 3회 세척하고 실온에서 15분 동안 4% 파라포름알데히드로 고정하였다. 이어서, 고정된 세포를 PBS에서 3회 세척하고 0.5% Triton X-100으로 5분 동안 처리한 후, 실온에서 1시간 동안 0.3% PBS-T에서 5% 소혈청 알부민으로 블로킹 하였다. 세포를 4℃의 블로킹 완충액에서 항-α-SMA 항체(1:200; abcam cat# ab7817), 항-MyoD 항체(1:200; Santa Cruz, cat# sc377460) 각각과 24시간 동안 인큐베이션 하고, PBS로 3회 세척한 후 Alexa Fluor 2차 항체와 실온에서 1시간 동안 인큐베이션 하였다. 핵 DNA를 DAPI(4,6-diamino-2-phenylindole, 1:1,000; Sigma)로 염색하고 PBS로 두 번 세척한 후 커버슬립을 Dako 형광 마운팅 배지(Dako)를 사용하여 유리 슬라이드에 마운팅 하였다. 40× 대물렌즈를 사용하여 Leica TCS SP8 공초점 현미경(Leica Microsystems, Wetzlar, Germany)으로 이미지를 관찰하였다. 또한, Leica Application Suite X 소프트웨어(Leica Microsystems)를 사용하여 블라인드 방식으로 정량화 하였다.
<실시예 4> 근위축성 측삭경화증(Amyotrophic lateral sclerosis, ALS) 동물모델 유전자 검사
근위축성 측삭경화증(Amyotrophic lateral sclerosis, ALS)에 있어서 할로푸지논의 효능을 알아보기 위하여, ALS 동물모델을 사용하였다.
구체적으로, 모든 동물 실험은 서울대학교 동물병원 동물관리위원회 지침(IACUC, 승인번호 SNU-200220-1-2)에 따라 진행하였다. ALS 동물모델로 인간 G93A 돌연변이 SOD1 유전자(B6SJL-Tg(SOD1-G93A) 1 Gur/J)를 발현하는 형질전환 마우스는 잭슨 연구소(Bar Harbor, ME, USA)에서 구입하였다. mtSOD1(G93A) H1 고발현자 균주(Jackson Laboratories, Bar Harbor, ME, USA)의 수컷 형질전환 ALS 마우스를 암컷 마우스(B6/SJLF1)와 교배시켰다. 마우스는 일정한 온도(22±1℃), 상대 습도(40%) 및 12시간 명암 주기의 표준 조건 하에서 사육하였고, 음식과 물에 자유롭게 접근할 수 있도록 하였다. 유전자형은 하기 [표 1]의 프라이머를 사용하여 중합효소 연쇄 반응(PCR)으로 확인하였고, 이식유전자 카피 수를 확인하였다. 그 다음, G93A 돌연변이 SOD1 형질전환 마우스를 시점에 따라 60일령(무증상), 90일령(초기 증상) 및 120일령(후기 증상)의 세 단계로 나누었다. 총 96마리의 마우스를 실험에 사용하였다. 비교군으로 비-형질전환 마우스를 이용하였다.
| 프라이머 | 서열(5'→3') | 서열번호 | |
| hSOD1wt | 정방향 | CTAGGCCACAGAATTGAAAGATCT | 1 |
| 역방향 | GTAGGTGGAAATTCTAGCATCATCC | 2 | |
| hSOD1G93A | 정방향 | CATCAGCCCTAATCCATCTGA | 3 |
| 역방향 | CGCGACTAACAATCAAAGTGA | 4 | |
<실시예 5> ALS 동물모델 유래 섬유아세포 배양 및 할로푸지논 처리
ALS에 있어서 할로푸지논의 효능을 알아보기 위하여, 상기 <실시예 4>에서 G93A 돌연변이 SOD1 유전자를 확인한 ALS 동물모델에서 섬유아세포를 분리하고, 상기 세포에 할로푸지논을 처리하였다.
구체적으로, 상기 <실시예 4>의 120일령의 비-형질전환 또는 G93A 돌연변이 SOD1 형질전환 마우스의 골격근에서 1차 섬유아세포를 분리하였다. 절제된 조직을 칼슘 및 마그네슘이 없는 HBSS(Hanks' Balanced Salt Solution; Gibco, cat# 14175095)와 페니실린-스트렙토마이신(Cat# 15070-063, Thermo Fisher Scientific)이 포함된 100 mm 배양 접시에 놓았다. 근육 조직을 얼음 블록에서 절단하였다. 그 다음, 조직을 1 mm 조각으로 자르고 37℃에서 1시간 동안 0.2% IV형 콜라게나아제(collagenase type IV; Sigma)로 효소반응 시켰다. 10 ml의 FBS(Gibco)를 첨가하여 효소 반응을 중단하였다. 조직 혼합물을 5분 동안 4℃에서 1,800 rpm으로 원심분리하고 10% FBS가 포함된 DMEM 배지(Welgene)로 재현탁하였다. 세포를 70 μm 세포 여과기(BD Biosciences, San Jose, CA)를 통해 여과하고 10% FBS, 1% 페니실린-스트렙토마이신이 포함된 DMEM 배지로 0.2% 젤라틴(Sigma) 코팅된 플레이트에서 배양하였다. 그 다음, 상기 <실시예 1>에 기재된 방법과 동일한 방법으로 할로푸지논을 처리하였다.
<실시예 6> ALS 동물모델에 할로푸지논 투여
ALS에 있어서 할로푸지논의 효능을 알아보기 위하여, 상기 <실시예 4>에서 G93A 돌연변이 SOD1 유전자를 확인한 ALS 동물모델에 할로푸지논을 투여하였다.
구체적으로, 도 1의 모식도와 같이 상기 <실시예 4>의 성별 및 연령이 일치하는 마우스를 무작위로 세 그룹으로 나누고, 하기 표 2에 나타낸 바와 같이 DMSO TG군 및 Hal TG군은 G93A 돌연변이 SOD1 형질전환 마우스에 비히클(DMSO, Duchefa Biochemie, D1370) 및 할로푸지논(Sigma, S8144) 각각을 10주령(초기 증상 단계)에 10주 이상 주당 3회 복강내(i.p.) 주사하였다. 비교군으로 DMSO Non-TG군은 비-형질전환 마우스에 동일한 기간 동안 동일한 방법으로 비히클(DMSO)을 복강내(i.p.) 주사하였다.
| 그룹 | 성별 | 동물수 (마리) |
시료 | 투여 방법 | |
| 투여시료 | 투여용량 | ||||
| DMSO Non-TG | Male | 16 | 비히클(DMSO) |
5 ㎕/마우스 |
복강 내, 주당 3회 |
| Female | 16 | ||||
| DMOS TG | Male | 16 | |||
| Female | 16 | ||||
| Hal TG | Male | 16 | 할로푸지논 | 250 ㎍/kg | |
| Female | 16 | ||||
한편, 생화학 분석에 사용되는 G93A 돌연변이 SOD1 형질전환 마우스 또는 비-형질전환 마우스를 생후 90일 및 120일에 희생시켰으며, 모든 실험은 삼중으로 수행하였다.
<실시예 7> ALS 동물모델의 질병 진행, 생존 및 운동 기능 분석
ALS에 있어서 할로푸지논의 효능을 알아보기 위하여, 상기 <실시예 6>과 같이 ALS 동물모델에 할로푸지논을 투여한 후 행동 실험을 단일 맹검 방식으로 수행하였다.
구체적으로, 상기 <실시예 6>의 마우스의 임상 상태와 체중을 출생 후 83일째부터 주당 3회 평가하였다. 질병 발병은 꼬리를 공중에 매달렸을 때 마우스의 팔다리가 떨리는 것으로 정의하였고, 이는 상부 운동 뉴런 시스템의 임상적 관련으로 인한 것으로 보고되고 있다[S. Nagano, Y. Fujii, T. Yamamoto, M. Taniyama, K. Fukada, T. Yanagihara, et al. The efficacy of trientine or ascorbate alone compared to that of the combined treatment with these two agents in familial amyotrophic lateral sclerosis model mice Exp Neurol, 179 (2003), pp. 176-180]. 종결 연령은 동물이 평평한 표면에 옆으로 눕혀진 후 30초 이내에 스스로를 바로잡을 수 없는 것으로 결정하였다. 이 시점에서 마우스가 죽은 것으로 보았다[C. Zheng, I. Nennesmo, B. Fadeel, J.I. Henter Vascular endothelial growth factor prolongs survival in a transgenic mouse model of ALS Ann Neurol, 56 (2004), pp. 564-567]. 마우스의 운동 기능은 로타로드 장치(JD-A-07M, 정도비앤피(주))를 사용하여 검증하였다. 마우스는 기록을 시작하기 전에 일주일 동안 훈련되었다. 대략 8.3초마다 1 rpm씩 증가시키면서 300초에 걸쳐 4 rpm의 속도로 시작하여 40 rpm까지 가속되는 로드에 마우스를 올려놓았다. 로타로드 테스트는 생후 83일부터 1주일에 3번씩 평균 3회 측정하여 연속 3회 로타로드에 10초 이상 머물 수 없는 시점까지 측정하였다.
<실시예 8> 면역조직화학 분석
ALS에 있어서 할로푸지논의 효능을 알아보기 위하여, 상기 <실시예 6>과 같이 ALS 동물모델에 할로푸지논을 투여한 후 요추 척수(lumbar spinal cords)와 무릎 관절 조직을 이용하여 면역조직화학 분석을 수행하였다.
구체적으로, 상기 <실시예 6>의 마우스를 생후 90일 및 120일에 4% 파라포름알데히드(PFA)를 관류하고 요추 척수와 무릎 관절을 분리하였다. 24시간 동안 4% PFA에 고정한 후 무릎 관절을 흐르는 수돗물에 24시간 동안 헹구고 탈회 용액(decalcifying solution, Calci-Clear, HS-104, National Diagnostics)과 함께 4℃에서 지속적으로 흔들면서 인큐베이션 하였다. 바늘로 뼈가 쉽게 관통되는 탈회(decalcification) 과정이 완료될 때까지 탈회 용액을 매일 새로운 용액으로 교체하였다. 그 후 탈회된 무릎 관절을 흐르는 수돗물에 24시간 동안 헹구고, 척수와 무릎 관절을 샘플이 가라앉을 때까지 30% 자당에 처리한 후 동결 보호한 다음 연속적으로 절단하였다(14 μm). 요추 척수 및 무릎 관절 조직 절편을 PBS로 3회 세척하고 0.5% Triton X-100으로 5분 동안 투과한 후 실온에서 1시간 동안 0.3% PBS-T의 5% 소혈청 알부민으로 블로킹 하였다. 무릎 관절 조직 절편은 항-TGF-β1 항체(1:200; Santa Cruz, cat# sc130348), 항-α-SMA 항체(1:200; abcam cat# ab7817), 항-MyoD 항체(1 :200; Santa Cruz, cat# sc377460), 항-콜라겐 Ⅰ항체(1:200; abcam cat# ab21286) 각각과, 요추 척수 절편은 항-GFAP 항체(1:200; Dako cat# Z0334), 항-Iba1 항체(1:200; Wako cat# 016) -20001), 항-TGF-β1 항체(1:200; Santa Cruz, cat# sc130348), 항-TGF-β1 항체(1:200; abcam, cat# ab92486), 항-IL-1β 항체(1:200; R&D Systems cat# AF-401-NA) 각각과 4℃에서 24시간 동안 추가로 인큐베이션 하였다. 절편을 PBS로 3회 세척한 후 Alexa Fluor 2차 항체와 암실에서 1시간 동안 실온으로 인큐베이션 하였다. 염색 및 세척된 척수 절편을 실온에서 10분 동안 DAPI(DAPI; 1:1,000; sigma)로 염색한 다음 PBS로 두 번 헹구고 커버슬립을 Dako 형광 마운팅 배지(Dako)로 마운팅 하고, 무릎 관절은 7.5배 대물렌즈를 이용하고 척수는 9.75배 대물렌즈를 이용하여 Leica TCS SP8 공초점 현미경(Leica Microsystems, Wetzlar, Germany)으로 관찰하였다. 또한, Leica Application Suite X 소프트웨어(Leica Microsystems)를 사용하여 분석하였다.
<실시예 9> 요추 척수의 운동 신경 세포 계수
ALS에 있어서 할로푸지논의 효능을 알아보기 위하여, 상기 <실시예 6>과 같이 ALS 동물모델에 할로푸지논을 투여한 후 요추 척수를 분리하여 운동 신경 세포를 계수하였다.
구체적으로, 상기 <실시예 6>의 마우스의 임상 상태에 따라 다양한 시점(90일 및 120일)에 마우스를 희생하였다. 각 마우스에 차가운 PBS에 이어 차가운 4% 파라포름알데히드(PFA)를 경심 관류하고 요추 척수를 분리하였다. 샘플을 4% 파라포름알데히드에 후-고정하고 차가운 30% 자당 용액에 처리한 후 동결 보호한 다음, 14 μm 두께의 횡단면 섹션을 연속적으로 수득하였다. 조직 절편을 PBS로 세척하고 0.3% 과산화수소(H2O2)를 포함하는 PBS에 15분 동안 침지하여 내인성 퍼옥시다제 활성을 제거하였다. 절편을 PBS로 세척하고 0.5% Triton X-100으로 5분 동안 투과하고 실온에서 1시간 동안 0.3% PBS-T의 5% 소혈청 알부민으로 블로킹 하였다. 각 세트의 조직 섹션을 1차 항체로 항-ChAT 항체(1:400; Millipore, cat# AB144P)와 함께 24시간 동안 인큐베이션 하였다. PBS로 세척 후, 절편을 비오틴화된 말 항-염소 IgG(H+L) 항체(1:200; Vector Laboratories, cat# BA-9500)와 함께 1시간 동안 인큐베이션 하고 PBS로 세척한 후 퍼옥시다제 결합 아비딘-비오틴 복합체(ABC 키트; 1:200; Vector Laboratories, cat# PK4000)와 함께 실온에서 1시간 동안 인큐베이션 하였다. 철저한 세척 후, 디아미노벤지딘(diaminobenzidine, DAB, ImmPACT® DAB Vector Laboratories, cat# SK-4105)에서 섹션을 인큐베이션 하여 퍼옥시다제 염색을 시각화 하였다. 섹션을 탈수 및 공기 건조하고 톨루엔 가용성 Permount 마운팅 배지(Fisher Scientific, cat# SP15-500)로 마운팅 하였다. 4× 배율로 컴퓨터 보조 현미경(Olympus BX53) 및 소프트웨어(cellSens 소프트웨어)를 사용하여 ChAT 염색 섹션에서 운동 신경을 계산하였다. 계수는 그룹당 총 3마리의 마우스에서 배측 뿔당(per ventral horn) 수행하였다. 분석된 필드는 각 반구의 회백질에 명확하게 표시된 면역 염색 섹션의 배측 절반에 위치한 모든 ChAT+ 프로파일이었다.
<실시예 10> 관절가동범위(ROM) 측정
ALS에 있어서 할로푸지논의 효능을 알아보기 위하여, 상기 <실시예 6>과 같이 ALS 동물모델에 할로푸지논을 투여한 후 무릎 관절의 관절가동범위(ROM)을 측정하였다.
구체적으로, 무릎 신전(knee extension) 각도를 결정하기 위해 해부학적 지표를 사용하였다. 질병 연령 말기(120일)에 2D 각도 분석 시스템인 Random Two-line을 사용하여 수동 무릎 관절 ROM을 측정하였다. 상기 <실시예 6>의 마우스에 1% 이소플루란(isoflurane)을 흡입하여 마취시킨 다음 아크릴 플레이트에 놓고 뒷다리의 피부를 면도하였다. 대퇴골을 플레이트에 고정하고 마우스당 무릎 관절에 일정한 힘의 신전 모멘트를 가하였다. 그 후 대전자, 무릎 외측 상과, 외측 복사뼈에 마커를 부착하여 촬영 영상의 마커를 얻었다. 대퇴골의 축(무릎 외측 관절 공간에 대한 대전자)과 비골(무릎 외측 관절 공간에서 외측 복사뼈까지) 사이의 각도를 무릎 신전 ROM으로 측정하였다. 각 군에서 16마리의 마우스를 분석하였고, 대조군으로 120일째 군에서 DMSO를 주사한 비-형질전환 마우스의 무릎을 사용하였다.
<실시예 11> 실시간 qRT-PCR 분석
상기 <실시예 1>에서 TGF-β1으로 자극 후 할로푸지논을 처리한 근아세포, 상기 <실시예 5>에서 ALS 동물모델에서 분리하여 할로푸지논을 처리한 섬유아세포 또는 상기 <실시예 6>과 같이 ALS 동물모델에 할로푸지논을 투여한 후 분리한 요추 척수를 이용하여 실시간 qRT-PCR 분석을 수행하였다.
구체적으로, 총 RNA를 FavorPrep™ Tri-RNA Reagent(Favorgen)를 사용하여 상기 <실시예 1>의 C2C12 세포, <실시예 5>의 섬유아세포 및 <실시예 6>의 마우스의 요추 척수에서 분리하였다. 상기 요추 척수는 <실시예 6>의 마우스에서 분리한 후 실험 전까지 -80℃에서 동결 보관하였다. 총 RNA의 농도는 260 nm 흡광도에서 분광광도계(NanoDrop Spectrophotometer ND-2000, Thermo Scientific)로 측정하였다. cDNA는 제조사의 프로토콜에 따라 ReverTra Ace-α-™(Toyobo)를 사용하여 1 ㎍의 총 RNA을 이용하여 합성하였다. SYBR green ExcelTaq™ 2X Fast Q-PCR Master Mix(TQ1200, Smobio)를 사용하여 써모 싸이클러 CFX Connect Real-Time PCR Detection System(BIO-RAD)에서 하기 표 3의 프라이머를 사용하여 정량적 RT-PCR을 수행하였다. 형광 데이터는 Bio-Rad CFX Manager 3.1 소프트웨어로 분석하였고, 2(-ΔΔCT) 방법으로 대조군 대 상대적 mRNA 발현을 계산하였다. 모든 샘플에 대해 4회 실험을 수행하였다. 모든 프라이머는 Primer3 온라인 소프트웨어를 사용하여 설계하였고, 대조군으로 GAPDH를 사용하였다.
| 프라이머 | 서열(5'→3') | 서열번호 | |
| GAPDH | 정방향 | TGTGTCCGTCGTGGATCTGA | 5 |
| GAPDH | 역방향 | CCTGCTTCACCACCTTCTTGA | 6 |
| TGF-β | 정방향 | CACCGGAGAGCCCTGGATA | 7 |
| TGF-β | 역방향 | TGTACAGCTGCCGCACACA | 8 |
| TGF-β1 | 정방향 | TCGCTTTGTACAACAGCACC | 9 |
| TGF-β1 | 역방향 | ACTGCTTCCCGAATGTCTGA | 10 |
| TGF-β2 | 정방향 | AGGCAGAGTTCAGGGTCTTC | 11 |
| TGF-β2 | 역방향 | CCTTGCTATCGATGTAGCGC | 12 |
| TGF-β3 | 정방향 | AGGAGACCTCGGAGTCTGAG | 13 |
| TGF-β3 | 역방향 | CACTGAGGACACATTGAAACGA | 14 |
| α-SMA | 정방향 | AGTTTTGTGCTGAGGTCCCTATATG | 15 |
| α-SMA | 역방향 | TTCCCAAACAAGGAGCAAAGA | 16 |
| MyoD | 정방향 | TACAGTGGCGACTCAGATGC | 17 |
| MyoD | 역방향 | GAGATGCGCTCCACTATGCT | 18 |
| Collagen Ⅰ | 정방향 | CTGGCGGTTCAGGTCCAAT | 19 |
| Collagen Ⅰ | 역방향 | TTCCAGGCAATCCACGAGC | 20 |
| ChAT | 정방향 | CTGTGCCCCCTTCTAGAGC | 21 |
| ChAT | 역방향 | CAAGGTTGGTGTCCCTGG | 22 |
| iNOS | 정방향 | ACCTTGTTCAGCTACGCCTT | 23 |
| iNOS | 역방향 | CATTCCCAAATGTGCTTGTC | 24 |
| CD86 | 정방향 | ACGATGGACCCCAGATGCACCA | 25 |
| CD86 | 역방향 | GCGTCTCCACGGAAACAGCA | 26 |
| Arginase 1 | 정방향 | TTAGGCCAAGGTGCTTGCTGCC | 27 |
| Arginase 1 | 역방향 | TACCATGGCCCTGAGGAGGTTC | 28 |
| IFN-α | 정방향 | AAGGACAGGAAGGATTTTGGATT | 29 |
| IFN-α | 역방향 | GAGCCTTCTGGATCTGTTGGTT | 30 |
| IL-6 | 정방향 | GAGGATACCACTCCCAACAGACC | 31 |
| IL-6 | 역방향 | AAGTGCATCATCGTTGTTCATACA | 32 |
| IL-1β | 정방향 | CCAAAAGATGAAGGGCTGCTT | 33 |
| IL-1β | 역방향 | GAAAAGAAGGTGCTCATGTCCTC | 34 |
| TNF-α | 정방향 | TCTCATTCCTGCTTGTGGCA | 35 |
| TNF-α | 역방향 | GGTGGTTTGCTACGACGTGG | 36 |
| Bax | 정방향 | AGCAAACTGGTGCTCAAGGC | 37 |
| Bax | 역방향 | CCACAAAGATGGTCACTGTC | 38 |
| Bcl2 | 정방향 | GTGGTGGAGGAACTCTTCAG | 39 |
| Bcl2 | 역방향 | GTTCCACAAAGGCATCCCAG | 40 |
| Caspase-3 | 정방향 | CCTCAGAGAGACATTCATGG | 41 |
| Caspase-3 | 역방향 | GCAGTAGTCGCCTCTGAAGA | 42 |
<실시예 12> 단백질 추출 및 웨스턴 블롯 분석
상기 <실시예 1>에서 TGF-β1으로 자극 후 할로푸지논을 처리한 근아세포, 상기 <실시예 5>에서 ALS 동물모델에서 분리하여 할로푸지논을 처리한 섬유아세포 또는 상기 <실시예 6>과 같이 ALS 동물모델에 할로푸지논을 투여한 후 분리한 요추 척수 또는 무릎 관절을 이용하여 웨스턴 블롯 분석을 수행하였다.
구체적으로, 상기 <실시예 6>의 마우스의 요추 척수 또는 무릎 관절을 분리하고 즉시 -80℃에 동결하였다. 그 다음, 각 요추 척수 또는 무릎 관절을 균질화하고 화학 처리하여 세포를 획득하였다. 상기 화학 처리된 세포, 상기 <실시예 1>의 C2C12 세포 또는 <실시예 5>의 섬유아세포를 RIPA 완충액(Thermo, MA, USA)에서 프로테아제 억제제 및 포스파타제 억제제(Roche, IN, USA)로 용해시키고 얼음 위에서 30분 동안 인큐베이션 하였다. 용해물을 4℃에서 13,000 rpm으로 20분 동안 원심분리한 후, 불용성 물질을 제거하였다. BCA 분석(Pierce Biotechnology)으로 단백질 농도를 측정하였다. 동량의 세포 용해물을 전기영동을 위해 SDS-PAGE 겔에 로딩하고, 니트로셀룰로오스 멤브레인(nitrocellulose membrane, Amersham Protran 0.2um NC, Amersham Pharmacia Biotech, Piscataway, NJ, USA)으로 옮겼다. 그 다음, 멤브레인을 실온에서 1시간 동안 1X TBST의 5%(w/v) 스킴밀크로 블로킹 하였다. 블로킹 후 멤브레인에 1차 항체로 항-β-액틴 항체(1:5000; Santa Cruz, cat# sc47778), 항-Smad2 항체(1:1000; Cell Signaling, cat# 5339), 항-p-Smad2 항체 (1:1000; Cell Signaling, cat# 3108), 항-TGF-β1 항체(1:1000; Santa Cruz, cat# sc130348), 항-α-SMA 항체(1:10000; abcam cat# ab7817), 항-MyoD 항체(1:1000; Santa Cruz, cat# sc377460), 항-콜라겐 Ⅰ 항체(1:1000; abcam cat# ab21286), 항-절단된 카스파제-3 항체(1:1000; Cell Signaling, cat# 9661) , 항-bax 항체(1:500; Santa Cruz, cat# sc493), 항-bcl2 항체(1:1000; Novus Biologicals, cat# NB100-56098), 항-ChAT 항체(1:1000; Millipore, cat# AB144P) 각각을 처리하고 4℃에서 밤새 인큐베이션 하였다. 그 후, 1X TBST로 여러 번 세척한 후 멤브레인을 실온(RT)에서 1시간 동안 블로킹 완충액에서 호스래디쉬 퍼옥시다제-접합 이차 항체(항-마우스, 토끼 또는 염소, 1:5000; GE Healthcare)와 함께 인큐베이션 하였다. 그 다음, 멤브레인을 세척하고, 제조사의 절차에 따라 SuperSignal West Pico Plus Chemiluminescent Substrate(Pierce Biotechnology)와 함께 간단히 인큐베이션 하고 이미지 분석기(Amersham Pharmacia Biotech, Piscataway, NJ, USA)로 정량화 하였다. 내부 대조군으로 β-액틴을 사용하였다. 단백질 강도의 농도 측정은 Image J(National Institutes of Health)를 사용하여 정량화 하였다.
<실시예 13> 통계 분석
모든 데이터는 최소 3회의 독립적인 실험을 기반으로 하는 평균 및 평균의 표준 오차(SEM)로 표시하였고 대조군 값의 비율로 표시하였다. 그룹 간의 차이의 유의성은 Student's t-test 또는 one-way ANOVA에 이어 Tukey's post hoc comparison으로 분석하였다. p-값 < 0.05는 통계적으로 유의한 것으로 간주하였다. KaplanMeier curve를 사용하여 증상 발병, 로타로드 부전 및 질병 종말점의 누적 확률을 분석하였다. 모든 분석은 GraphPad Prism을 사용하여 수행하였다.
<실험예 1> 근아세포에서 TGF-β1 자극에 의한 섬유증 증진 및 근형성 억제 확인
TGF-β1이 근아세포에 미치는 영향을 알아보기 위해, C2C12 마우스 근아세포 세포주에 TGF-β1 자극 후 실시간 qRT-PCR 분석 및 웨스턴 블롯 분석을 수행하였다.
구체적으로, 상기 <실시예 1>과 같이 C2C12 세포에 TGF-β1을 24시간 처리한 후 상기 <실시예 11>에 기재된 방법과 동일한 방법으로 실시간 qRT-PCR을 수행하여 TGF-β1, 2 및 3, α-SMA 및 MyoD mRNA 발현을 확인하였고(도 2a), 상기 <실시예 12>에 기재된 방법과 동일한 방법으로 웨스턴 블롯 분석을 수행하여 TGF-β1 및 MyoD 단백질 및 α-SMA의 자가분비(autocrine) 발현을 확인하였다(도 2b).
그 결과, 도 2a에 나타낸 바와 같이, C2C12 세포주에 TGF-β1 자극 24시간 후, TGF-β1, 2 및 3의 mRNA 수준이 대조군에 비해 유의하게 증가하였다. 또한, TGF-β 자극에 의한 근섬유아세포로의 근아세포의 활성화를 α-SMA의 mRNA 발현의 유의한 증가로 확인하였다. 대조적으로, MyoD의 mRNA 수준은 TGF-β 자극 후 유의하게 감소하였다(도 2a).
또한, 도 2b에 나타낸 바와 같이, C2C12 세포주에 TGF-β1 자극 24시간 후, TGF-β1 및 α-SMA 단백질 발현이 유의하게 증가하였다. 대조적으로, MyoD의 단백질 발현은 TGF-β 자극 후 유의하게 감소하였다(도 2b).
상기의 결과를 통해 근아세포에서 TGF-β1 자극에 의한 섬유증 증진 및 근형성 억제가 유발됨을 알 수 있다.
<실험예 2> 할로푸지논(halofuginone)의 세포독성 확인
근아세포에서 할로푸지논(halofuginone)의 세포독성을 알아보기 위하여, 세포 생존력 분석 및 웨스턴 블롯 분석을 수행하였다.
구체적으로, 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 C2C12 세포에 TGF-β1 자극 또는 무자극 후 할로푸지논을 처리하고 CCK-8 분석을 통해 세포 생존력 분석을 수행하였고(도 3a 및 도 3b), <실시예 12>에 기재된 방법과 동일한 방법으로 웨스턴 블롯 분석을 수행하여 p-Smad2, Smad2, TGF-β1, MyoD, 콜라겐 I 단백질 및 α-SMA의 자가분비 발현을 확인하였다(도 3c).
그 결과, 도 3a 및 도 3b에 나타낸 바와 같이, 1 ng/㎖ 내지 10 ng/㎖의 할로푸지논 농도에서 세포 생존율이 크게 변하지 않는 것을 확인하였다(도 3a 및 도 3b).
또한, 도 3c에 나타낸 바와 같이, 5 ng/㎖ 및 10 ng/㎖의 할로푸지논 농도에서 TGF-β1 자극에 의한 p-Smad2/Smad2 비율, TGF-β1, α-SMA 및 콜라겐 I 단백질 수준의 상승이 유의하게 감소하고, TGF-β1 자극에 의한 MyoD 단백질 수준의 감소가 유의하게 회복되었다(도 3c).
이에, C2C12 세포에서 할로푸지논의 최적 농도로 저농도는 5 ng/㎖, 고농도는 10 ng/㎖ 처리를 결정하였다.
<실험예 3> TGF-β1 자극 근아세포에서 할로푸지논에 의한 섬유증 증진 및 근형성 억제 완화 확인
근아세포에서 TGF-β1에 의한 변화가 TGF-β 억제제로 할로푸지논에 의해 억제될 수 있는지 여부를 조사하기 위하여, C2C12 마우스 근아세포 세포주에 TGF-β1 자극 후 할로푸지논을 처리하고, 실시간 qRT-PCR 분석, 웨스턴 블롯 분석 및 면역세포화학 분석을 수행하였다.
구체적으로, 상기 <실시예 1>과 같이 C2C12 세포를 TGF-β1로 24시간 자극한 후 할로푸지논을 24시간 처리하고, 상기 <실시예 11>에 기재된 방법과 동일한 방법으로 실시간 qRT-PCR을 수행하여 TGF-β1, α-SMA, MyoD 및 콜라겐 I(Col-I) mRNA 발현을 확인하였다(도 4a). 또한, 상기 <실시예 12>에 기재된 방법과 동일한 방법으로 웨스턴 블롯 분석을 수행하여 TGF-β1, α-SMA, MyoD 및 콜라겐 I 단백질 발현을 확인하였다(도 4b). 아울러, 상기 <실시예 3>에 기재된 방법과 동일한 방법으로 면역세포화학 분석을 수행하여 α-SMA 및 MyoD 발현을 확인하였다(도 4c).
그 결과, 도 4a 및 도 4b에 나타낸 바와 같이, 저농도 또는 고농도의 할로푸지논을 처리한 군에서 TGF-β1 자극에 의한 TGF-β1, α-SMA 및 콜라겐 I mRNA 수준의 상승이 유의하게 감소하고, TGF-β1 자극에 의한 MyoD mRNA 수준의 감소는 유의하게 회복되었다(도 4a). 단백질 발현 또한 동일한 양상을 보였다(도 4b).
또한, 도 4c에 나타낸 바와 같이, 면역형광 염색 및 공초점 현미경을 사용하여 할로푸지논 저농도 또는 고농도 처리에 의해 α-SMA가 감소된 강도와 MyoD가 회복된 강도를 확인하였다(도 4c).
상기의 결과를 통해 근아세포에서 TGF-β1 자극에 의한 섬유증의 증진 및 근형성 억제를 TGF-β 억제제로 할로푸지논을 사용하여 예방할 수 있음을 알 수 있다.
<실험예 4> ALS 동물모델 유래 섬유아세포에서 할로푸지논에 의한 섬유증 억제 확인
ALS 동물모델 유래 섬유아세포에서 TGF-β1의 변화 및 할로푸지논의 효과를 알아보기 위하여, ALS 동물모델 유래 섬유아세포에 할로푸지논을 처리한 후 실시간 qRT-PCR 분석 및 웨스턴 블롯 분석을 수행하였다.
구체적으로, 상기 <실시예 5>에 기재된 방법과 동일한 방법으로 ALS 동물모델에서 섬유아세포를 분리하고 할로푸지논을 처리한 후, 상기 <실시예 11>에 기재된 방법과 동일한 방법으로 실시간 qRT-PCR을 수행하여 TGF-β1, α-SMA 및 콜라겐 I(Col-I) mRNA 발현을 확인하였다(도 5a). 또한, 상기 <실시예 12>에 기재된 방법과 동일한 방법으로 웨스턴 블롯 분석을 수행하여 p-Smad2, Smad2, TGF-β1, α-SMA및 콜라겐 I 단백질 발현을 확인하였다(도 5b). 대조군으로 비-형질전환 마우스에서 분리한 섬유아세포를 이용하였다.
그 결과, 도 5a 및 도 5b에 나타낸 바와 같이, p-Smad2/Smad2 비율, 및 TGF-β, α-SMA 및 Col-I의 단백질 발현 뿐만 아니라 mRNA의 수준은 비-형질전환 마우스 유래 섬유아세포(Non-TG)에 비해 G93A 돌연변이 SOD1 마우스 유래 섬유아세포에서 유의하게 상승하였다. 이러한 변화는 24시간 동안 저농도 또는 고농도 할로푸지논 처리로 약화되는 것을 확인하였다(도 5a 및 도 5b).
상기의 결과를 통해 ALS 마우스 모델의 섬유아세포에서 섬유증이 증진되고, 할로푸지논 처리에 의해 섬유증이 억제될 수 있음을 알 수 있다.
<실험예 5> ALS 동물모델에서 할로푸지논 투여에 의한 ALS 발병 지연 및 수행 능력 향상 확인
생체 내에서 할로푸지논의 효과를 평가하기 위해, ALS 동물모델에 할로푸지논을 투여하고 질병 진행, 생존 및 운동 기능 분석을 수행하였다.
구체적으로, 상기 <실시예 6>에 기재된 방법과 동일한 방법으로 ALS 동물모델에 할로푸지논을 투여하고 상기 <실시예 7>에 기재된 방법과 동일한 방법으로 질병 진행, 생존 및 운동 기능 분석을 수행하였다.
그 결과, 도 6a에 나타낸 바와 같이, 증상 단계의 각 TG군은 non-TG군에 비해 로타로드에서 유의하게 시간이 단축되는 양상을 보였다. 한편, TG군 중에서, DMSO를 투여한 TG군(DMSO TG군)과 비교하여 할로푸지논을 투여한 TG군(Hal TG군)은 로타로드에서 유의하게 더 긴 시간을 나타냈다. 체중은 non-TG군과 비교하여 TG군에서 유의하게 감소되었고, DMSO TG군과 Hal TG군 간에는 유의한 차이가 나타나지 않았다(도 6a).
또한, 도 6b 및 도 6c에 나타낸 바와 같이, DMSO TG군과 Hal TG군 사이에 증상 발병의 차이가 있었고, Hal TG군의 증상 발병은 DMSO TG군에 비해 유의하게 지연되었다(평균 ± 표준 편차[SD], 113 ± 3.6 vs 94.2 ± 5.7, p < 각각 0.5). 또한, 로타로드 부전에 도달하는 연령은 DMSO TG군보다 Hal TG군에서 지연되었으며(각각 124.3 ± 3.5 vs 116.5 ± 3.1, p < 0.001), 종결 연령도 유의하게 증가하였다(141.8 ± 각각 9.8 vs 129.3 ± 7.6, 도 6b 및 도 6c).
<실험예 6> ALS 동물모델의 질병 초기 단계에서 할로푸지논 투여에 의한 활막강의 섬유증 감소 및 골격근 생성 향상 확인
ALS 발병에 있어서 할로푸지논의 효과를 평가하기 위해, ALS 동물모델에 할로푸지논을 투여하고 질병 초기와 후기에 무릎 관절 활막강의 변화를 면역조직화학 분석(IHC)으로 확인하였다.
구체적으로, 상기 <실시예 6>에 기재된 방법과 동일한 방법으로 G93A 돌연변이 SOD1 마우스에 ALS 발병 초기(73일)부터 할로푸지논을 투여하고, 상기 <실시예 8>에 기재된 방법과 동일한 방법으로 질병 초기 암컷 및 수컷(90일령, 도 7a 및 도 7b)과 후기 암컷 및 수컷(120일령, 도 7c 및 도 7d) 무릎 관절을 이용하여 면역조직화학 분석을 수행하였다.
그 결과, 도 7a 및 도 7b에 나타낸 바와 같이, DMSO Non-TG군과 비교하여 DMSO TG군은 성별에 관계없이 질병의 초기 단계에서 무릎 관절 활막강에서 TGF-β1의 유의한 증가를 확인하였다. 또한, DMSO Non-TG군에 비해 DMSO TG군의 활막강에서 TGF-β1의 증가와 함께 α-SMA 및 Col-I가 증가하고, MyoD는 감소하는 것을 확인하였다. 반면, Hal TG군에서는 질병의 초기 단계에서 TGF-β의 증가가 억제되었고, 이에 따라 α-SMA 및 Col-I 발현도 DMSO TG군에 비해 현저히 낮게 나타남을 확인하였다(도 7a 및 도 7b).
또한, 도 7c 및 도 7d에 나타낸 바와 같이, Hal TG군에서는 DMSO TG군와 비교하여 활막강에서 유의하게 더 낮은 TGF-β1, α-SMA, Col-I 및 더 높은 MyoD가 질병 후기 단계에서 지속적으로 유지됨을 확인하였다. 또한, 암컷 Hal TG군에서 TGF-β1, MyoD 및 Col-1의 강도는 DMSO non-TG군의 강도와 차이가 없었고, 수컷 Hal TG군의 MyoD 강도는 DMSO non-TG군에 비해 다소 증가하는 것을 확인하였다(도 7c 및 도 7d).
상기의 결과를 통해 TGF-β의 증가로 인한 ALS 마우스의 활막강에서의 근섬유아세포 활성화 및 강화된 섬유화가 할로푸지논 투여에 의해 개선될 수 있음을 알 수 있다. 또한, ALS 마우스의 활막강에서 감소되는 골격근의 근형성도 할로푸지논 투여로 예방할 수 있음을 알 수 있다. 더욱이, ALS 마우스의 질병 초기 단계에서 할로푸지논의 투여가 성별에 관계없이 활막강의 섬유증을 유의하게 감소시키고 근육 형성을 향상시킴을 알 수 있다.
<실험예 7> 할로푸지논 투여에 의한 ALS 동물모델의 관절 구축 개선 확인
ALS에 있어서 섬유증으로 인한 기능 저항 및 이에 대한 할로푸지논의 효과를 알아보기 위하여, ALS 동물모델에 할로푸지논을 투여한 후 무릎 관절의 관절가동범위(ROM)를 측정하고, 웨스턴 블롯 분석을 수행하였다.
구체적으로, 상기 <실시예 6>에 기재된 방법과 동일한 방법으로 G93A 돌연변이 SOD1 마우스에 할로푸지논을 투여하고, 상기 <실시예 10>에 기재된 방법과 동일한 방법으로 무릎 관절의 ROM 측정을 수행하였다(도 8a). 또한, 무릎 관절 조직을 이용하여 상기 <실시예 12>에 기재된 방법과 동일한 방법으로 웨스턴 블롯 분석을 수행하여 p-Smad2, Smad2, TGF-β1, α-SMA, MyoD 및 콜라겐 I 단백질 발현을 확인하였다(도 8b).
그 결과, 도 8a에 나타낸 바와 같이, 120일 된 DMSO Non-TG군에 비해 DMSO TG군에서 ROM이 유의적으로 감소하였고, Hal TG군에서는 ROM이 변화하지 않는 것을 확인하였다(도 8a).
또한, 도 8b에 나타낸 바와 같이, DMSO Non-TG군과 비교하여 DMSO TG군에서 p-Smad2/Smad2 비율, TGF-β, α-SMA, Col-I의 유의한 증가와 MyoD의 감소를 확인하였다. 또한, Hal TG군의 p-Smad2/Smad2 비율, 및 TGF-β1, α-SMA 및 MyoD의 발현 수준은 DMSO non-TG 마우스와 유사하게 보존되었고 Col-1 발현 수준은 오히려 감소하였다(도 8b).
상기의 결과를 통해 ALS 마우스에서 TGF-β의 증가가 무릎 관절 내 섬유증을 강화하여 관절 수축을 유도하는 반면, 할로푸지논 투여로 이를 개선할 수 있음을 알 수 있다.
<실험예 8> ALS 동물모델의 중추신경계(CNS) 조직에서 할로푸지논 투여에 의한 항염증 및 신경세포사멸 억제 효과 확인
ALS에 있어서 할로푸지논 투여에 의한 중추신경계(CNS) 내 효과를 조사하기 위하여, ALS 동물모델에 할로푸지논을 투여한 후 요추 척수를 이용하여 면역조직화학 분석, 요추 척수의 운동 신경 세포 계수 및 웨스턴 블롯 분석을 수행하였다.
구체적으로, 상기 <실시예 6>에 기재된 방법과 동일한 방법으로 G93A 돌연변이 SOD1 마우스에 할로푸지논을 투여하고, 생후 120일 마우스를 희생한 후 상기 <실시예 8>에 기재된 방법과 동일한 방법으로 면역조직화학 분석을 수행하여 요추 척수에서 TGF-β1 및 신경교세포(glial cell)를 확인하였다. 성상교세포(astrocyte)에서 파생된 TGF-β가 ALS 마우스에서 질병을 가속화한다고 보고된 것을 감안하여, 면역조직화학 분석 시 각 그룹의 척수를 TGF-β와 GFAP로 공동 염색하였다. 또한, 미세아교세포(microglia)의 활성을 확인하기 위해 Iba1 염색을 하였다(도 9a 및 도 9b).
또한, TGF-β와 CNS의 신경교세포 변화가 염증에 미치는 영향을 알아보기 위해, 면역조직화학 분석 시 대표적인 전염증성 사이토카인인 IL-1β를 GFAP로 동시염색하였다(도 9c).
또한, 척수의 운동신경원을 조사하기 위해 상기 <실시예 9>에 기재된 방법과 동일한 방법으로 요추 척수의 운동 신경 세포를 관찰 및 계수하고(도 9d), 상기 <실시예 11> 및 <실시예 12>에 기재된 방법과 동일한 방법으로 실시간 qRT-PCR 및 웨스턴 블롯 분석을 수행하여 ChAT mRNA(도 9e) 및 ChAT 단백질(도 9f) 발현을 정량적으로 분석하였다.
아울러, 상기 <실시예 6>에 기재된 방법과 동일한 방법으로 G93A 돌연변이 SOD1 마우스에 할로푸지논을 투여하고, 생후 90일 마우스를 희생한 후 상기와 동일한 방법으로 미세아교세포의 활성을 확인하기 위해 Iba1 염색을 하고(도 10a), 운동 신경 세포를 관찰 및 계수하였다(도 10b).
그 결과, 도 9a 및 도 9b에 나타낸 바와 같이, 120일령 마우스의 DMSO TG군에서는 DMSO Non-TG군에 비해 GFAP 강도가 유의하게 증가하였고, 동일한 부위에서 TGF-β1도 증가하였다. 성상교세포 활성 및 TGF-β1의 이러한 증가는 Hal TG군에서 현저히 감소하는 것을 확인하였다(도 9b). 한편, 미세아교세포는 DMSO TG군에서 유의한 증가를 보였고, Hal TG군에서도 미세아교세포가 지속적으로 증가함을 확인하였다(도 9a).
또한, 도 9c에 나타낸 바와 같이, 120일령 마우스의 DMSO non-TG군과 비교하여 DMSO TG군에서는 GFAP 활성과 함께 IL-1β가 증가하여 활성화된 염증을 보였고, 이 활성화된 염증은 Hal TG군에서 억제되었다(도 9c).
또한, 도 9d 내지 도 9f에 나타낸 바와 같이, 120일령 마우스의 DMSO TG군에서 ChAT의 모든 mRNA 수준, ChAT 양성 운동신경세포의 수 및 ChAT 발현이 DMSO Non-TG군보다 유의하게 낮게 나타나는 반면, Hal TG군에서는 DMSO Non-TG군과 유사하게 보존되는 것을 확인하였다(도 9d 내지 도 9f).
아울러, 도 10a 및 도 10b에 나타낸 바와 같이, 상기와 같은 변화는 90일령 마우스에서도 유사하게 나타났다(도 10a 및 도 10b).
상기의 결과를 통해 ALS 마우스의 CNS에서 TGF-β의 증가가 염증 반응의 증가 및 그에 따른 운동신경세포의 감소와 관련이 있으며, 이 과정은 할로푸지논 투여에 의해 억제될 수 있음을 알 수 있다.
<실험예 9> ALS 동물모델에서 할로푸지논 투여에 의한 CNS의 만성 염증 및 신경세포사멸 억제 확인
ALS에 있어서 할로푸지논 투여가 CNS의 염증 반응에 미치는 영향을 알아보기 위하여, ALS 동물모델에 할로푸지논을 투여한 후 요추 척수를 이용하여 실시간 qRT-PCR 분석 및 웨스턴 블롯 분석을 수행하였다.
구체적으로, 상기 <실시예 6>에 기재된 방법과 동일한 방법으로 G93A 돌연변이 SOD1 마우스에 할로푸지논을 투여하고, 생후 120일 마우스를 희생한 후 요추 척수를 분리하였다. 그 다음, CNS의 염증 관련 인자 및 신경세포사멸 관련 인자의 mRNA 발현을 상기 <실시예 11>에 기재된 방법과 동일한 방법으로 실시간 qRT-PCT 분석을 수행하여 확인하였고(도 11a), 신경세포사멸 관련 인자의 단백질 발현을 상기 <실시예 12>에 기재된 방법과 동일한 방법으로 웨스턴 블롯 분석을 수행하여 확인하였다(도 11b). 미세아교세포의 M1 또는 M2 아형에 따라 역할(전염증 또는 항염증 효과)이 다르기 때문에 CNS의 염증 관련 인자로는 M1 표지자(iNOS, CD86), M2 표지자(arginase 1)와 전염증 인자(IFN-a, TNF-a, IL-1b, IL-6)의 발현을 확인하였다. 또한, 신경세포사멸 관련 인자로 caspase-3, bax, bcl-2의 발현을 확인하였다.
그 결과, 도 11a에 나타낸 바와 같이, DMSO TG군에서 TGF-β의 mRNA 수준에 따라 M1 표지자 및 전염증성 인자의 mRNA 수준이 유의하게 증가되며, 이는 할로푸지논에 의해 억제됨을 확인하였다. 또한, 항신경세포사멸 인자인 bcl-2의 mRNA 수준은 DMSO Non-TG군 비교하여 DMSO TG군에서 감소하였고, Hal TG군에서 보존되는 것을 확인하였다(도 11a).
또한, 도 11b에 나타낸 바와 같이, DMSO Non-TG군과 비교하여 DMSO TG군에서 신경세포사멸 인자인 절단된 카스파제-3(cleaved caspase-3) 및 bax의 단백질 발현은 증가하고 항신경세포사멸 인자인 bcl-2는 감소하였으며, 이러한 변화는 Hal TG군에서 개선되는 것을 확인하였다(도 11b).
상기의 결과를 통해 할로푸지논이 ALS 마우스에서 지속적으로 증가된 TGF-β를 차단하여 CNS에서 항염증 효과를 나타내고 신경세포사멸을 억제할 수 있음을 알 수 있다.
상기 <실험예 1> 내지 <실험예 9>의 결과를 통해 할로푸지논이 ALS에 있어서 TGF-β 증가로 인한 관절 구축 개선 및 CNS의 만성 염증 및 신경세포사멸 억제라는 이중 치료 효과를 나타냄을 확인하였다. 따라서, 상기 할로푸지논은 ALS를 포함한 TGF-β 증가에 의한 신경퇴행성 또는 운동신경 질환의 예방 또는 치료에 이용될 수 있다.
본 발명에서는 근위축성 측삭경화증(Amyotrophic lateral sclerosis, ALS) 세포모델 및 동물모델에서 할로푸지논(Halofuginone)이 섬유증을 억제하고 골격근 생성을 향상하여 관절 구축을 개선하고 중추신경계의 염증 반응 및 신경세포사멸을 억제하는 이중 효과를 나타내어, ALS의 증상 진행을 지연시키고 수행 능력 및 생존기간을 향상시킬 수 있음을 확인하였으므로, 상기 할로푸지논 또는 이의 약학적으로 허용가능한 염은 ALS을 포함한 신경퇴행성 또는 운동신경 질환의 예방 또는 치료용 조성물의 유효성분으로 유용하게 이용될 수 있다.
Claims (11)
- 할로푸지논(Halofuginone) 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약학 조성물.
- 제 1항에 있어서, 상기 할로푸지논 또는 이의 약학적으로 허용가능한 염은 TGF-β 억제제인, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약학 조성물.
- 제 1항에 있어서, 상기 할로푸지논은 관절 활막강의 섬유증을 완화하고, 골격근 생성을 향상하는 것인, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약학 조성물.
- 제 1항에 있어서, 상기 할로푸지논은 중추신경계의 염증 반응 및 신경세포사멸을 억제하는 것인, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약학 조성물.
- 제 1항에 있어서, 상기 할로푸지논은 신경퇴행성 또는 운동신경 질환의 증상 악화를 지연시키고, 수행 능력 및 생존기간을 향상시키는 것인, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약학 조성물.
- 제 1항에 있어서, 상기 신경퇴행성 또는 운동신경 질환은 근위축성 측삭경화증, 알츠하이머병, 파킨슨병, 헌팅턴병, 다발성 경화증, 근육긴장이상증, 척수성 근위축증 또는 염증성 신경병증인, 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약학 조성물.
- 할로푸지논 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는, 신경퇴행성 또는 운동신경 질환 예방 또는 개선용 건강기능식품 조성물.
- 할로푸지논 또는 이의 약학적으로 허용가능한 염을 개체에 투여하는 단계를 포함하는, 신경퇴행성 또는 운동신경 질환 예방 또는 치료방법.
- 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 약제로 제조하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염의 용도.
- 신경퇴행성 또는 운동신경 질환 예방 또는 개선용 건강기능식품 조성물로 제조하기 위한 할로푸지논 또는 이의 약학적으로 허용가능한 염의 용도.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2024543121A JP7812929B2 (ja) | 2022-01-18 | 2022-12-12 | ハロフジノンを有効成分として含有する神経退行性又は運動神経疾患の予防又は治療用組成物 |
| US18/775,636 US20240390377A1 (en) | 2022-01-18 | 2024-07-17 | Composition for the prevention or treatment of neurodegenerative or motor neuron diseases comprising halofuginone as an active ingredient |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2022-0007094 | 2022-01-18 | ||
| KR20220007094 | 2022-01-18 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/775,636 Continuation US20240390377A1 (en) | 2022-01-18 | 2024-07-17 | Composition for the prevention or treatment of neurodegenerative or motor neuron diseases comprising halofuginone as an active ingredient |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023140505A1 true WO2023140505A1 (ko) | 2023-07-27 |
Family
ID=87348860
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2022/020102 Ceased WO2023140505A1 (ko) | 2022-01-18 | 2022-12-12 | 할로푸지논을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물 |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20240390377A1 (ko) |
| JP (1) | JP7812929B2 (ko) |
| KR (1) | KR102758662B1 (ko) |
| WO (1) | WO2023140505A1 (ko) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20240172656A (ko) | 2023-05-30 | 2024-12-10 | 그래핀스퀘어케미칼 주식회사 | 그래핀 양자점을 유효성분으로 포함하는 퇴행성 신경 질환의 예방 또는 치료용 약학적 조성물 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013106702A1 (en) * | 2012-01-13 | 2013-07-18 | President And Fellows Of Harvard College | Halofuginol derivatives and their use in cosmetic and pharmaceutical compositions |
| US20160317498A1 (en) * | 2008-08-11 | 2016-11-03 | President And Fellows Of Harvard College | Halofuginone analogs for inhibition of trna synthetases and uses thereof |
| US20190365760A1 (en) * | 2016-11-14 | 2019-12-05 | Keio University | A therapeutic or prophylactic agent for ischemic disease, glaucoma, optic nerve disease, retinal degenerative disease, angiogenic retinal disease, cancer, neurodegenerative or autoimmune disease, and a hypoxia inducing factor inhibitor |
-
2022
- 2022-12-12 JP JP2024543121A patent/JP7812929B2/ja active Active
- 2022-12-12 WO PCT/KR2022/020102 patent/WO2023140505A1/ko not_active Ceased
- 2022-12-12 KR KR1020220172399A patent/KR102758662B1/ko active Active
-
2024
- 2024-07-17 US US18/775,636 patent/US20240390377A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160317498A1 (en) * | 2008-08-11 | 2016-11-03 | President And Fellows Of Harvard College | Halofuginone analogs for inhibition of trna synthetases and uses thereof |
| WO2013106702A1 (en) * | 2012-01-13 | 2013-07-18 | President And Fellows Of Harvard College | Halofuginol derivatives and their use in cosmetic and pharmaceutical compositions |
| US20190365760A1 (en) * | 2016-11-14 | 2019-12-05 | Keio University | A therapeutic or prophylactic agent for ischemic disease, glaucoma, optic nerve disease, retinal degenerative disease, angiogenic retinal disease, cancer, neurodegenerative or autoimmune disease, and a hypoxia inducing factor inhibitor |
Non-Patent Citations (2)
| Title |
|---|
| KUNIMI HIROMITSU, MIWA YUKIHIRO, INOUE HIROYOSHI, TSUBOTA KAZUO, KURIHARA TOSHIHIDE: "A Novel HIF Inhibitor Halofuginone Prevents Neurodegeneration in a Murine Model of Retinal Ischemia-Reperfusion", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 20, no. 13, 1 January 2019 (2019-01-01), pages 1 - 19, XP093079465, DOI: 10.3390/ijms20133171 * |
| TRACY L KELLER, ZOCCO DAVIDE, SUNDRUD MARK S, HENDRICK MARGARET, EDENIUS MAJA, YUM JINAH, KIM YEON-JIN, LEE HAK-KYO, CORTESE JOSEP: "Halofuginone and other febrifugine derivatives inhibit prolyl-tRNA synthetase", NATURE CHEMICAL BIOLOGY, NATURE PUB. GROUP, vol. 8, no. 3, 1 January 2012 (2012-01-01), pages 311 - 317, XP055065300, ISSN: 15524450, DOI: 10.1038/nchembio.790 * |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2025503765A (ja) | 2025-02-04 |
| US20240390377A1 (en) | 2024-11-28 |
| KR102758662B1 (ko) | 2025-01-23 |
| KR20230112046A (ko) | 2023-07-26 |
| JP7812929B2 (ja) | 2026-02-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2022154356A1 (ko) | (7s)-(+)-시클로펜틸 카바믹산, 8,8-디메틸-2-옥소-6,7-디히드로-2h,8h-피라노[3,2-g]크로멘-7-일-에스테르를 유효성분으로 포함하는 안질환의 예방, 개선 또는 치료용 조성물 | |
| WO2018182329A1 (ko) | S1pr4를 타겟으로 하는 비알코올성 지방간염 예방 또는 치료용 조성물 | |
| WO2011152671A2 (ko) | 라말린을 함유하는 염증질환 또는 면역질환의 예방 또는 치료용 약학 조성물 | |
| WO2015190643A1 (ko) | 부틸 피리디늄(butylpyridinium) 또는 이의 유도체를 포함하는 근력약화 관련 질환의 예방 또는 치료용 약학적 조성물 | |
| WO2023140505A1 (ko) | 할로푸지논을 유효성분으로 함유하는 신경퇴행성 또는 운동신경 질환 예방 또는 치료용 조성물 | |
| WO2020106048A1 (ko) | 퇴행성 신경질환의 예방 또는 치료용 약학 조성물 | |
| WO2023191384A1 (ko) | 항염증 및 항섬유화 활성을 갖는 펩타이드 및 이의 용도 | |
| WO2023101441A1 (ko) | 마이크로조말 트리글리세라이드 전달 단백질 억제제의 섬유화 질환 치료 용도 | |
| WO2022005201A1 (ko) | 티로신을 유효성분으로 함유하는 단백질 내 티로신의 니트로화에 의한 질환의 예방, 개선 또는 치료용 조성물 | |
| KR20160123773A (ko) | 나프토퀴논계 화합물을 유효성분으로 포함하는 췌장염 예방 및 치료용 조성물 | |
| WO2019078381A1 (ko) | 엔테로코커스 패칼리스, 이의 배양액 또는 이의 사균체를 유효성분으로 함유하는 근육감퇴, 약화 및 근위축 예방, 개선 또는 치료용 약학 조성물, 식품 조성물 및 식품첨가제 | |
| WO2020055015A1 (ko) | 타제메토스타트 또는 이의 유도체를 유효성분으로 함유하는 비알콜성 지방간염의 예방 또는 치료용 약학적 조성물 | |
| WO2022270760A1 (ko) | 커큐민 유도체와 tgf-β 수용체 억제제의 병용투여를 통한 비알코올성 지방간염 치료 방법 | |
| WO2021033995A1 (ko) | 초과 추출물을 함유하는 근육 감소 관련 질병의 예방, 개선, 또는 치료용 조성물 | |
| WO2017014545A1 (ko) | 멜라닌 응집 호르몬을 유효성분으로 포함하는 파킨슨병 치료 및 레보도파 부작용 억제용 약학 조성물 | |
| WO2022163971A1 (ko) | 콜린에스터라제 억제제 및 항산화제를 포함하는 뇌질환 치료용 약학적 복합 조성물 | |
| WO2015108372A1 (ko) | 오스모틴을 포함하는 흥분독성 또는 시냅스 기능 장애에 의한 신경 질환의 예방 또는 치료용 조성물, 및 이를 이용한 신경 질환의 예방 또는 치료 방법 | |
| WO2021118298A1 (ko) | 페오포르바이드계 화합물을 유효성분으로 포함하는 섬유증의 예방 또는 치료용 약학적 조성물 | |
| WO2021054637A1 (ko) | 선퇴추출물을 포함하는 퇴행성 뇌질환의 예방, 개선 또는 치료용 조성물 | |
| WO2023128121A1 (ko) | P-쿠마르산을 유효성분으로 포함하는 간 관련 질환의 개선 및 치료용 조성물 | |
| WO2023195798A1 (ko) | 타우로데옥시콜린산 또는 이의 약학적으로 허용가능한 염을 유효성분으로 함유하는 폐섬유증 예방 또는 치료용 조성물 | |
| WO2025150987A1 (ko) | 아스파르트산을 포함하는 허혈성 심장질환의 예방 또는 치료용 약학적 조성물 | |
| WO2022234888A1 (ko) | 이미다졸린 유도체 화합물을 유효성분으로 포함하는 황반 변성 치료용 약학적 조성물 | |
| WO2024035015A1 (ko) | 펙소페나딘을 포함하는 퇴행성 신경질환의 예방, 개선 또는 치료용 조성물 | |
| WO2025226035A1 (ko) | 지방간 질환의 예방 또는 치료 활성을 갖는 펩타이드 복합체 및 이의 용도 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22922362 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024543121 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 22922362 Country of ref document: EP Kind code of ref document: A1 |

