WO2023132380A1 - Polynucléotide pour le traitement du cancer codant pour une protéine modifiée par la 5'-nucléotidase - Google Patents

Polynucléotide pour le traitement du cancer codant pour une protéine modifiée par la 5'-nucléotidase Download PDF

Info

Publication number
WO2023132380A1
WO2023132380A1 PCT/KR2022/000131 KR2022000131W WO2023132380A1 WO 2023132380 A1 WO2023132380 A1 WO 2023132380A1 KR 2022000131 W KR2022000131 W KR 2022000131W WO 2023132380 A1 WO2023132380 A1 WO 2023132380A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
cancer
seq
cells
mrna
Prior art date
Application number
PCT/KR2022/000131
Other languages
English (en)
Korean (ko)
Inventor
이현철
구봉성
김진숙
Original Assignee
비피진 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 비피진 주식회사 filed Critical 비피진 주식회사
Publication of WO2023132380A1 publication Critical patent/WO2023132380A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/07—Fusion polypeptide containing a localisation/targetting motif containing a mitochondrial localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal

Definitions

  • the present invention relates to a polynucleotide for cancer treatment, and more particularly, to a polynucleotide for cancer treatment used in a form entrapped in a drug delivery material.
  • Immune cells commonly called macrophages, detect cancer cells and then engulf and eat them.
  • proteins on the surface of cells send signals to macrophages not to eat or destroy them. This is useful for protecting the immune system from attacking normal cells, but cancer cells use these "don't eat me” signals to evade the immune system.
  • researchers have previously shown that the protein PD-L1 and the beta-2-microglobulin subunit of the major histocompatibility class 1 complex are utilized by cancer cells to protect themselves from immune cells.
  • Antibodies that block CD47 are currently in clinical trials, and cancer therapies targeting the PD-L1 or PDL1 receptor are being used to treat patients.
  • the present invention is a novel polynucleotide for cancer treatment, which is used in the form of being encapsulated in liposome-type nanoparticles that form a complex with a binder that binds to CD47, thereby maximizing the metabolic vulnerability of cancer cells to kill cancer cells. It is intended to provide polynucleotides for cancer treatment.
  • the present invention provides a polynucleotide for cancer treatment encoding the amino acid sequence represented by SEQ ID NO: 3.
  • polynucleotide is characterized by comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 38 to SEQ ID NO: 41.
  • the polynucleotide provides a polynucleotide for cancer treatment, characterized in that the mRNA.
  • the mRNA provides a polynucleotide for cancer treatment characterized in that it enters cancer cells and inhibits nucleic acid metabolism.
  • nucleic acid metabolism provides a polynucleotide for cancer treatment, characterized in that dTTP biosynthetic metabolism.
  • polynucleotide provides a polynucleotide for cancer treatment, characterized in that it further comprises a 5'-UTR represented by SEQ ID NO: 19 and a 3'-UTR represented by SEQ ID NO: 20.
  • polynucleotide provides a polynucleotide for cancer treatment, characterized in that it further comprises a nucleic acid sequence encoding a nuclear localization signal (NLS) represented by SEQ ID NO: 22.
  • NLS nuclear localization signal
  • the polynucleotide provides a polynucleotide for cancer treatment, characterized in that it further comprises a nucleic acid sequence encoding a mitochondrial localization signal (MLS) represented by SEQ ID NO: 23.
  • MLS mitochondrial localization signal
  • polynucleotide for the treatment of cancer characterized in that the cancer is colon cancer or breast cancer.
  • the present invention is a polynucleotide for cancer treatment having a mechanism of killing cancer cells by maximizing the metabolic vulnerability of cancer cells when used in the form of being captured in liposomal nanoparticles that form a complex with a binder that binds to CD47, It is possible to provide a polynucleotide for cancer treatment in which the gene sequence is optimized to minimize the site acting as a non-specific microRNA (microRNA) when delivered into human cells and to maximize expression.
  • microRNA non-specific microRNA
  • FIG. 1 is a diagram showing a comparison of the amino acid sequences of Sirp ⁇ , SV1 and SV4. Bold letters indicate residues that are not partially conserved. Sequence alignment was done with ClustalW, and images were created with the BioEdit sequence alignment editing program.
  • Figure 2 is a diagram explaining mutation of SV1 for correct directionality.
  • the SV domain green ribbon
  • CD47 red sphere
  • FIG. 2B shows the analysis results using mass spectrometry analysis of DSPE-conjugated SV1 and SV4.
  • Figure 3 is a diagram showing the conserved motif of T001 and human NT5M.
  • T001 and human NT5M As a sequence alignment of T001 and human NT5M, it was aligned through ClustalW to confirm the sequence similarity of human NT5M and T001.
  • the Swiss-Prot/TrEMBL accession numbers of the sequences used for alignment are human NT5M and T001. Red fields represent fully conserved amino acid residues, and red letters in white fields represent partially conserved amino acid residues with similar biochemical functions. Sequence alignment was done with ClustalW, and images were created with the ESPript server.
  • T001 and NT5M 4 are a model showing a comparison of structures of T001 and NT5M. Cytoplasmic T001 (CT) and dTMP-bound human NT5M (yellow) are shown superimposed, nitrogen is shown in white and oxygen is shown in red.
  • CT Cytoplasmic T001
  • dTMP-bound human NT5M yellow
  • 5 is a schematic diagram showing candidate structures for UTR screening for optimal expression of T001.
  • 6a to 6m are photographs and graphs showing FACS analysis results in UTR screening for optimal expression of T001.
  • the assay conditions were as follows: GFP fluorescence, HCT-116, 6well (5x10 5 cells/well), 24h mRNA transfection, 10% FBS, 2mM Gln MEM media.
  • FIG. 7 is a schematic diagram showing the N-terminal and C-terminal sequences of mStrawberry.
  • the estimated import signal is located as shown in FIG. 7 .
  • FIG. 8 is a photograph showing the intracellular action site of mStrawberry-NLS and mStrawberry-MLS revealed by fluorescence microscopy.
  • White arrows indicate the location of the nucleus, and black arrows indicate the location of the mitochondria.
  • MOA mode of action
  • FIG. 10 is a photograph showing the results of a live and dead assay after mRNA transfection in MCF7 cell line.
  • Cell viability of MCF7 cells was observed after treatment with 5 ⁇ g/well of mRNA using a fluorescence microscope. Cell viability was effectively reduced at 24 hours post-transfection, and this effect was either time dependent or dose dependent.
  • 11 is a graph showing the results of MTT analysis after mRNA transfection in MCF7 cell line.
  • 12a to 12d are graphs showing apoptosis analysis results according to Annexin V staining after mRNA transfection in MCF7 cell line.
  • the early apoptotic portion (lower right quadrant) increased continuously after mRNA transfection, and the late apoptotic portion (upper right quadrant) also increased.
  • 13 is a graph showing comparison results of cytotoxicity and cell growth inhibition according to T001 and NT5M transfection.
  • 14a to 14c are graphs showing apoptosis results induced by CT and NT5M transfection.
  • 15a to 15c are graphs showing cell cycle arrest by T001 transfection.
  • 16 is a graph showing the ratio of apoptosis-inducing cells according to the concentration in the colorectal cancer cell line HCT-116.
  • 17a to 17c are graphs showing the effect of T001 offset by siRNA treatment of T001.
  • TNBC triple-negative breast cancer
  • 19 is a photograph showing the results of Western blot analysis of DNA damage markers after CT treatment for triple-negative breast cancer.
  • 20 is a schematic diagram showing an anticancer agent using a SV4 binder and a drug T001.
  • 21 is a schematic diagram schematically showing the composition of T001 mRNA.
  • FIG. 22 is a schematic diagram and photographs explaining the results of in vitro analysis of carboxy fluorescein-DSPE complexed with an immuno-liposome (iLP) containing NLS-mStrawberry mRNA.
  • iLP immuno-liposome
  • FIG. 24 is a photograph showing the distribution of MCF7 xenograft mice after intravenous (IV) injection of SV4-conjugated iLP-NIR RFP mRNA.
  • A is a xenograft mouse
  • B is 1 hour after injection
  • C is 3 hours after injection
  • D is 6 hours after injection
  • E is the cut cancer tissue.
  • 25 is a graph and a tumor photograph showing tumor volume by period after iLPD intravenous injection in vivo .
  • 26 is a graph showing the results of toxicity test of mouse organs by iLPD treatment.
  • FIG. 27 is a schematic diagram showing the mechanism of anticancer agents using the SV4 binder according to the present invention.
  • 29 is a diagram explaining the conjugation process between DSPE-PEG 2000 -NHS and SV4 protein.
  • CD47 herein is not particularly limited, and may be derived from any animal, preferably a mammal, and more preferably human CD47.
  • the amino acid sequence and nucleotide sequence of human CD47 are already known (J. Cell. Biol., 123, 485-496, (1993), Journal of Cell Science, 108, 3419-3425, (1995), GenBank: Z25521). .
  • the term “binder” refers to a protein that binds to a receptor, in particular CD47, wherein the binder binds to CD47, particularly in cancer cells, enabling recognition and/or interaction with a cell-transmitter.
  • conjugated refers to a chemical compound formed by combining two or more compounds with one or more chemical bonds or linkers.
  • the binder and the liposome form a conjugate.
  • PEGylation refers to a technique for conjugating polyethylene glycol (PEG) to a target material to increase stability
  • PEG polyethylene glycol
  • a pegylated phospholipid may be used, for example, DSPE-PEG 2000 or the like may be used.
  • DSPE-PEG 2000 means DSPE attached with PEG having a number average molecular weight of about 2000.
  • polynucleotide generally refers to deoxyribonucleotides or polymers of ribonucleotides, which may be RNA or DNA, or modified RNA or DNA, in single-stranded or double-stranded form.
  • the polynucleotide is a synthesized single-chain "mRNA".
  • 5'-Untranslated Region is commonly understood as a specific portion of mRNA, and is located 5' of the protein coding region (ie, open reading frame (ORF)) of mRNA. Typically, the 5'-UTR begins at the transcription start region and ends one nucleotide before the initiation codon of the open reading frame.
  • 3'-Untranslated Region is a part of mRNA that is usually located between the open reading frame (ORF) of mRNA and the polyA sequence.
  • the 3'-UTR of mRNA is not translated into an amino acid sequence.
  • the 3'-UTR sequence is usually encoded by a gene that is transcribed into each mRNA during gene expression.
  • Kozak sequence herein refers to a translational initiation enhancer element that improves expression of a gene or open reading frame (ORF), which in eukaryotes is located in the 5'-UTR but at position -3 of the initiation codon is an A or It is located in a sequence containing G and may further include a sequence (eg, -GTG-) containing G at position +1 of the initiation codon.
  • ORF open reading frame
  • nuclear localization signal NLS
  • mitochondria localization signal MLS
  • transfection refers to a process in which an extracellular polynucleotide enters a host cell, particularly a cancer cell, with or without an accompanying substance.
  • Transfected cell may mean, for example, a cell having an extracellular mRNA by introducing an extracellular mRNA into the cell.
  • the present invention discloses a polynucleotide for cancer treatment encoding the amino acid sequence represented by SEQ ID NO: 3.
  • the polynucleotide for cancer treatment according to the present invention is used in the form of being encapsulated in liposomal nanoparticles that form a complex with a binder that binds to CD47, thereby maximizing the metabolic vulnerability of cancer cells.
  • the gene sequence is optimized to minimize the site acting as a non-specific microRNA (microRNA) and maximize expression when delivered into human cells.
  • microRNA non-specific microRNA
  • the polynucleotide whose gene sequence is optimized it can be selected from the nucleotide sequences represented by SEQ ID NO: 39 to SEQ ID NO: 41, and preferably, the nucleotide sequence represented by SEQ ID NO: 39 can be selected.
  • SEQ ID NO: 38 represents a wild type sequence.
  • the binder binds to CD47 overexpressed in cancer cells, and includes the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.
  • the binder comprising the amino acid sequence represented by SEQ ID NO: 1 was named 'SV1'
  • the binder comprising the amino acid sequence represented by SEQ ID NO: 2 was named 'SV4'.
  • Sirp ⁇ -variant-version1 was selected from a mutant library derived from pure Sirp ⁇ (see amino acid sequence (SEQ ID NO: 24)), which is the soluble domain of the original CD47 ligand.
  • the selection process for the SV1 mutation is as follows.
  • Valine at the 6th position is converted to isoleucine, valine located at the 27th position to isoleucine, isoleucine located at the 31st position to phenylalanine, Glutamate at position valine, lysine at position 53 to arginine, glutamate at position 54 to glutamine, position at position 56 Histidine was replaced with proline, serine at position 66 with threonine, and valine at position 92 was replaced with isoleucine.
  • SV1 was prepared by modifying the existing nucleic acid sequence through codon optimization, and FIG. 28 shows a comparison between the SIRP ⁇ sequence (SEQ ID NO: 25) and the DNA sequence (SEQ ID NO: 26) of SV1.
  • SV1-(C)CRM197 which is a protein in which CRM197 protein is added to the C-terminus of SV1
  • CRM197(N)-SV1 in which CRM197 protein is added to the N-terminus and SV1 protein are prepared to make SV1 N-terminus and CRM197 protein.
  • SPR Surface Plasmon Resonance
  • Lipid nanoparticles have high drug capacity, high stability, and high specificity, and the release point can be controlled. Because of the genetic material used as a drug, cationic liposomes have been used to deliver drugs to target cancers. The positively charged liposomes attract the genetic drug and form a spherical complex that covers the drug for protection until it meets its target.
  • pro-liposomes were prepared using one of cationic phospholipids, DOTAP and cholesterol.
  • PEG 1000 -DSPE was additionally added to pro-liposomes to prepare pegylated liposomes to increase serum stability during drug delivery to the target through blood vessels.
  • DSPE-PEG 2000 -SV4 was prepared by conjugating NHS activated DSPE-PEG 2000 with SV4 protein.
  • mRNA encapsulated pro-liposomes were mixed with DSPE-PEG 2000 -SV4.
  • the specific SV4-conjugated liposome manufacturing process is as follows.
  • Liposomes were prepared by dry-film method. Cationic liposomes composed of DOTAP (Avanti Polar Lipids) and cholesterol (Sigma) (1:1 molar ratio, 10 mM) and PEG-DSPE1000 (1 mM; Avanti Polar Lipids) were added. Cationic liposomes were dissolved in chloroform and methanol (2:1 (v/v)) in a round bottom glass flask. Lipid drying was performed under vacuum on a rotary evaporator at 50 °C. The lipid film was freeze-dried overnight to completely remove chloroform and methanol. After evaporation, the lipid film was rehydrated with nuclease free water at 50 °C for up to 1 hour.
  • DOTAP vanti Polar Lipids
  • cholesterol StemM
  • PEG-DSPE1000 1 mM
  • Liposomes were prepared by dry-film method. Cationic liposomes composed of DOTAP (Avanti Polar Lipids) and cholesterol (
  • lipid membrane was sonicated to form unilamellar vesicles. Finally, lipids were extruded with a mini extruder (Avanti Polar Lipids) using a membrane with a 100 nm pore.
  • DSPE-PEG 2000 -NHS Conjugation of DSPE-PEG 2000 -NHS with SV4 protein was prepared as follows (see Figure 29).
  • DSPE-PEG 2000 -NHS was prepared by dry-film method.
  • DSPE-PEG 2000 -NHS dissolved in chloroform was evaporated in a round bottom glass flask. Lipid drying was performed by rotary evaporator at 30° C. under vacuum for 1 hour. After evaporation, the lipid film was rehydrated with SV4 protein dissolved in nuclease-free water for 1 hour at 30 °C.
  • a 10,000 MWCO (Thermo Scientific) dialysis cassette was run overnight in PBS pH 6.8 to remove residual unconjugated DSPE-PEG 2000 -NHS.
  • Liposomes containing encapsulated drug and binding ligand were prepared as described above. 3 mg of cationic liposome, 25 ⁇ g of protamine, and diethylpyrocarbonate water were mixed to obtain solution A, and 50 ⁇ g of mRNA and diethylpyrocarbonate water were mixed to obtain solution B. Solutions A and B were equalized in volume with diethyl pyrocarbonate water and incubated for 30 minutes. Thereafter, mixing and incubation for 30 minutes formed liposomes with the encapsulated drug. For the binding of the DSPE-PEG 2000 -NHS conjugate SV4 ligand, liposomes (1:100 molar ratio) containing the encapsulated drug were mixed at 50°C for 15 minutes.
  • SV1 with improved binding ability to CD47 was selected through mutation, and SV4, which can be inserted in the correct direction and reacted when preparing a liposome formulation, was secured through mutation (FIG. 1). reference).
  • SV4 mutant construction was performed in the following way. In the SV1 sequence obtained above, 11th and 104th lysines were substituted with leucine for binding in the correct direction with CD47.
  • primers for substitution, using a plasmid in which the SV1 gene was inserted into the pET28a vector, primers (see Table 2 below) were prepared for point-mutation to sequences corresponding to the 11th and 104th positions, and Quickchange II site-directed According to the method of the mutagenesis kit (Agilent), mutant genes each or simultaneously substituted were prepared.
  • SV1 protein has six lysine residues in addition to the N-terminal amino group (see FIG. 2A).
  • residues that can act in the chemical reaction linking DSPE through NHS conjugation residues that can act in the correct orientation without interfering with CD47 binding are selected, and residues other than these residues are selected as Leucine. can be modified without loss of binding activity.
  • DSPE-conjugated SV4 was prepared through simple coupling by reducing the number of residues binding to DSPE through substitution.
  • the KD value of SV1 was significantly improved from 280 nM to 0.87 nM compared to Sirp ⁇ (wt) (see Table 1).
  • the affinity of SV1 was greatly improved, but when SV1-DSPE was prepared through the NHS conjugation reaction, the affinity decreased due to the increase in KD value from 0.87 nM to 2.67 nM. Also, in the case of SV1-iLP inserted into liposomes, the affinity was further decreased and the KD value increased to 10.9 nM.
  • Thymidylate 5' derived from Bacteriophage PBS2, which has activity similar to that of human 5'-nucleotidase, but has exceptionally high specificity only for dTMP and dUMP without specificity for other nucleic acids.
  • -Phosphohydrolase Thimidylate 5'-phosphohydrolase
  • microRNA non-specific microRNA
  • NT5C cytoplasm
  • NT5M mitochondrial
  • NT5E extracellular membrane
  • These three enzymes are known to have different preferred substrate nucleic acid species due to structural differences in activity and structural differences in hydrolyzing the phosphate group of NMP or dNMP as well as the site of action, and most of them have broad specificity for NMP or dNMP.
  • NT5M was presumed to be generally similar in structure to T001 compared to T001 in terms of amino acid sequence (see FIG. 3). In particular, despite the difference in sequence, the sequence of the action site was conserved and it was identified as belonging to the HAD superfamily (haloalkanoic acid dehalogenase superfamily).
  • T001 has a unique binding loop structure that does not exist in NT5M, and this is the biggest characteristic difference (see FIG. 4).
  • the binding loop is closely related to the substrate binding sites of NT5M and T001, and is presumed to be related to the specificity of the substrate. Until now, little is known about the function of the binding loop, but in the present invention, it was partially confirmed that the binding loop has higher affinity for dTMP than NT5M and high dTMP resolution (see Table 4).
  • the form of the final drug of T001 is in the form of mRNA, and UTR (untranslated region) and Kozak sequence were optimized by optimizing each component required for expression. To this end, expression efficiency was determined by selecting a candidate structure as shown in FIG. 5 using GFP (Green Fluorescent Protein) as a reporter gene. Sequence information of each used UTR is shown in Table 5 below.
  • EGFP mRNA purchased from Trilink Biotechnology was used.
  • the intensity of green fluorescence of the cultured cells was compared and analyzed as an image through a fluorescence microscope, and then the cells treated with EGFP mRNA with each UTR, including the control group, were detached from the bottom of the plate with trypsin enzyme, collected in a microcentrifuge tube, and phosphorus acid It was diluted in buffered physiological saline. Through the cell flow cytometer recovered in this way, the distribution of the cell population expressing green fluorescence compared to the control group was compared into three levels, strong, medium, and weak, according to intensity.
  • the location signal sequence (NLS: SEQ ID NO: 22, MLS: SEQ ID NO: 23) as shown in FIG.
  • the reporter gene mStrawberry was expressed according to the positioning signal sequence, and the position of the protein was confirmed by fluorescence (see FIG. 8).
  • the specific process of the fluorescence localization test (mRNA transfection: lipofectamine) according to the localization signal sequence is as follows.
  • T001 mRNA synthesis was performed as follows.
  • Template DNA preparation The vector for IVT (In Vitro Transcribed) mRNA synthesis was modified from the pIRES vector. Briefly, the 5'UTR-T001-3'UTR cassette was cloned into the MCS of pIRES vector. To generate the IVT template, the plasmid was treated with SacI/HpaI enzymes to form a linear strand, and the 1.5 kb linear strand containing the T7 promoter and the T001 cassette was column-purified as a template for PCR.
  • a forward primer (gtgcttctgacacaacagtctcgaacttaagc; SEQ ID NO: 36) and a reverse primer (gaaGCGGCCGCCTTCCTACTCAGGCTTTATTC; SEQ ID NO: 37) were used in the PCR reaction, and all PCR reactions were performed using Pfu polymerase at 95° C. for 1 min, 61° C. for 1 min; PCR was performed at 72° C. for 3 minutes, for a total of 30 cycles. PCR products were run on an agarose gel and extracted using the Qiagen cleanup kit before further processing.
  • IVT mNRA synthesis After PCR, genetic information is transcribed from DNA to mRNA in vitro using the HiScribeTM T7 ARCA mRNA kit (New England Biolabs, Cot. #. E2065). 20 ⁇ l of IVT reaction mixture was prepared by adding 10 ⁇ l of NTP/cap analog mixture, 1 ⁇ g of template DNA, and 2 ⁇ l of 1 ⁇ T7 RNA polymerase mixture to the reaction solution. The IVT reaction mixture was incubated at 37°C for 30 minutes. To remove template DNA, 1 ⁇ l DNase was added to the IVT reaction mixture and incubated at 37° C. for 15 minutes.
  • poly (A) tailing 20 ⁇ l of IVT reaction mixture was prepared by adding 5 ⁇ l 10 ⁇ poly (A) polymerase reaction buffer, 5 ⁇ l poly (A) polymerase and 20 ⁇ l nuclease-free water to a 40 minutes at 37°C. Then, after purification using the RNeasy Mini Kit (Qiagen, Hilden, Germany), the synthesized mRNA was purified by elution from the spin column membrane with 89 ⁇ l of nuclease-free water.
  • Thymidylate synthase is the only de novo source of thymidylate (dTMP) for DNA synthesis and repair.
  • Drugs targeting TS protein are the main types of cancer treatment, but their use is limited due to off-target effects and toxicity.
  • Cytosolic thymidine kinase (TK1) and mitochondrial thymidine kinase (TK2) contribute to alternative dTMP production pathways by restoring thymidine from the tumor milieu and may modulate resistance to TS-targeting drugs.
  • T001 can hydrolyze dTMP to thymidine without hydrolyzing other dNMP (deoxynucleotide monophosphate).
  • dNMP deoxynucleotide monophosphate
  • T001 Considering the substrate selectivity and activity of T001, we hypothesized that (1) an imbalanced nucleotide pool induces human tumor cells to accumulate damage, (2) overexpression of T001 may cause an imbalanced nucleotide pool, and , (3) imbalanced nucleotide pools can lead to cell death by excessive repair frequencies.
  • a live and dead assay was performed as follows.
  • 5 ⁇ 10 5 cells are put into each cell of a 6-hole cell culture plate and cultured for 24 hours in a cell incubator at 37° C. and 5% CO 2 , and adhered to the bottom. After 24 hours, each mRNA version was transfected using lipofectamine and cultured for an additional 24 hours.
  • the cells of each experimental group were collected, and 2 ⁇ M calcein AM and 4 ⁇ M EthD-1, which are viability assay reagents, were treated on the recovered cells, reacted for 30 minutes, and then the cells were examined under a fluorescence microscope. Calcein AM enters cells and shows green fluorescence after being degraded by enzymes of living cells, and EthD-1 enters cells of dead cells and stains the nucleus to show red fluorescence.
  • MTT assay was performed to quantify cell viability.
  • MTT analysis method is as follows.
  • mRNA for each version was prepared using lipofectamine messengerMAX reagent. transfected. First, mix 125 ⁇ l of OPTI-MEM medium and 3.5 ⁇ l of reagent in a microtube and incubate for 10 minutes at room temperature. In another microtube, add 125 ⁇ l of medium and 1.25 ⁇ g of mRNA having each UTR structure, and mix the mRNA diluted medium with the above reagent. After mixing and further incubating for 5 minutes, it was administered to the cells of each sphere.
  • the cells in each sphere were lightly washed with phosphate-buffered saline, replaced with cell culture medium, and then further cultured for 20 hours, then detached from the bottom of the plate with trypsin enzyme, collected in a microcentrifuge tube, and diluted in phosphate-buffered saline. . 3 ⁇ l of Annexin V staining reagent and Propidium Iodide staining reagent were added to each microcentrifuge tube, reacted at room temperature for 15 minutes, and the degree of apoptosis induced cell group by version of T001 was compared through flow cytometry. As a control, lipofectamine messengerMAX reagent without mRNA was used.
  • Annexin V reagent stains the cell membrane of cells undergoing apoptosis
  • Propidium Iodide stains the intracellular nucleus of dead cells. Therefore, on the flow cytometry graph, cells that do not undergo apoptosis are distributed in the third quadrant, and the position of the cell population moves from the fourth quadrant to the first quadrant according to the degree of apoptosis.
  • the apoptosis rates in all versions were similar to each other.
  • the apoptosis rate of the control group was 3.75%, and the premature apoptosis rates of cells transfected with NT, MT, and CT were 21.59%, 25.11%, and 24.65%, respectively.
  • the death rates of cells transferred with NT, MT, and CT were 9.85%, 8.42%, and 11.47%, respectively (see FIGS. 12A to 12D).
  • Apoptosis rates increased in a dose-dependent manner, with slight differences between each T001 version.
  • T001 is more specific for nucleic acid T due to other structural differences from NT5M. Therefore, the imbalance of nucleic acid due to the loss of dTTP rather than the overall loss of nucleic acid can have a greater effect on the metabolism of cancer cells, thereby inhibiting the growth of cancer cells.
  • CT cytoplasmic T001
  • Each mRNA was transfected into the colorectal cancer cell line HCT-116, and 24 hours later, Trypan blue assay was performed, and the results of HCT-116 cell viability and cell growth inhibition are shown in FIG. 13 .
  • the specific test method is as follows.
  • HCT-116 cells were transfected with each of 1.25 ⁇ g of non-mature form NT5M, mature form NT5M, and CT mRNA. After 24 hours, trypsin was treated and the cells were harvested using a centrifuge. After resuspension of the collected cells with 1 ⁇ DPBS, a certain amount of cells was mixed with trypan blue reagent at a ratio of 1:1. After 2 minutes of incubation at room temperature (RT), the number of cells was counted using a hemocytometer. After obtaining the number of cells stained and unstained with trypan blue reagent to obtain the number of viable cells and non-viable cells, divide by the total number of cells to obtain viability. did Each experiment was repeated three or more times to evaluate significance.
  • HCT-116 cells were transfected with 1.25 ⁇ g each of immature NT5M, mature NT5M, and CT mRNA, and the degree of apoptosis was measured and analyzed after culturing for 24 hours. ), it was confirmed that the CT mRNA increased by about 25% compared to the control group, whereas the Sub G1 phase increased by about 12% compared to the control group.
  • Apoptosis caused by expression of T001 is believed to originate from changes in the cell cycle caused by depletion of intracellular nucleic acids, and selective deficiency of specific nucleic acids and dTTP among substrates leads to arrest of the cell cycle, intensifying this process. It is presumed that apoptosis will eventually be induced if this occurs (see FIGS. 15a to 15c).
  • the apoptosis-inducing effect shown in the above results showed a concentration-dependent tendency according to the treatment concentration of CT in colon cancer cell lines, indicating that the activity of CT was directly involved in apoptosis (see FIG. 16).
  • T001 was knocked down using siRNA against CT, and then the change in the degree of apoptosis was confirmed.
  • Two types of siRNA targeting T001 were prepared and transfected into HCT-116 cells, and then CT mRNA was transfected. After 24 hours, the degree of apoptosis was confirmed by Annexin V/PI staining.
  • the specific test method is as follows.
  • siRNA targeting T001 Two types were prepared and transfected using RNAiMAX reagent, and CT mRNA was transfected 1 hour later. After 24 hours, cells were collected and stained using FITC Annexin V Apoptosis Detection Kit I. After incubation at room temperature for 20 minutes, the degree of fluorescence was analyzed using flow cytometry. 10,000 cells were analyzed for each sample.
  • the sequence of the siRNA used is as follows.
  • T001 can induce cancer cell death in carcinomas other than colorectal cancer based on its mechanism of action, and the same test was performed on triple-negative breast cancer (TNBC) to confirm its ability to induce apoptosis.
  • TNBC triple-negative breast cancer
  • MDA-MB-231 and MDA-MB-468 cells were each seeded at 5 ⁇ 10 5 cells/well, and 0, 0.625, 1.25, and 2.5 ⁇ g of CT mRNA were respectively transfected. After 24 hours, cells were collected and stained using FITC Annexin V Apoptosis Detection Kit I. After incubation at room temperature for 20 minutes, the degree of fluorescence was analyzed using a flow cytometer. 10,000 cells were analyzed for each sample. Significance was evaluated through three repeated experiments.
  • Anticancer drugs using SV4 binder and T001 drug primarily detect and bind to CD47, which is overexpressed on the surface of cancer cells, and secondarily, mRNA-type nucleic acid metabolism inhibitors that enter cancer cells detect and inhibit excessive nucleic acid synthesis metabolism in cancer cells, thereby inhibiting cancer cells It is a 4th-generation targeted metabolic cancer drug that innovatively reduces side effects of normal cells by targeting immune evasion and metabolic vulnerability.
  • cancer cell-specific surface proteins are often distributed even in normal cells, so when a target protein that recognizes a specific surface protein is combined with a toxic substance, damage to normal cells is inevitable.
  • the composition of the anticancer agent using the SV4 binder is an mRNA that has a CD47 recognition protein on the outside and an mRNA-type nucleic acid metabolism inhibitor on the inside and a location signal (nuclear, cytoplasmic, or mitochondrial) in different combinations depending on the type of carcinoma. It is in the form of liposome-type nanoparticles encapsulated.
  • 27 schematically shows the mechanism of the anticancer agent using the SV4 binder according to the present invention.
  • a high-affinity CD47 complex modified from a protein derived from Sirp ⁇ and SV4 modified to be positioned outside the liposome in the correct direction upon conjugation with DSPE were used as CD47 binders, and the estimated structure of SV4 is shown in FIG. 1A.
  • FIG. 1A was As a result of comparing the K D values of each of the samples combined with DSPE and the samples inserted into liposomes, it can be seen that the liposome form was improved by sequence mutation (see Table 1 above).
  • T001 mRNA As described above, the structure of T001 mRNA is schematically shown in FIG. 21 as an mRNA capable of expression in the nucleus, cytoplasm, and mitochondria.
  • mRNA was transfected into MCF7 with nuclear and mitochondrial localization signals. mStrawberry fluorescence was detected to confirm successful transfection and localization of each mRNA (see FIG. 22).
  • the specific test method is as follows.
  • confocal laser fluorescence microscopy confirmed the location on cells of green fluorescence where carboxyfluorescein of liposomes was generated with green wavelengths, and mRNA transfected with red wavelengths produced mStawberry protein and was located in the cytoplasm. Confirmed.
  • CD47 MCF-7 cells were treated with SV4-conjugated iLP, in which epirubicin was captured. At this time, to confirm CD47 mediation, the experimental group treated with CD47 antibody (polyclonal) and the experimental group not treated were compared.
  • the specific CD47 masking assay method is as follows.
  • NIR RFP Near Infrared Red Fluorescence Protein
  • MCF7 a human breast cancer cell line
  • SV4-iLP in which NIR-RFP (Near Infrared-Red Fluorescence Protein) mRNA was captured, was injected intravenously, adjusted so that 5 ⁇ g mRNA was administered per 25 g mouse, and then injected using an in vivo optical imaging system. The degree of fluorescence of the sample was tracked.
  • NIR-RFP Near Infrared-Red Fluorescence Protein
  • MCF7 xenograft mouse IV cancer growth control efficacy test (28 days) was performed, and specifically MCF7 was cultured and injected subcutaneously into nude mice.
  • PBS, Liposome, Liposome-NT, and Liposome-MT (Lipsome 20 mpk, 10 ⁇ g mRNA/mg liposome) were treated intravenously (IV), respectively.
  • Each mRNA was treated with 5 ⁇ g, a total of 5 times for 28 days at 3-day intervals.
  • the volume of the tumor was examined at 3-day intervals and displayed in a graph. On day 28, nude mice were sacrificed, tumors were separated and the volume was measured, and the results are shown in FIG. 25 .
  • mice In order to evaluate the toxic effect of mRNA in the body ( in vivo ), the body weight of mice was measured during the experimental period. In all groups, the body weight of mice increased slightly throughout the entire experimental period, and the change in body weight after sample injection compared to the control group was It turned out not to be large. As shown in FIG. 25, the final size of the tumor tissue collected from the sacrificed mouse after completion of the experiment was compared and shown.
  • FIG. 26 After completion of the experiment, hematological and histological examinations were performed with blood and tissues collected from the sacrificed mice, and the results are shown in FIG. 26 . Referring to FIG. 26, except for the number of WBCs in the blood and liver of mice treated with samples compared to the control group, no significant toxic effects were observed.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Dispersion Chemistry (AREA)
  • Nanotechnology (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un polynucléotide pour le traitement du cancer, qui est un nouveau polynucléotide pour le traitement du cancer, le polynucléotide étant utilisé capturé dans des nanoparticules liposomales qui forment un complexe avec un liant qui se lie à CD47, et ayant ainsi un mécanisme de destruction de cellules cancéreuses par maximisation de la vulnérabilité métabolique des cellules cancéreuses. La présente invention concerne un polynucléotide pour le traitement du cancer, codant pour la séquence d'acides aminés représentée par SEQ ID NO : 3.
PCT/KR2022/000131 2022-01-04 2022-01-05 Polynucléotide pour le traitement du cancer codant pour une protéine modifiée par la 5'-nucléotidase WO2023132380A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220001164A KR20230105583A (ko) 2022-01-04 2022-01-04 5'-뉴클레오티다아제 변형 단백질을 암호화하는 암 치료를 위한 폴리뉴클레오티드
KR10-2022-0001164 2022-01-04

Publications (1)

Publication Number Publication Date
WO2023132380A1 true WO2023132380A1 (fr) 2023-07-13

Family

ID=87073761

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/000131 WO2023132380A1 (fr) 2022-01-04 2022-01-05 Polynucléotide pour le traitement du cancer codant pour une protéine modifiée par la 5'-nucléotidase

Country Status (2)

Country Link
KR (1) KR20230105583A (fr)
WO (1) WO2023132380A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180028548A (ko) * 2015-08-07 2018-03-16 알렉소 테라퓨틱스 인크. Sirp-알파 도메인 또는 이의 변이체를 갖는 구조체
KR20210003766A (ko) * 2018-04-17 2021-01-12 항저우 섬근 바이오테크 코포레이션, 엘티디. Cd47 단백질에 결합하는 융합 단백질 및 이의 적용

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180028548A (ko) * 2015-08-07 2018-03-16 알렉소 테라퓨틱스 인크. Sirp-알파 도메인 또는 이의 변이체를 갖는 구조체
KR20210003766A (ko) * 2018-04-17 2021-01-12 항저우 섬근 바이오테크 코포레이션, 엘티디. Cd47 단백질에 결합하는 융합 단백질 및 이의 적용

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE Nucleotide 1 June 2016 (2016-06-01), ANONYMOUS : "Bacillus phage AR9, complete genome ", XP093077543, retrieved from NCBI Database accession no. KU878088.1 *
DATABASE Nucleotide 15 October 2021 (2021-10-15), ANONYMOUS : "Bacillus phage PBS1, complete genome ", XP093077548, retrieved from NCBI Database accession no. MF360957.1 *
K. WEISKOPF, RING AARON M, CHIA CHI M, HO, VOLKMER JENS-PETER, LEVIN ARON M, VOLKMER ANNE KATHRIN, ÖZKAN ENGIN, FERNHOFF NATHANIEL: "Engineered SIRP Variants as Immunotherapeutic Adjuvants to Anticancer Antibodies", SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE, US, vol. 341, no. 6141, 5 July 2013 (2013-07-05), US , pages 88 - 91, XP055223925, ISSN: 0036-8075, DOI: 10.1126/science.1238856 *

Also Published As

Publication number Publication date
KR20230105583A (ko) 2023-07-11

Similar Documents

Publication Publication Date Title
WO2018030608A1 (fr) Composition de support de nanoliposomes contenant un hybride de protéine cas9 et d'arn guide
CN105377867B (zh) I型干扰素的环状二核苷酸诱导
EP3341396B1 (fr) Protéine recombinante (icp)-socs3 perméable dans les cellules améliorée et ses utilisations
WO2019107896A1 (fr) Protéine de fusion comprenant une glutathion-s-transférase et une protéine ayant une affinité de liaison pour une cellule cible ou une protéine cible, et utilisation correspondante
KR20060015505A (ko) 올리고뉴클레오타이드 전구약물
US11927589B2 (en) Carrier peptide fragment for nucleolar localization and use thereof
WO2020130269A1 (fr) Nouvel aptamère d'adn et utilisation correspondante
WO2023132380A1 (fr) Polynucléotide pour le traitement du cancer codant pour une protéine modifiée par la 5'-nucléotidase
WO2022065725A1 (fr) Polynucléotide pour le traitement du cancer, codant pour une protéine modifiée de 5'-nucléotidase
WO2022065726A1 (fr) Complexe de liposome pour le traitement du cancer, comprenant un nouveau liant cd47 et un polynucléotide
WO2022065724A1 (fr) Liant cd47 et complexe liposome pour le traitement du cancer
EP1581253A2 (fr) Variants de butyrylcholinesterase modifiant l'activite d'agents chimiotherapeutiques
US20210214726A1 (en) Peptide Docking Vehicle for Targeted Nucleic Acid Delivery
JP2022023949A (ja) タンパク質性化合物とその利用
WO2024054062A1 (fr) Nouvelle composition polypeptidique pour transfection intracellulaire
WO2024085280A1 (fr) Nouvelle kynuréninase et son utilisation
WO2023014192A1 (fr) Ligand d'acide nucléique non naturel, ses utilisations, et composition pharmaceutique pour la prévention ou le traitement du cancer comprenant celui-ci en tant que principe actif
WO2012122943A1 (fr) Médicament contre la protéine x du virus de l'hépatite b utlisant un polypeptide
WO2023224385A1 (fr) Complexe her2-gst-sn-38 et composition pharmaceutique le comprenant servant à prévenir ou traiter des maladies prolifératives
WO2024080682A1 (fr) Mutant de la chaîne légère de la toxine botulique
WO2023163563A1 (fr) Composition pour la prévention ou le traitement du cancer du poumon comprenant un complexe d'acides nucléiques
WO2023249439A1 (fr) Nouveau peptide pouvant inhiber la signalisation du tgf-β et son utilisation
WO2019235771A9 (fr) Lignée de cellules souches mésenchymateuses dans laquelle l'infection par des adénovirus et leur réplication sont activées
WO2021182663A1 (fr) Transporteur de gène de polydixylitol à base de polyol couplé à la vitamine b6 comprenant un peptide se liant spécifiquement à une cellule souche cancéreuse et technique de thérapie ciblant des cellules souches cancéreuses
WO2020141930A1 (fr) Système d'administration de médicament utilisant des peptides de pénétration cellulaire dépendant du ph, et composite de ceux-ci avec un médicament

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22918917

Country of ref document: EP

Kind code of ref document: A1